Supplementary Information
|
|
- Alice Miles
- 6 years ago
- Views:
Transcription
1 Supplementary Information Microbial Population Dynamics in Membrane Bioreactor with Quorum Quenching Hak-Woo Kim 1, Hyun-Suk Oh 1, Sang-Ryoung Kim 1, Ki-Baek Lee 1, Kyung-Min Yeon 1, Chung-Hak Lee 1, Seil Kim 2 and Jung-Kee Lee 3 1 School of Chemical and Biological Engineering, Seoul National University, Seoul , Korea 2 Clean Energy Research Center, Korea Institute of Science and Technology, Seoul , Korea 3 Departments of Life Science and Genetic Engineering, Paichai University, Daejeon , Korea leech@snu.ac.kr, TEL: , FAX: stapler@kist.re.kr, TEL: , FAX:
2 Fig. S1 Size distribution of MIEX and MEC. 2
3 Fig. S2 2D SDS-PAGE gel images from (a) control channel and (b) quorum quenching channel 3
4 Table S1 Total reads and OTUs data C start C1 broth C2 broth Q start Q1 broth Q2 broth C1 biofilm C2 biofilm Q1 biofilm Q2 biofilm Total reads (all sequence) OTUs (CDHit)
5 Table S2 SIMPER analysis data for microorganisms in the broth and biofilm based on all ten samples Taxonomic a Average Abundance of b Average Abundance of c Average Average Dissimilarity Contribution Cumulative Phylotype Rank Control Group (%) Quorum quenching Group (%) Dissimilarity / Standard Deviation (%) contribution (%) Gammaproteobacteria Class Enterobacteriales Order Enterobacteriaceae Family Proteobacteria Phylum Pseudomonadales Order FJ755943_g Genus FJ755943_s Species Alphaproteobacteria Class Pseudomonadaceae Family Pseudomonas Genus Enterobacter Genus Rhizobiales Order Sphingobacteria Class Solibacteres Class FJ479064_o Order DQ532145_f Family DQ532145_g Genus FJ710748_s Species Acidobacteria Phylum Sphaerotilus_f Family Sphingobacteriales Order Bradyrhizobiaceae Family Pseudomonas monteilii Species Flavobacteriales Order Betaproteobacteria Class Burkholderiales Order
6 Flavobacteria Class Flavobacteriaceae Family Chitinophagaceae Family Bradyrhizobium Genus Bacteroidetes Phylum Ferruginibacter Genus Methylibium Genus Enterobacter asburiae Species Moraxellaceae Family Acinetobacter Genus Rhizobium lupini Species Cytophagia Class Cytophagales Order Acinetobacter guillouiae Species Elizabethkingia Genus Elizabethkingia miricola Species Pseudomonas fuscovaginae Species Deltaproteobacteria Class Chryseobacterium Genus Enterobacter cancerogenus Species Armatimonadetes Phylum AF368184_c Class AF368184_o Order AF418954_f Family AF418954_g Genus AY792299_s Species Sphingomonadaceae Family Sphingomonadales Order AF418954_s Species Methylibium petroleiphilum Species Chloroflexi Phylum Caldilineae Class
7 EF516688_s Species Caldilineales Order DQ906906_o Order Paracaedibacter_o Order Cytophagaceae Family Enterobacter ludwigii Species Bradyrhizobium canariense Species AJ867903_f Family AJ867903_g Genus AB240353_s Species AB240353_g Genus Hyphomicrobiaceae Family Hyphomicrobium Genus Sphingopyxis Genus DQ336985_s Species Sphingopyxis ummariensis Species Xanthomonadales Order Terrimonas Genus Xanthomonadaceae Family AY945920_s Species Aquincola Genus Nitrospira_g1 Genus Nitrospirales Order Nitrospiraceae Family Nitrospirae Phylum Nitrospira_c Class AB252940_s Species Chlorobi Phylum OPB56 Class OPB56_o Order AJ630296_f Family AJ630296_g Genus
8 AJ630296_s Species GQ088353_s Species Comamonas Genus AY218694_g Genus Sphingomonas Genus Comamonadaceae Family EU881309_f Family Sphingomonas koreensis Genus GQ093804_s Species EU937987_s Species EU234264_o Order EU234264_f Family EU234264_g Genus Myxococcales Order Polyangiaceae Family Chondromyces Genus Rhodospirillales Order Piscinibacter Genus Verrucomicrobia Phylum Piscinibacter aquaticus Species AB286578_s Species Comamonas testosteroni Species EU134489_f Family AY693832_o Order AY693832_f Family EF203200_o Order DQ309373_g Genus EF203200_f Family AB252934_s Species AY491576_s Species AB286618_f Family Alysiosphaera_f Family
9 DQ413135_s Species a Average Abundance of Broth Group: The average value of the abundances in broth samples in control and quorum quenching MBR (Cstart, C1 broth, C2 broth, Qstart, Q1 broth, Q2 broth) b Average Abundance of Biofilm Group: The average value of the abundances in biofilm samples in control and quorum quenching MBR (C1 biofilm, C2 biofilm, Q1 biofilm, Q2 biofilm) c Average Dissimilarity: The contribution of the specific taxon to the he average Bray-Curtis dissimilarity between broth group samples and biofilm group samples (The average dissimilarity between broth group samples and biofilm group samples was 54.81%.) 9
