Journal of Parasitology COMMENTS ON THE SYSTEMATIC REVISION OF ADELEID HAEMOGREGARINES: IS MORE DATA NEEDED?

Size: px
Start display at page:

Download "Journal of Parasitology COMMENTS ON THE SYSTEMATIC REVISION OF ADELEID HAEMOGREGARINES: IS MORE DATA NEEDED?"

Transcription

1 Journal of Parasitology COMMENTS ON THE SYSTEMATIC REVISION OF ADELEID HAEMOGREGARINES: IS MORE DATA NEEDED? --Manuscript Draft-- Manuscript Number: R2 Full Title: COMMENTS ON THE SYSTEMATIC REVISION OF ADELEID HAEMOGREGARINES: IS MORE DATA NEEDED? Short Title: RH: Critical Comment..... Article Type: Corresponding Author: Other David James Harris CIBIO, Centro de Investigação em Biodiversidade e Recursos Genéticos Vairão, Vila do Conde PORTUGAL Corresponding Author Secondary Information: Corresponding Author's Institution: CIBIO, Centro de Investigação em Biodiversidade e Recursos Genéticos Corresponding Author's Secondary Institution: First Author: João Pedro Maia, PhD First Author Secondary Information: Order of Authors: João Pedro Maia, PhD Salvador Carranza, PhD David James Harris, PhD Order of Authors Secondary Information: Abstract: Haemogregarines are a group of apicomplexan parasites composed of 3 families that infect a wide range of hosts. Many species within these families have been subjected to reclassifications and reassignments, especially since the use of molecular tools to estimate their phylogenetic relationships became more widespread. The 18S rrna gene has been the only widely used gene for studying the diversity of haemogregarines and recent phylogenetic analyses of this gene have indicated incongruences with the current taxonomy, such that a new genus Bartazoon has recently been proposed. To further investigate the current taxonomic situation we conducted an overview of all published 18S rrna sequence data for haemogregarines. We highlight that our understanding of the real diversity and phylogenetic relationships of haemogregarines is still limited, which undermines the proposed systematic revision. Notably all the molecular evidence comes from a single gene, and many studies have shown that single gene trees often do not reflect species trees. Combined with doubts over the relationships of Hemolivia, the recent identification of a new lineage that could also warrant creation of a new genus and issues with the type species for Hepatozoon, we suggest that any taxonomic changes now would be premature. In our opinion, type species need to be assessed, sampling across hosts improved and multiple genes employed prior to taxonomic alterations. Otherwise taxonomic instability will be likely. Powered by Editorial Manager and ProduXion Manager from Aries Systems Corporation

2 Manuscript Click here to download Manuscript R2 AP doc docx RH: CRITICAL COMMENT..... COMMENTS ON THE SYSTEMATIC REVISION OF ADELEID HAEMOGREGARINES: IS MORE DATA NEEDED? João P. Maia*, Salvador Carranza, and D. James Harris* * CIBIO Research Centre in Biodiversity and Genetic Resources, InBIO, Universidade do Porto, Campus Agrário de Vairão, Rua Padre Armando Quintas, Nº 7, Vairão, Vila do Conde, Portugal. Correspondence should be sent to: james@cibio.up.pt ABSTRACT: Haemogregarines are a group of apicomplexan parasites composed of 3 families that infect a wide range of hosts. Many species within these families have been subjected to reclassifications and reassignments, especially since the use of molecular tools to estimate their phylogenetic relationships became more widespread. The 18S rrna gene has been the only widely used gene for studying the diversity of haemogregarines and recent phylogenetic analyses of this gene have indicated incongruences with the current taxonomy, such that a new genus Bartazoon has recently been proposed. To further investigate the current taxonomic situation we conducted an overview of all published 18S rrna sequence data for haemogregarines. We highlight that our understanding of the real diversity and phylogenetic relationships of haemogregarines is still limited, which undermines the proposed systematic revision. Notably all the molecular evidence comes from a single gene, and many studies have shown that single gene trees often do not reflect species trees. Combined with doubts over the relationships of Hemolivia, the recent identification of a new lineage that could also warrant creation of a new genus and issues with the type species for Hepatozoon, we suggest that any taxonomic changes now would be premature. In our opinion, type species need to be assessed, sampling across hosts improved and multiple genes employed prior to taxonomic alterations. Otherwise taxonomic instability will be likely.

3 Haemogregarines are cosmopolitan parasites that are known to infect a wide range of vertebrate host groups. Traditionally, these parasites were identified based on microscopy of sexual reproduction stages in the invertebrate host (Telford, 2009). However, diagnostic characters are often difficult to be identified by microscopy and the same parasite species may have different morphologies in different host species (Sloboda et al., 2007). This has led to the improper description of many parasite species in the past (Mathew et al., 2000) and for this reason this group has been subjected to many reclassifications and reassignments of species (Morsy et al., 2013; Abdel-Baki et al., 2014; Cook et al., 2014). The 18S rrna gene has been the only widely used marker for studying genetic variation of haemogregarines, and recent assessments have uncovered unexpectedly high levels of diversity (O Dwyer et al., 2013; Tomé et al., 2014, 2016; Harris et al., 2015). Haemogregarines are composed of the genera Hepatozoon (Hepatozoidae), Haemogregarina, Desseria and Cyrilia (Haemogregarinidae), Hemolivia and Karyolysus (Karyolysidae) (Smith and Desser, 1997; Telford, 2009). These are heteroxenous parasites that require more than 1 host to complete their life cycle, at least a vertebrate host in which asexual reproduction occurs and an invertebrate host in which sexual reproduction occurs. The genus Hepatozoon is the most commonly reported haemogregarine, which is reflected in the amount of genetic data available for this genus in comparison with the others. This genus was described from rats (Miller, 1908) but has been reported in all tetrapod orders and may be transmitted by a variety of possible vectors, including mosquitoes, ticks, mites and leeches (Smith, 1996). The genus Haemogregarina was the first haemogregarine described in reptiles, and includes the type species of the family Haemogregarinidae, which are transmitted by leeches (Telford, 2009). Recent phylogenetic studies have shown that this genus forms a well-defined cluster outside the Hepatozoon phylogeny

4 (Cook et al., 2014; Kvičerová et al., 2014; Dvořáková et al., 2015). The genus Hemolivia is mostly known from anurans and testudines but has also been reported in lizards (Smallridge and Bull, 2000), and is transmitted by ticks. Phylogenetic analyses indicate that Hemolivia may make Hepatozoon paraphyletic, although it was noted that this changed depending on the outgroup used (Harris et al., 2013; Kvičerová et al., 2014), and that there was no significant difference from the alternative hypothesis in which Hepatozoon was monophyletic (Kvičerová et al., 2014). The genus Karyolysus has been reported in saurian hosts and is transmitted by mites (Svahn, 1975; Telford, 2009). Phylogenies that include Karyolysus have found that samples identified as such form a sister lineage to Hepatozoon from carnivores (Haklová-Kočíková et al., 2014). Finally, the genera Desseria and Cyrilia have not yet been genetically characterized. Karadjian et al. (2015) recently proposed a systematic revision of the adeleid haemogregarines based on biological life cycles and phylogenetic reconstruction. Those specimens currently characterized genetically from carnivore hosts would remain as Hepatozoon, and this would be the sister group to Karyolysus that is found in reptile hosts. Hemolivia was identified as a sister group to a lineage of parasites identified from many different hosts, including birds, rodents, amphibians and reptiles, and these were all placed in a new genus, Bartazoon. To further assess this, we conducted an overview of all 18S rrna gene data available in public databases for haemogregarines. A total of 1,202 sequences were used (see Suppl. Table 1) and Dactylosoma ranarum sequences were designated as an outgroup following Barta et al. (2012). These were aligned using the software MAFFT v7 (Katoh and Standley, 2013) with the G-INS-1 progressive method and applying parameters by default (Gap opening penalty: 1.53, Offset value: 0.0). Phylogenetic inference was carried out with Maximum-likelihood (ML) using the software RAxML

5 v (Stamatakis, 2006), the GTR+Γ model of sequence evolution and 10 random addition replicates. The resulting tree was used to infer sequences that differed by less than 5 bp in order to reduce the dataset. The final dataset consisted of 297 sequences of different lengths (ranging from 387 bp to 1,578 bp) that were aligned using MAFFT with the Q-INS-i iterative method and applying parameters by default, which resulted in an alignment of 1,726 bp in length. RAxML was used to infer a ML phylogenetic tree with the GTR+Γ model of sequence evolution and 10 random addition replicates. Reliability of the ML tree was assessed by bootstrap analysis (Felsenstein, 1985) with 1,000 replications. Our phylogenetic analysis (Fig. 1 and Suppl. Fig. S1) shows that Hemolivia (Fig. 1C), and putative Hemolivia that were originally identified as Hepatozoon but which may have been incorrectly diagnosed (Kvičerová et al., 2014), forms a sister group to the lineage proposed as Bartazoon (Fig. 1D-H), as in (Kvičerová et al., 2014). Branch lengths are very short in our analysis but Bartazoon as defined by Karadjian et al. (2015) appears to be monophyletic. However, previous analyses show that this is not always the case, depending on the number of taxa and methods used (Maia et al., 2012; Tomé et al., 2016). The lineage proposed as Karyolysus (Fig. 1K) is sister taxon to the recently identified forms currently known only from gecko hosts (Fig. 1I, J) (Maia, 2015; Tomé et al., 2016), and all these together are a sister group to Hepatozoon from carnivores (Fig. 1L-P). Interestingly, lineage A is identified as Hepatozoon sp. in the GenBank database but we consider these putative Haemogregarina species from Spanish terrapins, although this warrants confirmation. Haemogregarina species (Fig. 1, Lineages A and B) form a strongly supported group as in previous studies (Dvořáková et al., 2014, 2015; Kvičerová et al., 2014; Karadjian et al., 2015).

6 There are of course many different approaches to phylogeny reconstruction. Alternative outgroups can be used, different methods and different strategies employed to deal with missing data. In order to incorporate more of the diversity, many of the specimens used in this study were of shorter fragments than those used in some other phylogenetic studies. We are not proposing that this analysis, despite including far more specimens, is by default an improvement on other phylogenetic analyses. We intend only to highlight 2 major points. The first is that, even assuming that the 18S rrna gene accurately reflects the species tree, the monophyly of the proposed new genera is not well supported. Secondly, recent sampling of haemogregarines from geckos has identified new lineages (I-J), sister group to the one proposed as Karyolysus (K). If this lineage is placed within Karyolysus, support for the unit as monophyletic will be low, and the characters proposed to define the genus may no longer be appropriate. If not, another new genus would need to be erected. Given the limited geographic and host sampling so far, how many other new genera will be needed in the future? Another issue arises regarding the type species of Hepatozoon. Karadjian et al. (2015) recognized that this "raises a real problem" since the type is Hepatozoon perniciosum which is considered to have an unusual mode of reproduction. It is possible that this is a valid reason to assume that, in the absence of genetic data, it will be related to Hepatozoon from carnivores (L-P). It is important to note however, that the vertebrate host for H. perniciosum is a rodent, and currently most Hepatozoon from rodents have been reassigned to Bartazoon (D-H). Additionally, the invertebrate host of the type species, the mite Laelaps echidninus, can also transmit Hepatozoon in squirrels (Clark, 1958). Hepatozoon from squirrels would also be reassigned to Bartazoon following the revision of Karadjian et al. (2015). A counter argument would be that it is possible that the available Hepatozoon sequences from rodent hosts are from haemogregarine species,

7 unrelated to H. perniciosum, which formed cysts in the muscles of these hosts. However, it has also been suggested that the original description of the life cycle of H. perniciosum, from Miller (1908) might have overlooked microgametes, and that if this was the case the life cycle would actually be very similar to that in other rodents (Furman, 1966). There is therefore an alternative hypothesis that it is likely that H. perniciosum will eventually be phylogenetically more closely related to other Hepatozoon from rodents (Lineage H), which would mean that this lineage (and eventually Bartazoon as currently proposed) would have to remain as Hepatozoon, and rather the lineage of parasites found in carnivores (L-P) would need to be renamed. Given these arguments, we suggest that it is still premature to formerly name distinct lineages. We recognize that systematic changes are needed, but it seems clear that taxonomic instability will be increased if these changes are made now, something that should be avoided under the ICZN rules (Vences et al., 2013). We prefer to refer to "lineages" pending data from both additional genes (eg. cytochrome c oxidase subunit I, cytochrome c oxidase subunit III, and cytochrome B (Leveille et al., 2014)) and increased sampling across host groups, and particularly the inclusion of examples from Desseria and Cyrilia. Further assessments of the type species are also needed. While we applaud Karadjian et al. (2015) for highlighting the need for a systematic revision, we argue that delaying this until new data is available would be preferable in the long term. JPM was funded through a Ph.D. grant (SFRH/BD/74305/2010) supported by a Fundação para a Ciência e a Tecnologia (FCT) doctoral fellowship under the Programa Operacional Potencial Humano Quadro de Referência Estratégico Nacional funds (POPH-QREN) from the European Social Fund (ESF) and Portuguese Ministério da Educação e Ciência. DJH is supported by FEDER through the compete program, the project Genomics and Evolutionary Biology cofinanced by North Portugal Regional

8 Operational Program (ON.2) under NSRF through the European Regional Development Fund. SC is supported by grant CGL P from the Ministerio de Economía y Competitividad, Spain (cofunded by FEDER). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. LITERATURE CITED Abdel-Baki, A.-A. S., S. Al-Quraishy, and J. Y. Zhang Redescription of Haemogregarina garnhami (Apicomplexa: Adeleorina) from the blood of Psammophis schokari (Serpentes: Colubridae) as Hepatozoon garnhami n. comb. based on molecular, morphometric and morphologic characters. Acta Parasitologica 59: Barta, J. R., J. D. Ogedengbe, D. S. Martin, and T. G. Smith Phylogenetic position of the adeleorinid coccidia (Myzozoa, Apicomplexa, Coccidia, Eucoccidiorida, Adeleorina) inferred using 18S rdna sequences. Journal of Eukaryotic Microbiology 59: Clark, G. M Hepatozoon griseisciuri n. sp.; a new species of Hepatozoon from the grey squirrel (Sciurus carolinensis Gmelin, 1788), with studies on the life cycle. Journal of Parasitology 44: Cook, C. A., S. P. Lawton, A. J. Davies, and N. J. Smit Reassignment of the land tortoise haemogregarine Haemogregarina fitzsimonsi Dias 1953 (Adeleorina: Haemogregarinidae) to the genus Hepatozoon Miller 1908 (Adeleorina: Hepatozoidae) based on parasite morphology, life cycle and phylogenetic analysis of 18S. Parasitology 1953: Dvořáková, N., J. Kvičerová, M. Hostovský, and P. Široký Haemogregarines of freshwater turtles from Southeast Asia with a description of Haemogregarina sacaliae sp. n. and a redescription of Haemogregarina pellegrini Laveran and Pettit, Parasitology 142:

9 Dvořáková, N., J. Kvičerová, I. Papoušek, H. Javanbakht, G. Tiar, H. Kami, and P. Široký Haemogregarines from western Palaearctic freshwater turtles (genera Emys, Mauremys) are conspecific with Haemogregarina stepanowi Danilewsky, Parasitology 141: Felsenstein, J Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39: Furman, D. P Hepatozoon balfouri (Laveran, 1905): sporogonic cycle, pathogenesis, and transmission by mites to jerboa hosts. Journal of Parasitology 52: Haklová-Kočíková, B., A. Hižňanová, I. Majláth, K. Račka, D. J. Harris, G. Földvári, P. Tryjanowski, N. Kokošová, B. Malčeková, and V. Majláthová Morphological and molecular characterization of Karyolysus a neglected but common parasite infecting some European lizards. Parasites & Vectors 7: 555. Harris, D. J., D. M. Borges-Nojosa, and J. P. Maia Prevalence and diversity of Hepatozoon in native and exotic geckos from Brazil. Journal of Parasitology 101: Harris, D. J., E. Graciá, F. Jorge, J. P. M. C. Maia, A. Perera, M. A. Carretero, and A. Giménez Molecular detection of Hemolivia (Apicomplexa: Haemogregarinidae) from ticks of North African Testudo graeca (Testudines: Testudinidae) and an estimation of their phylogenetic relationships using 18S rrna sequences. Comparative Parasitology 80: Karadjian, G., J.-M. Chavatte, and I. Landau Systematic revision of the adeleid haemogregarines, with creation of Bartazoon n. g., reassignment of Hepatozoon argantis Garnham, 1954 to Hemolivia, and molecular data on Hemolivia stellata. Parasite 22: 31.

