Multidrug resistant Salmonella Kentucky epidemics in animals: Polish, German, and French trails

Size: px

Start display at page:

Download "Multidrug resistant Salmonella Kentucky epidemics in animals: Polish, German, and French trails"

Silvester Johnson
5 years ago
Views:

Multidrug resistant Salmonella Kentucky epidemics in animals: Polish, German, and French trails NVRI, Poland: Dariusz Wasyl, Magdalena Zając, Andrzej Hoszowski

1 Multidrug resistant Salmonella Kentucky epidemics in animals: Polish, German, and French trails NVRI, Poland: Dariusz Wasyl, Magdalena Zając, Andrzej Hoszowski BfR, Germany: Janine Beutlich, Beatriz Guerra, Andreas Schroeter, Mardjan Arvand, Istvan Szabo, Reiner Helmuth ANSES, France: Sophie Granier, Francois Guillon (DGAl) 1

2 THE POLISH TRAILS

3 S. Kentucky epidemic curve Poland, No of isolates referred to NRL-Salmonella N=144 (2009: 7; 2010: 49; 2011: 54; 2012:28) feed (N=10) turkeys (N=56) broilers (N=5) turkey meat (N=37) broiler meat (N=9) savage sludge (N=2) reptiles (N=25)

4 S. Kentucky: sample types turkey flocks turkey meat boot swab internal organs feaces dust sample neck skin meat cuts carcase minced meat

Ceftazidime TAZ 0,25-16 > 2 mg/l Chloramphenicol CHL 2-64 > 16 mg/l Ciprofloxacin CIP 0,008-8 > 0,064 mg/l Colistin COL 2-4** > 2 mg/l

5 Antibiotic resistance in S. Kentucky customized EUMVS2 plate antimicrobial range (mg/l) (NWT >) Ampicillin AMP 0,5-32 > 8 mg/l Cefotaxime FOT 0,06-4 > 0,5 mg/l Ceftazidime TAZ 0,25-16 > 2 mg/l Chloramphenicol CHL 2-64 > 16 mg/l Ciprofloxacin CIP 0,008-8 > 0,064 mg/l Colistin COL 2-4** > 2 mg/l Florfenicol FFN 2-64 > 16 mg/l Gentamycin GEN 0,25-32 > 2 mg/l Kanamycin KAN > 4 mg/l Nalidixic acid NAL 4-64 > 16 mg/l Streptomycin STR > 16 mg/l Sulphametoxazole SMX > 256 mg/l Tetracycline TET 1-64 > 8 mg/l Trimethoprim TMP 0,5-32 > 2 mg/l

6 Antibiotic resistance in S. Kentucky multidrug resistance: AmpStrepGenNalCipSmxTcy

7 Quinolones MIC distributions high-level Ciprofloxacin resistance ( 8 mg/l) infrequent in other Salmonella

8 Clonally related S. Kentucky infections spreading in turkey flocks in Poland XbaI profile indistinuishable to ST198 (S. Le Hello et al. JID 2011, 204 (5):

HLR Cip resistance mechanisms QRDR: PCR and sequencing of gyrase and topoisomerase IV genes Primer Gene Oligonucleotide sequence 33F-gyrA GTACTTTACGCCATGAACGT gyra 33R-gyrA

36R-parE CGCGTAACTGCATCGGGTTC Amplicon size Annealing temp. 313 bp 55 C 181 bp 60 C 540 bp 55 C 500 bp 60 C Reference Chiu et al. N Engl J Med, 2002, 346(6): 413-9 Eaves et al.

9 HLR Cip resistance mechanisms QRDR: PCR and sequencing of gyrase and topoisomerase IV genes Primer Gene Oligonucleotide sequence 33F-gyrA GTACTTTACGCCATGAACGT gyra 33R-gyrA TACCGTCATAGTTATCCACGA 34F-gyrB GCGCTGTCCGAACTGTACCT gyrb 34R-gyrB TGATCAGCGTCGCCACTTCC 35F-parC CGCCTACTTAAACTACTCCA parc 35R-parC ATCAGCGTAATCGCCGCTTT 36F-parE GACCGAGCTGTTCCTTGTGG pare 36R-parE CGCGTAACTGCATCGGGTTC Amplicon size Annealing temp. 313 bp 55 C 181 bp 60 C 540 bp 55 C 500 bp 60 C Reference Chiu et al. N Engl J Med, 2002, 346(6): Eaves et al. AAC 2004, 48(10): Casin et al. EID, 2003, 9(11): Casin et al. EID, 2003, 9(11): ; Weill et al. EID, 2006, 10(12): Gene Bank ref. sequence AE (gyra) Y M AE (pare) gyra pare

isolates QRDR mutations as described by S. Le Hello et al.

