Supplementary Information

Size: px
Start display at page:

Download "Supplementary Information"

Transcription

1 Supplementary Information Microbial Population Dynamics in Membrane Bioreactor with Quorum Quenching Hak-Woo Kim 1, Hyun-Suk Oh 1, Sang-Ryoung Kim 1, Ki-Baek Lee 1, Kyung-Min Yeon 1, Chung-Hak Lee 1, Seil Kim 2 and Jung-Kee Lee 3 1 School of Chemical and Biological Engineering, Seoul National University, Seoul , Korea 2 Clean Energy Research Center, Korea Institute of Science and Technology, Seoul , Korea 3 Departments of Life Science and Genetic Engineering, Paichai University, Daejeon , Korea leech@snu.ac.kr, TEL: , FAX: stapler@kist.re.kr, TEL: , FAX:

2 Fig. S1 Size distribution of MIEX and MEC. 2

3 Fig. S2 2D SDS-PAGE gel images from (a) control channel and (b) quorum quenching channel 3

4 Table S1 Total reads and OTUs data C start C1 broth C2 broth Q start Q1 broth Q2 broth C1 biofilm C2 biofilm Q1 biofilm Q2 biofilm Total reads (all sequence) OTUs (CDHit)

5 Table S2 SIMPER analysis data for microorganisms in the broth and biofilm based on all ten samples Taxonomic a Average Abundance of b Average Abundance of c Average Average Dissimilarity Contribution Cumulative Phylotype Rank Control Group (%) Quorum quenching Group (%) Dissimilarity / Standard Deviation (%) contribution (%) Gammaproteobacteria Class Enterobacteriales Order Enterobacteriaceae Family Proteobacteria Phylum Pseudomonadales Order FJ755943_g Genus FJ755943_s Species Alphaproteobacteria Class Pseudomonadaceae Family Pseudomonas Genus Enterobacter Genus Rhizobiales Order Sphingobacteria Class Solibacteres Class FJ479064_o Order DQ532145_f Family DQ532145_g Genus FJ710748_s Species Acidobacteria Phylum Sphaerotilus_f Family Sphingobacteriales Order Bradyrhizobiaceae Family Pseudomonas monteilii Species Flavobacteriales Order Betaproteobacteria Class Burkholderiales Order

6 Flavobacteria Class Flavobacteriaceae Family Chitinophagaceae Family Bradyrhizobium Genus Bacteroidetes Phylum Ferruginibacter Genus Methylibium Genus Enterobacter asburiae Species Moraxellaceae Family Acinetobacter Genus Rhizobium lupini Species Cytophagia Class Cytophagales Order Acinetobacter guillouiae Species Elizabethkingia Genus Elizabethkingia miricola Species Pseudomonas fuscovaginae Species Deltaproteobacteria Class Chryseobacterium Genus Enterobacter cancerogenus Species Armatimonadetes Phylum AF368184_c Class AF368184_o Order AF418954_f Family AF418954_g Genus AY792299_s Species Sphingomonadaceae Family Sphingomonadales Order AF418954_s Species Methylibium petroleiphilum Species Chloroflexi Phylum Caldilineae Class

7 EF516688_s Species Caldilineales Order DQ906906_o Order Paracaedibacter_o Order Cytophagaceae Family Enterobacter ludwigii Species Bradyrhizobium canariense Species AJ867903_f Family AJ867903_g Genus AB240353_s Species AB240353_g Genus Hyphomicrobiaceae Family Hyphomicrobium Genus Sphingopyxis Genus DQ336985_s Species Sphingopyxis ummariensis Species Xanthomonadales Order Terrimonas Genus Xanthomonadaceae Family AY945920_s Species Aquincola Genus Nitrospira_g1 Genus Nitrospirales Order Nitrospiraceae Family Nitrospirae Phylum Nitrospira_c Class AB252940_s Species Chlorobi Phylum OPB56 Class OPB56_o Order AJ630296_f Family AJ630296_g Genus

8 AJ630296_s Species GQ088353_s Species Comamonas Genus AY218694_g Genus Sphingomonas Genus Comamonadaceae Family EU881309_f Family Sphingomonas koreensis Genus GQ093804_s Species EU937987_s Species EU234264_o Order EU234264_f Family EU234264_g Genus Myxococcales Order Polyangiaceae Family Chondromyces Genus Rhodospirillales Order Piscinibacter Genus Verrucomicrobia Phylum Piscinibacter aquaticus Species AB286578_s Species Comamonas testosteroni Species EU134489_f Family AY693832_o Order AY693832_f Family EF203200_o Order DQ309373_g Genus EF203200_f Family AB252934_s Species AY491576_s Species AB286618_f Family Alysiosphaera_f Family

9 DQ413135_s Species a Average Abundance of Broth Group: The average value of the abundances in broth samples in control and quorum quenching MBR (Cstart, C1 broth, C2 broth, Qstart, Q1 broth, Q2 broth) b Average Abundance of Biofilm Group: The average value of the abundances in biofilm samples in control and quorum quenching MBR (C1 biofilm, C2 biofilm, Q1 biofilm, Q2 biofilm) c Average Dissimilarity: The contribution of the specific taxon to the he average Bray-Curtis dissimilarity between broth group samples and biofilm group samples (The average dissimilarity between broth group samples and biofilm group samples was 54.81%.) 9

10 Table S3 SIMPER analysis data of microorganisms in the control and quorum quenching MBRs based on all ten samples Taxonomic a Average Abundance of b Average Abundance of c Average Average Dissimilarity Contribution Cumulative Phylotype Rank Control Group (%) Quorum quenching Group (%) Dissimilarity / Standard Deviation (%) contribution (%) Gammaproteobacteria Class Enterobacteriales Order Enterobacteriaceae Family Proteobacteria Phylum Pseudomonadales Order Alphaproteobacteria Class Rhizobiales Order FJ755943_g Genus FJ755943_s Species Pseudomonadaceae Family FJ710748_s Species DQ532145_g Genus Pseudomonas Species FJ479064_o Order Solibacteres Class DQ532145_f Family Acidobacteria Order Enterobacter Genus Sphingobacteria Class Sphingobacteriales Order Bradyrhizobiaceae Family Bacteroidetes Phylum Ferruginibacter Genus Sphaerotilus_f Family Chitinophagaceae Family Flavobacteria Class Flavobacteriales Order Flavobacteriaceae Family Betaproteobacteria Class Burkholderiales Order