10 Katoh, K., and D. M. Standley MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular biology and evolution 30: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with tangled evolutionary relationships. Protist 165: Leveille, A. N., M. E. Ogedengbe, M. A. Hafeez, H.-H. A. Tu and J. R. Barta The complete mitochondrial genome sequence of Hepatozoon catesbianae (Apicomplexa; Coccidia; Adeleorina), a blood parasite of the Green frog, Lithobates (formerly Rana) clamitans. Journal of Parasitology 100: Maia, J. P. M. C., A. Perera, and D. J. Harris Molecular survey and microscopic examination of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina) in lacertid lizards from the Maia, J. P., D. J. Harris, S. Carranza, and E. Goméz-Díaz. Accepted. Assessing the diversity, host-specificity and infection patterns of apicomplexan parasites in reptiles from Oman, Arabia. Parasitology Mathew, J. S., R. A. Van Den Bussche, S. A. Ewing, J. R. Malayer, B. R. Latha, and R. J. Panciera Phylogenetic relationships of Hepatozoon (Apicomplexa: Adeleorina) based on molecular, morphologic, and life-cycle characters. Journal of Parasitology 86: Miller, W. W Hepatozoon perniciosum n. g., n. sp., a haemogregarine pathogenic for white rats; with a brief description of the sexual cycle in the intermediate host, a mite (Laelaps echidninus Berlese). Bulletin of the Hygiene Laboratory of Washington 46: Morsy, K., A. R. Bashtar, F. A. Ghaffar, S. Al Quraishy, S. Al Hashimi, A. Al Ghamdi,

11 and M. Shazly Developmental stages of Hepatozoon seurati (Laveran and Pettit 1911) comb. nov., a parasite of the corned viper Cerastes cerastes and the mosquito Culex pipiens from Egypt. Parasitology Research 112: O Dwyer, L. H., T. C. Moço, K. D. S. Paduan, C. Spenassatto, R. J. da Silva, and P. E. M. Ribolla Description of three new species of Hepatozoon (Apicomplexa, Hepatozoidae) from Rattlesnakes (Crotalus durissus terrificus) based on molecular, morphometric and morphologic characters. Experimental Parasitology 135: Sloboda, M., M. Kamler, J. Bulantová, J. Votýpka, and D. Modrý A new species of Hepatozoon (Apicomplexa: Adeleorina) from Python regius (Serpentes: Pythonidae) and its experimental transmission by a mosquito vector. Journal of Parasitology 93: Smallridge, C. J., and C. M. Bull Prevalence and intensity of the blood parasite Hemolivia mariae in a field population of the skink Tiliqua rugosa. Parasitology Research 86: Smith, T. G The genus Hepatozoon (Apicomplexa: Adeleina). Journal of Parasitology 82: Smith, T. G., and S. S. Desser Phylogenetic analysis of the genus Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina). Systematic Parasitology 36: Stamatakis, A RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics (Oxford, England) 22: Svahn, K Blood parasites of the genus Karyolysus (Coccidia, Adeleidae) in Scandinavian lizards. Norwegian Journal of Zoology 23: Telford, S. R Hemoparasites of the reptilia. CRC Press, Taylor and Francis Group, Boca Raton, Florida, 394 p.

12 Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. A. Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. Journal of Parasitology. (In Press). Vences, M., J. M. Guayasamin, A. Miralles, and I. De La Riva To name or not to name: Criteria to promote economy of change in Linnaean classification schemes. Zootaxa 3636: Figure 1. Tree derived from a Maximum Likelihood analysis of a representative set of haemogregarine 18S rrna gene sequences available on GenBank (see Table S1 for more details). Bootstrap values for Maximum Likelihood above 70% are given. Dashed lines indicate the new systematic revision proposed by Karadjian et al. (2015). Departamento de Biologia, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre FC Porto, Portugal. Institute of Evolutionary Biology (CSIC-Universitat Pompeu Fabra). Passeig Marítim de la Barceloneta, Barcelona. Spain.

13 Figure1 Click here to download Figure R1_fig1.tif

14 A n=2 100 HQ HQ KR KJ KM Supplemental 100Material 85 HQ Figure S1 KF KM B n=12 76 KF KF KP JQ KF KC KR EU C n=26 JN KF GU KF FJ D n=2 EU EF EF E n=19 KJ KC KM KC JQ KR JF JQ F n=17 KM KM JN HQ KP KF KP AF HQ AF HQ KC JF KM KC KC KC HQ KJ KC AY HM AY AY KF KJ KJ AF KC JQ KJ KJ KJ KJ KJ KC JX KJ KJ KJ KJ HM EU EU AY AY S7134 S6045 KM KC KC HQ HQ KU HQ HQ KU H n= KC KC HM KM KF HQ AY HM S7101 EF JF KC KC HQ S7542 KU KU JQ CN3768 KC KJ KM FJ FJ EF FJ KM AB KJ JF KJ CN205 EF KT KT EF AY KF AY JX JX S S S7154 I n=3 99 S7077 KU KU KU KU KU J n=13 KU HQ EU KJ KJ HQ KJ JX KC HQ HQ K n=157 JX KU KJ HQ JX JX JF KF LC KM KP AB FJ FJ AB AB AB AB L n=145 AB AB AB AB AB AB JF AB KF KF KF KF KF KF KF KF JN GQ KJ HQ M n=32 KF AY AB AB AB AB AB AB AB EU KC FJ EF FJ FJ N n=25 FJ FJ JX KC JF KF JX JX AY KC JX AF JX KF O n=42 KF JX EU EU AY JX KF KF KJ GU KP FJ FJ JX KT DQ DQ EU AB KT KT LC KF DQ DQ DQ DQ KP JX KT LC KT GU KT subs/site DQ JX JQ DQ FJ KP JX JX KM KM EU JF KP KM KM KF GU KJ KJ JN FJ KJ FJ KF KM AY EF JX DQ CRITICAL COMMENT..... DQ KT COMMENTS ON THE SYSTEMATIC REVISION OF KT KT KT ADELEID HAEMOGREGARINES: IS MORE DATA NEEDED? KT KT João P. Maia, Salvador Carranza, and D. James Harris KT KT Journal of Parasitology KT KT KT KT Figure S1 - Tree derived from a Maximum Likelihood analysis of a representative KT KT set of hemogregarine 18S rrna gene sequences available on GenBank (see Table S1 for more details) KT KT Click Haemogregarina here to download Supplemental Material 15- Hemolivia G n=39 P n=389 Proposed as Bartazoon (Karadjian et al. 2015) Karyolysus Hepatozoon

15 Supplemental Material Table S1 Click here to download Supplemental Material R1_tableS1.xlsx CRITICAL COMMENT..... COMMENTS ON THE SYSTEMATIC REVISION Table S1 Details for each sequence downloaded from GenBank for an overview o Genbank Length (bp) Final-alignment Lineage Parasite species HQ HQ _outgroup Dactylosoma ranarum HQ HQ _outgroup Dactylosoma ranarum HQ224961* 1649 HQ _outgroup Hemolivia mariae KJ KJ A Hepatozoon sp. KR KR A Haemogregarina sp. HQ HQ B Haemogregarina balli KF KF B Haemogregarina sp. KF KF B Haemogregarina sp. KF KF B Haemogregarina sp. KF KF B Haemogregarina stepanowi KF KF B Haemogregarina stepanowi KF KF B Haemogregarina stepanowi KF KF B Haemogregarina stepanowi KF KF B Haemogregarina stepanowi KM KM B Haemogregarina sacaliae KM KM B Haemogregarina pellegrini KM KM B Haemogregarina pellegrini EU EU C Hepatozoon sp. EU EU C Hepatozoon sp. EU EU C Hepatozoon sp. JN JN C Hemolivia mariae JQ JQ C Hepatozoon sp. KC KC C Hemolivia sp. KF KC C Hemolivia mauritanica KF KC C Hemolivia mauritanica KF KC C Hemolivia mauritanica KF KC C Hemolivia mauritanica KF KC C Hemolivia mauritanica KF KC C Hemolivia mauritanica KF KC C Hemolivia mauritanica KF KC C Hemolivia mauritanica KF KC C Hemolivia mauritanica KF KC C Hemolivia mauritanica KF KC C Hemolivia mauritanica KF KC C Hemolivia mauritanica KF KC C Hemolivia mauritanica KF KF C Hemolivia mariae KF KF C Hemolivia mariae KF KF C Hemolivia sp. KF KF C Hemolivia sp. KP KP C Hemolivia stellata KR KR C Hemolivia parvula KR KR C Hemolivia parvula GU GU D Hepatozoon sp. KF KF D Hepatozoon sp. EF EF E Hepatozoon sp. EF EF E Hepatozoon sp. EF EF E Hepatozoon sp. EF EF E Hepatozoon sp. EF EF E Hepatozoon sp. EF EF E Hepatozoon sp. EF EF E Hepatozoon sp. EF EF E Hepatozoon sp.

16 EF EF E Hepatozoon sp. EF EF E Hepatozoon sp. EF EF E Hepatozoon sp. EF EF E Hepatozoon sp. EF EF E Hepatozoon sp. EU EU E Hepatozoon sp. EU EU E Hepatozoon sp. EU EU E Hepatozoon sp. EU EU E Hepatozoon sp. FJ FJ E Hepatozoon sp. FJ FJ E Hepatozoon sp. JF JF F Hepatozoon sp. JN JN F Hepatozoon sipedon*** JQ JQ F Hepatozoon sp. JQ JQ F Hepatozoon sp. KC KC F Hepatozoon massardii KC KC F Hepatozoon cevapii KC KC F Hepatozoon massardii KJ KJ F Hepatozoon sp. KJ KJ F Hepatozoon sp. KJ KJ F Hepatozoon sp. KM KM F Hepatozoon sp. KM KM F Hepatozoon sp. KM KM F Hepatozoon sp. KJ KR F Hepatozoon fitzsimonsi KJ KR F Hepatozoon sp. KR KR F Hepatozoon fitzsimonsi KT KR F Hepatozoon fitzsimonsi AF AF G Hepatozoon catesbianae AF AF G Hepatozoon catesbianae HQ AF G Hepatozoon cf. clamatae HQ HQ G Hepatozoon cf. catesbianae HQ HQ G Hepatozoon magna HQ HQ G Hepatozoon cf. clamatae Bf1 599 KF G Hepatozoon sp. Bf KF G Hepatozoon sp. Bf KF G Hepatozoon sp. Bf KF G Hepatozoon sp. Bf KF G Hepatozoon sp. Bf KF G Hepatozoon sp. Bf KF G Hepatozoon sp. Bf KF G Hepatozoon sp. Bf KF G Hepatozoon sp. Bf KF G Hepatozoon sp. Bf KF G Hepatozoon sp. Bf KF G Hepatozoon sp. Bf KF G Hepatozoon sp. Bf KF G Hepatozoon sp. Bf6 599 KF G Hepatozoon sp. Bf7 599 KF G Hepatozoon sp. KF KF G Hepatozoon sp. Bf KP G Hepatozoon sp. Bf KP G Hepatozoon sp. Bf KP G Hepatozoon sp. Bf KP G Hepatozoon sp. Bf2 598 KP G Hepatozoon sp. Bf KP G Hepatozoon sp.

17 Bf KP G Hepatozoon sp. Bf3 597 KP G Hepatozoon sp. Bf4 597 KP G Hepatozoon sp. Bf5 595 KP G Hepatozoon sp. Bf8 594 KP G Hepatozoon sp. KP KP G Hepatozoon ixoxo KP KP G Hepatozoon ixoxo KP KP G Hepatozoon ixoxo KJ KP G Hepatozoon theileri KP KP G Hepatozoon theileri AB AB H Hepatozoon sp. AF AF H Hepatozoon sp. AY AY H Hepatozoon sp. AY AY H Hepatozoon sp. AY AY H Hepatozoon sp. AY AY H Hepatozoon sp. AY AY H Hepatozoon sp. AY AY H Hepatozoon sp. AY AY H Hepatozoon sp. AY AY H Hepatozoon sp. AY AY H Hepatozoon sp. AY AY H Hepatozoon sp. FJ AY H Hepatozoon sp. FJ AY H Hepatozoon sp. HM AY H Hepatozoon sp. AY AY H Hepatozoon sp. JQ AY H Hepatozoon sp. JX AY H Hepatozoon sp. KF AY H Hepatozoon erhardovae KJ AY H Hepatozoon erhardovae CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN205 H Hepatozoon sp. CN CN3768 H Hepatozoon sp. EF EF H Hepatozoon sp. EF EF H Hepatozoon ayorgbor KJ EF H Hepatozoon sp. EF EF H Hepatozoon sp. EF EF H Hepatozoon sp. EU EU H Hepatozoon sp. EU EU H Hepatozoon sp. HM EU H Hepatozoon sp.

18 HM EU H Hepatozoon sp. HM EU H Hepatozoon sp. HM EU H Hepatozoon sp. HM EU H Hepatozoon sp. HM EU H Hepatozoon sp. HQ EU H Hepatozoon sp. HQ EU H Hepatozoon sp. JQ EU H Hepatozoon sp. KF EU H Hepatozoon sp. KF EU H Hepatozoon sp. KF EU H Hepatozoon sp. KF EU H Hepatozoon sp. KF EU H Hepatozoon sp. KF EU H Hepatozoon sp. KF EU H Hepatozoon sp. KF EU H Hepatozoon sp. KF EU H Hepatozoon sp. EU EU H Hepatozoon sp. FJ FJ H Hepatozoon sp. FJ FJ H Hepatozoon sp. KP FJ H Hepatozoon sp. FJ FJ H Hepatozoon sp. FJ FJ H Hepatozoon sp. FJ FJ H Hepatozoon sp. HM HM H Hepatozoon sp. HM HM H Hepatozoon sp. EF HM H Hepatozoon sp. HM HM H Hepatozoon sp. HM HM H Hepatozoon sp. HQ HQ H Hepatozoon sp. HQ HQ H Hepatozoon sp. HQ HQ H Hepatozoon sp. HQ HQ H Hepatozoon sp. HQ HQ H Hepatozoon sp. KC HQ H Hepatozoon sp. HQ HQ H Hepatozoon sp. HQ HQ H Hepatozoon sp. HQ HQ H Hepatozoon sp. HQ HQ H Hepatozoon sp. HQ HQ H Hepatozoon sp. HQ HQ H Hepatozoon sp. HQ HQ H Hepatozoon sp. HQ HQ H Hepatozoon sp. JX HQ H Hepatozoon sp. KC HQ H Hepatozoon sp. KJ HQ H Hepatozoon sp. HQ HQ H Hepatozoon sp. JX HQ H Hepatozoon sp. KJ HQ H Hepatozoon sp. KJ HQ H Hepatozoon sp. KJ HQ H Hepatozoon sp. KJ HQ H Hepatozoon sp. JF JF H Hepatozoon sp. JF JF H Hepatozoon sp. JF JF H Hepatozoon sp. JF JF H Hepatozoon sp. JQ JQ H Hepatozoon sp.