10 Table S3 SIMPER analysis data of microorganisms in the control and quorum quenching MBRs based on all ten samples Taxonomic a Average Abundance of b Average Abundance of c Average Average Dissimilarity Contribution Cumulative Phylotype Rank Control Group (%) Quorum quenching Group (%) Dissimilarity / Standard Deviation (%) contribution (%) Gammaproteobacteria Class Enterobacteriales Order Enterobacteriaceae Family Proteobacteria Phylum Pseudomonadales Order Alphaproteobacteria Class Rhizobiales Order FJ755943_g Genus FJ755943_s Species Pseudomonadaceae Family FJ710748_s Species DQ532145_g Genus Pseudomonas Species FJ479064_o Order Solibacteres Class DQ532145_f Family Acidobacteria Order Enterobacter Genus Sphingobacteria Class Sphingobacteriales Order Bradyrhizobiaceae Family Bacteroidetes Phylum Ferruginibacter Genus Sphaerotilus_f Family Chitinophagaceae Family Flavobacteria Class Flavobacteriales Order Flavobacteriaceae Family Betaproteobacteria Class Burkholderiales Order
11 Bradyrhizobium Genus Pseudomonas monteilii Species Cytophagia Class Cytophagales Order Methylibium Genus Acinetobacter Genus Moraxellaceae Family Deltaproteobacteria Class Acinetobacter guillouiae Species Rhizobium lupini Species AY792299_s Species Enterobacter asburiae Species Elizabethkingia Genus Pseudomonas fuscovaginae Species Armatimonadetes Genus AF368184_c Class AF368184_o Order Elizabethkingia miricola Species AF418954_f Family AF418954_g Genus Chloroflexi Phylum DQ906906_o Order Caldilineae Family Chryseobacterium Species AF418954_s Order Caldilineales Family Cytophagaceae Family Sphingomonadaceae Family Sphingomonadales Order AB240353_s Species AB240353_g Genus Methylibium petroleiphilum Species Terrimonas Genus Enterobacter cancerogenus Species Sphingopyxis Genus
12 EF516688_s Species Sphingopyxis ummariensis Species Enterobacter ludwigii Species Xanthomonadales Order Paracaedibacter_o Order Xanthomonadaceae Family Hyphomicrobiaceae Family Hyphomicrobium Genus AJ867903_f Family AJ867903_g Genus Bradyrhizobium canariense Species DQ336985_s Species AY218694_g Genus GQ088353_s Species Chlorobi Phylum OPB56 Class OPB56_o Order AJ630296_f Family AJ630296_g Genus AJ630296_s Species Sphingomonas Genus Sphingomonas koreensis Species GQ093804_s Species Comamonadaceae Family EU234264_o Order EU234264_f Family EU234264_g Genus AB252934_s Species Myxococcales Order Polyangiaceae Family Chondromyces Genus EU134489_f Family AB286578_s Species Nitrospirales Order Nitrospirae Phylum
13 Nitrospira_c Class Nitrospiraceae Family Nitrospira_g1 Genus EU937987_s Genus Aquincola Species AY945920_s Species AB252940_s Species Rhodospirillales Order EU881309_f Family AY693832_o Order Comamonas Genus AY693832_f Family EF203200_o Order Afipia Genus AB286618_f Family DQ309373_g Genus EF203200_f Family Verrucomicrobia Phylum AY491576_s Species Rhizobiaceae Family Rickettsiales Order Rickettsiaceae Family Hyphomicrobium denitrificans Species DQ404664_g Genus Mesorhizobium Genus Comamonas testosteroni Species Pseudomonas carboxydohydrogena Species Piscinibacter Genus Piscinibacter aquaticus Species Opitutales Order Opitutae Class Opitutaceae Family EF520417_g Genus Opitutus Genus Alysiosphaera_f Family
14 Bacteroidia Class Bacteroidales Order AB286342_f Family Alysiomicrobium Genus EF520417_s Species Mesorhizobium plurifarium Species Caulobacterales Order Caulobacteraceae Family DQ413135_s Species Prevotellaceae Family Prevotella Genus DQ337099_f Family Thiotrichales Order Rudaea Genus Desulfuromonadales Order AB240359_f Family Rudaea cellulosilytica Species a Average Abundance of Control Group: The average value of the abundances in broth and biofilm samples in control MBR (Cstart, C1 broth, C2 broth, C1 biofilm, C2 biofilm) b Average Abundance of Quorum Quenching Group: The average value of the abundances in broth and biofilm samples in quorum quenching MBR (Qstart, Q1 broth, Q2 broth, Q1 biofilm, Q2 biofilm) c Average Dissimilarity: The contribution of the specific taxon to the average Bray-Curtis dissimilarity between control group samples and quorum quenching group samples (The average dissimilarity between control group samples and quorum quenching group samples was 37.51%.) 14
15 Table S4. The composition of major taxa in the microbial community Taxonomic rank Name C start C1 broth C2 broth Q start Q1 broth Q2 broth C1 biofilm C2 biofilm Q1 biofilm Q2 biofilm Phylum Armatimonadetes Class AF368184_c Order AF368184_o Family AF418954_f Genus AF418954_g Phylum Chloroflexi Class Caldilineae Order Caldilineales Phylum Proteobacteria Class Betaproteobacteria Order Burkholderiales Family Sphaerotilus_f Genus Methylibium Species Methylibium petroleiphilum Class Gammaproteobacteria Order Enterobacteriales Family Enterobacteriaceae Genus Enterobacter Species Enterobacter ludwigii Species Enterobacter asburiae Genus FJ755943_g Species FJ755943_s Order Pseudomonadales Family Pseudomonadaceae Genus Pseudomonas Species Pseudomonas fuscovaginae Species Pseudomonas monteilii Family Moraxellaceae