11 Bradyrhizobium Genus Pseudomonas monteilii Species Cytophagia Class Cytophagales Order Methylibium Genus Acinetobacter Genus Moraxellaceae Family Deltaproteobacteria Class Acinetobacter guillouiae Species Rhizobium lupini Species AY792299_s Species Enterobacter asburiae Species Elizabethkingia Genus Pseudomonas fuscovaginae Species Armatimonadetes Genus AF368184_c Class AF368184_o Order Elizabethkingia miricola Species AF418954_f Family AF418954_g Genus Chloroflexi Phylum DQ906906_o Order Caldilineae Family Chryseobacterium Species AF418954_s Order Caldilineales Family Cytophagaceae Family Sphingomonadaceae Family Sphingomonadales Order AB240353_s Species AB240353_g Genus Methylibium petroleiphilum Species Terrimonas Genus Enterobacter cancerogenus Species Sphingopyxis Genus

12 EF516688_s Species Sphingopyxis ummariensis Species Enterobacter ludwigii Species Xanthomonadales Order Paracaedibacter_o Order Xanthomonadaceae Family Hyphomicrobiaceae Family Hyphomicrobium Genus AJ867903_f Family AJ867903_g Genus Bradyrhizobium canariense Species DQ336985_s Species AY218694_g Genus GQ088353_s Species Chlorobi Phylum OPB56 Class OPB56_o Order AJ630296_f Family AJ630296_g Genus AJ630296_s Species Sphingomonas Genus Sphingomonas koreensis Species GQ093804_s Species Comamonadaceae Family EU234264_o Order EU234264_f Family EU234264_g Genus AB252934_s Species Myxococcales Order Polyangiaceae Family Chondromyces Genus EU134489_f Family AB286578_s Species Nitrospirales Order Nitrospirae Phylum

13 Nitrospira_c Class Nitrospiraceae Family Nitrospira_g1 Genus EU937987_s Genus Aquincola Species AY945920_s Species AB252940_s Species Rhodospirillales Order EU881309_f Family AY693832_o Order Comamonas Genus AY693832_f Family EF203200_o Order Afipia Genus AB286618_f Family DQ309373_g Genus EF203200_f Family Verrucomicrobia Phylum AY491576_s Species Rhizobiaceae Family Rickettsiales Order Rickettsiaceae Family Hyphomicrobium denitrificans Species DQ404664_g Genus Mesorhizobium Genus Comamonas testosteroni Species Pseudomonas carboxydohydrogena Species Piscinibacter Genus Piscinibacter aquaticus Species Opitutales Order Opitutae Class Opitutaceae Family EF520417_g Genus Opitutus Genus Alysiosphaera_f Family

14 Bacteroidia Class Bacteroidales Order AB286342_f Family Alysiomicrobium Genus EF520417_s Species Mesorhizobium plurifarium Species Caulobacterales Order Caulobacteraceae Family DQ413135_s Species Prevotellaceae Family Prevotella Genus DQ337099_f Family Thiotrichales Order Rudaea Genus Desulfuromonadales Order AB240359_f Family Rudaea cellulosilytica Species a Average Abundance of Control Group: The average value of the abundances in broth and biofilm samples in control MBR (Cstart, C1 broth, C2 broth, C1 biofilm, C2 biofilm) b Average Abundance of Quorum Quenching Group: The average value of the abundances in broth and biofilm samples in quorum quenching MBR (Qstart, Q1 broth, Q2 broth, Q1 biofilm, Q2 biofilm) c Average Dissimilarity: The contribution of the specific taxon to the average Bray-Curtis dissimilarity between control group samples and quorum quenching group samples (The average dissimilarity between control group samples and quorum quenching group samples was 37.51%.) 14

15 Table S4. The composition of major taxa in the microbial community Taxonomic rank Name C start C1 broth C2 broth Q start Q1 broth Q2 broth C1 biofilm C2 biofilm Q1 biofilm Q2 biofilm Phylum Armatimonadetes Class AF368184_c Order AF368184_o Family AF418954_f Genus AF418954_g Phylum Chloroflexi Class Caldilineae Order Caldilineales Phylum Proteobacteria Class Betaproteobacteria Order Burkholderiales Family Sphaerotilus_f Genus Methylibium Species Methylibium petroleiphilum Class Gammaproteobacteria Order Enterobacteriales Family Enterobacteriaceae Genus Enterobacter Species Enterobacter ludwigii Species Enterobacter asburiae Genus FJ755943_g Species FJ755943_s Order Pseudomonadales Family Pseudomonadaceae Genus Pseudomonas Species Pseudomonas fuscovaginae Species Pseudomonas monteilii Family Moraxellaceae

16 Genus Acinetobacter Species Acinetobacter guillouiae Order Xanthomonadales Family Xanthomonadaceae Class Alphaproteobacteria Order Rhizobiales Family Bradyrhizobiaceae Genus Bradyrhizobium Species Rhizobium lupini Order Sphingomonadales Family Sphingomonadaceae Order Paracaedibacter_o Class Deltaproteobacteria Order DQ906906_o Phylum Acidobacteria Class Solibacteres Order FJ479064_o Family DQ532145_f Genus DQ532145_g Species FJ710748_s Phylum Bacteroidetes Class Sphingobacteria Order Sphingobacteriales Family Chitinophagaceae Genus Terrimonas Species GQ088353_s Genus Ferruginibacter Species AY792299_s Class Flavobacteria Order Flavobacteriales Family Flavobacteriaceae Genus Elizabethkingia

17 Species Elizabethkingia miricola Genus Chryseobacterium Class Cytophagia Order Cytophagales

Tung-Yi Huang et al. Correspondence to: Cheng-Wei Fan

Tung-Yi Huang et al. Correspondence to: Cheng-Wei Fan Supplement of Biogeosciences, 15, 115 126, 21 https://doi.org/1.5194/bg-15-115-21-supplement Author(s) 21. This work is distributed under the Creative Commons Attribution 3. License. Supplement of Plant

More information

Individual signatures and environmental factors shape skin microbiota in healthy dogs

Individual signatures and environmental factors shape skin microbiota in healthy dogs Cuscó et al. Microbiome (2017) 5:139 DOI 10.1186/s40168-017-0355-6 RESEARCH Open Access Individual signatures and environmental factors shape skin microbiota in healthy dogs Anna Cuscó 1,2*, Janelle M.