19 JQ JQ H Hepatozoon sp. KF JQ H Hepatozoon sp. JF JQ H Hepatozoon sp. JQ JQ H Hepatozoon garnhami JX JX H Hepatozoon sp. JX JX H Hepatozoon sp. KJ JX H Hepatozoon sp. JX JX H Hepatozoon sp. KC KC H Hepatozoon sp. KC KC H Hepatozoon cuestensis KC KC H Hepatozoon cuestensis KC KC H Hepatozoon cuestensis KC KC H Hepatozoon cuestensis KC KC H Hepatozoon sp. KC KC H Hepatozoon sp. KC KC H Hepatozoon sp. KR KC H Hepatozoon sp. KR KC H Hepatozoon sp. KC KC H Hepatozoon sp. KC KC H Hepatozoon sp. KC KC H Hepatozoon sp. KC KC H Hepatozoon sp. KJ KC H Hepatozoon sp. KJ KC H Hepatozoon sp. KC KC H Hepatozoon sp. KC KC H Hepatozoon sp. KC KC H Hepatozoon sp. KC KC H Hepatozoon sp. JF KC H Hepatozoon sp. KC KC H Hepatozoon sp. KF KF H Hepatozoon seychellensis KF KF H Hepatozoon seychellensis KF KF H Hepatozoon erhardovae KF KF H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp.

20 KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. JF KJ H Hepatozoon sp. JX KJ H Hepatozoon sp. KC KJ H Hepatozoon sp. KC KJ H Hepatozoon sp. KC KJ H Hepatozoon sp. KF KJ H Hepatozoon sp. KF KJ H Hepatozoon sp. KF KJ H Hepatozoon sp. KF KJ H Hepatozoon sp. KF KJ H Hepatozoon sp. KF KJ H Hepatozoon sp. KF KJ H Hepatozoon sp. KF KJ H Hepatozoon sp. KF KJ H Hepatozoon sp. KF KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KM KJ H Hepatozoon sp. KJ KJ H Hepatozoon sp. KM KM H Hepatozoon sp. KM KM H Hepatozoon sp. KM KM H Hepatozoon sp. KM KM H Hepatozoon sp. KM KM H Hepatozoon domerguei KM KM H Hepatozoon domerguei KM KM H Hepatozoon domerguei KM KM H Hepatozoon sp. KT KT H Hepatozoon sp. KT KT H Hepatozoon sp. KT KT H Hepatozoon sp. KT KT H Hepatozoon sp. KT KT H Hepatozoon sp. KT KT H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp.

21 KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. KU KU H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S6045 H Hepatozoon sp. S S7101 H Hepatozoon sp. CN S7134 H Hepatozoon sp. S S7134 H Hepatozoon sp. S S7134 H Hepatozoon sp.

22 S S7542 H Hepatozoon sp. S S6061 I unidentified Haemogregarinidae S S7154 I unidentified Haemogregarinidae S S7336 I unidentified Haemogregarinidae KU KU J unidentified Haemogregarinidae KU KU J unidentified Haemogregarinidae KU KU J unidentified Haemogregarinidae KU KU J unidentified Haemogregarinidae KU KU J unidentified Haemogregarinidae KU KU J unidentified Haemogregarinidae KU KU J unidentified Haemogregarinidae KU KU J unidentified Haemogregarinidae KU KU J unidentified Haemogregarinidae KU KU J unidentified Haemogregarinidae KU KU J unidentified Haemogregarinidae KU KU J unidentified Haemogregarinidae S S7077 J unidentified Haemogregarinidae EU EU K Hepatozoon sp. HQ HQ K Hepatozoon sp. HQ HQ K Hepatozoon sp. HQ HQ K Hepatozoon sp. HQ HQ K Hepatozoon sp. HQ HQ K Hepatozoon sp. JQ HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. HQ HQ K Hepatozoon sp. HQ HQ K Hepatozoon sp. HQ HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. KF HQ K Hepatozoon sp. HQ HQ K Hepatozoon sp. HQ HQ K Hepatozoon sp. HQ HQ K Hepatozoon sp. HQ HQ K Hepatozoon sp. HQ HQ K Hepatozoon sp. HQ HQ K Hepatozoon sp. HQ HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp.

23 JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX HQ K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JQ JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JQ JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. KJ JX K Hepatozoon sp. JX JX K Hepatozoon sp.

24 JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. JX JX K Hepatozoon sp. CN KC K Hepatozoon sp. CN KC K Hepatozoon sp. JX KC K Hepatozoon sp. KC KC K Hepatozoon sp. KJ KC K Hepatozoon sp. KJ KC K Hepatozoon sp. KJ KC K Hepatozoon sp. KJ KC K Hepatozoon sp. JX KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Hepatozoon sp. KJ KJ K Karyolysus latus KJ KJ K Karyolysus lacazei KJ KJ K Karyolysus sp. KJ KJ K Karyolysus lacazei KJ KJ K Karyolysus lacazei KJ KJ K Karyolysus sp.

25 KJ KJ K Karyolysus sp. KJ KJ K Karyolysus sp. KU KU K Hepatozoon sp. AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis GQ AB L Hepatozoon sp. AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis

26 AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis

27 AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis AB AB L Hepatozoon felis FJ FJ L Hepatozoon sp. FJ FJ L Hepatozoon sp. JF JF L Hepatozoon sp. JF JF L Hepatozoon sp. KF KF L Hepatozoon sp. KF KF L Hepatozoon sp. KM KM L Hepatozoon felis KP KP L Hepatozoon sp. JQ LC L Hepatozoon sp. KF LC L Hepatozoon sp. LC LC L Hepatozoon sp. AB AB M Hepatozoon sp. AB AB M Hepatozoon sp. AB AB M Hepatozoon sp. AB AB M Hepatozoon sp. AB AB M Hepatozoon sp. AB AB M Hepatozoon sp. AB AB M Hepatozoon sp. AB AB M Hepatozoon sp. AY AY M Hepatozoon felis AY AY M Hepatozoon felis JN EU M Hepatozoon felis GQ GQ M Hepatozoon sp. HQ HQ M Hepatozoon felis HQ HQ M Hepatozoon felis JN JN M Hepatozoon felis KF KF M Hepatozoon sp. KF KF M Hepatozoon sp. EF KF M Hepatozoon sp. KC KF M Hepatozoon sp. KC KF M Hepatozoon sp. KF KF M Hepatozoon sp. KF KF M Hepatozoon sp. KF KF M Hepatozoon sp.

28 KF KF M Hepatozoon sp. KF KF M Hepatozoon sp. KF KF M Hepatozoon sp. KF KF M Hepatozoon sp. KF KF M Hepatozoon sp. KF KF M Hepatozoon sp. KF KF M Hepatozoon sp. KF KF M Hepatozoon sp. KJ KJ M Hepatozoon sp. KJ KJ M Hepatozoon sp. EF EF N Hepatozoon sp. EU EF N Hepatozoon sp. AB EU N Hepatozoon sp. EU EU N Hepatozoon sp. EU EU N Hepatozoon sp. HQ EU N Hepatozoon sp. HQ EU N Hepatozoon sp. HQ EU N Hepatozoon sp. HQ EU N Hepatozoon sp. HQ EU N Hepatozoon sp. HQ EU N Hepatozoon sp. HQ EU N Hepatozoon sp. HQ EU N Hepatozoon sp. HQ EU N Hepatozoon sp. FJ FJ N Hepatozoon sp. FJ FJ N Hepatozoon sp. FJ FJ N Hepatozoon sp. FJ FJ N Hepatozoon sp. FJ FJ N Hepatozoon sp. FJ FJ N Hepatozoon sp. FJ FJ N Hepatozoon sp. FJ FJ N Hepatozoon sp. JX JX N Hepatozoon sp. KC KC N Hepatozoon sp. KC KC N Hepatozoon sp. AF AF O Hepatozoon americanum AY AY O Hepatozoon sp. AY AY O Hepatozoon sp. JX AY O Hepatozoon americanum EU EU O Hepatozoon sp. EU EU O Hepatozoon sp. EU EU O Hepatozoon sp. EU EU O Hepatozoon americanum EU EU O Hepatozoon americanum EU EU O Hepatozoon americanum JF EU O Hepatozoon sp. JF EU O Hepatozoon sp. JF EU O Hepatozoon sp. JF EU O Hepatozoon sp. JX EU O Hepatozoon americanum JX EU O Hepatozoon americanum JX EU O Hepatozoon americanum JF JF O Hepatozoon sp. JF JF O Hepatozoon sp. JF JF O Hepatozoon sp. JF JF O Hepatozoon sp. JX JX O Hepatozoon americanum

29 JX JX O Hepatozoon americanum JX JX O Hepatozoon americanum JX JX O Hepatozoon americanum JX JX O Hepatozoon americanum JX JX O Hepatozoon americanum JF JX O Hepatozoon sp. JX JX O Hepatozoon americanum JF JX O Hepatozoon sp. JF JX O Hepatozoon sp. JX JX O Hepatozoon sp. JX JX O Hepatozoon sp. JX JX O Hepatozoon sp. JX JX O Hepatozoon sp. JX JX O Hepatozoon sp. JX JX O Hepatozoon sp. JX JX O Hepatozoon sp. KC KC O Hepatozoon sp. KF KF O Hepatozoon sp. KF KF O Hepatozoon sp. KF KF O Hepatozoon sp. AB AB P Hepatozoon canis GQ AB P Hepatozoon canis AF AY P Hepatozoon sp. AY AY P Hepatozoon canis AY AY P Hepatozoon canis AY AY P Hepatozoon canis AY AY P Hepatozoon sp. AY AY P Hepatozoon sp. AY AY P Hepatozoon sp. DQ AY P Hepatozoon canis DQ AY P Hepatozoon canis EU AY P Hepatozoon canis FJ AY P Hepatozoon canis FJ AY P Hepatozoon canis FJ AY P Hepatozoon canis GQ AY P Hepatozoon canis GU AY P Hepatozoon canis GU AY P Hepatozoon canis GU AY P Hepatozoon canis GU AY P Hepatozoon canis GU AY P Hepatozoon canis GU AY P Hepatozoon canis HQ AY P Hepatozoon canis JF AY P Hepatozoon canis JX AY P Hepatozoon canis KC AY P Hepatozoon canis KC AY P Hepatozoon canis KC AY P Hepatozoon canis KC AY P Hepatozoon canis KC AY P Hepatozoon canis KC AY P Hepatozoon canis KC AY P Hepatozoon canis KC AY P Hepatozoon canis KC AY P Hepatozoon canis KC AY P Hepatozoon canis KC AY P Hepatozoon canis KC AY P Hepatozoon canis

30 KC AY P Hepatozoon canis KC AY P Hepatozoon canis KC AY P Hepatozoon canis KC AY P Hepatozoon canis KF AY P Hepatozoon canis KF AY P Hepatozoon canis KF AY P Hepatozoon canis KF AY P Hepatozoon canis KJ AY P Hepatozoon sp. KJ AY P Hepatozoon sp. KJ AY P Hepatozoon sp. KJ AY P Hepatozoon sp. KJ AY P Hepatozoon sp. KJ AY P Hepatozoon sp. KJ AY P Hepatozoon sp. KJ AY P Hepatozoon canis KJ AY P Hepatozoon canis KM AY P Hepatozoon canis KM AY P Hepatozoon canis KM AY P Hepatozoon canis KM AY P Hepatozoon canis KM AY P Hepatozoon canis KM AY P Hepatozoon canis KM AY P Hepatozoon canis KM AY P Hepatozoon canis KM AY P Hepatozoon canis KM AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis

31 KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis KP AY P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis KJ DQ P Hepatozoon sp. KJ DQ P Hepatozoon sp. KJ DQ P Hepatozoon sp. DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis AY DQ P Hepatozoon canis AY DQ P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis JF DQ P Hepatozoon canis JF DQ P Hepatozoon canis JF DQ P Hepatozoon canis JN DQ P Hepatozoon canis JN DQ P Hepatozoon canis JQ DQ P Hepatozoon canis JX DQ P Hepatozoon canis KF DQ P Hepatozoon sp. KJ DQ P Hepatozoon sp. KJ DQ P Hepatozoon sp. KJ DQ P Hepatozoon sp. KJ DQ P Hepatozoon sp. KJ DQ P Hepatozoon sp. KJ DQ P Hepatozoon canis KJ DQ P Hepatozoon canis KJ DQ P Hepatozoon canis KJ DQ P Hepatozoon canis KJ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis DQ DQ P Hepatozoon canis AY EF P Hepatozoon canis DQ EF P Hepatozoon canis DQ EF P Hepatozoon canis EF EF P Hepatozoon canis EU EU P Hepatozoon canis

32 AF EU P Hepatozoon canis EU EU P Hepatozoon canis HQ EU P Hepatozoon canis HQ EU P Hepatozoon canis JF EU P Hepatozoon canis JN EU P Hepatozoon canis JN EU P Hepatozoon canis JQ EU P Hepatozoon canis JQ EU P Hepatozoon canis JQ EU P Hepatozoon canis JQ EU P Hepatozoon canis JQ EU P Hepatozoon canis KC EU P Hepatozoon canis KF EU P Hepatozoon canis KF EU P Hepatozoon canis KF EU P Hepatozoon canis KF EU P Hepatozoon canis KF EU P Hepatozoon canis KJ EU P Hepatozoon canis KJ EU P Hepatozoon canis KP EU P Hepatozoon canis KP EU P Hepatozoon canis KP EU P Hepatozoon canis KP EU P Hepatozoon canis KP EU P Hepatozoon canis KP EU P Hepatozoon canis KP EU P Hepatozoon canis KT EU P Hepatozoon canis KT EU P Hepatozoon canis KT EU P Hepatozoon canis KT EU P Hepatozoon canis LC EU P Hepatozoon canis LC EU P Hepatozoon canis LC EU P Hepatozoon canis LC EU P Hepatozoon canis LC EU P Hepatozoon canis LC EU P Hepatozoon canis LC EU P Hepatozoon canis LC EU P Hepatozoon canis LC EU P Hepatozoon canis LC EU P Hepatozoon canis LC EU P Hepatozoon canis LC EU P Hepatozoon canis FJ FJ P Hepatozoon canis FJ FJ P Hepatozoon canis FJ FJ P Hepatozoon canis FJ FJ P Hepatozoon canis DQ FJ P Hepatozoon canis DQ FJ P Hepatozoon canis FJ FJ P Hepatozoon canis FJ FJ P Hepatozoon canis KF FJ P Hepatozoon canis KJ FJ P Hepatozoon sp. KJ FJ P Hepatozoon sp. KJ FJ P Hepatozoon sp.

