Myxosporeans and myxosporidiosis of allogynogenetic gibel carp (Carassius auratus gibelio Bloch) in China
|
|
- Arline Parks
- 5 years ago
- Views:
Transcription
1 Myxosporeans and myxosporidiosis of allogynogenetic gibel carp (Carassius auratus gibelio Bloch) in China Zhang Jinyong Laboratory of Fish Diseases; Institute of Hydrobiology (IHB), Chinese Academy of Sciences (CAS) Szarvas, Hungary May. 21.
2 Brief history of fish myxosporean research in China IV developmental stages I. Initial stage: ; description solely based on morphology of myxospores Prof. Chen Prof. Ma II. Developmental stage: ; traditional taxonomy, epidemiology, histopathology Representative work: Publication of Fauna Sinica, Myxozoa, Myxosporea in 1998 III. Mature stage: ; combined morphological and molecular characteristics, host, tissue tropism; molecular epidemiology; life cycle, ecology, host-parasite relationships; IV. Progressive stage: 2013 afterwards; Genomic era; evolution; phylogenomic anlysis; functional genomics Representative work: available of full genome data of Thelohanellus kitauei; ongoing genomic project of Myxobolus honghuensis Recorded 575 species in 23 genera
3 Allogynogenetic gibel carp Introduction Dual reproduction (sexual reproduction and gynogynesis) Rapid growth 500g/year, third-fifth freshwater cultured species (after grass carp, common carp, silver carp and bighead) above 2 million ton/year and replacing crucian carp in Chinese aquculture.. Certificate of New variety of 3 rd gibel carp bred by IHB, CAS Cited from Prof. Gui (IHB, CAS)
4 Diversity of myxosporean species from gibel carp: Morphological and molecular characterization since 2001; (About 100 myxosporean infecting gold fish and gibel carp belong to 15 genera recorded in Fauna Sinica, Myxozoa, Myxosporea by Chen & Ma (1998) although most only simply described with line drawing and spore morphological data.) 1. Validation of described or recorded species; 2. Description of new species Outline Life cycles of fish myxosporean in China since 2009; no one species with known full life cycle before 2009; Myxosporidiosis of gibel carp since 2001; 3 species (Thelohanellus wangi, T. wuhanensis and Myxobolus honghuensis) severely affected the sustainable development of gibel carp culture industry
5 Myxobolus pyramidis Redescription M.pyramidis Chen, 1958; Infection site: gill lamellae Molecular data: HQ μ m Showing plasmodium locating at the tip of gill filaments and spore in frontal and sutural view Cluster in capillary network of gill lamellae-infecting clade Showing the location of plasmodium and no inflammatory responses besides mechanistic extrusion
6 Myxobolus hearti Redescription Infection site: myocardium Molecular data: GU normal round plasmodium Unnormal plasmodium Cluster with species with round spore
7 Myxobolus ampullicapsulatus n. sp. Infection site: gill filaments Molecular data: DQ339482, KJ725082, KC M.honghuensis M. ampullicapsulatus Showing tiny morphological and molecuar difference between M. ampullicapsulatus and M. honghuensis (molecular similarity is above 99.2% based on comparsion of SSU rdna sequence, and morpholgocially almost undistinguished )
8 Henneguya doneci n. sp. Redescription M.doneci Schulman, 1962; Infection site: gill filaments Molecular data: EU ; HM146129; LC011456, JQ Gill-infecting cllade Cited from Ye et al. 2012
9 Henneguya globulata n.sp. Infection site: gill filaments Molecular data: KJ725074; JF Myxobolus nielii (Nie et Li, 1973) Landsberg et Lom, 1991 Infection site: gill filaments Molecular data: KJ725074; JF Phylogenetic relationship consistent with spore morphology (round spore body)
10 Myxobolus oralis n. sp. Infection site: buccal cavity Molecular data: KC Cluster with species with round spore Cited from Liu et al. 2014
11 Myxobolus turpisrotundus n.sp. Correction of M. rotundus recorded in China; Infection site: connective tissue of gill arch, fins, intestine and body surface Molecular data: EF690299, GU Plasmodium being going to detach from the dorsal fins Showing location of plasmodia and no severe host inflammatory response
12 Myxobolus wulii Synonyms: Myxosoma magna wu & Li, 1986; Myxobolus quanqiaoensis Wu & Wang, 1997; Infection site: hepatopancreas Molecular data: EF Honeycomb-like hepatocyte completely replaced by mature spores Very pathogenic sp., but the infection prevalence is low (below 10%)
13 Thelohanellus testudineus n. sp. Infection site: skin Molecular data: KC Showing plasmodium developing in the dermis of the skin and distinct inflammatory infiltration, Cluster in a Thelohanellus clade Cited from Liu et al. 2013
14 Myxobolus honghuensis n.sp. Synonyms: Myxosoma pharynae Xiu & Lu 2013;M. ampullicapsulatus Jsa.a Infection site: phyarynx Molecular data: KJ725074; JF Tofukasu-like cysts Many small plasmodia forming a big cyst Cluster with species with elongated spore
15 Current severe myxosporidiosis of gibel carp in China 1. Pharynx myxosporidiosis caused by Myxobolus honghuensis Infection prevalence: 70%; Mortality rate: up to 100%, especially in Northern Jiangsu Province; Infection season: from early May to late October, especially summer; Economic losses: 20 billion Chinese yuan per year; Control strategy: blocking the transmission and inactivating the infective actinospores by Ino-org (inosine-arginine);