10 HLR Cip resistance mechanisms gyra substitutions Ser83Phe, Asp87Tyr parc substitutions Ser80Ile Tyr57Ser in all isolates QRDR mutations as described by S. Le Hello et al. (2011) and J. Beutlich et al.. (2012) gyrb, pare: no mutations

11 Plasmid mediated quinolone resistance Primer Gene Oligonucleotide sequence 18F-qnrA 18R-qnrA qnra 02F-qnrB 02R-qnrB qnrb* 19F-qnrC 19R-qnrC qnrc 20F-qnrD 20R-qnrD qnrd 03F-qnrS 03R-qnrS qnrs* 21F-acc 21R-acc aac(6')-ib 22F-qepA 22R-qepA qepa GGATGCCAGTTTCGAGGA TGCCAGGCACAGATCTTG GGMATHGAAATTCGCCACTG TTTGCYGYYCGCCAGTCGAA GGGTTGTACATTTATTGAATCG CACCTACCCATTTATTTTCA CGAGATCAATTTACGGGGAATA AACAAGCTGAAGCGCCTG TCGACGTGCTAACTTGCG GATCTAAACCGTCGAGTTCGG TTGCGATGCTCTATGAGTGGCTA CTCGAATGCCTGGCGTGTTT AACTGCTTGAGCCCGTAGAT GTCTACGCCATGGACCTCAC all negative, but: aac(6 )-Ib Amplicon size Annealing temp. 492 bp 56 C Reference Cavaco et al. Microb Drug Resist 2008; 14:163-9 Gene Bank ref. sequence 262 bp 56 C Cattoir et al. JAC, 2007; 60:394-7 n/a 307 bp 50 C 582 bp 56 C 466 bp 56 C 482 bp 56 C 596 bp 56 C Jacoby et al. AAC, 2009, 53(4): Cavaco et al. AAC, 2009, 53(2): Cavaco et al. Microb Drug Resist 2008; 14:163-9 Park et al. AAC, 2006, 50(11): Kim et al. AAC, 2009, 53(2): n/a n/a n/a n/a JF HQ n/a 1643/2010 CTX-M clinical isolate amplicon sequencing: Trp102Arg, Asp179Tyr Ser117Leu (n/s) aac(6 )-Ib-cr

12 Where did it come from? The case turkey breeding flock IL Laying period: 2-9 Jan Formalin disinfection Liege Airport eggs destination: Hatchery PL Hatchery PL: import Hatching batch : (81,5%) , boot swabs S.Kentucky , boot swabs; negative , boot swabs; negative internal organs S. Kentucky ESC internal organs S. Kentucky , boot swabs S. Kentucky , boot swabs S. Kentucky , boot swabs; negative Feb E.coli screening for ESBL - negative flock 3; negative (13wk); (19wk); flock 4; negative (13wk); (20wk); flock 5, negative Hatchery PL: import CZ Hatching batch: (82,8%)

13 Where did it come from? The case Breeding flocks (IL, CZ): free from: Newcastle disease, avian influenza; Salmonella, incl. SP-G Hatchery (PL): egg import in agreement with Com. Reg. (EC) No 411/2009 no Salmonella in hatchery own checks hatching batch (IL): 3 other purchasing farms; no Salmonella reported hatching batch (CZ): 2 other purchasing farms; no Salmonella reported

14 Where did the infection come from? year Number of slaughtered turkeys turkey breeders in Poland in farms 120 flocks average flock size: 3500 import of hatching eggs or 1 day old poults Presumable S. Kentucky infection scenario: import-associated established subclinical infection cross-contamination: hatcheries (poultry species), farm (flocks), food industry (products)

15 Public health effects NIH, Infectious diseases and poisonings in Poland in 2010

16 S. Kentucky in pet reptiles Magdalena Zając: PhD research project on Salmonella in pet reptiles Study on 24 S. Kentucky reptile isolates; (submitted, )