33 KJ FJ P Hepatozoon sp. KJ FJ P Hepatozoon sp. KJ FJ P Hepatozoon sp. KJ FJ P Hepatozoon sp. KJ FJ P Hepatozoon sp. KJ FJ P Hepatozoon canis FJ FJ P Hepatozoon canis FJ FJ P Hepatozoon canis FJ FJ P Hepatozoon canis HM FJ P Hepatozoon canis KJ FJ P Hepatozoon canis GU GU P Hepatozoon canis GU GU P Hepatozoon canis GU GU P Hepatozoon canis GU GU P Hepatozoon canis GU GU P Hepatozoon canis GU GU P Hepatozoon canis GU GU P Hepatozoon canis GU GU P Hepatozoon canis JF JF P Hepatozoon sp. JN JN P Hepatozoon canis JQ JQ P Hepatozoon canis JQ JQ P Hepatozoon canis JQ JQ P Hepatozoon canis JQ JQ P Hepatozoon canis JQ JQ P Hepatozoon canis JQ JQ P Hepatozoon canis JX JQ P Hepatozoon canis JX JQ P Hepatozoon canis JX JQ P Hepatozoon canis JX JQ P Hepatozoon canis JX JQ P Hepatozoon canis JX JQ P Hepatozoon canis JX JQ P Hepatozoon canis JX JX P Hepatozoon canis JX JX P Hepatozoon canis KF JX P Hepatozoon canis KF JX P Hepatozoon canis KF JX P Hepatozoon canis KF JX P Hepatozoon canis KF JX P Hepatozoon canis EU JX P Hepatozoon sp. EU JX P Hepatozoon sp. JX JX P Hepatozoon canis JX JX P Hepatozoon canis KF JX P Hepatozoon canis KF JX P Hepatozoon canis JX JX P Hepatozoon canis JX JX P Hepatozoon canis KF JX P Hepatozoon canis JX JX P Hepatozoon canis KF KF P Hepatozoon sp. KF KF P Hepatozoon sp. KF KF P Hepatozoon canis KF KF P Hepatozoon canis KF KF P Hepatozoon canis KM KF P Hepatozoon canis

34 KJ KJ P Hepatozoon sp. KJ KJ P Hepatozoon sp. KJ KJ P Hepatozoon sp. KJ KJ P Hepatozoon sp. KJ KJ P Hepatozoon sp. KJ KJ P Hepatozoon sp. KJ KJ P Hepatozoon sp. KJ KJ P Hepatozoon sp. KJ KJ P Hepatozoon sp. KJ KJ P Hepatozoon sp. KJ KJ P Hepatozoon sp. KJ KJ P Hepatozoon sp. KJ KJ P Hepatozoon sp. KJ KJ P Hepatozoon canis JF KJ P Hepatozoon canis KJ KJ P Hepatozoon canis KJ KJ P Hepatozoon canis KM KM P Hepatozoon canis KM KM P Hepatozoon canis KP KM P Hepatozoon canis KM KM P Hepatozoon canis KM KM P Hepatozoon canis KM KM P Hepatozoon canis KP KP P Hepatozoon canis FJ KP P Hepatozoon canis FJ KP P Hepatozoon canis FJ KP P Hepatozoon canis HM KP P Hepatozoon canis JX KP P Hepatozoon canis JX KP P Hepatozoon canis JX KP P Hepatozoon canis KC KP P Hepatozoon canis KC KP P Hepatozoon canis KC KP P Hepatozoon canis KC KP P Hepatozoon canis KC KP P Hepatozoon canis KC KP P Hepatozoon canis KC KP P Hepatozoon canis KC KP P Hepatozoon sp. KC KP P Hepatozoon canis KC KP P Hepatozoon canis KC KP P Hepatozoon canis KF KP P Hepatozoon canis KF KP P Hepatozoon canis KJ KP P Hepatozoon canis KJ KP P Hepatozoon canis KM KP P Hepatozoon canis KM KP P Hepatozoon canis KM KP P Hepatozoon canis KM KP P Hepatozoon canis KM KP P Hepatozoon canis KP KP P Hepatozoon canis KP KP P Hepatozoon canis KP KP P Hepatozoon canis JX KP P Hepatozoon canis JX KP P Hepatozoon canis KP KP P Hepatozoon canis

35 KT KP P Hepatozoon canis LC KP P Hepatozoon canis LC KP P Hepatozoon canis LC KP P Hepatozoon canis KM KP P Hepatozoon canis KM KP P Hepatozoon canis KP KP P Hepatozoon canis KP KP P Hepatozoon canis KP KP P Hepatozoon canis KP KP P Hepatozoon canis KP KP P Hepatozoon canis KP KP P Hepatozoon canis KP KP P Hepatozoon canis KP KP P Hepatozoon canis KP KP P Hepatozoon canis KP KP P Hepatozoon canis KP KP P Hepatozoon canis KT KP P Hepatozoon canis KT KP P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KF KT P Hepatozoon canis KF KT P Hepatozoon canis KF KT P Hepatozoon canis KF KT P Hepatozoon canis KF KT P Hepatozoon canis

36 KF KT P Hepatozoon canis KF KT P Hepatozoon canis KF KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis KT KT P Hepatozoon canis LC LC P Hepatozoon canis LC LC P Hepatozoon canis LC LC P Hepatozoon canis LC LC P Hepatozoon canis * Sequence HQ identified as Hemolivia mariae is actually Dactylosoma ran Sequences obtained from Maia et al. (2015)

37 N OF ADELEID HAEMOGREGARINES: IS MORE DATA NEEDED? João P. Maia, Salvador Carranza, a of the hemogregarine diversity and phylogenetic relationships, ordered by Lineage and GenBank accession nu Host taxonomy Amphibia, Anura, Ranidae Amphibia, Anura, Ranidae Reptilia, Lacertilia, Scincidae Reptilia, Testudines, Geoemydidae Reptilia, Testudines Reptilia, Testudines, Chelydridae Reptilia, Testudines, Pelomedusidae Reptilia, Testudines, Pelomedusidae Reptilia, Testudines, Pelomedusidae Reptilia, Testudines, Geoemydidae Reptilia, Testudines, Geoemydidae Reptilia, Testudines, Emydidae Reptilia, Testudines, Geoemydidae Reptilia, Testudines, Geoemydidae Reptilia, Testudines, Geoemydidae Reptilia, Testudines, Geoemydidae Reptilia, Testudines, Platysternidae Reptilia, Lacertilia, Scincidae Insecta, Diptera, Culicidae Reptilia, Testudines, Testudinidae Reptilia, Testudines, Testudinidae Reptilia, Testudines, Testudinidae Reptilia, Testudines, Testudinidae Reptilia, Testudines, Testudinidae Reptilia, Testudines, Testudinidae Reptilia, Testudines, Testudinidae Reptilia, Testudines, Testudinidae Reptilia, Testudines, Testudinidae Reptilia, Testudines, Testudinidae Reptilia, Testudines, Testudinidae Reptilia, Testudines, Testudinidae Reptilia, Testudines, Testudinidae Reptilia, Lacertilia, Scincidae Reptilia, Lacertilia, Scincidae Reptilia, Testudines, Geoemydidae Reptilia, Testudines, Geoemydidae Reptilia, Testudines, Testudinidae Reptilia, Testudines, Testudinidae Aves, Cathartiformes, Cathartidae Aves, Procellariiformes, Hydrobatidae Mammalia, (Marsupialia), Peramelemorphia Mammalia, (Marsupialia), Peramelemorphia Mammalia, (Marsupialia), Peramelemorphia Mammalia, (Marsupialia), Peramelemorphia Mammalia, (Marsupialia), Peramelemorphia Mammalia, (Marsupialia), Peramelemorphia Mammalia, (Marsupialia), Peramelemorphia Mammalia, (Marsupialia), Peramelemorphia Host species Pelophylax esculentus Pelophylax esculentus Tiliqua rugosa Mauremys leprosa Turtle Chelydra serpentina serpentina Pelusios marani Pelusios williamsi Pelusios subniger Mauremys caspica Mauremys rivulata Emys orbicularis Mauremys leprosa Mauremys caspica Sacalia quadriocellata Malayemys subtrijuga Platysternon megacephalum Amblyomma fimbriatum from Varanus panoptes Amblyomma fimbriatum from Varanus panoptes Amblyomma fimbriatum from Liasis fuscus Tiliqua rugosa Aedes taeniorhynchus Hyalomma aegyptium from Testudo graeca Testudo graeca Testudo marginata Testudo graeca Testudo graeca Testudo graeca Testudo graeca Testudo graeca Testudo graeca Testudo graeca Testudo graeca Testudo graeca Testudo graeca Testudo marginata Egernia stokesii Egernia stokesii Rhinoclemmys pulcherrima manni Rhinoclemmys pulcherrima manni Amblyomma rotundatum from Rhinella marina Kinixys zombensis Kinixys zombensis Cathartes aura Oceanodroma melania Isoodon obesulus Isoodon obesulus Isoodon obesulus Isoodon obesulus Isoodon obesulus Isoodon obesulus Isoodon obesulus Isoodon obesulus

38 Mammalia, (Marsupialia), Peramelemorphia Mammalia, (Marsupialia), Peramelemorphia Mammalia, (Marsupialia), Peramelemorphia Mammalia, (Marsupialia), Peramelemorphia Mammalia, (Marsupialia), Peramelemorphia Mammalia, (Marsupialia), Microbiotheria Mammalia, (Marsupialia), Microbiotheria Mammalia, (Marsupalia), Didelphimorphia Insecta, Diptera, Culicidae Insecta, Diptera, Culicidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Testudines, Testudinidae Reptilia, Testudines, Geoemydidae Reptilia, Testudines, Testudinidae Amphibia, Anura, Ranidae Amphibia, Anura, Ranidae Amphibia, Anura, Ranidae Amphibia, Anura, Ranidae Amphibia, Anura, Ranidae Amphibia, Anura, Ranidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Ranidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Isoodon obesulus Isoodon obesulus Isoodon obesulus Isoodon obesulus Isoodon obesulus Ixodes tasmani from Sarcophilus harrisii Ixodes tasmani from Sarcophilus harrisii Ixodes tasmani from Sarcophilus harrisii Ixodes tasmani from Sarcophilus harrisii Dromiciops gliroides Dromiciops gliroides Didelphis virginiana Nerodia sipedon sipedon Aedes taeniorhynchus Aedes taeniorhynchus Crotalus durissus terrificus Crotalus durissus terrificus Crotalus durissus terrificus Dolichophis caspius Hierophis viridiflavus Hierophis viridiflavus Phyllopezus pollicaris Phyllopezus periosus Hemidactylus mabouia Chersina angulata Mauremys leprosa Kinixys zombensis Amblyomma sparsum from Tortoise Rana catesbeiana Rana catesbeiana Rana clamitans Rana catesbeiana Pelophylax esculentus Rana clamitans Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Pelophylax perezi Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus

39 Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Bufonidae Amphibia, Anura, Pyxicephalidae Amphibia, Anura, Pyxicephalidae Mammalia, Rodentia, Muridae Reptilia, Lacertilia, Varanidae Reptilia, Lacertilia, Varanidae Reptilia, Lacertilia, Varanidae Reptilia, Lacertilia, Varanidae Mammalia, Rodentia, Cricetidae Mammalia, Rodentia, Cricetidae Mammalia, Rodentia, Cricetidae Mammalia, Rodentia, Cricetidae Mammalia, Rodentia, Cricetidae Insecta, Siphonaptera, Ctenophthalmidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Pythonidae Mammalia, Rodentia, Sciuridae Mammalia, Rodentia, Cricetidae Reptilia, Lacertilia, Varanidae Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Bufo arabicus Amietophrynus garmani Amietophrynus gutturalis Amietophrynus maculatus Amietia quecketti Amietia quecketti Bandicota indica Boiga sp. Boiga sp. Liasis fuscus Liasis fuscus Varanus panoptes Varanus panoptes Varanus scalaris Varanus scalaris Stegonotus cucullatus Stegonotus cucullatus Clethrionomys glareolus Clethrionomys glareolus Myodes glareolus Myodes glareolus Myodes glareolus Ctenophthalmus agyrtes from Apodemus agrarius Pseudocerastes persicus Cerastes gasparetti Echis omanensis Echis omanensis Lytorhynchus diadema Echis omanensis Lytorhynchus diadema Cerastes gasparetti Echis omanensis Telescopus dhara Cerastes gasparetti Lytorhynchus diadema Echis sp. Echis omanensis Echis omanensis Cerastes gasparetti Echis omanensis Psammophis schokari Cerastes gasparetti Cerastes cerastes Python regius Vulpes pallida Sciurus vulgaris Sigmodon sp. Amblyomma moreliae from Liasis fuscus Amblyomma fimbriatum from Varanus panoptes Varanus salvator salvator

40 Reptilia, Lacertilia, Varanidae Reptilia, Lacertilia, Varanidae Reptilia, Lacertilia, Varanidae Reptilia, Lacertilia, Varanidae Reptilia, Lacertilia, Varanidae Reptilia, Lacertilia, Varanidae Reptilia, Lacertilia, Varanidae Reptilia, Serpentes, Pythonidae Reptilia, Serpentes, Pythonidae Reptilia, Serpentes, Pythonidae Reptilia, Serpentes, Pythonidae Reptilia, Serpentes, Pythonidae Mammalia, Rodentia, Cricetidae Mammalia, Rodentia, Cricetidae Mammalia, Rodentia, Cricetidae Mammalia, Rodentia, Cricetidae Mammalia, Rodentia, Cricetidae Mammalia, Rodentia, Cricetidae Reptilia, Lacertilia, Varanidae Reptilia, Lacertilia, Varanidae Mammalia, Rodentia, Cricetidae Reptilia, Lacertilia, Varanidae Reptilia, Lacertilia, Varanidae Reptilia, Serpentes, Elapidae Reptilia, Lacertilia, Varanidae Mammalia, Rodentia, Cricetidae Mammalia, Rodentia, Cricetidae Mammalia, Rodentia, Cricetidae Varanus salvator salvator Varanus salvator salvator Varanus salvator salvator Varanus salvator salvator Varanus salvator salvator Varanus salvator salvator Varanus salvator salvator Aponomma varanense from Ophiophagus hannah Aponomma varanense from Ophiophagus hannah Aponomma varanense from Ophiophagus hannah Aponomma varanense from Ophiophagus hannah Aponomma varanense from Ophiophagus hannah Python reticulatus Python molurus Python molurus Python molurus Python molurus bivittatus Amblyomma fimbriatum from Varanus panoptes Abrothrix olivaceus Abrothrix sanborni Calomys callosus Abrothrix olivaceus Abrothrix olivaceus Abrothrix sanborni Varanus salvator komaini Varanus salvator komaini Peromyscus leucopus Varanus salvator salvator Varanus salvator salvator Mabuya wrightii Mabuya wrightii Lycognathophis seychellensis Lycognathophis seychellensis Lycognathophis seychellensis Dendroaspis polylepis Varanus salvator komaini Tarentola mauritanica Tarentola mauritanica Quedenfeldtia moerens Ptyodactylus oudrii Tarentola mauritanica Ptyodactylus oudrii Quedenfeldtia moerens Hemorrhois hippocrepis Psammophis sibilans Crotaphopeltis hotamboeia Timon tangitanus Podarcis bocagei Hierophis viridiflavus Hierophis viridiflavus Hierophis viridiflavus Hierophis viridiflavus Peromyscus leucopus Neotoma micropus Neotoma micropus Boa constrictor imperator Aponomma varanensis from Ptyas korros

41 Reptilia, Serpentes, Elapidae Mammalia, Rodentia, Cricetidae Mammalia, Rodentia, Cricetidae Mammalia, Rodentia, Cricetidae Mammalia, Rodentia, Cricetidae Amphibia, Anura, Leptodactylidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Pythonidae Reptilia, Serpentes, Pythonidae Reptilia, Serpentes, Pythonidae Reptilia, Serpentes, Viperidae Mammalia, Chiroptera Mammalia, Chiroptera Reptilia, Serpentes, Pythonidae Reptilia, Serpentes, Elapidae Mammalia, Rodentia, Sciuridae Reptilia, Serpentes, Elapidae Amphibia, Gymnophiona, Indotyphlidae Amphibia, Gymnophiona, Indotyphlidae Mammalia, Rodentia, Cricetidae Reptilia, Serpentes, Elapidae Reptilia, Crocodilia, Alligatoridae Reptilia, Crocodilia, Alligatoridae Reptilia, Crocodilia, Alligatoridae Reptilia, Crocodilia, Alligatoridae Reptilia, Crocodilia, Alligatoridae Reptilia, Crocodilia, Alligatoridae Reptilia, Crocodilia, Alligatoridae Reptilia, Crocodilia, Alligatoridae Reptilia, Crocodilia, Alligatoridae Reptilia, Crocodilia, Alligatoridae Reptilia, Crocodilia, Alligatoridae Reptilia, Crocodilia, Alligatoridae Reptilia, Crocodilia, Alligatoridae Reptilia, Crocodilia, Alligatoridae Aponomma varanensis from Xenochrophis piscator Naja kaouthia Neotoma fuscipes Psammophis schokari Myodes glareolus Myodes glareolus Clethrionomys glareolus Leptodactylus sp. Cerdocyon thous Crotalus durissus terrificus Crotalus durissus terrificus Crotalus durissus terrificus Crotalus durissus terrificus Psammophis schokari Psammophis elegans Philothamnus semivariegatus Python sebae Python sebae Python sebae natalensis Mehelya capensis Coluber constrictor Corallus caninus Cerastes cerastes Macroprotodon cucullatus Hipposideros cervinus Hipposideros cervinus Morelia viridis Dendroaspis jamesoni camerun Sciurus carolinensis Dendroaspis jamesoni jamesoni Grandisonia alternans Grandisonia alternans Myodes glareolus Elaphe carinata Hemorrhois nummifer Macroprotodon cucullatus Natrix tessellata Spalerosophis dolichospilus Zamenis lineatus Zamenis situla Naja haje Macroprotodon cucullatus Spalerosophis dolichospilus Caiman crocodilus yacare Caiman crocodilus yacare Caiman crocodilus yacare Caiman crocodilus yacare Caiman crocodilus yacare Caiman crocodilus yacare Caiman crocodilus yacare Caiman crocodilus yacare Caiman crocodilus yacare Caiman crocodilus yacare Caiman crocodilus yacare Caiman crocodilus yacare Caiman crocodilus yacare Caiman crocodilus yacare