16 Genus Acinetobacter Species Acinetobacter guillouiae Order Xanthomonadales Family Xanthomonadaceae Class Alphaproteobacteria Order Rhizobiales Family Bradyrhizobiaceae Genus Bradyrhizobium Species Rhizobium lupini Order Sphingomonadales Family Sphingomonadaceae Order Paracaedibacter_o Class Deltaproteobacteria Order DQ906906_o Phylum Acidobacteria Class Solibacteres Order FJ479064_o Family DQ532145_f Genus DQ532145_g Species FJ710748_s Phylum Bacteroidetes Class Sphingobacteria Order Sphingobacteriales Family Chitinophagaceae Genus Terrimonas Species GQ088353_s Genus Ferruginibacter Species AY792299_s Class Flavobacteria Order Flavobacteriales Family Flavobacteriaceae Genus Elizabethkingia
17 Species Elizabethkingia miricola Genus Chryseobacterium Class Cytophagia Order Cytophagales
Tung-Yi Huang et al. Correspondence to: Cheng-Wei Fan
Supplement of Biogeosciences, 15, 115 126, 21 https://doi.org/1.5194/bg-15-115-21-supplement Author(s) 21. This work is distributed under the Creative Commons Attribution 3. License. Supplement of Plant
More informationIndividual signatures and environmental factors shape skin microbiota in healthy dogs
Cuscó et al. Microbiome (2017) 5:139 DOI 10.1186/s40168-017-0355-6 RESEARCH Open Access Individual signatures and environmental factors shape skin microbiota in healthy dogs Anna Cuscó 1,2*, Janelle M.
More informationSupplementary Figures
Unique IgM CDR AA Sequences IgM Affinity Maturation Index a b cdc MHCII MFI.% naïve B cell MHCII MFI CD11c + Bacterial Abundance (per 1oong fecal DNA) Supplementary Figures MHCII + (Gated on CD0 + CD +
More informationAn ecological perspective on microbes and immune defences in avian eggs Grizard, Stephanie
University of Groningen An ecological perspective on microbes and immune defences in avian eggs Grizard, Stephanie IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if
More informationC&W Three-Year Cumulative Antibiogram January 2013 December 2015
C&W Three-Year Cumulative Antibiogram January 213 December 215 Division of Microbiology, Virology & Infection Control Department of Pathology & Laboratory Medicine Contents Comments and Limitations...
More informationThis article was published in FEMS Microbiology Reviews, 38, ,
1 2 3 This article was published in FEMS Microbiology Reviews, 38, 761-778, 2014 http://dx.doi.org/10.1111/1574-6976.12062 4 5 Title: Bacterial diversity and antibiotic resistance in water habitats: searching
More informationESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED
ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED Caroline Pissetti 1, Jalusa Deon Kich 2, Heather K. Allen 3, Claudia Navarrete
More informationSemina: Ciências Agrárias ISSN: X Universidade Estadual de Londrina Brasil
Semina: Ciências Agrárias ISSN: 1676-546X semina.agrarias@uel.br Universidade Estadual de Londrina Brasil Holtz Tirabassi, Adriane; França Madeira, Humberto Maciel; Perdigão Fragoso, Stenio; Castilhos
More informationIntracellular Symbionts and Other Bacteria Associated with Deer Ticks (Ixodes scapularis) from Nantucket and Wellfleet, Cape Cod, Massachusetts
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jan. 2004, p. 616 620 Vol. 70, No. 1 0099-2240/04/$08.00 0 DOI: 10.1128/AEM.70.1.616 620.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved.
More informationSupplementary Table 1. Primers used in the study.
Supplementary Table 1. Primers used in the study. Primer Position (bp) Upstream primer (5 3 ) Downstream primer (5 3 ) Expected (bp) size 1 1 278 ACCAAACAGAGAATCTGTGAG CAGCAATCCGAAGGCAGAATAC 299 2 48 946
More informationThe Disinfecting Effect of Electrolyzed Water Produced by GEN-X-3. Laboratory of Diagnostic Medicine, College of Medicine, Soonchunhyang University
The Disinfecting Effect of Electrolyzed Water Produced by GEN-X-3 Laboratory of Diagnostic Medicine, College of Medicine, Soonchunhyang University Tae-yoon Choi ABSTRACT BACKGROUND: The use of disinfectants
More informationTransition cow health and immune function
Transition cow health and immune function Ynte Schukken, Brianna Pomeroy and Anja Sipka Cornell University Wageningen University Utrecht University GD Animal Health Introduction Transition cow health:
More informationEvaluation of the nasal microbiota in slaughter-age pigs and the impact on nasal methicillin-resistant Staphylococcus aureus (MRSA) carriage
Weese et al. BMC Veterinary Research 2014, 10:69 RESEARCH ARTICLE Open Access Evaluation of the nasal microbiota in slaughter-age pigs and the impact on nasal methicillin-resistant Staphylococcus aureus
More informationComparative analyses of foregut and hindgut bacterial communities in hoatzins and cows
(2012) 6, 531 541 & 2012 International Society for Microbial Ecology All rights reserved 1751-7362/12 www.nature.com/ismej ORIGINAL ARTICLE Comparative analyses of foregut and hindgut bacterial communities
More informationEffects of Age of Laying Hens on Internal and External Quality of Eggs