16 Thelohanellus wangi n.sp. Infection site: gill filaments Molecular data: JX Cluster in a Thelohanellus clade Obvious epithelial hyperphasia at the anterior part of infected gill filaments and a thin connective tissue membrane delimited the plasmodium from cartilage cells of gill filaments
17 2. Gill myxosporidiosis caused by Thelohanellus wangi Infection prevalence: 60%; Mortality rate: up to 100%, especially under anoxia, crowded or other stress; Infection season: only from early April to late June on fry fish below 7cm in body length; Economic losses: 10 million Chinese yuan per year; Control strategy: blocking the transmission and inactivating the infective actinospores by Ino-org (inosine-arginine);
18 Thelohanellus wuhanensis n. sp. Infection site: skin Molecular data: JQ968687; JQ088179; HQ Membranous sheath surrounding spore cited from Liu et al plasmodium Raised plasmodium Showing plasmodium developing in the stratum spongiosum of dermis and many melanocytes gathering together around the plasmodia
19 3. Skin myxosporidiosis caused by Thelohanellus wuhanensis Infection prevalence: 70%; Mortality rate: no directly lethal,but up to 100% under anoxia, crowded or other stress condition; Infection season: only from early April to late June on fry fish below 7cm in body length; Economic losses: 10 million Chinese yuan per year; Control strategy: blocking the transmission and inactivating the infective actinospores by Ino-org (inosine-arginine);
20 Myxozoan life cycle studies in China Firstly reported Triactinomyxon type from Branchiura sowerbyi (Wang et al. 2000) no molecuar data Secondly Triactinomyxon type from Branchiura sowerbyi (Zhai et al. 2012) molecuar data: HM Short spore axis
21 Firstly Raabeia type from Branchiura sowerbyi (Zhai et al. 2013; Xi et al. 2013) molecular data:ab121146; HQ Firstly Aurantiactinomyxon type from Branchiura sowerbyi (Xi et al. 2013); molecular HQ613406
22 Firstly Guyenotia type from Branchiura sowerbyi (Xi et al. 2013); molecular data unavailable Secondly Raabeia type from Branchiura sowerbyi molecular data: HQ613410
23 Firstly Echinactionmyxon type from Branchiura sowerbyi; molecular data: EF branches at the end of caudal processes Secondly Echinactionmyxon type from Branchiura sowerbyi; molecular data: unavailable many branches at the end of caudal processes
24 Thirdly Triactinomyxon from Branchiura molecuar data: JX Firstly Neoactinomyxum type from Branchiura sowerbyi; molecuar data: KP642135, JX458816
25 Molecular data match Experimental infection and molecular match Molecular data match Molecular data match
26 Acknowledgements: Dr. Gu ZM and Dr. Liu Y from Huazhong Agricultural University, Wuhan, China; Prof. Csaba Székely and Prof. Molnár Kálmán from Institute for Veterinary Medical Research, Centre for Agricultural Research, HAS; Dr. Zhai and Dr. Ye LT from Institute of Hydrobiology, Chinese Academy of Sciences; Thank you for your attention
Myxosporeans and myxosporidiosis of common carp and gibel carp in China
Myxosporeans and myxosporidiosis of common carp and gibel carp in China Zhang Jinyong, Liu Xinhua, Xi Bingwen, Kálmán Molnár zhangjy@ihb.ac.cn Hungary 2015 June.3 Laboratory of Fish Diseases; Institute
More informationAhead of print online version
FOLIA PARASITOLOGICA 61 [6]: 505 511, 2014 ISSN 0015-5683 (print), ISSN 1803-6465 (online) doi: 10.14411/fp.2014.052 Institute of Parasitology, Biology Centre ASCR http://folia.paru.cas.cz/ Myxobolus oralis
More informationBORKHANUDDIN Hafiz, CECH Gábor, OSTOROS Györgyi, MOLNÁR Kálmán, SZÉKELY Csaba
BORKHANUDDIN Hafiz, CECH Gábor, OSTOROS Györgyi, MOLNÁR Kálmán, SZÉKELY Csaba Veterinary Medical Research Institute of the Hungarian Academy of Sciences, 1143. Budapest. Hungária krt. 21. Introduction
More informationThe life cycle of Myxobolus lentisuturalis (Myxozoa: Myxobolidae), from goldfish (Carassius auratus auratus), involves a Raabeia-type actinospore
FOLIA PARASITOLOGICA 56[1]: 6 12, 2009 ISSN 0015-5683 (print), ISSN 1803-6465 (online) Institute of Parasitology, Biology Centre ASCR http://www.paru.cas.cz/folia/ The life cycle of Myxobolus lentisuturalis
More informationAhead of print online version
Folia Parasitologica 58[2]: 157 163, 2011 ISSN 0015-5683 (print), ISSN 1803-6465 (online) Institute of Parasitology, Biology Centre ASCR http://www.paru.cas.cz/folia/ The development of Myxobolus pavlovskii
More informationA novel myxozoan parasite of terrestrial mammals: description of Soricimyxum minuti sp. n. (Myxosporea) in pygmy shrew Sorex minutus from Hungary
Institute of Parasitology, Biology Centre CAS Folia Parasitologica 2015, 62: 045 http://folia.paru.cas.cz Research Article A novel myxozoan parasite of terrestrial mammals: description of Soricimyxum minuti
More informationThomas G. Rosser. Wes A. Baumgartner. Michael A. Barger. Matt J. Griffin
DOI 10.1007/s10-017-9719-3 Myxobolus lepomis n. sp. (Cnidaria: Myxobolidae), a gill myxozoan infecting Lepomis marginatus Holbrook and Lepomis miniatus Jordan (Perciformes: Centrarchidae), in the Big Thicket
More informationSupplementary Table 1. Primers used in the study.