More information

Supplementary Figures

Supplementary Figures Unique IgM CDR AA Sequences IgM Affinity Maturation Index a b cdc MHCII MFI.% naïve B cell MHCII MFI CD11c + Bacterial Abundance (per 1oong fecal DNA) Supplementary Figures MHCII + (Gated on CD0 + CD +

More information

An ecological perspective on microbes and immune defences in avian eggs Grizard, Stephanie

An ecological perspective on microbes and immune defences in avian eggs Grizard, Stephanie University of Groningen An ecological perspective on microbes and immune defences in avian eggs Grizard, Stephanie IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if

More information

C&W Three-Year Cumulative Antibiogram January 2013 December 2015

C&W Three-Year Cumulative Antibiogram January 2013 December 2015 C&W Three-Year Cumulative Antibiogram January 213 December 215 Division of Microbiology, Virology & Infection Control Department of Pathology & Laboratory Medicine Contents Comments and Limitations...

More information

This article was published in FEMS Microbiology Reviews, 38, ,

This article was published in FEMS Microbiology Reviews, 38, , 1 2 3 This article was published in FEMS Microbiology Reviews, 38, 761-778, 2014 http://dx.doi.org/10.1111/1574-6976.12062 4 5 Title: Bacterial diversity and antibiotic resistance in water habitats: searching

More information

ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED

ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED Caroline Pissetti 1, Jalusa Deon Kich 2, Heather K. Allen 3, Claudia Navarrete

More information

Semina: Ciências Agrárias ISSN: X Universidade Estadual de Londrina Brasil

Semina: Ciências Agrárias ISSN: X Universidade Estadual de Londrina Brasil Semina: Ciências Agrárias ISSN: 1676-546X semina.agrarias@uel.br Universidade Estadual de Londrina Brasil Holtz Tirabassi, Adriane; França Madeira, Humberto Maciel; Perdigão Fragoso, Stenio; Castilhos

More information

Intracellular Symbionts and Other Bacteria Associated with Deer Ticks (Ixodes scapularis) from Nantucket and Wellfleet, Cape Cod, Massachusetts

Intracellular Symbionts and Other Bacteria Associated with Deer Ticks (Ixodes scapularis) from Nantucket and Wellfleet, Cape Cod, Massachusetts APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jan. 2004, p. 616 620 Vol. 70, No. 1 0099-2240/04/$08.00 0 DOI: 10.1128/AEM.70.1.616 620.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved.

More information

Supplementary Table 1. Primers used in the study.

Supplementary Table 1. Primers used in the study. Supplementary Table 1. Primers used in the study. Primer Position (bp) Upstream primer (5 3 ) Downstream primer (5 3 ) Expected (bp) size 1 1 278 ACCAAACAGAGAATCTGTGAG CAGCAATCCGAAGGCAGAATAC 299 2 48 946

More information

The Disinfecting Effect of Electrolyzed Water Produced by GEN-X-3. Laboratory of Diagnostic Medicine, College of Medicine, Soonchunhyang University

The Disinfecting Effect of Electrolyzed Water Produced by GEN-X-3. Laboratory of Diagnostic Medicine, College of Medicine, Soonchunhyang University The Disinfecting Effect of Electrolyzed Water Produced by GEN-X-3 Laboratory of Diagnostic Medicine, College of Medicine, Soonchunhyang University Tae-yoon Choi ABSTRACT BACKGROUND: The use of disinfectants

More information

Transition cow health and immune function

Transition cow health and immune function Transition cow health and immune function Ynte Schukken, Brianna Pomeroy and Anja Sipka Cornell University Wageningen University Utrecht University GD Animal Health Introduction Transition cow health:

More information

Evaluation of the nasal microbiota in slaughter-age pigs and the impact on nasal methicillin-resistant Staphylococcus aureus (MRSA) carriage

Evaluation of the nasal microbiota in slaughter-age pigs and the impact on nasal methicillin-resistant Staphylococcus aureus (MRSA) carriage Weese et al. BMC Veterinary Research 2014, 10:69 RESEARCH ARTICLE Open Access Evaluation of the nasal microbiota in slaughter-age pigs and the impact on nasal methicillin-resistant Staphylococcus aureus

More information

Comparative analyses of foregut and hindgut bacterial communities in hoatzins and cows

Comparative analyses of foregut and hindgut bacterial communities in hoatzins and cows (2012) 6, 531 541 & 2012 International Society for Microbial Ecology All rights reserved 1751-7362/12 www.nature.com/ismej ORIGINAL ARTICLE Comparative analyses of foregut and hindgut bacterial communities

More information

Effects of Age of Laying Hens on Internal and External Quality of Eggs

Effects of Age of Laying Hens on Internal and External Quality of Eggs 45 1, 63 71 (2018) Korean J. Poult. Sci. Vol.45, No.1, 63 71 (2018) https://doi.org/10.5536/kjps.2018.45.1.63 63 1 2 1 1 1 2 Effects of Age of Laying Hens on Internal and External Quality of Eggs Dong

More information

Bacterial diversity and antibiotic resistance in water habitats: searching the links with the human microbiome

Bacterial diversity and antibiotic resistance in water habitats: searching the links with the human microbiome REVIEW ARTICLE Bacterial diversity and antibiotic resistance in water habitats: searching the links with the human microbiome Ivone Vaz-Moreira 1, Olga C. Nunes 2 &Celia M. Manaia 1 1 CBQF Centro de Biotecnologia

More information

The Antibiotic Susceptibility of Escherichia coli from Community-Acquired Uncomplicated Urinary Tract Infection: A Focused on Fosfomycin

The Antibiotic Susceptibility of Escherichia coli from Community-Acquired Uncomplicated Urinary Tract Infection: A Focused on Fosfomycin Original Article ISSN 2465-8243(Print) / ISSN: 2465-8510(Online) https://doi.org/10.14777/uti.2017.12.2.77 Urogenit Tract Infect 2017;12(2):77-81 http://crossmark.crossref.org/dialog/?doi=10.14777/uti.2017.12.2.77&domain=pdf&date_stamp=2017-08-25

More information

Non-Susceptibility of Bacterial Pathogens Causing Hospital-Onset Pneumonia UK and Ireland,

Non-Susceptibility of Bacterial Pathogens Causing Hospital-Onset Pneumonia UK and Ireland, Non-Susceptibility of Bacterial Pathogens Causing Hospital-Onset Pneumonia UK and Ireland, 2008-2016 Alicia Russell Federation of Infection Societies conference 14 th November 2018 alisia_russell BSAC

More information

TAXONOMIC OUTLINE OF THE PROCARYOTES BERGEY S MANUAL OF SYSTEMATIC BACTERIOLOGY, SECOND EDITION Release 2.0, January 2002

TAXONOMIC OUTLINE OF THE PROCARYOTES BERGEY S MANUAL OF SYSTEMATIC BACTERIOLOGY, SECOND EDITION Release 2.0, January 2002 TAXONOMIC OUTLINE OF THE PROCARYOTES BERGEY S MANUAL OF SYSTEMATIC BACTERIOLOGY, SECOND EDITION Release 2.0, January 2002 George M. Garrity Matthew Winters Austin W. Kuo and Denise B. Searles George M.