45 1, 63 71 (2018) Korean J. Poult. Sci. Vol.45, No.1, 63 71 (2018) https://doi.org/10.5536/kjps.2018.45.1.63 63 1 2 1 1 1 2 Effects of Age of Laying Hens on Internal and External Quality of Eggs Dong
More informationBacterial diversity and antibiotic resistance in water habitats: searching the links with the human microbiome
REVIEW ARTICLE Bacterial diversity and antibiotic resistance in water habitats: searching the links with the human microbiome Ivone Vaz-Moreira 1, Olga C. Nunes 2 &Celia M. Manaia 1 1 CBQF Centro de Biotecnologia
More informationThe Antibiotic Susceptibility of Escherichia coli from Community-Acquired Uncomplicated Urinary Tract Infection: A Focused on Fosfomycin
Original Article ISSN 2465-8243(Print) / ISSN: 2465-8510(Online) https://doi.org/10.14777/uti.2017.12.2.77 Urogenit Tract Infect 2017;12(2):77-81 http://crossmark.crossref.org/dialog/?doi=10.14777/uti.2017.12.2.77&domain=pdf&date_stamp=2017-08-25
More informationNon-Susceptibility of Bacterial Pathogens Causing Hospital-Onset Pneumonia UK and Ireland,
Non-Susceptibility of Bacterial Pathogens Causing Hospital-Onset Pneumonia UK and Ireland, 2008-2016 Alicia Russell Federation of Infection Societies conference 14 th November 2018 alisia_russell BSAC
More informationTAXONOMIC OUTLINE OF THE PROCARYOTES BERGEY S MANUAL OF SYSTEMATIC BACTERIOLOGY, SECOND EDITION Release 2.0, January 2002
TAXONOMIC OUTLINE OF THE PROCARYOTES BERGEY S MANUAL OF SYSTEMATIC BACTERIOLOGY, SECOND EDITION Release 2.0, January 2002 George M. Garrity Matthew Winters Austin W. Kuo and Denise B. Searles George M.
More informationTrends in Bloodstream Infections at a Korean University Hospital between 2008 and 2013
Ann Clin Microbiol Vol. 18, No. 1, March, 2015 http://dx.doi.org/10.5145/acm.2015.18.1.14 pissn 2288-0585 eissn 2288-6850 Trends in Bloodstream Infections at a Korean University Hospital between 2008 and
More informationSupplementary Fig. 1: 16S rrna rarefaction curves indicating mean alpha diversity (observed 97% OTUs) for different mammalian dietary categories,
Supplementary Fig. 1: 16S rrna rarefaction curves indicating mean alpha diversity (observed 97% OTUs) for different mammalian dietary categories, error bars indicating standard deviations. Odontocetes
More informationESIA Albania Annex 11.4 Sensitivity Criteria
ESIA Albania Annex 11.4 Sensitivity Criteria Page 2 of 8 TABLE OF CONTENTS 1 SENSITIVITY CRITERIA 3 1.1 Habitats 3 1.2 Species 4 LIST OF TABLES Table 1-1 Habitat sensitivity / vulnerability Criteria...
More informationANTIBIOTIC RESISTANCE. Syed Ziaur Rahman, MD, PhD D/O Pharmacology, JNMC, AMU, Aligarh
ANTIBIOTIC RESISTANCE Syed Ziaur Rahman, MD, PhD D/O Pharmacology, JNMC, AMU, Aligarh WHY IS THIS IMPORTANT? The most important problem associated with infectious disease today is the rapid development
More informationErika K. Ganda 1, Natalia Gaeta 2, Anja Sipka 1, Brianna Pomeroy 1, Georgios Oikonomou 1,3, Ynte H. Schukken 1,4,5 and Rodrigo C.
Ganda et al. Microbiome (17) 5:7 DOI 1.1/s-17-91-5 RESEARCH Open Access Normal milk microbiome is reestablished following experimental infection with Escherichia coli independent of intramammary antibiotic
More informationAnalysis of community- and hospital-acquired bacteraemia during a recent 5-year period
Journal of Medical Microbiology (2014), 63, 421 426 DOI 10.1099/jmm.0.069054-0 Analysis of community- and hospital-acquired bacteraemia during a recent 5-year period Hee-Won Moon, Young Jin Ko, Seungman
More information2017 NAMI Meat Industry Summit, San Diego, CA April 3-5, Keith E. Belk
2017 NAMI Meat Industry Summit, San Diego, CA April 3-5, 2017 Keith E. Belk Professor & Monfort Chair Center for Meat Safety & Quality Department of Animal Sciences Colorado State University Fort Collins
More informationOIE Reference Laboratory Reports Activities
OIE Reference Laboratory Reports Activities Activities in 2016 This report has been submitted : 2016-12-27 06:20:17 Name of disease (or topic) for which you are a designated OIE Reference Laboratory: Brucellosis
More informationAntibiotic resistant bacteria as contaminants of emerging concern. Célia M. Manaia Catholic University of Portugal
Antibiotic resistant bacteria as contaminants of emerging concern Célia M. Manaia Catholic University of Portugal cmanaia@porto.ucp.pt ~75 YEARS OF ANTIBIOTHERAPY Clatworthy etal. (2007) Nature Chemical
More informationAntimicrobial Resistance among Gram-Negative Bacilli Causing Infections in Intensive Care Unit Patients in the United States between 1993 and 2004
JOURNAL OF CLINICAL MICROBIOLOGY, Oct. 2007, p. 3352 3359 Vol. 45, No. 10 0095-1137/07/$08.00 0 doi:10.1128/jcm.01284-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Antimicrobial
More informationAvailable online at
Available online at www.annclinlabsci.org Time-Kill Synergy Tests of Tigecycline Combined with Imipenem, Amikacin, and Ciprofloxacin against Clinical Isolates of Multidrug-Resistant Klebsiella pneumoniae