Supplementary Table 1. Primers used in the study. Primer Position (bp) Upstream primer (5 3 ) Downstream primer (5 3 ) Expected (bp) size 1 1 278 ACCAAACAGAGAATCTGTGAG CAGCAATCCGAAGGCAGAATAC 299 2 48 946
More informationJUNE Yorkshire Goldfish a Ryukin gets a First
JUNE 2016 Yorkshire Goldfish a Ryukin gets a First Traditionally the Bradford & District Aquarist Society starts the club show scene in Yorkshire with a Springtime Open Show and Auction. This year (and
More informationFirst Record of Myxobolus Species (Myxosporea: Myxobolidae) in Grey Mullet Mugil cephalus (Teleostei, Mugilidae) from Syria
First Record of Myxobolus Species (Myxosporea: Myxobolidae) in Grey Mullet Mugil cephalus (Teleostei, Mugilidae) from Syria Hassan M Salman*,Amal I Dayoub**, Paolo Merella***,Nasreen M Kurhaily* *Department
More information*Corresponding author:
American Journal of Infectious Diseases and Microbiology, 2017, Vol. 5, No. 4, 137-142 Available online at http://pubs.sciepub.com/ajidm/5/4/3 Science and Education Publishing DOI:10.12691/ajidm-5-4-3
More informationMyxozoans Exploiting Homeotherms
Myxozoans Exploiting Homeotherms Sascha L. Hallett, Stephen D. Atkinson, Jerri L. Bartholomew, and Csaba Székely 7 Abstract Discoveries published in 2007 and 2008 expanded the known host range of myxozoans
More informationInternational Journal of Multidisciplinary and Current Research ISSN: Research Article. Available at:
International Journal of Multidisciplinary and Current Research ISSN: - Research Article Available at: http://ijmcr.com, parasites of Barbus callipterus Boulenger, (Cyprinidae) in the Soudano-guinean zone
More informationSupporting information
Supporting information Reassortment and distinct evolutionary dynamics of Rift Valley Fever virus genomic segments Caio C. M. Freire 1, Atila Iamarino 1, Peinda O. Ly Soumaré 2, Ousmane Faye 2, Amadou
More informationPrevention of experimentally induced whirling disease in rainbow trout Oncorhynchus mykiss by Fumagillin
Vol. 10: 109-113, 1991 DISEASES OF AQUATIC ORGANISMS Dis. aquat. Org. Published April 4 Prevention of experimentally induced whirling disease in rainbow trout Oncorhynchus mykiss by Fumagillin M. El-Matbouli,
More informationName Class Date. After you read this section, you should be able to answer these questions:
CHAPTER 14 4 Vertebrates SECTION Introduction to Animals BEFORE YOU READ After you read this section, you should be able to answer these questions: How are vertebrates different from invertebrates? How
More informationPLASMODIUM MODULE 39.1 INTRODUCTION OBJECTIVES 39.2 MALARIAL PARASITE. Notes
Plasmodium MODULE 39 PLASMODIUM 39.1 INTRODUCTION Malaria is characterized by intermittent fever associated with chills and rigors in the patient. There may be enlargement of the liver and spleen in the
More informationImpact of Antimicrobial Resistance on Human Health. Robert Cunney HSE HCAI/AMR Programme and Temple Street Children s University Hospital
Impact of Antimicrobial Resistance on Human Health Robert Cunney HSE HCAI/AMR Programme and Temple Street Children s University Hospital AMR in Foodchain Conference, UCD, Dec 2014 Sir Patrick Dun s Hospital
More informationThe role of the fish parasite Myxobolus inornatus in young-of-year Smallmouth Bass Micropterus dolomieu mortality in Pennsylvania
The role of the fish parasite Myxobolus inornatus in young-of-year Smallmouth Bass Micropterus dolomieu mortality in Pennsylvania Identifying parasite distribution, intermediate host, and distribution
More informationVertebrates. Vertebrate Characteristics. 444 Chapter 14
4 Vertebrates Key Concept All vertebrates have a backbone, which supports other specialized body structures and functions. What You Will Learn Vertebrates have an endoskeleton that provides support and
More informationMyxobolus albi infection in cartilage of captive lumpfish (Cyclopterus lumpus)
440990JVDXXX10.1177/1040638712440990Ca vin et al.myxobolus albi in lumpfish cartilage Myxobolus albi infection in cartilage of captive lumpfish (Cyclopterus lumpus) Journal of Veterinary Diagnostic Investigation
More informationEpidemic and Information Research and Development Monitoring and Detection Education Training International Cooperation
Principal Vice Principal College of Bioresources and Agriculture Center for Biotechnology Zoonoses Reasearch Center Epidemic and Information Research and Development Monitoring and Detection Education
More informationMitochondrial Phylogenomics yields Strongly Supported Hypotheses for Ascaridomorph Nematodes
Supplementary Info Mitochondrial Phylogenomics yields Strongly Supported Hypotheses for Ascaridomorph Nematodes Guo-Hua Liu 1,2, Steven A. Nadler 3, Shan-Shan Liu 1, Magdalena Podolska Stefano D Amelio
More information"Incremento del riesgo de Necrosis Aguda del
"Incremento del riesgo de Necrosis Aguda del Hepatopáncreas (AHPND) y Necrosis Séptica del Hepátopacreas (SHPN) en Penaeus vannamei infectados con Enterocytozoon hepatopenaei (EHP) Luis Fernando Aranguren
More informationQuestion Set 1: Animal EVOLUTIONARY BIODIVERSITY
Biology 162 LAB EXAM 2, AM Version Thursday 24 April 2003 page 1 Question Set 1: Animal EVOLUTIONARY BIODIVERSITY (a). We have mentioned several times in class that the concepts of Developed and Evolved
More informationSession Fur & Wool. Qian Q.X., Ma J.X., Zhang G.Z., Xie C.S., Ren L., Qian B.Q. BREEDING AND APPLICATION OF ZHEXI ANGORA RABBITS.