42 Reptilia, Crocodilia, Alligatoridae Reptilia, Crocodilia, Alligatoridae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Cricetidae Mammalia, Chiroptera Arachnida, Mesostigmata, Macronyssidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Mammalia, Rodentia, Dipodidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Lamprophiidae Reptilia, Lacertilia, Chamaeleonidae Mammalia, Rodentia, Muridae Mammalia, Rodentia, Muridae Mammalia, Rodentia, Muridae Mammalia, Rodentia, Muridae Mammalia, Rodentia, Muridae Mammalia, Rodentia, Muridae Caiman crocodilus yacare Yacare caiman Jaculus orientalis Jaculus jaculus Jaculus jaculus Jaculus jaculus Jaculus orientalis Jaculus orientalis Jaculus orientalis Jaculus jaculus Jaculus orientalis Jaculus jaculus Jaculus jaculus Jaculus jaculus Jaculus jaculus Jaculus jaculus Neotoma fuscipes Malpolon monspessulanus Psammophis sibilans Psammophis schokari Hipposideros cervinus Boiga dendrophila melanota Ophiophagus hannah Elaphe carinata Elaphe carinata Elaphe carinata Elaphe carinata Elaphe carinata Elaphe carinata Elaphe carinata Elaphe carinata Jaculus jaculus Jaculus jaculus Jaculus jaculus Jaculus jaculus Jaculus jaculus Jaculus jaculus Jaculus jaculus Jaculus jaculus Hemidactylus mabouia Cerastes cerastes cerastes Phyllopezus pollicaris Hemidactylus mabouia Hemidactylus mabouia Madagascarophis colubrinus Madagascarophis colubrinus Ithycyphus oursi Furcifer sp. Oplurus sp. Acomys dimidiatus Acomys dimidiatus Acomys russatus Acomys dimidiatus Acomys russatus Acomys russatus Tarentola boehmei Tarentola boehmei

43 Reptilia, Serpentes, Viperidae Tarentola ephippiata Tarentola mauritanica Tarentola mauritanica Tarentola deserti Tarentola sp. Tarentola mauritanica Tarentola mauritanica Tarentola mauritanica Tarentola mauritanica Tarentola mauritanica Tarentola deserti Tarentola mauritanica Tarentola mauritanica Tarentola deserti Tarentola ephippiata Tarentola ephippiata Tarentola mauritanica Tarentola deserti Tarentola deserti Assacus platyrhynchus Assacus platyrhynchus Assacus platyrhynchus Hemidactylus luqueorum Assacus platyrhynchus Ptyodactylus hasselquistii Ptyodactylus hasselquistii Ptyodactylus hasselquistii Hemidactylus luqueorum Ptyodactylus hasselquistii Assacus platyrhynchus Hemidactylus hajarensis Assacus platyrhynchus Assacus platyrhynchus Ptyodactylus hasselquistii Assacus platyrhynchus Assacus platyrhynchus Assacus platyrhynchus Assacus platyrhynchus Pristurus rupestris Pristurus rupestris Assacus platyrhynchus Hemidactylus hajarensis Pristurus rupestris Ptyodactylus hasselquistii Ptyodactylus hasselquistii Ptyodactylus hasselquistii Assacus platyrhynchus Ptyodactylus hasselquistii Assacus platyrhynchus Assacus platyrhynchus Assacus platyrhynchus Assacus platyrhynchus Assacus platyrhynchus Hemidactylus atairensis Echis omanensis Hemidactylus lemurinus Hemidactylus festivus

44 Reptilia, Lacertilia, Scincidae Reptilia, Lacertilia, Scincidae Reptilia, Lacertilia, Scincidae Pristurus rupestris Hemidactylus hajarensis Hemidactylus hajarensis Hemidactylus hajarensis Tarentola mauritanica Tarentola boehmei Tarentola sp. Tarentola ephippiata Tarentola mauritanica Tarentola mauritanica Tarentola mauritanica Tarentola mauritanica Tarentola mauritanica Tarentola mauritanica Tarentola mauritanica Tarentola mauritanica Assacus platyrhynchus Lacerta agilis Scelarcis perspicillata Podarcis vaucheri Podarcis vaucheri Podarcis vaucheri Podarcis vaucheri Podarcis hispanica Podarcis bocagei Podarcis bocagei Eumeces algeriensis Eumeces algeriensis Chalcides polylepis Hemorrhois hippocrepis Panthera leo Timon tangitanus Timon tangitanus Timon tangitanus Podarcis vaucheri Atlantolacerta andreanskyi Timon tangitanus Podarcis vaucheri Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi

45 Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Algyroides marchi Podarcis hispanica Podarcis hispanica Podarcis bocagei Podarcis bocagei Podarcis bocagei Podarcis lilfordi Podarcis lilfordi Podarcis lilfordi Podarcis hispanica Podarcis hispanica Podarcis hispanica Podarcis hispanica Podarcis hispanica Podarcis bocagei Podarcis bocagei Podarcis bocagei Podarcis bocagei Podarcis hispanica Podarcis bocagei Podarcis hispanica Podarcis hispanica Podarcis bocagei Podarcis bocagei Podarcis bocagei Podarcis hispanica Podarcis hispanica Podarcis bocagei Podarcis bocagei Podarcis hispanica Podarcis bocagei Podarcis hispanica Podarcis bocagei Podarcis bocagei Podarcis hispanica Podarcis bocagei Podarcis hispanica Podarcis bocagei Podarcis hispanica Podarcis hispanica Podarcis bocagei Podarcis bocagei Podarcis vaucheri Podarcis vaucheri Podarcis vaucheri Podarcis vaucheri Podarcis vaucheri Podarcis hispanica

46 Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Reptilia, Serpentes, Viperidae Arachnida, Mesostigmata, Macronyssidae Podarcis hispanica Podarcis hispanica Podarcis hispanica Podarcis hispanica Podarcis hispanica Podarcis hispanica Podarcis hispanica Podarcis bocagei Podarcis bocagei Podarcis bocagei Podarcis bocagei Podarcis bocagei Podarcis bocagei Podarcis bocagei Podarcis hispanica Cerastes gasparetti Echis carinatus Hemorrhois hippocrepis Psammophis schokari Cerastes cerastes Malpolon moilensis Psammophis schokari Spalerosophis dolichospilus Podarcis hispanica Podarcis bocagei Podarcis hispanica Podarcis bocagei Podarcis bocagei Podarcis hispanica Podarcis bocagei Podarcis hispanica Podarcis bocagei Podarcis hispanica Podarcis bocagei Podarcis bocagei Podarcis bocagei Podarcis bocagei Podarcis bocagei Podarcis bocagei Podarcis hispanica Podarcis hispanica Podarcis hispanica Podarcis hispanica Podarcis bocagei Podarcis hispanica Podarcis bocagei Podarcis hispanica Podarcis hispanica Podarcis hispanica Podarcis hispanica Podarcis hispanica Podarcis muralis Lacerta agilis Ixodes ricinus from Lacerta viridis Lacerta trilineata Lacerta viridis Ophionyssus sp. from Zootoca vivipara

47 Arachnida, Mesostigmata, Macronyssidae Zootoca vivipara Ophionyssus sp. from Lacerta viridis Tarentola angustimentalis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus bengalensis iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus planiceps Prionailurus iriomotensis Haemaphysalis longicornis from Prionailurus bengalensis iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus iriomotensis Prionailurus bengalensis euptilurus Prionailurus bengalensis iriomotensis Prionailurus bengalensis iriomotensis

48 Prionailurus bengalensis euptilurus Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Prionailurus iriomotensis Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Haemaphysalis longicornis from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Amblyomma testudinarium from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Amblyomma testudinarium from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Amblyomma testudinarium from Prionailurus bengalensis iriomotensis Haemaphysalis longicornis from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis iriomotensis Haemaphysalis hystricis from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Haemaphysalis megaspinosa from Prionailurus bengalensis euptilurus Haemaphysalis campanulata from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Haemaphysalis megaspinosa from Prionailurus bengalensis euptilurus Haemaphysalis megaspinosa from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Haemaphysalis megaspinosa from Prionailurus bengalensis euptilurus Haemaphysalis megaspinosa from Prionailurus bengalensis euptilurus Amblyomma testudinarium from Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus

49 Mammalia, Lagomorph, Leporidae Mammalia, Lagomorph, Leporidae Mammalia, Artiodactyla, Suidae Mammalia, Carnivora, Hyaenidae Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Amblyomma testudinarium from Prionailurus bengalensis euptilurus Haemaphysalis megaspinosa from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Haemaphysalis campanulata from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Haemaphysalis megaspinosa from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Ixodes tanuki from Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Prionailurus bengalensis euptilurus Sylvilagus floridanus Sylvilagus aquaticus Lynx rufus Lynx rufus Dermacentor auratus from Sus scrofa Dermacentor atrosignatus from Sus scrofa Felis catus Felis catus Dermacentor atrosignatus from Sus scrofa Dermacentor auratus from Sus scrofa Sus scrofa leucomystax Felis catus Felis catus Felis catus Felis catus Felis catus Felis catus Felis catus Felis catus Felis catus Felis catus Felis catus Prionailurus bengalensis Panthera tigris tigris Panthera tigris tigris Felis catus Panthera leo Panthera leo Crocuta crocuta Amblyomma americanum from Homo sapiens Amblyomma americanum from Homo sapiens Panthera leo Panthera leo

50 Mammalia, Carnivora, Hyaenidae Mammalia, Carnivora, Hyaenidae Mammalia, Carnivora, Mustelidae Mammalia, Carnivora, Mustelidae Mammalia, Carnivora, Ursidae Mammalia, Carnivora, Ursidae Mammalia, Carnivora, Ursidae Mammalia, Carnivora, Ursidae Mammalia, Carnivora, Ursidae Mammalia, Carnivora, Ursidae Mammalia, Carnivora, Ursidae Mammalia, Carnivora, Ursidae Mammalia, Carnivora, Ursidae Mammalia, Carnivora, Ursidae Mammalia, Carnivora, Ursidae Mammalia, Carnivora, Ursidae Mammalia, Carnivora, Mustelidae Mammalia, Carnivora, Mustelidae Mammalia, Carnivora, Mustelidae Mammalia, Carnivora, Mustelidae Mammalia, Carnivora, Mustelidae Mammalia, Carnivora, Mustelidae Mammalia, Carnivora, Mustelidae Mammalia, Carnivora, Mustelidae Mammalia, Rodentia, Cricetidae Mammalia, Carnivora, Procyonidae Mammalia, Carnivora, Procyonidae Mammalia, Carnivora, Procyonidae Mammalia, Carnivora, Procyonidae Panthera leo Panthera leo Panthera leo Panthera leo Panthera leo Crocuta crocuta Crocuta crocuta Panthera leo Panthera leo Acinonyx jubatus Martes martes Martes martes Ursus thibetanus japonicus Ursus thibetanus japonicus Ursus thibetanus japonicus Melursus ursinus Melursus ursinus Melursus ursinus Melursus ursinus Melursus ursinus Melursus ursinus Melursus ursinus Melursus ursinus Melursus ursinus Martes melampus melampus Martes melampus melampus Martes melampus melampus Martes melampus melampus Martes melampus melampus Martes melampus melampus Martes melampus melampus Martes melampus melampus Ixodes hexagonus from Amblyomma americanum from Homo sapiens Ixodes hexagonus Amblyomma maculatum from Cerdocyon thous Canis latrans Amblyomma maculatum from Sigmodon sp. Felis catus Canis latrans Canis latrans Canis latrans Canis latrans Canis latrans Canis latrans Procyon lotor Procyon lotor Procyon lotor Procyon lotor Canis latrans

51 Mammalia, Rodentia, Sciuridae Mammalia, Carnivora, Hyaenidae Mammalia, Carnivora, Procyonidae Canis latrans Canis latrans Canis latrans Canis latrans Canis latrans Canis latrans Canis latrans Canis latrans Marmota monax Canis latrans Canis latrans Canis latrans Canis latrans Canis latrans Canis latrans Canis latrans Cerdocyon thous Lycaon pictus Crocuta crocuta Nasua nasua Cerdocyon thous Pseudalopex gymnocercus Amblyomma ovale Rhipicephalus (Boophilus) microplus Dermacentor marginatus Dermacentor sp. Haemaphysalis concinna Ixodes canisuga Canis aureus Canis aureus

52 Canis aureus Canis aureus Canis aureus Canis aureus Ixodes ricinus from Homo sapiens Rhipicephalus sanguineus Canis aureus Canis aureus Vulpes zerda Vulpes zerda Canis aureus Canis aureus Vulpes zerda Vulpes zerda Canis aureus Rhipicephalus turanicus

53 Mammalia, Rodentia, Caviidae Vulpes zerda Canis aureus Vulpes rueppellii Felis catus Felis catus Rhipicephalus sanguineus Hyalomma anatolicum Canis aureus Vulpes zerda Canis adustus Rhipicephalus sp. Pseudalopex gymnocercus Hydrochaeris hydrochaeris

54 Rhipicephalus sanguineus from Cuon alpinus Cuon alpinus Rhipicephalus sanguineus Rhipicephalus sp. Vulpes rueppellii

55 Vulpes rueppellii Vulpes rueppellii Canis aureus Rhipicephalus sp. Canis aureus Ixodes ricinus Urocyon cinereoargenteus Rhipicephalus turanicus from Rhipicephalus sanguineus from Haemaphysalis adleri from Rhipicephalus turanicus from Rhipicephalus turanicus from Rhipicephalus sanguineus from Haemaphysalis adleri from Rhipicephalus sanguineus from Rhipicephalus sanguineus from Rhipicephalus sanguineus from Rhipicephalus sanguineus from Canis latrans Canis aureus Dermacentor marginatus Ixodes ricinus from Homo sapiens Canis aureus Canis aureus Canis aureus

56 Vulpes pallida Vulpes pallida Vulpes pallida Vulpes pallida Vulpes pallida Vulpes rueppellii Vulpes pallida Vulpes pallida Vulpes pallida Vulpes pallida Vulpes pallida Vulpes pallida Vulpes pallida Canis aureus Canis aureus Canis aureus Canis aureus Canis aureus Haemaphysalis concinna Ixodes ricinus Ixodes hexagonus Ixodes canisuga Dermacentor reticulatus Ixodes canisuga Rhipicephalus sanguineus from Rhipicephalus sanguineus from

57 Mammalia, Artiodactyla, Bovidae Lycalopex gymnocercus Amblyomma sculptum from Ovis aries Amblyomma cajennense Amblyomma cajennense Rhipicephalus turanicus Rhipicephalus turanicus Amblyomma cajennense

58 Rhipicephalus sanguineus from Rhipicephalus sanguineus from narum (see Karadjian et al., 2015) and was used as an outgroup.