More informationA Metagenomic Approach to Study the Effects of Using Tylosin an Antibiotic Growth Promoter on the Pig Distal Gut Microflora
A Metagenomic Approach to Study the Effects of Using Tylosin an Antibiotic Growth Promoter on the Pig Distal Gut Microflora A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY
More informationIn vitro Comparison of Anti-Biofilm Effects against
Original Article http://dx.doi.org/10.3947/ic.2015.47.1.27 Infect Chemother 2015;47(1):27-32 ISSN 2093-2340 (Print) ISSN 2092-6448 (Online) Infection & Chemotherapy In vitro Comparison of Anti-Biofilm
More informationRisk Stratification-based Surveillance of Bacterial Contamination in Metropolitan Ambulances
ORIGINAL ARTICLE Emergency & Critical Care Medicine DOI: 0.6/jkms.0.6.. J Korean Med Sci 0; 6: -0 Risk Stratification-based Surveillance of Bacterial Contamination in Metropolitan Ambulances Hyun Noh,
More informationmicrobiology testing services
microbiology testing services You already know Spectra Laboratories for a wide array of dialysis-related testing services. Now get to know us for your microbiology needs. As the leading provider of renal-specific
More informationMulti-drug resistant microorganisms
Multi-drug resistant microorganisms Arzu TOPELI Director of MICU Hacettepe University Faculty of Medicine, Ankara-Turkey Council Member of WFSICCM Deaths in the US declined by 220 per 100,000 with the
More informationInvestigation of bovine tuberculosis outbreaks by using a trace-back system and molecular typing in Korean Hanwoo beef cattle
Original Article J Vet Sci 2018, 19(1), 45-50 ㆍ https://doi.org/10.4142/jvs.2018.19.1.45 JVS Investigation of bovine tuberculosis outbreaks by using a trace-back system and molecular typing in Korean Hanwoo
More informationAQUAMANCHE. Development of methods for discriminating sources of faecal pollution of waters: Application to the catchment Havre de l Ay
Unité de Recherche Risques Microbiens Université de Caen Basse-Normandie QUMNCHE France (Channel) England INTERREG IV Program (FEDER) Development of methods for discriminating sources of faecal pollution
More informationBacteriological Profile and Antimicrobial Sensitivity of DJ Stents
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 5 Number 6 (2016) pp. 345-349 Journal homepage: http://www.ijcmas.com Original Research Article http://dx.doi.org/10.20546/ijcmas.2016.506.039
More informationPneumonia in hospitalized neurologic patients: trends in pathogen distribution and antibiotic susceptibility
Lee et al. Antimicrobial Resistance and Infection Control (2019) 8:25 https://doi.org/10.1186/s13756-019-0475-9 RESEARCH Open Access Pneumonia in hospitalized neurologic patients: trends in pathogen distribution
More informationGlobal comparisons of beta diversity among mammals, birds, reptiles, and amphibians across spatial scales and taxonomic ranks
Journal of Systematics and Evolution 47 (5): 509 514 (2009) doi: 10.1111/j.1759-6831.2009.00043.x Global comparisons of beta diversity among mammals, birds, reptiles, and amphibians across spatial scales
More information2 0 hr. 2 hr. 4 hr. 8 hr. 10 hr. 12 hr.14 hr. 16 hr. 18 hr. 20 hr. 22 hr. 24 hr. (time)
Key words I μ μ μ μ μ μ μ μ μ μ μ μ μ μ II Fig. 1. Microdilution plate. The dilution step of the antimicrobial agent is prepared in the -well microplate. Serial twofold dilution were prepared according
More informationCo-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli 4
SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16176 DOI: 10.1038/NMICROBIOL.2016.176 Co-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli 4 5 6 7 8 9 10 11 12 13 14 15 16 17
More informationWELCOME MESSAGE. Sincerely,
WELCOME MESSAGE On behalf of KRISS, I would like to welcome you to Korea, and thank you for your participation in APMP 2014. The Asia Pacific Metrology Programme has been a productive foundation for the
More informationSummary of the latest data on antibiotic consumption in the European Union
Summary of the latest data on antibiotic consumption in the European Union ESAC-Net surveillance data November 2016 Provision of reliable and comparable national antimicrobial consumption data is a prerequisite
More informationNo limbs Eastern glass lizard. Monitor lizard. Iguanas. ANCESTRAL LIZARD (with limbs) Snakes. No limbs. Geckos Pearson Education, Inc.
No limbs Eastern glass lizard Monitor lizard guanas ANCESTRAL LZARD (with limbs) No limbs Snakes Geckos Species: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum:
More informationWhat is Classification?
Classification Diversity of Life Biologists have identified over 1.5 million different species of living organisms so far... Estimates = between 2-100 million species yet to be discovered What is Classification?
More informationWhat is multidrug resistance?