PROCEEDINGS OF THE 11 th WORLD RABBIT CONGRESS Qingdao (China) - June 15-18, 2016 ISSN 2308-1910 Session Fur & Wool Qian Q.X., Ma J.X., Zhang G.Z., Xie C.S., Ren L., Qian B.Q. BREEDING AND APPLICATION
More informationCurrent information about teaching and research in veterinary parasitology in Hungary.
Current information about teaching and research in veterinary parasitology in Hungary. The department was established in 1929 by the world-famous parasitologist, Sándor Kotlán, who led education and
More informationA new basal sauropodiform dinosaur from the Lower Jurassic of Yunnan Province, China
SUPPLEMENTARY INFORMATION A new basal sauropodiform dinosaur from the Lower Jurassic of Yunnan Province, China Ya-Ming Wang 1, Hai-Lu You 2,3 *, Tao Wang 4 1 School of Earth Sciences and Resources, China
More informationJuehuaornis gen. nov.
34 1 2015 3 GLOBAL GEOLOGY Vol. 34 No. 1 Mar. 2015 1004 5589 2015 01 0007 05 Juehuaornis gen. nov. 1 1 1 2 1. 110034 2. 110034 70% Juehuaornis zhangi gen. et sp. nov Q915. 4 A doi 10. 3969 /j. issn. 1004-5589.
More informationGerman Experiences in Teaching Animal Welfare at TiHo Hannover Germany and Nanjing Agricultural University P.R. China - Capacity building -
German Experiences in Teaching Animal Welfare at TiHo Hannover Germany and Nanjing Agricultural University P.R. China - Capacity building - Jörg Hartung 1 and Endong Bao 2 1 Hannover, Germany 2 (NAU),
More informationEctoparasites Myobia musculi Radfordia affinis Radfordia ensifera
Ectoparasites Fleas, ticks, and lice are uncommon in modern laboratory facilities, but may be seen on wild or feral rodents. Most ectoparasite infestations seen in rats and mice used for research are various
More informationFlatworms Flatworms Platyhelminthes dorsoventrally free-living planarian parasitic fluke tapeworm label three body layers ectoderm mesoderm
Flatworms Flatworms are in the phylum Platyhelminthes. Flatworms are flattened dorsoventrally (top to bottom). The group includes the freshwater, free-living planarian and the parasitic fluke and tapeworm.
More informationPeng GUO 1, 2*, Qin LIU 1, 2, Jiatang LI 3, Guanghui ZHONG 2, Yueying CHEN 3 and Yuezhao WANG Introduction. 2. Material and Methods
Asian Herpetological Research 2012, 3(4): 334 339 DOI: 10.3724/SP.J.1245.2012.00334 Catalogue of the Type Specimens of Amphibians and Reptiles in the Herpetological Museum of the Chengdu Institute of Biology,
More informationSecret Bonus: Ten most Popular Goldfish!