59 and D. James Harris. Journal of Parasitology umber. Geography Locality Isolate Europe France 1A2_2 Europe France 1B1_6 Australia South Australia Hem_B_7 Europe Spain MALEPRO3 Asia Iran Fars 93 North America Canada SAS_1 Africa Gabon 3136 Africa Kenya 3133 Africa Mozambique 3140 Asia Iran 2798 Asia Syria 3202 Europe Bulgaria 3786 Africa Algeria 5013 Europe Turkey 4024 Asia Vietnam 5084, VN Asia Vietnam 5093, VN Asia China 5083, CHI Australia Australia 770a Australia Australia 782 Australia Australia 786b Australia Australia South America Galapagos Islands MIG2 Africa Algeria ASStick Europe Turkey TR-8-08 Europe Greece GR-9-04 Asia Iraq IQ-4-10 Asia Syria SY Asia Syria SY Asia Syria SY Asia Syria SY Asia Syria SY Asia Syria SY Asia Syria SY Asia Syria SY Asia Syria SY Europe Greece Vendelin Australia Australia 4903 Australia Australia 4955 South America Nicaragua 5054 South America Nicaragua 5060 South America Brazil South Africa KwaZulu-Natal RC140409A1 South Africa KwaZulu-Natal NMB<ZAF>:P:371 North America USA South America Mexico SPmx Australia Australia 1 Australia Australia B11 Australia Australia B12 Australia Australia B13 Australia Australia B24 Australia Australia B27 Australia Australia B28 Australia Australia B3

60 Australia Australia B4 Australia Australia B8 Australia Australia B15 Australia Australia B16 Australia Australia B17 Australia Australia 842a Australia Australia 539 Australia Australia 530 Australia Australia 512 South America Chile DG1 South America Chile DG2 North America USA Dv North America Canada Guelph 1994 South America Galapagos Islands MIG1 South America Galapagos Islands MIG3 South America Brazil Hep_3_hemo South America Brazil Hep2_hep South America Brazil Hep3_hep Europe Turkey DB16486 Europe Italy DB15087 Europe Italy TEU South America Brazil CHUFCL2851 South America Brazil CHUFCL3654 South America Brazil CHUFCL4684 Africa South Africa Europe Spain MALEPRO2 South Africa KwaZulu-Natal RC140411C1 Africa Kenya TIC69 North America USA North America USA North Africa Canada B_1 North Africa Canada A_4 Europe France JRB-2011 North Africa Canada B_2 Asia Oman Bf1 Asia Oman Bf11 Asia Oman Bf14 Asia Oman Bf17 Asia Oman Bf18 Asia Oman Bf19 Asia Oman Bf24 Asia Oman Bf25 Asia Oman Bf27 Asia Oman Bf30 Asia Oman Bf31 Asia Oman Bf36 Asia Oman Bf37 Asia Oman Bf39 Asia Oman Bf6 Asia Oman Bf7 Europe Portugal SM20 Asia Oman Bf10 Asia Oman Bf12 Asia Oman Bf13 Asia Oman Bf16 Asia Oman Bf2 Asia Oman Bf20

61 Asia Oman Bf28 Asia Oman Bf3 Asia Oman Bf4 Asia Oman Bf5 Asia Oman Bf8 Africa South Africa NMB<ZAF>:P:369 Africa South Africa NMB<ZAF>:P:370 Africa South Africa NMB<ZAF>:P:368 Africa South Africa NMB<ZAF>:P:255 Africa South Africa NMB<ZAF>:P:255 Asia Thailand HepBiCM001 Australia Australia Australia Australia 1 Australia Australia 1 Australia Australia 2 Australia Australia 1 Australia Australia 2 Australia Australia 1 Australia Australia 2 Australia Australia 1 Australia Australia 2 Europe Spain BV2 Europe Croatia dog/77/cro Europe Croatia dog/100/cro Europe Croatia Fox-Hep3 Europe Spain BV1 Europe Germany T56 Europe Hungary HEP8 Europe Poland UR1_2010 Europe Hungary K126b.RLB-F2 Asia Oman CN205 Asia Oman CN2698 Asia Oman CN3266 Asia Oman CN3399 Asia Oman CN3459 Asia Oman CN365 Asia Oman CN3851 Asia Oman CN3856 Asia Oman CN3870 Asia Oman CN3900 Asia Oman CN3923 Asia Oman CN4093 Asia Oman CN4375 Asia Oman CN729 Asia Oman CN730 Asia Oman CN7622 Asia Oman CN8350 Asia Oman CN8365 Asia Oman CN3768 Asia Saudi Arabia Africa Ghana Africa Senegal 468EB3 Europe Spain 1 North America USA CR Australia Australia 797 Australia Australia 774c Asia Thailand V2

62 Asia Thailand V17 Asia Thailand V25 Asia Thailand V30 Asia Thailand V32 Asia Thailand V64 Asia Thailand V36Hep_Th Asia Thailand V5Hep_Th Asia Thailand APOH1 Asia Thailand APOH3 Asia Thailand APOH4 Asia Thailand APOH10 Asia Thailand APOH14 Asia Thailand S34 Asia Thailand S45 Asia Thailand S48 Asia Thailand S57 Asia Thailand S59 Australia Australia 777a South America Chile AO12 South America Chile AS15 South America Brazil Rodent MT South America Chile AO6 South America Chile AO5 South America Chile AS7 Asia Thailand V9 Asia Thailand V10 North America USA WfM Asia Thailand V63 Asia Thailand V66 Africa Seychelles 1SPMwSE Africa Seychelles 23SP Africa Seychelles 35SHLsSE Africa Seychelles 41FGLsSE Africa Seychelles 59PLLsSE Africa Swaziland 395B Asia Thailand V46Hep_Th Africa Algeria DB487TmAL Africa Algeria DB486TmAL Africa Morocco DB1606QmMO Africa Algeria PTY01PoAL Africa Morocco 3126TmMO Africa Morocco PTY34PoMO Africa Morocco Q39QmMO Europe Spain DB1210 Africa Burjina Faso DB2218 Africa Niger DB2217 Africa Morocco LPA1TtMO Europe Portugal 351gPbPO Europe Italy DB15049 Europe Italy DB15165 Europe Italy DB15442 Europe Italy DB15473 North America USA Pg North America USA Nm1 North America USA Nm2 North America USA Bci Asia Thailand APPK1

63 Asia Thailand APXP2 Asia Thailand S23 North America USA Nf1 Asia Saudi Arabia ASH-2012 Europe Hungary HEP2 Europe Hungary HEP5 Europe Slovakia BeCG South America Brazil DDML-2013a South America Brazil F4, fox-es-3 South America Brazil Hep_1_hemo South America Brazil Hep1_hep South America Brazil Hep4_hep South America Brazil Hep5_hep Africa Algeria DB2229 Africa Mali DB2220 Africa Swaziland 440ps Africa Mauritania DB23989 Africa Mauritania DB24047 Africa Swaziland 451psn Africa Swaziland 456mc North America USA 701colcons South America South America 647corcan Africa Mauritania ZC2864 Africa Morocco DB2332 Asia Malaysia USNM Asia Malaysia USNM Asia Indonesia 626B Africa Uganda 587B North America USA Sc Africa Cameroon 599B Africa Seychelles DB6535 Africa Seychelles DB6726 Europe Poland UR2_2010 Asia China S003 Europe Turkey DB15783 Africa Morocco DB1549 Europe Turkey DB16312 Africa Morocco DB14630 Europe Italy CL054 Europe Italy ST002 Africa Morocco DB856 Africa Morocco DB1416 Africa Morocco DB2382 South America Brazil C32 South America Brazil C19 South America Brazil C15 South America Brazil C14 South America Brazil C7 South America Brazil C27 South America Brazil C25 South America Brazil C6 South America Brazil C29 South America Brazil C8 South America Brazil C17 South America Brazil C11 South America Brazil C10 South America Brazil C20

64 South America Brazil C31 South America Brazil C4 Africa Morocco 171jac Africa Mauritania 3107jac Africa Mauritania 1003jac Africa Mauritania 241jac Africa Morocco 173jac Africa Morocco 170jac Africa Morocco 169jac Africa Mauritania 22jac Africa Morocco 172jac Africa Mauritania 53jac Africa Mauritania 506jac Africa Western Sahara 541jac Africa Mauritania 243jac Africa Mauritania 256jac North America USA Nf2 Africa Morocco DB1201 Africa Niger DB2214 Africa Western Sahara DB2231 Asia Malaysia USNM Asia Thailand S22 Asia Thailand S25 Asia China S001 Asia China S002 Asia China S004 Asia China S005 Asia China S006 Asia China S007 Asia China S008 Asia China S009 Africa Mauritania 101jac Africa Western Sahara 563jac Africa Western Sahara 796jac Africa Western Sahara 549jac Africa Morocco 577jac Africa Mauritania 113jac Africa Mauritania 3055jac Africa Mauritania 265jac South America Brazil CHUFCL4319 Africa Egypt South America Brazil AAG3774 South America Brazil CHUFCL4282 South America Brazil CHUFCL4322 Africa Madagascar ACZC1827 Africa Madagascar ACZC1827 Africa Madagascar ACZC1932 Africa Madagascar md67 Africa Madagascar x49 Africa Egypt I Gebel Africa Egypt I El.erbein Africa Egypt I Gharaba Africa Egypt I Itlah Africa Egypt I Gebel Africa Egypt I Itlah Africa Morocco DB14212 Africa Morocco DB14214

65 Africa Morocco DB14219 Africa Libya DB2155 Africa Morocco DB1411 Africa Morocco DB14179 Africa Morocco DB14207 Africa Morocco DB160 Africa Morocco DB201 Africa Morocco DB2545 Africa Morocco DB373 Africa Morocco DB795 Africa Morocco DB9006 Africa Morocco DB978 Africa Morocco DB999 Africa Morocco DB14185 Africa Morocco DB14223 Africa Morocco DB14224 Africa Libya DB2170 Africa Algeria DB363 Africa Morocco DB9016 Asia Oman S6045 Asia Oman S6050 Asia Oman S6078 Asia Oman Asia Oman S6082 Asia Oman Asia Oman Asia Oman Asia Oman Asia Oman Asia Oman S7168 Asia Oman Asia Oman S7182 Asia Oman S7189 Asia Oman Asia Oman S7361 Asia Oman S7429 Asia Oman S7464 Asia Oman S7474 Asia Oman Asia Oman Asia Oman S7582 Asia Oman Asia Oman Asia Oman Asia Oman Asia Oman Asia Oman S7750 Asia Oman Asia Oman S7782 Asia Oman S7805 Asia Oman S7835 Asia Oman S7836 Asia Oman S7850 Asia Oman Asia Oman CN2586 Asia Oman Asia Oman

66 Asia Oman Asia Oman Asia Oman Asia Oman Africa Morocco DB11019 Africa Morocco DB11024 Africa Morocco DB14204 Africa Morocco DB14229 Africa Morocco DB14248 Africa Morocco DB14249 Africa Morocco DB14251 Africa Morocco DB14245 Africa Morocco DB14253 Africa Morocco DB9076 Africa Morocco DB2563 Africa Algeria DB469 Asia Oman S7077 Europe Poland LA81 Africa Morocco 133SpMO Africa Morocco 164PvMO Africa Morocco Pb7421PvMO Africa Morocco 167PvMO Africa Morocco 168PvMO Europe Spain 5220PhSP Europe Portugal 372gPbPO Europe Portugal 379gPbPO Africa Morocco 127EaMO Africa Morocco 129EaMO Africa Morocco E16119CpMO Africa Morocco DB1562 Africa Zambia L3 Africa Morocco LPA4TtMO Africa Morocco LPA28TtMO Africa Morocco LPA31TtMO Africa Morocco 165PvMO Africa Morocco 317AmMO Africa Morocco LPA25TtMO Africa Morocco Pb7413PvMO Europe Spain DB9379AmSP Europe Spain DB9365AmSP Europe Spain DB9183AmSP Europe Spain DB9171AmSP Europe Spain DB5022AmSP Europe Spain DB9449AmSP Europe Spain DB11116AmSP Europe Spain DB11110AmSP Europe Spain DB11054AmSP Europe Spain DB11075AmSP Europe Spain A42AmSP Europe Spain A83AmSP Europe Spain A34AmSP Europe Spain A80AmSP Europe Spain A30AmSP Europe Spain A2AmSP Europe Spain A24AmSP Europe Spain A16AmSP Europe Spain A21AmSP

67 Europe Spain A9AmSP Europe Spain A92AmSP Europe Spain A20AmSP Europe Spain A35AmSP Europe Spain A40AmSP Europe Spain A8AmSP Europe Spain A38AmSP Europe Spain A53AmSP Europe Spain A79AmSP Europe Spain A69AmSP Europe Spain 5208PhSP Europe Spain 5210PhSP Europe Portugal 3240PbPO Europe Spain 3282PbSP Europe Spain 3285PbSP Europe Spain DB10519PlCA Europe Spain DB10504PlCA Europe Spain DB10519PlCA Europe Spain 5202PhSP Europe Spain 5206PhSP Europe Spain 5214PhSP Europe Spain 5212PhSP Europe Spain 5213PhSP Europe Portugal 3237PbPO Europe Portugal 364gPbPO Europe Portugal 361gPbPO Europe Portugal 370gPbPO Europe Spain 5211PhSP Europe Portugal 362gPbPO Europe Spain 5220PhSP Europe Spain 5221PhSP Europe Portugal DB7307 Europe Portugal DB7314 Europe Portugal DB5854 Europe Portugal DB7320 Europe Portugal DB5859 Europe Portugal DB7357 Europe Portugal DB7349 Europe Portugal DB7345 Europe Portugal DB7328 Europe Portugal DB7325 Europe Portugal DB7310 Europe Portugal DB7334 Europe Portugal DB7336 Europe Portugal DB7344 Europe Portugal DB7313 Europe Portugal DB7289 Europe Portugal DB7311 Europe Portugal DB7326 Europe Portugal DB7301 Europe Portugal DB7067 Africa Morocco DB20143 Africa Morocco DB20147 Africa Morocco DB20173 Africa Morocco DB20177 Africa Morocco DB20180 Europe Spain 5219PhSP

68 Europe Spain 5205PhSP Europe Spain 5218PhSP Europe Spain 5209PhSP Europe Spain 5215PhSP Europe Spain 5207PhSP Europe Spain 5217PhSP Europe Spain 5204PhSP Europe Portugal 3253PbPO Europe Portugal 367gPbPO Europe Portugal 378gPbPO Europe Portugal 368gPbPO Europe Portugal 380gPbPO Europe Portugal 3231PbPO Europe Spain 3284PbSP Europe Spain 5202PhSP Asia Oman CN2672 Asia Oman CN4086 Africa Morocco DB1203 Africa Morocco DB879 Africa Morocco DB14696 Africa Morocco DB14191 Africa Morocco DB14198 Africa Morocco DB14694 Europe Spain 5216PhSP Europe Portugal DB7322 Europe Portugal DB7335 Europe Portugal DB7303 Europe Portugal DB7337 Europe Portugal DB7295 Europe Portugal DB7282 Europe Portugal DB7329 Europe Portugal DB5853 Europe Portugal DB7352 Europe Portugal DB7327 Europe Portugal DB7346 Europe Portugal DB7284 Europe Portugal DB5857 Europe Portugal DB7288 Europe Portugal DB7338 Europe Portugal DB5909 Europe Portugal DB7315 Europe Portugal DB6456 Europe Portugal DB7354 Europe Portugal DB7294 Europe Portugal DB7305 Europe Portugal DB7355 Europe Portugal DB7298 Europe Portugal DB7318 Europe Portugal DB7285 Europe Portugal DB7317 Europe Portugal DB7306 Europe Slovakia PM1004BSK Europe Poland LA780BPL Europe Hungary IR289BLVHU Europe Romania LT33BRO Europe Hungary LV268BHU Europe Poland OPZVPL