What is multidrug resistance? Umaer Naseer Senior Research Scientist Department of Zoonotic, Water- and Foodborne Infections Norwegian Institute of Public Health Magiorakos A.P. et al 2012 Definition of
More informationImmobilization. of Acinetobacter baumannii onto. Serbian-Croatian
Immobilization of Acinetobacter baumannii onto natural zeolite dependent on the nutrient concentration of water media Tomislav Ivankovic, Faculty of Science, University of Zagreb, Croatia Jasna Hrenovic,
More informationIsolation and identification of bacterial endosymbionts in the brooding brittle star Amphipholis squamata
University of New Hampshire University of New Hampshire Scholars' Repository Honors Theses and Capstones Student Scholarship Spring 2016 Isolation and identification of bacterial endosymbionts in the brooding
More informationin wastewater treatment plant
Abundance of carbapenem-resistant resistant bacteria in wastewater treatment plant Tomislav Ivankovic, Faculty of Science, University of Zagreb, Croatia Svjetlana Dekic, Faculty of Science, University
More informationAffiliation: Morton Bioinformatics, Morton, Texas, United States of America
Title: Antibiotic resistant characteristics from 16S rrna Author: Casey R. Richardson Affiliation: Morton Bioinformatics, Morton, Texas, United States of America Abstract Background: Microbiota have evolved
More informationCh. 17: Classification
Ch. 17: Classification Who is Carolus Linnaeus? Linnaeus developed the scientific naming system still used today. Taxonomy What is? the science of naming and classifying organisms. A taxon group of organisms
More informationAHFA 2016 Regulatory Summit. Antimicrobial Material Preservatives & Sustainability Considerations
Material AHFA 2016 Regulatory Summit Scientific and Regulatory Excellence Antimicrobial Material Preservatives & Sustainability Considerations Erin Tesch Technology Sciences Group Inc. (TSG) 1150 18 th
More informationSupplementary Figure 1
Supplementary Figure 1 Suppl. Fig. 1 Time calibrated phylogenetic trees with annotated biogeographical range estimates used to infer dispersal events between the n subcontinent and mainland. The 37 phylogenies
More informationHealthcare Facilities and Healthcare Professionals. Public
Document Title: DOH Guidelines for Antimicrobial Stewardship Programs Document Ref. Number: DOH/ASP/GL/1.0 Version: 1.0 Approval Date: 13/12/2017 Effective Date: 14/12/2017 Document Owner: Applies to:
More informationPrevalence of Extended-spectrum β-lactamase Producing Enterobacteriaceae Strains in Latvia
Prevalence of Extended-spectrum β-lactamase Producing Enterobacteriaceae Strains in Latvia Ruta Paberza 1, Solvita Selderiņa 1, Sandra Leja 1, Jelena Storoženko 1, Lilija Lužbinska 1, Aija Žileviča 2*
More informationAntibiotic Resistance. Antibiotic Resistance: A Growing Concern. Antibiotic resistance is not new 3/21/2011
Antibiotic Resistance Antibiotic Resistance: A Growing Concern Judy Ptak RN MSN Infection Prevention Practitioner Dartmouth-Hitchcock Medical Center Lebanon, NH Occurs when a microorganism fails to respond
More informationEcography. Supplementary material
Ecography ECOG-2343 Lin, L.-H. and Wiens, J. J. 216. Comparing macroecological patterns across continents: evolution of climatic niche breadth in varanid lizards. Ecography doi: 1.1111/ecog.2343 Supplementary
More informationNasal Colonization of Methicillin-Resistant Staphylococcus aureus in Patients with Chronic Suppurative Otitis Media
online ML Comm ORIGINL RTICLE Korean J udiol 212;16:75-79 pissn 292-9862 / eissn 293-3797 http://dx.doi.org/1.7874/kja.212.16.2.75 Nasal Colonization of Methicillin-Resistant Staphylococcus aureus in Patients
More informationAssessment of ultrasound irradiation on inactivation of gram negative and positive bacteria isolated from hospital in aqueous solution
of gram negative and positive bacteria isolated from hospital in aqueous solution Afshin Maleki 1, Behzad Shahmoradi 1, Hiua Daraei 1, Enayatollah Kalantar 2 1 Kurdistan Environmental Health Research Center,
More informationIntermediate risk of multidrug-resistant organisms in patients who admitted intensive care unit with healthcare-associated pneumonia
ORIGINAL ARTICLE Korean J Intern Med 2016;31:525-534 Intermediate risk of multidrug-resistant organisms in patients who admitted intensive care unit with healthcare-associated pneumonia Hongyeul Lee, Ji
More informationModule Egg. MODULE NO. 25: Internal Quality of Egg
Module Egg MODULE NO. 25: Internal Quality of Egg Quality Quality : Degree of excellence Those conditions and characteristics that consumers want, and are willing to pay for, are, in a broad sense, factors
More informationAntimicrobial resistance. Impact on the food industry. Dr Peter Wareing. A Leatherhead Food Research white paper
Antimicrobial resistance A Leatherhead Food Research white paper Impact on the food industry 56 Dr Peter Wareing Antimicrobial resistance In this white paper, Dr Peter Wareing discusses antimicrobial resistance,
More informationSAMPLE (DO NOT COPY)
E-mail: Inquiries@astmanual.com Website: www.astmanual.ca or www.astmanual.com Copyright 2009 Edith Blondel-Hill MD All rights reserved. No part of this publication may be reproduced, stored in a retrieval
More informationOriginal Article. Introduction. Korean Circulation Journal
Original Article Print ISSN 1738-5520 On-line ISSN 1738-5555 Korean Circulation Journal Valsartan 160 mg/amlodipine 5 mg Combination Therapy versus Amlodipine 10 mg in Hypertensive Patients with Inadequate
More informationSalvage of Infected Breast Implants
Salvage of Infected Breast Implants Original Article Joon Ho Song 1, Young Seok Kim 1, Bok Ki Jung 1, Dong Won Lee 2, Seung Yong Song 2, Tai Suk Roh 1, Dae Hyun Lew 2 1 Department of Plastic and Reconstructive
More informationThe gut microbiome correlates with conspecific aggression in a small population of rescued dogs (Canis familiaris)