Secret Bonus: Ten most Popular Goldfish! You can t imagine the kind of varieties of Goldfish there are! People have been breeding Goldfish for over 2000 years now. China is believed to have over 100 varieties
More informationOribatid Mites of the Family Otocepheidae from Tian-mu Mountain in China (Acari: Oribatida)1'
Acta arachnol,, 42 (1): 1-6, August 30, 1993 Oribatid Mites of the Family Otocepheidae from Tian-mu Mountain in China (Acari: Oribatida)1' Jun-ichi AoKI2' and Sheng-hao Hu3' Abstract Dolicheremaeus wangi
More informationHISTOPATHOLOGY. Introduction:
Introduction: HISTOPATHOLOGY Goats and sheep are the major domestic animal species in India. Much of the economy of the country has been depend upon the domestication of these animals. Especially economy
More informationThe Israeli Journal of Aquaculture Bamidgeh 58(3), 2006,
The Israeli Journal of Aquaculture Bamidgeh 58(3), 26, 157-169. 157 Efficacy and Toxicity of Orally Administrated Anti-Coccidial Drug Treatment on Enteromyxum leei Infections in Sharpsnout Seabream (Diplodus
More informationExceptional fossil preservation demonstrates a new mode of axial skeleton elongation in early ray-finned fishes
Supplementary Information Exceptional fossil preservation demonstrates a new mode of axial skeleton elongation in early ray-finned fishes Erin E. Maxwell, Heinz Furrer, Marcelo R. Sánchez-Villagra Supplementary
More informationA TAXONOMIC RE-EVALUATION OF Goniurosaurus hainanensis (SQUAMATA: EUBLEPHARIDAE) FROM HAINAN ISLAND, CHINA
Russian Journal of Herpetology Vol. 00, No.??, 20??, pp. 1 6 A TAXONOMIC RE-EVALUATION OF Goniurosaurus hainanensis (SQUAMATA: EUBLEPHARIDAE) FROM HAINAN ISLAND, CHINA Christopher Blair, 1,2 Nikolai L.
More informationA TAXONOMIC RE-EVALUATION OF Goniurosaurus hainanensis (SQUAMATA: EUBLEPHARIDAE) FROM HAINAN ISLAND, CHINA
Russian Journal of Herpetology Vol. 16, No. 1, 2009, pp. 35 40 A TAXONOMIC RE-EVALUATION OF Goniurosaurus hainanensis (SQUAMATA: EUBLEPHARIDAE) FROM HAINAN ISLAND, CHINA Christopher Blair, 1,2 Nikolai
More informationAP Lab Three: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST
AP Biology Name AP Lab Three: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST In the 1990 s when scientists began to compile a list of genes and DNA sequences in the human genome
More informationThe melanocortin 1 receptor (mc1r) is a gene that has been implicated in the wide
Introduction The melanocortin 1 receptor (mc1r) is a gene that has been implicated in the wide variety of colors that exist in nature. It is responsible for hair and skin color in humans and the various
More informationAquaculture health, AMU and AMR, and status of AMR National Action Plan in China
FMM/RAS/298: Strengthening capacities, policies and national action plans on prudent and responsible use of antimicrobials in fisheries Aquaculture health, AMU and AMR, and status of AMR National Action
More informationFrog Dissection Information Manuel
Frog Dissection Information Manuel Anatomical Terms: Used to explain directions and orientation of a organism Directions or Positions: Anterior (cranial)- toward the head Posterior (caudal)- towards the
More informationMyxosporidiosis in intensively-reared Piaractus mesopotamicus: Histopathological diagnosis by means of Ziehl-Neelsen staining 1
Myxosporidiosis in intensively-reared Piaractus mesopotamicus: Histopathological diagnosis by means of Ziehl-Neelsen staining 1 Wilson G. Manrique 2, Gustavo S. Claudiano 2, Mayra A.P. Figueiredo 2, Thalita
More informationFormation of Proximal and Anterior Limb Skeleton Requires Early Function of Irx3 and Irx5 and Is Negatively Regulated by Shh Signaling
Developmental Cell, Volume 29 Supplemental Information Formation of Proximal and Anterior Limb Skeleton Requires Early Function of Irx3 and Irx5 and Is Negatively Regulated by Shh Signaling Danyi Li, Rui
More informationSpot the (wildcat) hybrid not an easy task
Spot the (wildcat) hybrid not an easy task Dr Helen Senn Programme Manager RZSS WildGenes laboratory Royal Zoological Society of Scotland Edinburgh Sarah Robinson Head of Conservation David Barclay Cat
More informationOIE Collaborating Centres Reports Activities
OIE Collaborating Centres Reports Activities Activities in 2016 This report has been submitted : 2017-01-08 05:38:55 Title of collaborating centre: Food-Borne Parasites from the Asia-Pacific Region Address
More informationEcography. Supplementary material
Ecography ECOG-2343 Lin, L.-H. and Wiens, J. J. 216. Comparing macroecological patterns across continents: evolution of climatic niche breadth in varanid lizards. Ecography doi: 1.1111/ecog.2343 Supplementary
More informationDescription of Echo candens sp. nov. from western Yunnan, China (Odonata: Calopterygidae)
Echo candens sp. nov. from western Yunnan, China 1 st June 2015 107 Description of Echo candens sp. nov. from western Yunnan, China (Odonata: Calopterygidae) Hao-miao Zhang 1, Matti Hämäläinen 2 & Qing-hua
More informationMost amphibians begin life as aquatic organisms and then live on land as adults.