69 Europe Poland ZV752BPL Europe Hungary OP289BHU Europe Spain DB1366 Asia Japan E-60_ Asia Japan W-106_ Asia Japan E-70_ Asia Japan W-106_ Asia Japan W-108_ Asia Japan W-129_ Asia Japan 3 Asia Japan E-33_ Asia Japan E-33_ Asia Japan E-67_ Asia Japan W-71_ Asia Japan E-72_ Asia Japan W-118_ Asia Japan E-67_ Asia Japan W-113_ Asia Japan W-120_ Asia Japan E-60_ Asia Japan W-101_ Asia Japan W-87_ Asia Japan E-67_ Asia Japan W-126_ Asia Japan W-129_ Asia Japan W-134_ Asia Japan E-91_ Asia Japan W-135_ Asia Japan E-67_ Asia Japan W-87_ Asia Japan E-30_ Asia Japan W-129_ Asia Japan W-127_ Asia Japan W-129_ Asia Japan W-140_ Asia Japan W-134_ Asia Japan W-130_ Asia Japan W-143_ Asia Japan W-146_ Asia Japan W-149_ Asia Japan E-83_ Asia Japan W-127_ Asia Japan E-98_ Asia Japan E-100_ Asia Japan W-145_ Asia Japan E-82_ Asia Thailand VETKU-BKK1 Asia Japan E-83_ Asia Japan Hf_W-146_ Asia Japan W-127_ Asia Japan E-60_ Asia Japan E-91_ Asia Japan W-140_ Asia Japan W-134_ Asia Japan CFT-17_ Asia Japan 1 Asia Japan 2

70 Asia Japan CMM-19_ Asia Japan Hf_W-143_ Asia Japan W-99_ Asia Japan CMM-19_ Asia Japan CFM-20_ Asia Japan CMM-19_ Asia Japan CFT-27_ Asia Japan CMS-29_ Asia Japan MM-22_ Asia Japan CFT-24_ Asia Japan CMS-32_ Asia Japan CFT28_ Asia Japan CFT-24_ Asia Japan CMS-29_ Asia Japan CFT-27_ Asia Japan Hf_W-146_ Asia Japan Hf_W-146_ Asia Japan Hf_W-146_ Asia Japan Hf_W-129_ Asia Japan Hf_W-129_ Asia Japan Hf_W-129_ Asia Japan Hf_W-129_ Asia Japan Hf_W-127_ Asia Japan Hf_W-143_ Asia Japan Hf_W-134_ Asia Japan Hf_E-83_ Asia Japan Hf_W-145_ Asia Japan Hf_W-145_ Asia Japan Hf_E-100_ Asia Japan Hf_E-98_ Asia Japan Hf_E-98_ Asia Japan Hf_E-98_ Asia Japan Hf_W-140_ Asia Japan Hf_W-140_ Asia Japan Hf_W-140_ Asia Japan Hf_W-130_ Asia Japan Hf_CMS-29_ Asia Japan Hf_CMS-29_ Asia Japan Hf_CMS-29_ Asia Japan Hf_CMS-29_ Asia Japan Hf_CMS-35_ Asia Japan Hf_CFT-24_ Asia Japan Hf_CFT-27_ Asia Japan Hf_CFT-27_ Asia Japan Hf_CFT-28_ Asia Japan Hf_CFT-28_ Asia Japan Hf_CFT-25_ Asia Japan Hf_CFT-25_ Asia Japan Hf_CFT-25_ Asia Japan CFS-18_ Asia Japan CFS-26_ Asia Japan CFT-25_ Asia Japan CFT-24_ Asia Japan CFT-27_ Asia Japan CMS-29_ Asia Japan CFT-25_ Asia Japan CMT-33_

71 Asia Japan CMS-34_ Asia Japan CFT-25_ Asia Japan CFT-27_ Asia Japan CFT-24_ Asia Japan Hf_CMS-29_ Asia Japan Hf_CMS-29_ Asia Japan Hf_CMS-35_ Asia Japan Hf_CFT-24_ Asia Japan Hf_CFT-24_ Asia Japan Hf_CFT-24_ Asia Japan Hf_CFT-24_ Asia Japan Hf_CFT-27_ Asia Japan Hf_CFT-27_ Asia Japan Hf_CFT-27_ Asia Japan Hf_CFT-27_ Asia Japan Hf_CFT-27_ Asia Japan Hf_CFT-27_ Asia Japan Hf_CMS-34_ Asia Japan Hf_CMS-34_ Asia Japan Hf_CFT-25_ Asia Japan Hf_CFT-25_ Asia Japan CFT-28_ Asia Japan CMS-29_ North America USA KEA-2009a North America USA KEA-2009b North America USA Lr1 North America USA Lr2 Asia Thailand SSPG3TH Asia Thailand SSPG8TH South America Brazil Cuiaba South America Brazil CAT31 Asia Thailand SSPG3-8 Asia Thailand SSPG3HP Asia Japan IB20 Europe Portugal H8 Europe Portugal H10 Europe Portugal H21 Europe Portugal H22 Europe Portugal H1 Europe Portugal H2 Europe Portugal H3 Europe Portugal H6 Europe Spain Spain 1 Europe Spain Spain 2 Asia India LaCONES/domestic cat 01 Asia Thailand VETKU-BKK2 Asia India LaCONES/Bengal tiger 01 Asia India LaCONES/Bengal tiger 02 Asia India LaCONES/domestic cat 02 Africa Zambia LiF Africa Zambia LLPM Asia Tanzania Serengeti North America USA Tick5121RIBR North America USA Tick5121RUM Africa Zambia LPB Africa Zambia LPMTahoe Africa Zambia E102

72 Africa Zambia E1116 Africa Zambia L2 Africa Zambia L4 Africa Zambia L6NSE Africa Zambia L6WSE Africa Zambia HI Africa Zambia HY5F Africa Zambia L5Nym Africa Zimbabwe Z-13 Africa Zimbabwe Z-68 Europe Spain 1 Europe United Kingdom PM421 Asia Japan Asia Japan Gifu 1 Asia Japan Gifu 2 Asia India LaCONES/Indian sloth bear 01 Asia India LaCONES/Indian sloth bear 02 Asia India LaCONES/Indian sloth bear 03 Asia India LaCONES/Indian sloth bear 04 Asia India LaCONES/Indian sloth bear 05 Asia India LaCONES/Indian sloth bear 06 Asia India LaCONES/Indian sloth bear 07 Asia India LaCONES/Indian sloth bear 08 Asia India LaCONES/Indian sloth bear 09 Asia Japan JM-1 Asia Japan JM-2 Asia Japan JM-3 Asia Japan JM-4 Asia Japan JM-5 Asia Japan JM-6 Asia Japan JM-7 Asia Japan JM-8 Europe Germany 1 North America USA Tick5121RIBF Europe Germany 1 North America USA South America Brazil Curupira 2 North America USA North America USA 29b North America USA animal control Dog isolate 3 North America USA Clinic Dog isolate 2 North America USA Clinic Dog isolate 1 North America USA Muskogee Dog isolate 1 North America USA Laboratoty raised Laboratoty raised North America USA Fc North America USA Cl 2-1 North America USA Cl 2-2 North America USA Cl 3-2 North America USA 26a North America USA 29a North America USA 5c North America USA Pl 1 North America USA Pl 2 North America USA Pl 3 North America USA Pl 4 North America USA 5a

73 North America USA 18c North America USA 18b North America USA 14b North America USA 14c North America USA 14e North America USA Cl 3-1 North America USA 14f North America USA Cl1 North America USA Mm North America USA 3a North America USA 26c North America USA 26d North America USA 3b North America USA 3c North America USA 5d North America USA 3g South America Brazil F3, fox-es-2 Africa Zambia WDPONT1 Africa Zambia LHY29 South America Brazil Africa Nigeria Nigeria #01 Africa Cape Verde Hd38-2 Asia Japan Europe Spain Spain-1 South America Brazil Curupira 3 South America Brazil Curupira 4 South America Brazil 3 South America Brazil South America Brazil 1 South America Brazil South America Brazil 1 South America Brazil Porto Alegre Europe Croatia Dog-162-Cro South America Brazil Botucatu South America Brazil South America Brazil Europe Italy 932 Europe Italy 1448 Europe Italy 1458 Europe Italy 399 Europe Italy 4434 Europe Italy 4156 South America Brazil 3583 South America Brazil Cuiaba South America Brazil CG-MS Europe Hungary HUN-1 Europe Hungary HUN-2 Europe Hungary HUN-4 Europe Hungary HUN-5 Europe Hungary HUN-6 Europe Germany Europe Hungary S286 Europe Hungary R127/2 Europe Hungary R124 Europe Hungary R366/1 Europe Hungary F06 Europe Hungary J05

74 Europe Hungary J06 Europe Hungary J07 Europe Hungary J08 Europe Hungary J09 Europe Turkey H139 Europe Turkey HB6 Europe Hungary dr. Papp jackal South America Brazil 12 Africa Algeria 1516FC7 Africa Mauritania 5765D2 Africa Western Sahara 6483C3 Africa Mauritania 2204D8 Africa Mauritania 514CD3 Africa Morocco 544CH3 Africa Mauritania 791CF4 Europe Hungary J2 Europe Italy 4 Europe Austria fox2 Europe Austria fox3 Europe Austria fox4 Europe Austria fox7 Europe Austria fox13 Europe Austria fox15b Europe Austria fox20b Europe Austria fox27 Europe Austria fox31 Europe Austria fox35 Europe Bosnia and Herzegovina 13/14 Europe Bosnia and Herzegovina 17A/14 Europe Bosnia and Herzegovina 1A/14 Europe Bosnia and Herzegovina 1B/14 Europe Bosnia and Herzegovina 1D/14 Europe Bosnia and Herzegovina 2/14b Europe Bosnia and Herzegovina 202A/13b Europe Bosnia and Herzegovina 204A/13a Europe Bosnia and Herzegovina 211B/13 Europe Bosnia and Herzegovina 212B/13 Europe Bosnia and Herzegovina 215C/13 Europe Bosnia and Herzegovina 217/13 Europe Bosnia and Herzegovina 219/13 Europe Bosnia and Herzegovina 222B/13 Europe Bosnia and Herzegovina 222E/13 Europe Bosnia and Herzegovina 230C/13 Europe Bosnia and Herzegovina 231D/13b Europe Bosnia and Herzegovina 231G/13 Europe Bosnia and Herzegovina 232A/13 Europe Bosnia and Herzegovina 24/14 Europe Bosnia and Herzegovina 240A/13 Europe Bosnia and Herzegovina 243A/13 Europe Bosnia and Herzegovina 243B/13 Europe Bosnia and Herzegovina 244B/13 Europe Bosnia and Herzegovina 25A/14b Europe Bosnia and Herzegovina 277A/13 Europe Bosnia and Herzegovina 30/14 Europe Bosnia and Herzegovina 32F/14 Europe Bosnia and Herzegovina 45/14 Europe Bosnia and Herzegovina 6B/14

75 Europe Bosnia and Herzegovina 6D/14 Europe Bosnia and Herzegovina 74A/14 Europe Bosnia and Herzegovina 78A/14 Europe Bosnia and Herzegovina 78B/14 Europe Bosnia and Herzegovina 78C/14 Europe Bosnia and Herzegovina 83/14 Europe Bosnia and Herzegovina 86/14 Europe Bosnia and Herzegovina 9A/14 Europe Turkey Manisa Europe Turkey Marmaris Europe Turkey Bodrum Europe Turkey Selcuk Africa Sudan Dog-12 Africa Sudan Dog-47 Africa Sudan Dog-60 Africa Mauritania 792CG4 Africa Mauritania 3054G10 Africa Mauritania 6010H2 Africa Sudan Dog-08 Africa Sudan Dog-26 Africa Sudan Dog-33 South America Brazil 2 South America Brazil 1 South America Brazil 2 Europe Spain Spain 2 Europe Spain Spain 3 Africa Sudan Dog-13 Africa Sudan Dog-78 Africa Sudan Dog-68 South America Venezuela Venezuela 2 South America Venezuela Venezuela 1 Asia Thailand Thailand 1 Europe Italy Europe Italy Asia Jordan 37 Asia India LaCONES/dog 01 Asia India LaCONES/dog 02 Europe Turkey DD11 Asia Pakistan 15Bt3 North America USA Africa Tunisia 305BG2 Africa Algeria 1517FD7 Africa Western Sahara 6480B3 Africa Tunisia 6821F10 Africa Ethiopia 2799E10 Europe Turkey TrKysHcan1 Europe Turkey TrKysHcan2 Europe Spain 1 Europe Malta 36 Europe Malta 41 South America Venezuela Venezuela 3 Asia Thailand Thailand 2 South America Brazil Curupira 1 Europe Spain Spain 4 Europe Spain Spain 5 South America Brazil Pelotas 1 Europe Poland 49GK

76 Asia India Asia Taiwan TWN1 Asia India LaCONES/Indian wild dog 01 Asia India LaCONES/Indian wild dog 02 Asia Taiwan South America Colombia dog-1 South America Colombia dog-2 Europe Turkey DD11 Africa Nigeria ZA03 Africa Nigeria ZA04 Africa Nigeria PH10 Africa Nigeria PH03 Europe Spain 7243 Asia Thailand BK-35 Asia Thailand BK-37 Asia Thailand BK-42 Asia Thailand BK-45 Asia Thailand BK-48 Europe Spain 3 Europe Malta 39 N/A N/A EEEE_HepF N/A N/A JJJ_HepF N/A N/A LLL_HepF N/A N/A M_HepF N/A N/A VVVV_Hep Europe Italy fox26 Europe Italy fox25 Asia Malaysia Penang clone 17 Asia Malaysia Pahang clone 31 Asia Malaysia Johor clone 318 Asia Malaysia Klang clone 108 Europe Portugal ID64BJ23ALG85 Europe Portugal ID64BJ27ALG108 Europe Portugal ID64BJ28ALG104 Europe Portugal ID64BJ29B2 Europe Portugal ID64BJ30ALGEr4 Europe Portugal ID64BJ32ALG306 Europe Portugal ID64BJ33ALG305 Europe Portugal ID64BJ34SET5 Europe Portugal ID64BJ36ALG312 Europe Portugal ID64BJ37ALG307 Europe Portugal ID64BJ38SET1 Europe Portugal ID64BJ39ALG415 Europe Croatia Dog-155-Cro Europe Croatia Dog-141-Cro Europe Croatia Dog-168-Cro Europe Croatia Dog-97-Cro Europe Turkey Kusadasy Europe Turkey Aydin Europe Croatia Dog-98-Cro Europe Croatia Dog-106-Cro South America Brazil 17 Africa Mauritania 84CE1 Africa Morocco 6588H3 Africa Morocco 1446G7

77 Africa Mauritania 4964B12 Africa Morocco 5710A2 Africa Mauritania 3213H10 Africa Mauritania 4439B9 Africa Morocco 6589A4 Asia India 2 Europe Croatia Dog-160-Cro Europe Croatia Dog-161-Cro Europe Croatia Dog-165-Cro Europe Croatia Fox-Hep2 Europe Hungary J4 Europe Italy 1442 Europe Italy 4546 Europe Italy 1509 Europe Italy 4548 Europe Italy 4241 Europe Italy 4530 Europe Italy 4252 Europe Luxembourg 1318 North America USA Uc South America Brazil Africa Nigeria 1605 Africa Nigeria Joh5 Africa Nigeria ZA10 Africa Nigeria ST66 Africa Nigeria Joh2 Africa Nigeria J27 Africa Nigeria DT20A Africa Nigeria DT4N Africa Nigeria DT15N Africa Nigeria DT3AT Africa Nigeria DT32AT Africa Nigeria DT33N Africa Nigeria DTVC6 Africa Nigeria DT32N North America St Kitts and Nevis SK-144 South America Brazil HcDog1 South America Brazil Hctick1 South America Brazil Hcdog2 South America Brazil Hctick2 South America Brazil Hctick3 North America USA animal control Dog isolate 1 North America USA animal control Dog isolate 2 North America USA 18a Europe Austria 1 Europe Turkey H130 Europe Turkey H140 Europe Austria 3 Europe Austria Europe Hungary R93 Europe Austria 5 Europe Turkey Karaman A50 Europe Turkey Konya B29 Europe Turkey Konya B167 Europe Turkey Konya B172 South America Brazil 27 Europe Austria fox26