More information

Trends in Bloodstream Infections at a Korean University Hospital between 2008 and 2013

Trends in Bloodstream Infections at a Korean University Hospital between 2008 and 2013 Ann Clin Microbiol Vol. 18, No. 1, March, 2015 http://dx.doi.org/10.5145/acm.2015.18.1.14 pissn 2288-0585 eissn 2288-6850 Trends in Bloodstream Infections at a Korean University Hospital between 2008 and

More information

Supplementary Fig. 1: 16S rrna rarefaction curves indicating mean alpha diversity (observed 97% OTUs) for different mammalian dietary categories,

Supplementary Fig. 1: 16S rrna rarefaction curves indicating mean alpha diversity (observed 97% OTUs) for different mammalian dietary categories, Supplementary Fig. 1: 16S rrna rarefaction curves indicating mean alpha diversity (observed 97% OTUs) for different mammalian dietary categories, error bars indicating standard deviations. Odontocetes

More information

ESIA Albania Annex 11.4 Sensitivity Criteria

ESIA Albania Annex 11.4 Sensitivity Criteria ESIA Albania Annex 11.4 Sensitivity Criteria Page 2 of 8 TABLE OF CONTENTS 1 SENSITIVITY CRITERIA 3 1.1 Habitats 3 1.2 Species 4 LIST OF TABLES Table 1-1 Habitat sensitivity / vulnerability Criteria...

More information

ANTIBIOTIC RESISTANCE. Syed Ziaur Rahman, MD, PhD D/O Pharmacology, JNMC, AMU, Aligarh

ANTIBIOTIC RESISTANCE. Syed Ziaur Rahman, MD, PhD D/O Pharmacology, JNMC, AMU, Aligarh ANTIBIOTIC RESISTANCE Syed Ziaur Rahman, MD, PhD D/O Pharmacology, JNMC, AMU, Aligarh WHY IS THIS IMPORTANT? The most important problem associated with infectious disease today is the rapid development

More information

Erika K. Ganda 1, Natalia Gaeta 2, Anja Sipka 1, Brianna Pomeroy 1, Georgios Oikonomou 1,3, Ynte H. Schukken 1,4,5 and Rodrigo C.

Erika K. Ganda 1, Natalia Gaeta 2, Anja Sipka 1, Brianna Pomeroy 1, Georgios Oikonomou 1,3, Ynte H. Schukken 1,4,5 and Rodrigo C. Ganda et al. Microbiome (17) 5:7 DOI 1.1/s-17-91-5 RESEARCH Open Access Normal milk microbiome is reestablished following experimental infection with Escherichia coli independent of intramammary antibiotic

More information

Analysis of community- and hospital-acquired bacteraemia during a recent 5-year period

Analysis of community- and hospital-acquired bacteraemia during a recent 5-year period Journal of Medical Microbiology (2014), 63, 421 426 DOI 10.1099/jmm.0.069054-0 Analysis of community- and hospital-acquired bacteraemia during a recent 5-year period Hee-Won Moon, Young Jin Ko, Seungman

More information

2017 NAMI Meat Industry Summit, San Diego, CA April 3-5, Keith E. Belk

2017 NAMI Meat Industry Summit, San Diego, CA April 3-5, Keith E. Belk 2017 NAMI Meat Industry Summit, San Diego, CA April 3-5, 2017 Keith E. Belk Professor & Monfort Chair Center for Meat Safety & Quality Department of Animal Sciences Colorado State University Fort Collins

More information

OIE Reference Laboratory Reports Activities

OIE Reference Laboratory Reports Activities OIE Reference Laboratory Reports Activities Activities in 2016 This report has been submitted : 2016-12-27 06:20:17 Name of disease (or topic) for which you are a designated OIE Reference Laboratory: Brucellosis

More information

Antibiotic resistant bacteria as contaminants of emerging concern. Célia M. Manaia Catholic University of Portugal

Antibiotic resistant bacteria as contaminants of emerging concern. Célia M. Manaia Catholic University of Portugal Antibiotic resistant bacteria as contaminants of emerging concern Célia M. Manaia Catholic University of Portugal cmanaia@porto.ucp.pt ~75 YEARS OF ANTIBIOTHERAPY Clatworthy etal. (2007) Nature Chemical

More information

Antimicrobial Resistance among Gram-Negative Bacilli Causing Infections in Intensive Care Unit Patients in the United States between 1993 and 2004

Antimicrobial Resistance among Gram-Negative Bacilli Causing Infections in Intensive Care Unit Patients in the United States between 1993 and 2004 JOURNAL OF CLINICAL MICROBIOLOGY, Oct. 2007, p. 3352 3359 Vol. 45, No. 10 0095-1137/07/$08.00 0 doi:10.1128/jcm.01284-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Antimicrobial

More information

Available online at

Available online at Available online at www.annclinlabsci.org Time-Kill Synergy Tests of Tigecycline Combined with Imipenem, Amikacin, and Ciprofloxacin against Clinical Isolates of Multidrug-Resistant Klebsiella pneumoniae

More information

A Metagenomic Approach to Study the Effects of Using Tylosin an Antibiotic Growth Promoter on the Pig Distal Gut Microflora

A Metagenomic Approach to Study the Effects of Using Tylosin an Antibiotic Growth Promoter on the Pig Distal Gut Microflora A Metagenomic Approach to Study the Effects of Using Tylosin an Antibiotic Growth Promoter on the Pig Distal Gut Microflora A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY

More information

In vitro Comparison of Anti-Biofilm Effects against

In vitro Comparison of Anti-Biofilm Effects against Original Article http://dx.doi.org/10.3947/ic.2015.47.1.27 Infect Chemother 2015;47(1):27-32 ISSN 2093-2340 (Print) ISSN 2092-6448 (Online) Infection & Chemotherapy In vitro Comparison of Anti-Biofilm