Section 3: Most amphibians begin life as aquatic organisms and then live on land as adults. K What I Know W What I Want to Find Out L What I Learned Essential Questions What were the kinds of adaptations
More informationEPIDEMIOLOGY OF CAMPYLOBACTER IN IRELAND
EPIDEMIOLOGY OF CAMPYLOBACTER IN IRELAND Table of Contents Acknowledgements 3 Summary 4 Introduction 5 Case Definitions 6 Materials and Methods 7 Results 8 Discussion 13 References 14 Epidemiology of Campylobacteriosis
More informationRabies Control in China
Rabies Control in China Sun Yan Veterinary Bureau, Ministry of Agriculture, the People s Republic of China July 17, 2013 Outline 1 Rabies in the World 2 Rabies in China 1. Disease Situation 2. Reasons
More informationFish Farms. DATCP Fish Health 4/21/2009. Myron Kebus, MS, DVM. State Aquaculture Veterinary Epidemiologist
Fish Farms Myron Kebus, MS, DVM State Aquaculture Veterinary Epidemiologist DATCP Fish Health National model for fish health programs Requirements: Import permits Health certificates Record-keeping Reportable
More informationMy fish appear to be itchy... they re jumping about, scraping and flicking
Vet Times The website for the veterinary profession https://www.vettimes.co.uk My fish appear to be itchy... they re jumping about, scraping and flicking Author : FIONA MACDONALD Categories : Vets Date
More informationCONVENTION ON INTERNATIONAL TRADE IN ENDANGERED SPECIES OF WILD FAUNA AND FLORA
CoP12 Inf. 8 (English only/ Seulement en anglais/ Únicamente en inglés) CONVENTION ON INTERNATIONAL TRADE IN ENDANGERED SPECIES OF WILD FAUNA AND FLORA Twelfth meeting of the Conference of the Parties
More informationACTA ADRIAT., 49(1): 19-23, 2008
ISSN: 0001-5113 AADRAY ACTA ADRIAT., 49(1): 19-23, 2008 UDC:593.194:597.5 (663)(261) Identification of Myxobolus episquamalis (Myxozoa, Myxobolidae) in flathead mullet Mugil cephalus (Pisces, Teleostei,
More informationTHE CONTROL AND SURVEILLANCE OF FILARIASIS IN HAINAN PROVINCE, CHINA
FILARIASIS IN HAINAN, PR CHINA THE CONTROL AND SURVEILLANCE OF FILARIASIS IN HAINAN PROVINCE, CHINA Hu Xi-min, Wang Shan-qing, Huang Jie-min, Lin Shaoxiong, Tong Chongjin, Li Shanwen and Zhen Wen Hainan
More informationIndex. Note: Page numbers of article titles are in boldface type.
Index Note: Page numbers of article titles are in boldface type. A Abdominal viscera, examination of, in investigation of emerging infectious diseases of food animals, 6 American Veterinary Medical Association,
More informationTOPIC CLADISTICS
TOPIC 5.4 - CLADISTICS 5.4 A Clades & Cladograms https://upload.wikimedia.org/wikipedia/commons/thumb/4/46/clade-grade_ii.svg IB BIO 5.4 3 U1: A clade is a group of organisms that have evolved from a common
More informationJournal of Parasitology COMMENTS ON THE SYSTEMATIC REVISION OF ADELEID HAEMOGREGARINES: IS MORE DATA NEEDED?
Journal of Parasitology COMMENTS ON THE SYSTEMATIC REVISION OF ADELEID HAEMOGREGARINES: IS MORE DATA NEEDED? --Manuscript Draft-- Manuscript Number: 15-930R2 Full Title: COMMENTS ON THE SYSTEMATIC REVISION
More informationVERTEBRATA PALASIATICA
1) 42 2 2004 4 VERTEBRATA PALASIATICA pp. 171 176 fig. 1 1 1,2 1,3 (1 710069) (2 710075) (3 710062) :,, : Q915. 864 : A :1000-3118(2004) 02-0171 - 06 1, 1999, Coni2 codontosaurus qinlingensis sp. nov.
More informationBREATHING WHICH IS NOT RESPIRATION
BREATHING WHICH IS NOT RESPIRATION Breathing vs. Respiration All animals respire. A lot of people think respiration means breathing- this is not true! Breathing is the physical process of inhaling oxygen
More informationSupplementary Figure 1 Cartilaginous stages in non-avian amniotes. (a) Drawing of early ankle development of Alligator mississippiensis, as reported
Supplementary Figure 1 Cartilaginous stages in non-avian amniotes. (a) Drawing of early ankle development of Alligator mississippiensis, as reported by a previous study 1. The intermedium is formed at
More informationBioinformatics: Investigating Molecular/Biochemical Evidence for Evolution
Bioinformatics: Investigating Molecular/Biochemical Evidence for Evolution Background How does an evolutionary biologist decide how closely related two different species are? The simplest way is to compare
More informationThe Breeding Ecology of a Critically Endangered Salamander, Hynobius amjiensis (Caudata: Hynobiidae), Endemic to Eastern China
Asian Herpetological Research 2016, 7(1): 53 58 DOI: 10.16373/j.cnki.ahr.150050 ORIGINAL ARTICLE The Breeding Ecology of a Critically Endangered Salamander, Hynobius amjiensis (Caudata: Hynobiidae), Endemic
More informationANIMALS IN CHINA LAW AND SOCIETY Book Review
ANIMALS IN CHINA LAW AND SOCIETY Book Review by Shih-Yun Wu 1 The book Animals in China - Law and Society, written by Professor Deborah Cao 2, was published in August 2015 by Palgrave Macmillan as part
More informationThe Worms / Chapter 34 and Partial 35 (pgs )
Name: The Worms / Chapter 34 and Partial 35 (pgs.712-716) 1-6. Worms are not the simple organisms most people think of at first sight. List three specific features that support the idea that worms are
More informationPreparation. Quantities. Activity Instructions. A Recipe for Traits
Preparation Dog DNA envelopes: 1. To prepare 14 envelopes, make four copies each of DNA Strips A, B, C, and D (pages 4-7) on colored paper. Choose one color for each type of DNA Strip. For example: DNA
More informationTRAINING CLUB LISTED STATUS APPLICATION FORM
TRAINING CLUB LISTED STATUS APPLICATION FORM THE KENNEL CLUB IS THE LEADING AUTHORITY IN DOGS AND DOG OWNERSHIP IN THE UK, WITH ITS PRINCIPAL OBJECTIVE BEING THE GENERAL IMPROVEMENT OF DOGS. The Kennel
More informationDESCRIPTIONS OF THREE NEW SPECIES OF PETALOCEPHALA STÅL, 1853 FROM CHINA (HEMIPTERA: CICADELLIDAE: LEDRINAE) Yu-Jian Li* and Zi-Zhong Li**
499 DESCRIPTIONS OF THREE NEW SPECIES OF PETALOCEPHALA STÅL, 1853 FROM CHINA (HEMIPTERA: CICADELLIDAE: LEDRINAE) Yu-Jian Li* and Zi-Zhong Li** * Institute of Entomology, Guizhou University, Guiyang, Guizhou
More informationPhylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA.