17 67.3 Dice (Opt:0.50%) (Tol 1.5%-1.5%) (H>0.0% S>0.0%) [0.0%-100.0%] PFGE-XbaI PFGE-XbaI Two clonal lineages of S. Kentucky isolated from reptiles AStrain No. 1497/ / / / / / / / / / / / / / / / / / / / / / / / / / /2010 Date private owner 2 (0663) breeding farm (2408) pet shop (3064) Source (area code) breeding farm (1465) private owner (0617) private owner (0617) private owner 1 (0663) private owner (1465) breeding farm (1465) pet shop (0663) private owner (0617) reptile exhibition (2476) breeding farm (2408) breeding farm (2408) breeding farm (2408) breeding farm (2408) breeding farm (2408) breeding farm (2408) breeding farm (2408) breeding farm (2408) slaughterhouse (2807) farm (0809) breeding farm (1465) breeding farm (1465) reptile exhibition (0663) slaughterhouse (0222) farm (3207) Origin boa (Boa constrictor) viper (Bitis gabonica) 1931/ reptile exhibition (2476) exhibition hall viper (Agkistrodon contortrix) viper (Agkistrodon contortrix) agama (Agama aculeata) boa (Boa constrictor) boa (Boa constrictor) gecko (Gekko vitattus) gecko (Hemitheconyx caudicinctus) exhibition hall chameleon (Chamaeleo calyptratus) chameleon (Chamaeleo calyptratus) chameleon (Chamaeleo calyptratus) chameleon (Chamaeleo calyptratus) gecko (Eublepharis macularius) gecko (Eublepharis macularius) gecko (Eublepharis macularius) gecko (Eublepharis macularius) gecko (Eublepharis macularius) monitor lizard (Varanus niloticus) food turkey flock python (Morelia spilota) python (Morelia spilota) exhibition hall food turkey flock cluster of 4 profiles found 28 S. Kentucky isolated from turkey flocks (N= 21), turkey (N = 3) and poultry meat (N=4) cluster of 2 profiles found 6 S. Kentucky isolated from turkey flocks (N = 3), turkey and poultry meat (N = 2), and sewage sludge cluster of 2 profiles found S. Kentucky feed isolates (N = 2) Resistance profile Str NalCipStrGenTcySmx AmpNalCipStrGenTcySmx AmpNalCipStrCtxCazKanGenTcySmx AmpNalCipKan AmpNalCipKan AmpNalCip NalCipStrGenTcySmx AmpNalCipStrKanSmx Feed-associated clonal lineage; AB- Reptile-associated clonal lineage AB- different species breeders, private owners, environment horizontal transmission vertical (egg) transmission HLRcip clonal lineage MDR, XbaI profiles common with turkey-associated clone carnivore species (varan, python) breeders, environment horizontal transmission public health impact

18 S. Kentucky in pet reptiles Reptiles may suffer from MDR, high-level ciprofloxacin resistant S. Kentucky just like humans due to feeding with raw meat (poults) Another reptile-associated lineage present Both may spread horizontally Environment contamination Both of possible public health impact Awareness and education needed (reptile breeders, distributors, owners)

19 THE GERMAN TRAIL

20 Study of the National Salmonella Reference Laboratory (NRL-Salm) at the BfR Bacterial strain selection Revision of the lab internal database: a total of registered Salmonella isolates ( ) 122 S. Kentucky from Germany (originating from farm animals or food products) 40 multidrug resistant isolates (mainly from poultry) 25 isolates with CIP MIC 8 mg/l (EUCAST: clinical breakpoint MHK > 1 mg/l; ECOFF mg/l; CLSI: MHK 4 mg/l) Analysis of all CIP resistant isolates recorded in the database until August S. Kentucky (NAL, MHK > 64 mg/l; CIP, MHK 8 mg/l ) (isolation dates: 03/ /2011) 1 human isolate (CIP, MHK 8 mg/l), sent by State Health Office, Dillenburg Reference group: 7 sensitive isolates of different origins ( )