The gut microbiome correlates with conspecific aggression in a small population of rescued dogs (Canis familiaris) Nicole S. Kirchoff 1, Monique A. R. Udell 2, Thomas J. Sharpton Corresp. 1, 3 1 Department
More informationJournal of Antimicrobial Chemotherapy Advance Access published April 14, 2008
Journal of Antimicrobial Chemotherapy Advance Access published April 14, 2008 Journal of Antimicrobial Chemotherapy doi:10.1093/jac/dkn164 Control of extended-spectrum b-lactamase-producing Klebsiella
More informationInterpretation At-a-Glance
3425 Corporate Way Duluth, GA. 30096 Patient: Jane Doe DOB: September 16, 1960 Sex: F MRN: Order Number: E1210572 Completed: October 05, 2013 Received: September 21, 2013 Collected: September 20, 2013
More informationThe sandwich technique for repair of pectus carinatum and excavatum/carinatum complex
Featured rticle The sandwich technique for repair of pectus carinatum and excavatum/carinatum complex Hyung Joo Park, Kyung Soo Kim Department of Thoracic and Cardiovascular Surgery, Seoul St. Mary s Hospital,
More informationKREISEL Rotary valve vs. screw pump
KREISEL Rotary valve vs. screw pump KREISEL ceramic rotary feeder for pneumatic conveyance The KREISEL rotary feeder is one of the most popular feeder for pneumatic conveyance. Depending on the bulk material,
More informationWitchcraft for Gram negatives
Witchcraft for Gram negatives Dr Subramanian S MD DNB MNAMS AB (Medicine, Infect Dis) Infectious Diseases Consultant Global Health City, Chennai www.asksubra.com Drug resistance follows the drug like a
More informationMICRONAUT MICRONAUT-S Detection of Resistance Mechanisms. Innovation with Integrity BMD MIC
MICRONAUT Detection of Resistance Mechanisms Innovation with Integrity BMD MIC Automated and Customized Susceptibility Testing For detection of resistance mechanisms and specific resistances of clinical
More informationMAGFORMERS MODEL BOOKLET MAGFORMERS LLC
MAGFORMERS MODEL BOOKLET MAGFORMERS LLC MINI DINOSAUR DINO LINE Magformers Mini Dinosaur Set Magformers Mini Dinosaur Set includes 40 pieces in 10 different shapes that form 6 cute baby dinosaurs. With
More informationCharacterization of the Multidrug-Resistant Acinetobacter
Ann Clin Microbiol Vol. 7, No. 2, June, 20 http://dx.doi.org/0.55/acm.20.7.2.29 pissn 2288-0585 eissn 2288-6850 Characterization of the Multidrug-Resistant Acinetobacter species Causing a Nosocomial Outbreak
More informationFood safety related to camelids products: Brucellosis and its impact on Public Health and the consumers as an example
DIRECCION GENERAL DE LABORATORIOS Y CONTROL TECNICO Food safety related to camelids products: Brucellosis and its impact on Public Health and the consumers as an example Third Global Conference of OIE
More informationDetermination of Acaricides in Korean Honey Bull. Korean Chem. Soc. 2008, Vol. 29, No
Determination of Acaricides in Korean Honey Bull. Korean Chem. Soc. 2008, Vol. 29, No. 5 1043 Simultaneous Determination of Amitraz, Bromopropylate, Coumaphos, Cymiazole and 2,4-Dimethylaniline in Korean
More informationDexmedetomidine intravenous sedation using a patient-controlled sedation infusion pump: a case report
Case Report pissn 2383-9309 eissn 2383-9317 J Dent Anesth Pain Med 2016;16(1):55-59 http://dx.doi.org/10.17245/jdapm.2016.16.1.55 Dexmedetomidine intravenous sedation using a patient-controlled sedation
More informationAntimicrobial Copper Touch Surfaces: A new tool for Infection Control and Prevention
Antimicrobial Copper Touch Surfaces: A new tool for Infection Control and Prevention Wilton Moran Project Engineer Copper Development Association The Science Behind the Technology Digital Summit Infection
More informationGraduate School of Business
Graduate School of Business Phone: +82-62-530-1501 2 Fax: +82-62-530-1490 E-mail: gsbmba.jnu.ac.kr URL: http://mba.jnu.ac.kr/ Overview The mission of the Graduate School of Business (GSB), established
More informationCUMULATIVE ANTIBIOGRAM
BC Children s Hospital and BC Women s Hospital & Health Centre CUMULATIVE ANTIBIOGRAM 2017 Division of Medical Microbiology Department of Pathology and Laboratory Medicine Page 1 of 5 GRAM-POSITIVE BACTERIA
More informationOvernight identification of imipenem-resistant Acinetobacter baumannii carriage in hospitalized patients
TABLE 1. Origin and carbapenem resistance characteristics of the 64 Acinetobacter baumannii stock D-750 Overnight identification of imipenem-resistant Acinetobacter baumannii carriage in hospitalized patients
More informationOIE Reference Laboratory Reports Activities
OIE Reference Laboratory Reports Activities Activities in 2013 This report has been submitted : 2014-01-28 09:07:56 Name of disease (or topic) for which you are a designated OIE Reference Laboratory: Brucellosis
More informationAntibiotics in the Treatment of Acute Exacerbation of Chronic Obstructive Pulmonary Disease
Antibiotics in the Treatment of Acute Exacerbation of Chronic Obstructive Pulmonary Disease Sung Kyu Kim, M.D.Young Sam Kim, M.D. Department of Internal Medicine Yonsei University College of Medicine,
More informationSeasonal and Temperature-Associated Increase in Community-Onset Acinetobacter baumannii Complex Colonization or Infection
Brief Communication Clinical Microbiology Ann Lab Med 18;38:266-27 https://doi.org/.3343/alm.18.38.3.266 ISSN 2234-386 eissn 2234-3814 Seasonal and Temperature-Associated Increase in Community-Onset Acinetobacter
More informationEvaluation of Ceftriaxone Utilization at Multicenter Study
ORIGINAL ARTICLE DOI: 10.3904/kjim.2009.24.4.374 Evaluation of Ceftriaxone Utilization at Multicenter Study Hyuck Lee 1, Dongsik Jung 1, Joon Sup Yeom 2, Jun Seong Son 3, Sook-In Jung 4, Yeon-Sook Kim
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12234 Supplementary Figure 1. Embryonic naked mole-rat fibroblasts do not undergo ECI. Embryonic naked mole-rat fibroblasts ( EF) were isolated from eight mid-gestation embryos. All the
More informationEffective Hatching Egg Sanitization. Craig D. Coufal, Ph.D.