Zoology Department Phylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA By HAGAR IBRAHIM HOSNI BAYOUMI A thesis submitted in
More informationSession Pathology and Hygiene
PROCEEDINGS OF THE 11 th WORLD RABBIT CONGRESS Qingdao (China) - June 15-18, 2016 ISSN 2308-1910 Session Pathology and Hygiene Li Y., Wang Y., Tao G., Cui Y., Suo X., Liu X. PROPHYLACTIC AND THERAPEUTIC
More informationCh 1.2 Determining How Species Are Related.notebook February 06, 2018
Name 3 "Big Ideas" from our last notebook lecture: * * * 1 WDYR? Of the following organisms, which is the closest relative of the "Snowy Owl" (Bubo scandiacus)? a) barn owl (Tyto alba) b) saw whet owl
More informationCenter for Fish Disease Research, Department of Microbiology, 220 Nash Hall, Oregon State University, Corvallis, Oregon , USA
Journal of Aquatic Animal Health 16:116 129, 24 Copyright by the American Fisheries Society 24 A Digenean Metacercaria (Apophallus sp.) and a Myxozoan (Myxobolus sp.) Associated with Vertebral Deformities
More informationThese small issues are easily addressed by small changes in wording, and should in no way delay publication of this first- rate paper.
Reviewers' comments: Reviewer #1 (Remarks to the Author): This paper reports on a highly significant discovery and associated analysis that are likely to be of broad interest to the scientific community.
More informationINQUIRY & INVESTIGATION
INQUIRY & INVESTIGTION Phylogenies & Tree-Thinking D VID. UM SUSN OFFNER character a trait or feature that varies among a set of taxa (e.g., hair color) character-state a variant of a character that occurs
More informationSecond Specimen of a Rare Deep-sea Chiton, Deshayesiella sinica (Xu, 1990) (Polyplacophora, Lepidopleurida, Protochitonidae) from Northern Japan
Bull. Natl. Mus. Nat. Sci., Ser. A, 38(1), pp. 7 11, February 22, 2012 Second Specimen of a Rare Deep-sea Chiton, Deshayesiella sinica (Xu, 1990) (Polyplacophora, Lepidopleurida, Protochitonidae) from
More informationSarcocystis heydorni, n. sp. (Apicomplexa: Protozoa) with cattle (Bos taurus) and human
1 Sarcocystis heydorni, n. sp. (Apicomplexa: Protozoa) with cattle (Bos taurus) and human (Homo sapiens) cycle Jitender P. Dubey 1, Erna van Wilpe 2, Rafael Calero-Bernal 1, Shiv Kumar Verma 1, Ronald
More informationOutlines of Key Funds for Animal Health from Chinese Ministries and in CAAS. Prof. Dr. Hong Yin
Outlines of Key Funds for Animal Health from Chinese Ministries and in CAAS Prof. Dr. Hong Yin Sponsors of Programmes on Animal Health - State level - Ministry of Science and Technology (MOST) - National
More informationFood-borne Zoonoses. Stuart A. Slorach
Food-borne Zoonoses Stuart A. Slorach OIE Conference on Evolving veterinary education for a safer world,, Paris, 12-14 14 October 2009 1 Definition For the purposes of this paper, food-borne zoonoses are
More informationGUIDELINES FOR APPROPRIATE USES OF RED LIST DATA
GUIDELINES FOR APPROPRIATE USES OF RED LIST DATA The IUCN Red List of Threatened Species is the world s most comprehensive data resource on the status of species, containing information and status assessments
More informationOrigin and Evolution of Birds. Read: Chapters 1-3 in Gill but limited review of systematics
Origin and Evolution of Birds Read: Chapters 1-3 in Gill but limited review of systematics Review of Taxonomy Kingdom: Animalia Phylum: Chordata Subphylum: Vertebrata Class: Aves Characteristics: wings,
More informationEpidemiology of Opisthorchis felineus in the European Union
Epidemiology of Opisthorchis felineus in the European Union Edoardo Pozio European Union Reference Laboratory for Parasites Istituto Superiore di Sanità Rome, Italy World distribution and human prevalence
More information1 EEB 2245/2245W Spring 2017: exercises working with phylogenetic trees and characters
1 EEB 2245/2245W Spring 2017: exercises working with phylogenetic trees and characters 1. Answer questions a through i below using the tree provided below. a. Identify the taxon (or taxa if there is more
More information( M amenchisaurus youngi Pi, Ouyang et Ye, 1996)
39 4 2001 10 V ERTEBRATA PALASIATICA pp. 266 271 fig. 1,pl. I ( 643013), ( M amenchisaurus hochuanensis),,, Q915. 864 1995 12 31 (ZDM0126) ( M amenchisau rus hochuanensis Young et Chao, 1972),,, ZDM0126