21 NRL-Salm study - Results Antimicrobial resistance NRL-Salm German Federal Land Isolation Origin Resistance phenotype Nr. year Baden-Württemberg 2010 Turkey meat AMP-GEN-TET-STR-SMX- [NAL-CIP] Nordrhein-Westfalen 2010 Turkey meat AMP-GEN-TET-STR-SMX- [NAL-CIP] Nordrhein-Westfalen 2010 Turkey meat AMP-GEN-TET-STR-SMX- [NAL-CIP] Sachsen 2010 Turkey meat AMP-GEN-TET-STR-SMX- [NAL-CIP] Sachsen-Anhalt 2010 Turkey meat AMP-GEN-TET-STR-SMX- [NAL-CIP] Nordrhein-Westfalen 2010 Turkey meat AMP-GEN-TET-STR-SMX- [NAL-CIP] Nordrhein-Westfalen 2011 Turkey meat AMP-GEN-TET-STR-SMX- [NAL-CIP] Mecklenburg-Vorpommern 2010 Turkey skin AMP-GEN-TET-STR-SMX- [NAL-CIP] Niedersachsen 2010 Turkey skin AMP-GEN-TET-STR-SMX- [NAL-CIP] unknown Turkey faeces AMP- [NAL-CIP] Berlin 2010 Minced meat AMP- [NAL-CIP ] Niedersachsen 2010 Chicken meat AMP-GEN-TET-STR-SMX- [NAL-CIP] Bayern 2010 Reptile organs AMP-GEN-TET-STR-SMX- [NAL-CIP] Niedersachsen 2010 Bacterial culture AMP-GEN-TET-STR-SMX- [NAL-CIP] Mecklenburg-Vorpommern 2010 Meat AMP-GEN-TET-STR-SMX- [NAL-CIP] Ty813 Bayern 2011 Human AMP-GEN-TET-STR-SMX- [NAL-CIP] Bayern 2004 Chicken sensitive Hessen 2007 Soja sensitive Niedersachsen 2008 Chicken meat sensitive Niedersachsen 2009 Cereals sensitive unknown Fertilizer sensitive Sachsen-Anhalt 2011 Cat sensitive unknown Dog faeces sensitive S. Kentucky (BfR) Human isolate (State Health Office) Reference group

22 NRL-Salm study - Results PCR assays NRL-Salm Origin Resistance phenotype Resistance genotype Class 1 integron SGI1 Nr Turkey meat AMP-GEN-TET-STR-SMX- [NAL-CIP] bla TEM-1 - aac(3)-ie - tet (A)- aada7 - sul1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] 1600 bp/ aac(3)-ie - aada Turkey meat AMP-GEN-TET-STR-SMX- [NAL-CIP] bla TEM-1 - aac(3)-ie - tet (A)- aada7 - sul1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] 1600 bp/ aac(3)-ie - aada Turkey meat AMP-GEN-TET-STR-SMX- [NAL-CIP] bla TEM-1 - aac(3)-ie - tet (A)- aada7 - sul1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] 1600 bp/ aac(3)-ie - aada Turkey meat AMP-GEN-TET-STR-SMX- [NAL-CIP] bla TEM-1 - aac(3)-ie - tet (A)- aada7 - sul1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] 1600 bp/ aac(3)-ie - aada Turkey meat AMP-GEN-TET-STR-SMX- [NAL-CIP] bla TEM-1 - aac(3)-ie - tet (A)- aada7 - sul1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] 1600 bp/ aac(3)-ie - aada Turkey meat AMP-GEN-TET-STR-SMX- [NAL-CIP] bla TEM-1 - aac(3)-ie - tet (A)- aada7 - sul1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] 1600 bp/ aac(3)-ie - aada Turkey meat AMP-GEN-TET-STR-SMX- [NAL-CIP] bla TEM-1 - aac(3)-ie - tet (A)- aada7 - sul1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] 1600 bp/ aac(3)-ie - aada Turkey skin AMP-GEN-TET-STR-SMX- [NAL-CIP] bla TEM-1 - aac(3)-ie - tet (A)- aada7 - sul1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] 1600 bp/ aac(3)-ie - aada Turkey skin AMP-GEN-TET-STR-SMX- [NAL-CIP] bla TEM-1 - aac(3)-ie - tet (A)- aada7 - sul1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] 1600 bp/ aac(3)-ie - aada Turkey faeces AMP- [NAL-CIP] bla TEM-1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] Minced meat AMP- [NAL-CIP ] bla TEM-1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] Chicken meat AMP-GEN-TET-STR-SMX- [NAL-CIP] bla TEM-1 - aac(3)-ie - tet (A)- aada7 - sul1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] 1600 bp/ aac(3)-ie - aada Reptile organs AMP-GEN-TET-STR-SMX- [NAL-CIP] bla TEM-1 - aac(3)-ie - tet (A)- aada7 - sul1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] 1600 bp/ aac(3)-ie - aada Bacterial culture AMP-GEN-TET-STR-SMX- [NAL-CIP] bla TEM-1 - aac(3)-ie - tet (A)- aada7 - sul1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] 1600 bp/ aac(3)-ie - aada Meat AMP-GEN-TET-STR-SMX- [NAL-CIP] bla TEM-1 - aac(3)-ie - tet (A)- aada7 - sul1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] 1600 bp/ aac(3)-ie - aada7 + Ty813 Human AMP-GEN-TET-STR-SMX- [NAL-CIP] bla TEM-1 - aac(3)-ie - tet (A)- aada7 - sul1 - [ gyra Ser83?Phe83, gyra Asp87?Tyr87, parc Ser80?Ile80 ] 1600 bp/ aac(3)-ie - aada Chicken sensitive Soja sensitive Chicken meat sensitive Cereals sensitive Fertilizer sensitive Cat sensitive Dog faeces sensitive