Effective Hatching Egg Sanitization Craig D. Coufal, Ph.D. Consequences A lack of hatching egg disinfection can lead to: Contaminated/exploding eggs Reduced hatch Cross contamination throughout the hatchery
More informationDifferences in phenotypic and genotypic traits against antimicrobial agents between Acinetobacter baumannii and Acinetobacter genomic species 13TU
Journal of Antimicrobial Chemotherapy (2007) 59, 633 639 doi:10.1093/jac/dkm007 Advance Access publication 6 March 2007 Differences in phenotypic and genotypic traits against antimicrobial agents between
More informationAuthor's response to reviews
Author's response to reviews Title: The Influence of Chronic Renal Failure on the Spectrum and Antimicrobial Susceptibility of Uropathogens in Community-Acquired Acute Pyelonephritis Presenting as a Positive
More informationStudy on Acoustic Features of Laying Hens Vocalization
Study on Acoustic Features of Laying Hens Vocalization Ligen Yu 1,*, Guanghui Teng 1, Zhizhong Li 1, and Xuming Liu 2 1 Key Laboratory of Agricultural Engineering in Structure and Environment, China Agricultural
More informationMicrobial landscape of surgical hospital. Biology and Medicine
eissn: 09748369 Microbial landscape of surgical hospital Biology and Medicine Research Article Volume 6, Issue 4, Article ID: BM-058-14, 2014 Indexed by Scopus (Elsevier) www.biolmedonline.com Microbial
More information2010 ANTIBIOGRAM. University of Alberta Hospital and the Stollery Children s Hospital
2010 ANTIBIOGRAM University of Alberta Hospital and the Stollery Children s Hospital Medical Microbiology Department of Laboratory Medicine and Pathology Table of Contents Page Introduction..... 2 Antibiogram
More informationMICROBIOLOGY of RAW MILK
MICROBIOLOGY of RAW MILK Introduction Milk and other dairy products are of superior quality and safety Milk Quality 00 29 49 69 89 99 Microbial in Raw Milk GENERAL ASPECTS Milk is a good source of nutrients
More informationCaused by microorganisms (usually bacteria) that invade the udder, multiply, and produce toxins that are harmful to the mammary gland
MASTITIS PA R T 1 MASTITIS Mast = breast; itis = inflammation Inflammation of the mammary gland Caused by microorganisms (usually bacteria) that invade the udder, multiply, and produce toxins that are
More informationOzone Inactivation Kinetics of Multiple Antibiotic Resistant Strains of Bacteria in Water.
Ozone Inactivation Kinetics of Multiple Antibiotic Resistant Strains of Bacteria in Water. M. S. Gutiérrez, I. Lezcano, Ch. Baluja and E. Sánchez Centro de Investigaciones del Ozono Calle 230 # 1313 y
More informationCONFLICT OF INTEREST ANTIMICROBIAL LOCK SOLUTIONS INCREASE BACTEREMIA
CONFLICT OF INTEREST ANTIMICROBIAL LOCK SOLUTIONS INCREASE BACTEREMIA NONE Vandana Dua Niyyar, MD Associate Professor of Medicine, Division of Nephrology, Emory University. OBJECTIVES Role of biofilm in
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/319/5870/1679/dc1 Supporting Online Material for Drosophila Egg-Laying Site Selection as a System to Study Simple Decision-Making Processes Chung-hui Yang, Priyanka
More informationTitle: Phylogenetic Methods and Vertebrate Phylogeny
Title: Phylogenetic Methods and Vertebrate Phylogeny Central Question: How can evolutionary relationships be determined objectively? Sub-questions: 1. What affect does the selection of the outgroup have
More informationGuideline for Antibiotic Use in Adults with Community-acquired Pneumonia
Special Article https://doi.org/10.3947/ic.2018.50.2.160 Infect Chemother 2018;50(2):160-198 ISSN 2093-2340 (Print) ISSN 2092-6448 (Online) Infection & Chemotherapy Guideline for Antibiotic Use in Adults
More information