More information

Risk Stratification-based Surveillance of Bacterial Contamination in Metropolitan Ambulances

Risk Stratification-based Surveillance of Bacterial Contamination in Metropolitan Ambulances ORIGINAL ARTICLE Emergency & Critical Care Medicine DOI: 0.6/jkms.0.6.. J Korean Med Sci 0; 6: -0 Risk Stratification-based Surveillance of Bacterial Contamination in Metropolitan Ambulances Hyun Noh,

More information

microbiology testing services

microbiology testing services microbiology testing services You already know Spectra Laboratories for a wide array of dialysis-related testing services. Now get to know us for your microbiology needs. As the leading provider of renal-specific

More information

Multi-drug resistant microorganisms

Multi-drug resistant microorganisms Multi-drug resistant microorganisms Arzu TOPELI Director of MICU Hacettepe University Faculty of Medicine, Ankara-Turkey Council Member of WFSICCM Deaths in the US declined by 220 per 100,000 with the

More information

Investigation of bovine tuberculosis outbreaks by using a trace-back system and molecular typing in Korean Hanwoo beef cattle

Investigation of bovine tuberculosis outbreaks by using a trace-back system and molecular typing in Korean Hanwoo beef cattle Original Article J Vet Sci 2018, 19(1), 45-50 ㆍ https://doi.org/10.4142/jvs.2018.19.1.45 JVS Investigation of bovine tuberculosis outbreaks by using a trace-back system and molecular typing in Korean Hanwoo

More information

AQUAMANCHE. Development of methods for discriminating sources of faecal pollution of waters: Application to the catchment Havre de l Ay

AQUAMANCHE. Development of methods for discriminating sources of faecal pollution of waters: Application to the catchment Havre de l Ay Unité de Recherche Risques Microbiens Université de Caen Basse-Normandie QUMNCHE France (Channel) England INTERREG IV Program (FEDER) Development of methods for discriminating sources of faecal pollution

More information

Bacteriological Profile and Antimicrobial Sensitivity of DJ Stents

Bacteriological Profile and Antimicrobial Sensitivity of DJ Stents International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 5 Number 6 (2016) pp. 345-349 Journal homepage: http://www.ijcmas.com Original Research Article http://dx.doi.org/10.20546/ijcmas.2016.506.039

More information

Pneumonia in hospitalized neurologic patients: trends in pathogen distribution and antibiotic susceptibility

Pneumonia in hospitalized neurologic patients: trends in pathogen distribution and antibiotic susceptibility Lee et al. Antimicrobial Resistance and Infection Control (2019) 8:25 https://doi.org/10.1186/s13756-019-0475-9 RESEARCH Open Access Pneumonia in hospitalized neurologic patients: trends in pathogen distribution

More information

Global comparisons of beta diversity among mammals, birds, reptiles, and amphibians across spatial scales and taxonomic ranks

Global comparisons of beta diversity among mammals, birds, reptiles, and amphibians across spatial scales and taxonomic ranks Journal of Systematics and Evolution 47 (5): 509 514 (2009) doi: 10.1111/j.1759-6831.2009.00043.x Global comparisons of beta diversity among mammals, birds, reptiles, and amphibians across spatial scales

More information

2 0 hr. 2 hr. 4 hr. 8 hr. 10 hr. 12 hr.14 hr. 16 hr. 18 hr. 20 hr. 22 hr. 24 hr. (time)

2 0 hr. 2 hr. 4 hr. 8 hr. 10 hr. 12 hr.14 hr. 16 hr. 18 hr. 20 hr. 22 hr. 24 hr. (time) Key words I μ μ μ μ μ μ μ μ μ μ μ μ μ μ II Fig. 1. Microdilution plate. The dilution step of the antimicrobial agent is prepared in the -well microplate. Serial twofold dilution were prepared according

More information

Co-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli 4

Co-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli 4 SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16176 DOI: 10.1038/NMICROBIOL.2016.176 Co-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli 4 5 6 7 8 9 10 11 12 13 14 15 16 17

More information

WELCOME MESSAGE. Sincerely,

WELCOME MESSAGE. Sincerely, WELCOME MESSAGE On behalf of KRISS, I would like to welcome you to Korea, and thank you for your participation in APMP 2014. The Asia Pacific Metrology Programme has been a productive foundation for the

More information

Summary of the latest data on antibiotic consumption in the European Union

Summary of the latest data on antibiotic consumption in the European Union Summary of the latest data on antibiotic consumption in the European Union ESAC-Net surveillance data November 2016 Provision of reliable and comparable national antimicrobial consumption data is a prerequisite

More information

No limbs Eastern glass lizard. Monitor lizard. Iguanas. ANCESTRAL LIZARD (with limbs) Snakes. No limbs. Geckos Pearson Education, Inc.

No limbs Eastern glass lizard. Monitor lizard. Iguanas. ANCESTRAL LIZARD (with limbs) Snakes. No limbs. Geckos Pearson Education, Inc. No limbs Eastern glass lizard Monitor lizard guanas ANCESTRAL LZARD (with limbs) No limbs Snakes Geckos Species: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum:

More information

What is Classification?

What is Classification? Classification Diversity of Life Biologists have identified over 1.5 million different species of living organisms so far... Estimates = between 2-100 million species yet to be discovered What is Classification?

More information

What is multidrug resistance?

What is multidrug resistance? What is multidrug resistance? Umaer Naseer Senior Research Scientist Department of Zoonotic, Water- and Foodborne Infections Norwegian Institute of Public Health Magiorakos A.P. et al 2012 Definition of

More information

Immobilization. of Acinetobacter baumannii onto. Serbian-Croatian

Immobilization. of Acinetobacter baumannii onto. Serbian-Croatian Immobilization of Acinetobacter baumannii onto natural zeolite dependent on the nutrient concentration of water media Tomislav Ivankovic, Faculty of Science, University of Zagreb, Croatia Jasna Hrenovic,

More information

Isolation and identification of bacterial endosymbionts in the brooding brittle star Amphipholis squamata

Isolation and identification of bacterial endosymbionts in the brooding brittle star Amphipholis squamata University of New Hampshire University of New Hampshire Scholars' Repository Honors Theses and Capstones Student Scholarship Spring 2016 Isolation and identification of bacterial endosymbionts in the brooding

More information

in wastewater treatment plant

in wastewater treatment plant Abundance of carbapenem-resistant resistant bacteria in wastewater treatment plant Tomislav Ivankovic, Faculty of Science, University of Zagreb, Croatia Svjetlana Dekic, Faculty of Science, University