23 NRL Salm study - Results Molecular typing AST1 = resistance to: AMP-GEN-TET-STR-SMX-NAL-CIP AST2 = resistance to: AMP-NAL-CIP (According to Le Hello et al., 2011, J Infect Dis 204: )

24 NRL-Salm study- Discussion All CIP-R isolates are assigned to the SGI1-positive S. Kentucky clone ST198-X1 foods orginating from poultry especially turkey meat seem to be important carrier of the clone We also found for the very first time in Germany, one isolate collected from turkey faeces that showed the CIP resistance and belonged to the clone. First description in turkey primary production

25 NRL-Salm study - Discussion Human side ST198 is present also in Germany human isolate sent to the NRL-Salm for molecular analysis by the Hesse State Health Office (Dillenburg, Germany): - no travel anamnesis within the last four weeks before disease outbreak - it was assumed that the infection had been acquired in Germany We are currently cooperating with the Robert Koch Institute (Wernigerode, Germany) in order to analyse further 25 CIP-R human isolates. This clone might establish also in Germany as a human infection causing pathogen

27 THE FRENCH TRAIL

Since 1997 150 public & private labs Serotyping reference center for non human Salmonella

28 Since public & private labs Serotyping reference center for non human Salmonella Recieve 7000 strains/year Antibiograms 3500 non-duplicate strains/year 2/3 strains are Wild Type

29 S. Kentucky CIP-R in French poultry Between October 2012 and January fatenning turkey farms in Morbihan, France Less than 3 miles away from each other Anses set an alert on january, 22nd, 2013

Local investigation Coordinated by the French Food Directorate, Jan 28-30 Investigated farmers, producer group,

30 Local investigation Coordinated by the French Food Directorate, Jan Investigated farmers, producer group, mayors, vets To determine the origin of this contamination To evaluate risk of diffusion to the french avian production

31 Results of the investigation Farm 1 : S. Kentucky CIP-R detected first on oct 2012 Aug : farmers on holidays in Morocco Aug 23 : farmers are sick, acute enteritis Aug 24 : day-old turkeys introduced in the farm Aug 31 : 1350 dead turkeys -> treated with Enrofloxacin during week 1 & 3 Farm 2 : S. Kentucky CIP-R detected first on nov 2012 No providers in common, no material in common Both farm participate to the same «mutual aid» with 3 other poultry breeders from the area The «mutual aid» group was in farm 1 on Nov, 12th and farm 2 on Nov, 13th

Controle mesures Cleaning and desinfection, environment sampled before new batch in both farms Enhanced screening in the area for gallus gallus and turkey farms Anses Salmonella Network mobilize the

32 Controle mesures Cleaning and desinfection, environment sampled before new batch in both farms Enhanced screening in the area for gallus gallus and turkey farms Anses Salmonella Network mobilize the partner labs to enhance their vigilance (sampling the farmers to see if they are still shading the S. Kentucky CIP R) To date, no new cases identified Follow up next year! For further details contact : sophie.granier@anses.fr

33 S. Kentucky in the EU The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in the EFSA Journal, (3): p

34 S. Kentucky in the EU The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in the EFSA Journal, (3): p S. Kentucky turkey meat: the fourth most common serovar (8.6 %); predominant in Hungary broiler meat: the second most common (5.7 %) serovar; high prevalence among isolates from Ireland (69.6 %) fattening turkeys: 0.4% breeding turkeys: 0.6%

35 S. Kentucky in other countries

36 Awareness: bbc.co.uk Q: what makes the clone so epidemiologically successful?

Main objectives of the EURL EQAS s

EQAS Enterococci, Staphylococci and E. coli EURL workshop, April, 11 Lourdes García Migura Main objectives of the EURL EQAS s To improve the comparability of antimicrobial susceptibility testing (AST)