More informationAlimentary System 解剖學科徐淑媛
Alimentary System 解剖學科徐淑媛 本堂重點 1. Structures derived from primitive guts 2. Specific events Alimentary System endoderm of primordial gut epithelium & glands of digestive tract ectoderm of stomodeum epithelium
More informationEfficacy and toxicity of orally administrated anti-coccidial drugs for innovative treatments of Myxobolus sp. infection in Puntazzo puntazzo
DISEASES OF AQUATIC ORGANISMS Vol. 62: 217 226, 2004 Published December 13 Dis Aquat Org Efficacy and toxicity of orally administrated anti-coccidial drugs for innovative treatments of Myxobolus sp. infection
More informationModern Evolutionary Classification. Lesson Overview. Lesson Overview Modern Evolutionary Classification
Lesson Overview 18.2 Modern Evolutionary Classification THINK ABOUT IT Darwin s ideas about a tree of life suggested a new way to classify organisms not just based on similarities and differences, but
More informationWho Wants to Live A Million Years? Objective: Students will learn about the process of natural selection through an online simulation.
MCAS Biology Ms. Chen Name: Date: Who Wants to Live A Million Years? Objective: Students will learn about the process of natural selection through an online simulation. Directions: Access the internet
More informationCHAPTER 1 INTRODUCTION
1 CHAPTER 1 INTRODUCTION The Staphylococci are a group of Gram-positive bacteria, 14 species are known to cause human infections but the vast majority of infections are caused by only three of them. They
More informationDuddingtonia flagrans What is it?
Duddingtonia flagrans What is it? A natural strain of fungus isolated from the environment (Australia, early 1990s) Found around the world Application as a biological control for larvae of parasitic worms
More informationThe Open Access Israeli Journal of Aquaculture Bamidgeh
The Open Access Israeli Journal of Aquaculture Bamidgeh As from January 2010 The Israeli Journal of Aquaculture - Bamidgeh (IJA) has been published exclusively as an online Open Access scientific journal,
More informationTransfer of the Family Platysternidae from Appendix II to Appendix I. Proponent: United States of America and Viet Nam. Ref. CoP16 Prop.
Transfer of the Family Platysternidae from Appendix II to Appendix I Proponent: United States of America and Viet Nam Summary: The Big-headed Turtle Platysternon megacephalum is the only species in the
More informationDiagnosis, treatment and control: dealing with coccidiosis in cattle
Vet Times The website for the veterinary profession https://www.vettimes.co.uk Diagnosis, treatment and control: dealing with coccidiosis in cattle Author : Adam Martin Categories : Vets Date : January
More informationWoodcock: Your Essential Brief
Woodcock: Your Essential Brief Q: Is the global estimate of woodcock 1 falling? A: No. The global population of 10-26 million 2 individuals is considered stable 3. Q: Are the woodcock that migrate here
More informationSTUDIES ON SOME PROBLEMS OF PROTOZOAL INFECTION IN FRESHWATER FISHES NEHAL ABOU EL-KARAMAT YOUNIS. Prof. Dr. Mohammed Abed El Aziz Ahmed
Cairo University Faculty of Veterinary Medicine Department of Fish Diseases and Management STUDIES ON SOME PROBLEMS OF PROTOZOAL INFECTION IN FRESHWATER FISHES Thesis presented By NEHAL ABOU EL-KARAMAT
More informationANIMAL BEHAVIOR. Laboratory: a Manual to Accompany Biology. Saunders College Publishing: Philadelphia.
PRESENTED BY KEN Yasukawa at the 2007 ABS Annual Meeting Education Workshop Burlington VT ANIMAL BEHAVIOR Humans have always been interested in animals and how they behave because animals are a source
More informationUNIT III A. Descent with Modification(Ch19) B. Phylogeny (Ch20) C. Evolution of Populations (Ch21) D. Origin of Species or Speciation (Ch22)
UNIT III A. Descent with Modification(Ch9) B. Phylogeny (Ch2) C. Evolution of Populations (Ch2) D. Origin of Species or Speciation (Ch22) Classification in broad term simply means putting things in classes
More informationLecture 11 Wednesday, September 19, 2012
Lecture 11 Wednesday, September 19, 2012 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean
More information