More information

Affiliation: Morton Bioinformatics, Morton, Texas, United States of America

Affiliation: Morton Bioinformatics, Morton, Texas, United States of America Title: Antibiotic resistant characteristics from 16S rrna Author: Casey R. Richardson Affiliation: Morton Bioinformatics, Morton, Texas, United States of America Abstract Background: Microbiota have evolved

More information

Ch. 17: Classification

Ch. 17: Classification Ch. 17: Classification Who is Carolus Linnaeus? Linnaeus developed the scientific naming system still used today. Taxonomy What is? the science of naming and classifying organisms. A taxon group of organisms

More information

AHFA 2016 Regulatory Summit. Antimicrobial Material Preservatives & Sustainability Considerations

AHFA 2016 Regulatory Summit. Antimicrobial Material Preservatives & Sustainability Considerations Material AHFA 2016 Regulatory Summit Scientific and Regulatory Excellence Antimicrobial Material Preservatives & Sustainability Considerations Erin Tesch Technology Sciences Group Inc. (TSG) 1150 18 th

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Suppl. Fig. 1 Time calibrated phylogenetic trees with annotated biogeographical range estimates used to infer dispersal events between the n subcontinent and mainland. The 37 phylogenies

More information

Healthcare Facilities and Healthcare Professionals. Public

Healthcare Facilities and Healthcare Professionals. Public Document Title: DOH Guidelines for Antimicrobial Stewardship Programs Document Ref. Number: DOH/ASP/GL/1.0 Version: 1.0 Approval Date: 13/12/2017 Effective Date: 14/12/2017 Document Owner: Applies to:

More information

Prevalence of Extended-spectrum β-lactamase Producing Enterobacteriaceae Strains in Latvia

Prevalence of Extended-spectrum β-lactamase Producing Enterobacteriaceae Strains in Latvia Prevalence of Extended-spectrum β-lactamase Producing Enterobacteriaceae Strains in Latvia Ruta Paberza 1, Solvita Selderiņa 1, Sandra Leja 1, Jelena Storoženko 1, Lilija Lužbinska 1, Aija Žileviča 2*

More information

Antibiotic Resistance. Antibiotic Resistance: A Growing Concern. Antibiotic resistance is not new 3/21/2011

Antibiotic Resistance. Antibiotic Resistance: A Growing Concern. Antibiotic resistance is not new 3/21/2011 Antibiotic Resistance Antibiotic Resistance: A Growing Concern Judy Ptak RN MSN Infection Prevention Practitioner Dartmouth-Hitchcock Medical Center Lebanon, NH Occurs when a microorganism fails to respond

More information

Ecography. Supplementary material

Ecography. Supplementary material Ecography ECOG-2343 Lin, L.-H. and Wiens, J. J. 216. Comparing macroecological patterns across continents: evolution of climatic niche breadth in varanid lizards. Ecography doi: 1.1111/ecog.2343 Supplementary

More information

Nasal Colonization of Methicillin-Resistant Staphylococcus aureus in Patients with Chronic Suppurative Otitis Media

Nasal Colonization of Methicillin-Resistant Staphylococcus aureus in Patients with Chronic Suppurative Otitis Media online ML Comm ORIGINL RTICLE Korean J udiol 212;16:75-79 pissn 292-9862 / eissn 293-3797 http://dx.doi.org/1.7874/kja.212.16.2.75 Nasal Colonization of Methicillin-Resistant Staphylococcus aureus in Patients

More information

Assessment of ultrasound irradiation on inactivation of gram negative and positive bacteria isolated from hospital in aqueous solution

Assessment of ultrasound irradiation on inactivation of gram negative and positive bacteria isolated from hospital in aqueous solution of gram negative and positive bacteria isolated from hospital in aqueous solution Afshin Maleki 1, Behzad Shahmoradi 1, Hiua Daraei 1, Enayatollah Kalantar 2 1 Kurdistan Environmental Health Research Center,

More information

Intermediate risk of multidrug-resistant organisms in patients who admitted intensive care unit with healthcare-associated pneumonia

Intermediate risk of multidrug-resistant organisms in patients who admitted intensive care unit with healthcare-associated pneumonia ORIGINAL ARTICLE Korean J Intern Med 2016;31:525-534 Intermediate risk of multidrug-resistant organisms in patients who admitted intensive care unit with healthcare-associated pneumonia Hongyeul Lee, Ji

More information

Module Egg. MODULE NO. 25: Internal Quality of Egg

Module Egg. MODULE NO. 25: Internal Quality of Egg Module Egg MODULE NO. 25: Internal Quality of Egg Quality Quality : Degree of excellence Those conditions and characteristics that consumers want, and are willing to pay for, are, in a broad sense, factors

More information

Antimicrobial resistance. Impact on the food industry. Dr Peter Wareing. A Leatherhead Food Research white paper

Antimicrobial resistance. Impact on the food industry. Dr Peter Wareing. A Leatherhead Food Research white paper Antimicrobial resistance A Leatherhead Food Research white paper Impact on the food industry 56 Dr Peter Wareing Antimicrobial resistance In this white paper, Dr Peter Wareing discusses antimicrobial resistance,

More information

SAMPLE (DO NOT COPY)

SAMPLE (DO NOT COPY) E-mail: Inquiries@astmanual.com Website: www.astmanual.ca or www.astmanual.com Copyright 2009 Edith Blondel-Hill MD All rights reserved. No part of this publication may be reproduced, stored in a retrieval

More information

Original Article. Introduction. Korean Circulation Journal

Original Article. Introduction. Korean Circulation Journal Original Article Print ISSN 1738-5520 On-line ISSN 1738-5555 Korean Circulation Journal Valsartan 160 mg/amlodipine 5 mg Combination Therapy versus Amlodipine 10 mg in Hypertensive Patients with Inadequate

More information

Salvage of Infected Breast Implants

Salvage of Infected Breast Implants Salvage of Infected Breast Implants Original Article Joon Ho Song 1, Young Seok Kim 1, Bok Ki Jung 1, Dong Won Lee 2, Seung Yong Song 2, Tai Suk Roh 1, Dae Hyun Lew 2 1 Department of Plastic and Reconstructive

More information

The gut microbiome correlates with conspecific aggression in a small population of rescued dogs (Canis familiaris)

The gut microbiome correlates with conspecific aggression in a small population of rescued dogs (Canis familiaris) The gut microbiome correlates with conspecific aggression in a small population of rescued dogs (Canis familiaris) Nicole S. Kirchoff 1, Monique A. R. Udell 2, Thomas J. Sharpton Corresp. 1, 3 1 Department

More information

Journal of Antimicrobial Chemotherapy Advance Access published April 14, 2008

Journal of Antimicrobial Chemotherapy Advance Access published April 14, 2008 Journal of Antimicrobial Chemotherapy Advance Access published April 14, 2008 Journal of Antimicrobial Chemotherapy doi:10.1093/jac/dkn164 Control of extended-spectrum b-lactamase-producing Klebsiella

More information

Interpretation At-a-Glance

Interpretation At-a-Glance 3425 Corporate Way Duluth, GA. 30096 Patient: Jane Doe DOB: September 16, 1960 Sex: F MRN: Order Number: E1210572 Completed: October 05, 2013 Received: September 21, 2013 Collected: September 20, 2013

More information

The sandwich technique for repair of pectus carinatum and excavatum/carinatum complex

The sandwich technique for repair of pectus carinatum and excavatum/carinatum complex Featured rticle The sandwich technique for repair of pectus carinatum and excavatum/carinatum complex Hyung Joo Park, Kyung Soo Kim Department of Thoracic and Cardiovascular Surgery, Seoul St. Mary s Hospital,

More information

KREISEL Rotary valve vs. screw pump

KREISEL Rotary valve vs. screw pump KREISEL Rotary valve vs. screw pump KREISEL ceramic rotary feeder for pneumatic conveyance The KREISEL rotary feeder is one of the most popular feeder for pneumatic conveyance. Depending on the bulk material,

More information

Witchcraft for Gram negatives

Witchcraft for Gram negatives Witchcraft for Gram negatives Dr Subramanian S MD DNB MNAMS AB (Medicine, Infect Dis) Infectious Diseases Consultant Global Health City, Chennai www.asksubra.com Drug resistance follows the drug like a

More information

MICRONAUT MICRONAUT-S Detection of Resistance Mechanisms. Innovation with Integrity BMD MIC

MICRONAUT MICRONAUT-S Detection of Resistance Mechanisms. Innovation with Integrity BMD MIC MICRONAUT Detection of Resistance Mechanisms Innovation with Integrity BMD MIC Automated and Customized Susceptibility Testing For detection of resistance mechanisms and specific resistances of clinical

More information

MAGFORMERS MODEL BOOKLET MAGFORMERS LLC

MAGFORMERS MODEL BOOKLET MAGFORMERS LLC MAGFORMERS MODEL BOOKLET MAGFORMERS LLC MINI DINOSAUR DINO LINE Magformers Mini Dinosaur Set Magformers Mini Dinosaur Set includes 40 pieces in 10 different shapes that form 6 cute baby dinosaurs. With

More information

Characterization of the Multidrug-Resistant Acinetobacter

Characterization of the Multidrug-Resistant Acinetobacter Ann Clin Microbiol Vol. 7, No. 2, June, 20 http://dx.doi.org/0.55/acm.20.7.2.29 pissn 2288-0585 eissn 2288-6850 Characterization of the Multidrug-Resistant Acinetobacter species Causing a Nosocomial Outbreak

More information

Food safety related to camelids products: Brucellosis and its impact on Public Health and the consumers as an example

Food safety related to camelids products: Brucellosis and its impact on Public Health and the consumers as an example DIRECCION GENERAL DE LABORATORIOS Y CONTROL TECNICO Food safety related to camelids products: Brucellosis and its impact on Public Health and the consumers as an example Third Global Conference of OIE

More information

Determination of Acaricides in Korean Honey Bull. Korean Chem. Soc. 2008, Vol. 29, No

Determination of Acaricides in Korean Honey Bull. Korean Chem. Soc. 2008, Vol. 29, No Determination of Acaricides in Korean Honey Bull. Korean Chem. Soc. 2008, Vol. 29, No. 5 1043 Simultaneous Determination of Amitraz, Bromopropylate, Coumaphos, Cymiazole and 2,4-Dimethylaniline in Korean

More information

Dexmedetomidine intravenous sedation using a patient-controlled sedation infusion pump: a case report

Dexmedetomidine intravenous sedation using a patient-controlled sedation infusion pump: a case report Case Report pissn 2383-9309 eissn 2383-9317 J Dent Anesth Pain Med 2016;16(1):55-59 http://dx.doi.org/10.17245/jdapm.2016.16.1.55 Dexmedetomidine intravenous sedation using a patient-controlled sedation

More information

Antimicrobial Copper Touch Surfaces: A new tool for Infection Control and Prevention

Antimicrobial Copper Touch Surfaces: A new tool for Infection Control and Prevention Antimicrobial Copper Touch Surfaces: A new tool for Infection Control and Prevention Wilton Moran Project Engineer Copper Development Association The Science Behind the Technology Digital Summit Infection

More information

Graduate School of Business

Graduate School of Business Graduate School of Business Phone: +82-62-530-1501 2 Fax: +82-62-530-1490 E-mail: gsbmba.jnu.ac.kr URL: http://mba.jnu.ac.kr/ Overview The mission of the Graduate School of Business (GSB), established

More information

CUMULATIVE ANTIBIOGRAM

CUMULATIVE ANTIBIOGRAM BC Children s Hospital and BC Women s Hospital & Health Centre CUMULATIVE ANTIBIOGRAM 2017 Division of Medical Microbiology Department of Pathology and Laboratory Medicine Page 1 of 5 GRAM-POSITIVE BACTERIA

More information

Overnight identification of imipenem-resistant Acinetobacter baumannii carriage in hospitalized patients

Overnight identification of imipenem-resistant Acinetobacter baumannii carriage in hospitalized patients TABLE 1. Origin and carbapenem resistance characteristics of the 64 Acinetobacter baumannii stock D-750 Overnight identification of imipenem-resistant Acinetobacter baumannii carriage in hospitalized patients

More information

OIE Reference Laboratory Reports Activities

OIE Reference Laboratory Reports Activities OIE Reference Laboratory Reports Activities Activities in 2013 This report has been submitted : 2014-01-28 09:07:56 Name of disease (or topic) for which you are a designated OIE Reference Laboratory: Brucellosis

More information

Antibiotics in the Treatment of Acute Exacerbation of Chronic Obstructive Pulmonary Disease

Antibiotics in the Treatment of Acute Exacerbation of Chronic Obstructive Pulmonary Disease Antibiotics in the Treatment of Acute Exacerbation of Chronic Obstructive Pulmonary Disease Sung Kyu Kim, M.D.Young Sam Kim, M.D. Department of Internal Medicine Yonsei University College of Medicine,

More information

Seasonal and Temperature-Associated Increase in Community-Onset Acinetobacter baumannii Complex Colonization or Infection

Seasonal and Temperature-Associated Increase in Community-Onset Acinetobacter baumannii Complex Colonization or Infection Brief Communication Clinical Microbiology Ann Lab Med 18;38:266-27 https://doi.org/.3343/alm.18.38.3.266 ISSN 2234-386 eissn 2234-3814 Seasonal and Temperature-Associated Increase in Community-Onset Acinetobacter

More information

Evaluation of Ceftriaxone Utilization at Multicenter Study

Evaluation of Ceftriaxone Utilization at Multicenter Study ORIGINAL ARTICLE DOI: 10.3904/kjim.2009.24.4.374 Evaluation of Ceftriaxone Utilization at Multicenter Study Hyuck Lee 1, Dongsik Jung 1, Joon Sup Yeom 2, Jun Seong Son 3, Sook-In Jung 4, Yeon-Sook Kim

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12234 Supplementary Figure 1. Embryonic naked mole-rat fibroblasts do not undergo ECI. Embryonic naked mole-rat fibroblasts ( EF) were isolated from eight mid-gestation embryos. All the

More information

Effective Hatching Egg Sanitization. Craig D. Coufal, Ph.D.

Effective Hatching Egg Sanitization. Craig D. Coufal, Ph.D. Effective Hatching Egg Sanitization Craig D. Coufal, Ph.D. Consequences A lack of hatching egg disinfection can lead to: Contaminated/exploding eggs Reduced hatch Cross contamination throughout the hatchery

More information

Differences in phenotypic and genotypic traits against antimicrobial agents between Acinetobacter baumannii and Acinetobacter genomic species 13TU

Differences in phenotypic and genotypic traits against antimicrobial agents between Acinetobacter baumannii and Acinetobacter genomic species 13TU Journal of Antimicrobial Chemotherapy (2007) 59, 633 639 doi:10.1093/jac/dkm007 Advance Access publication 6 March 2007 Differences in phenotypic and genotypic traits against antimicrobial agents between

More information

Author's response to reviews

Author's response to reviews Author's response to reviews Title: The Influence of Chronic Renal Failure on the Spectrum and Antimicrobial Susceptibility of Uropathogens in Community-Acquired Acute Pyelonephritis Presenting as a Positive

More information

Study on Acoustic Features of Laying Hens Vocalization

Study on Acoustic Features of Laying Hens Vocalization Study on Acoustic Features of Laying Hens Vocalization Ligen Yu 1,*, Guanghui Teng 1, Zhizhong Li 1, and Xuming Liu 2 1 Key Laboratory of Agricultural Engineering in Structure and Environment, China Agricultural

More information

Microbial landscape of surgical hospital. Biology and Medicine

Microbial landscape of surgical hospital. Biology and Medicine eissn: 09748369 Microbial landscape of surgical hospital Biology and Medicine Research Article Volume 6, Issue 4, Article ID: BM-058-14, 2014 Indexed by Scopus (Elsevier) www.biolmedonline.com Microbial

More information

2010 ANTIBIOGRAM. University of Alberta Hospital and the Stollery Children s Hospital

2010 ANTIBIOGRAM. University of Alberta Hospital and the Stollery Children s Hospital 2010 ANTIBIOGRAM University of Alberta Hospital and the Stollery Children s Hospital Medical Microbiology Department of Laboratory Medicine and Pathology Table of Contents Page Introduction..... 2 Antibiogram

More information

MICROBIOLOGY of RAW MILK

MICROBIOLOGY of RAW MILK MICROBIOLOGY of RAW MILK Introduction Milk and other dairy products are of superior quality and safety Milk Quality 00 29 49 69 89 99 Microbial in Raw Milk GENERAL ASPECTS Milk is a good source of nutrients

More information

Caused by microorganisms (usually bacteria) that invade the udder, multiply, and produce toxins that are harmful to the mammary gland

Caused by microorganisms (usually bacteria) that invade the udder, multiply, and produce toxins that are harmful to the mammary gland MASTITIS PA R T 1 MASTITIS Mast = breast; itis = inflammation Inflammation of the mammary gland Caused by microorganisms (usually bacteria) that invade the udder, multiply, and produce toxins that are

More information

Ozone Inactivation Kinetics of Multiple Antibiotic Resistant Strains of Bacteria in Water.

Ozone Inactivation Kinetics of Multiple Antibiotic Resistant Strains of Bacteria in Water. Ozone Inactivation Kinetics of Multiple Antibiotic Resistant Strains of Bacteria in Water. M. S. Gutiérrez, I. Lezcano, Ch. Baluja and E. Sánchez Centro de Investigaciones del Ozono Calle 230 # 1313 y

More information

CONFLICT OF INTEREST ANTIMICROBIAL LOCK SOLUTIONS INCREASE BACTEREMIA

CONFLICT OF INTEREST ANTIMICROBIAL LOCK SOLUTIONS INCREASE BACTEREMIA CONFLICT OF INTEREST ANTIMICROBIAL LOCK SOLUTIONS INCREASE BACTEREMIA NONE Vandana Dua Niyyar, MD Associate Professor of Medicine, Division of Nephrology, Emory University. OBJECTIVES Role of biofilm in

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/319/5870/1679/dc1 Supporting Online Material for Drosophila Egg-Laying Site Selection as a System to Study Simple Decision-Making Processes Chung-hui Yang, Priyanka

More information

Title: Phylogenetic Methods and Vertebrate Phylogeny

Title: Phylogenetic Methods and Vertebrate Phylogeny Title: Phylogenetic Methods and Vertebrate Phylogeny Central Question: How can evolutionary relationships be determined objectively? Sub-questions: 1. What affect does the selection of the outgroup have

More information

Guideline for Antibiotic Use in Adults with Community-acquired Pneumonia

Guideline for Antibiotic Use in Adults with Community-acquired Pneumonia Special Article https://doi.org/10.3947/ic.2018.50.2.160 Infect Chemother 2018;50(2):160-198 ISSN 2093-2340 (Print) ISSN 2092-6448 (Online) Infection & Chemotherapy Guideline for Antibiotic Use in Adults

More information