78 Africa Niger 6646D10 Africa Mauritania 2434H8 Africa Mauritania 4584A12 Africa Mauritania 1000CH5 Africa Mauritania 966FE5 Africa Morocco 795CB5 Africa Mauritania 2432G8 Africa Mauritania 81BA1 Africa Mauritania 968CG5 Africa Mauritania 1001CA6 Africa Niger 6644B10 Africa Niger 6645C10 Africa Mauritania 2230E8 Europe Hungary J1 Asia Jordan 27 Europe Hungary South America Brazil Pocone#3 Europe Romania ROFox106 Europe Austria fox14b Europe Bosnia and Herzegovina 238A/13b Europe Austria fox22 Europe Austria fox30b Europe Austria fox33 N/A N/A UUUU_Hep Europe Croatia Dog-136-Cro Europe Croatia Dog-85-Cro Europe Croatia Dog-129-Cro Europe Croatia Fox-Hep1 Europe Austria 2 Europe Austria 4 Europe Austria 7 Europe Hungary HUN-3 Europe Hungary HUN-7 Europe Germany Europe Germany Europe Germany Europe Germany Europe Germany Europe Germany 1 Europe Hungary R366/3 Europe Hungary Europe Hungary Europe Hungary R370/3 Europe Hungary dr. Papp fox Europe Hungary F1 Europe Hungary F2 Europe Austria fox16 Europe Austria fox18 Europe Austria fox19 Europe Austria fox24 Europe Austria fox29 Europe Bosnia and Herzegovina 213/13b Europe Bosnia and Herzegovina 76/14 Europe Bosnia and Herzegovina 92/14 Africa Nigeria DT25 Africa Nigeria DT22A South America Brazil DVT_UFV 01

79 Asia Pakistan Dog 1 Europe Portugal ID64BJ26ALG187 Europe Portugal ID64BJ31ALGEr2 Europe Portugal ID64BJ35ALG318 South America Brazil LgHc Europe Austria fox32 South America Brazil Pocone#6 Europe Bosnia and Herzegovina 204B/13b Europe Bosnia and Herzegovina 244D/13b Europe Bosnia and Herzegovina 39/14b Europe Bosnia and Herzegovina 7/14b South America Brazil DVT_UFV 02 South America Brazil DVT_UFV 03 Europe Italy DVT_UFV 04 Europe Italy fox28 Europe Italy fox24 Europe Italy fox27 Asia Malaysia Sarawak clone 10 Asia Malaysia Sarawak clone 17 South America Mexico Balancan2 South America Mexico Balancan14 South America Mexico Balancan3 South America Mexico Balancan5 South America Mexico Balancan16 South America Mexico Balancan18 South America Mexico Balancan8 South America Mexico Balancan9 South America Mexico Balancan10 South America Mexico Balancan4 South America Mexico Balancan6 South America Mexico Balancan7 South America Mexico Balancan11 South America Mexico Balancan15 South America Mexico Balancan13 South America Mexico Balancan17 South America Mexico Balancan12 South America Mexico Balancan19 South America Mexico Balancan20 South America Mexico Balancan21 South America Mexico Balancan22 South America Mexico Balancan23 South America Mexico Balancan1 South America Mexico Balancan24 South America Mexico Balancan25 Asia India 2a_Upper Asia Malaysia Johor clone 321 Asia Malaysia Sabah clone 42 Asia Malaysia Sabah clone 47 Asia Malaysia Klang clone 1 Asia Thailand BK-34 Asia Thailand BK-38 Asia Thailand BK-39 Asia Thailand BK-40 Asia Thailand BK-41

80 Asia Thailand BK-43 Asia Thailand BK-44 Asia Thailand BK-47 Asia Malaysia Penang clone 12 Asia Malaysia Kedah clone 5 Asia Malaysia Pahang clone 17 Asia Malaysia Klang clone 53 Asia Malaysia Sarawak clone 44 Asia Palestine tick6.5a Asia Palestine tick17.8c Europe Portugal ID64BJ40ALG411 Europe Portugal ID64BJ96CxEr14 Europe Portugal ID64BJ97Sa542 Asia India

81 Reference Barta, J. R., J. D. Ogedengbe, D. S. Martin, and T. G. Smith Phylogenetic position of the adeleorinid coccidia (Myzozoa, Apicomplexa, Coccidia, Eucoccidiorida, Adeleorina) inferred using 18S rdna sequences. The Journal of Eukaryotic Microbiology 59: Barta, J. R., J. D. Ogedengbe, D. S. Martin, and T. G. Smith Phylogenetic position of the adeleorinid coccidia (Myzozoa, Apicomplexa, Coccidia, Eucoccidiorida, Adeleorina) inferred using 18S rdna sequences. The Journal of Eukaryotic Microbiology 59: Barta, J. R., J. D. Ogedengbe, D. S. Martin, and T. G. Smith Phylogenetic position of the adeleorinid coccidia (Myzozoa, Apicomplexa, Coccidia, Eucoccidiorida, Adeleorina) inferred using 18S rdna sequences. The Journal of Eukaryotic Microbiology 59: Ibáñez, A., A. Marzal, M. González-Blázquez, P. López, and J. Martín Basking activity is modulated by health state but is constrained by conspicuousness to predators in male Spanish Terrapins. Ethology 121: Unpublished. Rakhshanderoo,E., Sharifiyazdi,H. and Ahmadi,A. Barta, J. R., J. D. Ogedengbe, D. S. Martin, and T. G. Smith Phylogenetic position of the adeleorinid coccidia (Myzozoa, Apicomplexa, Coccidia, Eucoccidiorida, Adeleorina) inferred using 18S rdna sequences. The Journal of Eukaryotic Microbiology 59: Dvořáková, N., J. Kvičerová, I. Papoušek, H. Javanbakht, G. Tiar, H. Kami, and P. Široký Haemogregarines from western Palaearctic freshwater turtles (genera Emys, Mauremys) are conspecific with Haemogregarina stepanowi Danilewsky, Parasitology 141: Dvořáková, N., J. Kvičerová, I. Papoušek, H. Javanbakht, G. Tiar, H. Kami, and P. Široký Haemogregarines from western Palaearctic freshwater turtles (genera Emys, Mauremys) are conspecific with Haemogregarina stepanowi Danilewsky, Parasitology 141: Dvořáková, N., J. Kvičerová, I. Papoušek, H. Javanbakht, G. Tiar, H. Kami, and P. Široký Haemogregarines from western Palaearctic freshwater turtles (genera Emys, Mauremys) are conspecific with Haemogregarina stepanowi Danilewsky, Parasitology 141: Dvořáková, N., J. Kvičerová, I. Papoušek, H. Javanbakht, G. Tiar, H. Kami, and P. Široký Haemogregarines from western Palaearctic freshwater turtles (genera Emys, Mauremys) are conspecific with Haemogregarina stepanowi Danilewsky, Parasitology 141: Dvořáková, N., J. Kvičerová, I. Papoušek, H. Javanbakht, G. Tiar, H. Kami, and P. Široký Haemogregarines from western Palaearctic freshwater turtles (genera Emys, Mauremys) are conspecific with Haemogregarina stepanowi Danilewsky, Parasitology 141: Dvořáková, N., J. Kvičerová, I. Papoušek, H. Javanbakht, G. Tiar, H. Kami, and P. Široký Haemogregarines from western Palaearctic freshwater turtles (genera Emys, Mauremys) are conspecific with Haemogregarina stepanowi Danilewsky, Parasitology 141: Dvořáková, N., J. Kvičerová, I. Papoušek, H. Javanbakht, G. Tiar, H. Kami, and P. Široký Haemogregarines from western Palaearctic freshwater turtles (genera Emys, Mauremys) are conspecific with Haemogregarina stepanowi Danilewsky, Parasitology 141: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Dvořáková, N., J. Kvičerová, M. Hostovský, and P. Široký Haemogregarines of freshwater turtles from Southeast Asia with a description of Haemogregarina sacaliae sp. n. and a redescription of Haemogregarina pellegrini Laveran and Pettit, Parasitology 142: Dvořáková, N., J. Kvičerová, M. Hostovský, and P. Široký Haemogregarines of freshwater turtles from Southeast Asia with a description of Haemogregarina sacaliae sp. n. and a redescription of Haemogregarina pellegrini Laveran and Pettit, Parasitology 142: Dvořáková, N., J. Kvičerová, M. Hostovský, and P. Široký Haemogregarines of freshwater turtles from Southeast Asia with a description of Haemogregarina sacaliae sp. n. and a redescription of Haemogregarina pellegrini Laveran and Pettit, Parasitology 142: Vilcins, I.-M. E., B. Ujvari, J. M. Old, and E. Deane Molecular and morphological description of a Hepatozoon species in reptiles and their ticks in the Northern Territory, Australia. The Journal of parasitology 95: Vilcins, I.-M. E., B. Ujvari, J. M. Old, and E. Deane Molecular and morphological description of a Hepatozoon species in reptiles and their ticks in the Northern Territory, Australia. The Journal of parasitology 95: Vilcins, I.-M. E., B. Ujvari, J. M. Old, and E. Deane Molecular and morphological description of a Hepatozoon species in reptiles and their ticks in the Northern Territory, Australia. The Journal of parasitology 95: Barta, J. R., J. D. Ogedengbe, D. S. Martin, and T. G. Smith Phylogenetic position of the adeleorinid coccidia (Myzozoa, Apicomplexa, Coccidia, Eucoccidiorida, Adeleorina) inferred using 18S rdna sequences. The Journal of Eukaryotic Microbiology 59: Bataille, A., G. Fournié, M. Cruz, V. Cedeño, P. G. Parker, A. A. Cunningham, and S. J. Goodman Host selection and parasite infection in Aedes taeniorhynchus, endemic disease vector in the Galápagos Islands. Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases 12: Harris, D. J., E. Graciá, F. Jorge, J. P. M. C. Maia, A. Perera, M. A. Carretero, and A. Giménez Molecular Detection of Hemolivia (Apicomplexa: Haemogregarinidae) from Ticks of North African Testudo graeca (Testudines: Testudinidae) and an Estimation of Their Phylogenetic Relationships Using 18S rrna Sequences. Comparative Parasitology 80: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Kvičerová, J., V. Hypša, N. Dvořáková, P. Mikulíček, D. Jandzik, M. G. Gardner, H. Javanbakht, G. Tiar, and P. Široký Hemolivia and Hepatozoon: Haemogregarines with Tangled Evolutionary Relationships. Protist 165: Karadjian, G., J.-M. Chavatte, and I. Landau Systematic revision of the adeleid haemogregarines, with creation of Bartazoon n. g., reassignment of Hepatozoon argantis Garnham, 1954 to Hemolivia, and molecular data on Hemolivia stellata. Parasite 22: 31. Cook, C. A., E. C. Netherlands, and N. J. Smit First Hemolivia from southern Africa: reassigning chelonian Haemogregarina parvula Dias, 1953 (Adeleorina: Haemogregarinidae) to Hemolivia (Adeleorina: Karyolysidae). African Zoology 50: Cook, C. A., E. C. Netherlands, and N. J. Smit First Hemolivia from southern Africa: reassigning chelonian Haemogregarina parvula Dias, 1953 (Adeleorina: Haemogregarinidae) to Hemolivia (Adeleorina: Karyolysidae). African Zoology 50: Unpublished. Velguth,K., Ketz-Riley,C., Allen,K., Johnson,E. and Little,S. Hepatozoon species from turkey vulture (Cathartes aura) in Oklahoma. Merino, S., J. Martínez, J. F. Masello, Y. Bedolla, and P. Quillfeldt First molecular characterization of a Hepatozoon species (Apicomplexa: Hepatozoidae) infecting birds and description of a new species infecting storm petrels (Aves: Hydrobatidae). The Journal of Parasitology 100: Wicks, R. M., P. B. S. Spencer, P. Moolhuijzen, and P. Clark Morphological and molecular characteristics of a species of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina) from the blood of Isoodon obesulus (Marsupialia: Peramelidae) in Western Australia. Systematic parasitology 65: Wicks, R. M., P. B. S. Spencer, P. Moolhuijzen, and P. Clark Morphological and molecular characteristics of a species of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina) from the blood of Isoodon obesulus (Marsupialia: Peramelidae) in Western Australia. Systematic parasitology 65: Wicks, R. M., P. B. S. Spencer, P. Moolhuijzen, and P. Clark Morphological and molecular characteristics of a species of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina) from the blood of Isoodon obesulus (Marsupialia: Peramelidae) in Western Australia. Systematic parasitology 65: Wicks, R. M., P. B. S. Spencer, P. Moolhuijzen, and P. Clark Morphological and molecular characteristics of a species of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina) from the blood of Isoodon obesulus (Marsupialia: Peramelidae) in Western Australia. Systematic parasitology 65: Wicks, R. M., P. B. S. Spencer, P. Moolhuijzen, and P. Clark Morphological and molecular characteristics of a species of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina) from the blood of Isoodon obesulus (Marsupialia: Peramelidae) in Western Australia. Systematic parasitology 65: Wicks, R. M., P. B. S. Spencer, P. Moolhuijzen, and P. Clark Morphological and molecular characteristics of a species of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina) from the blood of Isoodon obesulus (Marsupialia: Peramelidae) in Western Australia. Systematic parasitology 65: Wicks, R. M., P. B. S. Spencer, P. Moolhuijzen, and P. Clark Morphological and molecular characteristics of a species of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina) from the blood of Isoodon obesulus (Marsupialia: Peramelidae) in Western Australia. Systematic parasitology 65: Wicks, R. M., P. B. S. Spencer, P. Moolhuijzen, and P. Clark Morphological and molecular characteristics of a species of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina) from the blood of Isoodon obesulus (Marsupialia: Peramelidae) in Western Australia. Systematic parasitology 65:

82 Wicks, R. M., P. B. S. Spencer, P. Moolhuijzen, and P. Clark Morphological and molecular characteristics of a species of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina) from the blood of Isoodon obesulus (Marsupialia: Peramelidae) in Western Australia. Systematic parasitology 65: Wicks, R. M., P. B. S. Spencer, P. Moolhuijzen, and P. Clark Morphological and molecular characteristics of a species of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina) from the blood of Isoodon obesulus (Marsupialia: Peramelidae) in Western Australia. Systematic parasitology 65: Wicks, R. M., P. B. S. Spencer, P. Moolhuijzen, and P. Clark Morphological and molecular characteristics of a species of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina) from the blood of Isoodon obesulus (Marsupialia: Peramelidae) in Western Australia. Systematic parasitology 65: Wicks, R. M., P. B. S. Spencer, P. Moolhuijzen, and P. Clark Morphological and molecular characteristics of a species of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina) from the blood of Isoodon obesulus (Marsupialia: Peramelidae) in Western Australia. Systematic parasitology 65: Wicks, R. M., P. B. S. Spencer, P. Moolhuijzen, and P. Clark Morphological and molecular characteristics of a species of Hepatozoon Miller, 1908 (Apicomplexa: Adeleorina) from the blood of Isoodon obesulus (Marsupialia: Peramelidae) in Western Australia. Systematic parasitology 65: Vilcins, I.-M. E., B. Ujvari, J. M. Old, and E. Deane Molecular and morphological description of a Hepatozoon species in reptiles and their ticks in the Northern Territory, Australia. The Journal of parasitology 95: Vilcins, I.-M. E., B. Ujvari, J. M. Old, and E. Deane Molecular and morphological description of a Hepatozoon species in reptiles and their ticks in the Northern Territory, Australia. The Journal of parasitology 95: Vilcins, I.-M. E., B. Ujvari, J. M. Old, and E. Deane Molecular and morphological description of a Hepatozoon species in reptiles and their ticks in the Northern Territory, Australia. The Journal of parasitology 95: Vilcins, I.-M. E., B. Ujvari, J. M. Old, and E. Deane Molecular and morphological description of a Hepatozoon species in reptiles and their ticks in the Northern Territory, Australia. The Journal of parasitology 95: Merino, S., R. A. Vásquez, J. Martínez, J. L. Celis-Diez, L. Gutiérrez-Jiménez, S. Ippi, I. Sánchez-Monsalvez, and J. Martínez-de la Puente Molecular characterization of an ancient Hepatozoon species parasitizing the living fossil marsupial Monito del Monte Dromiciops gliroides from Chile. Biological Journal of the Linnean Society 98: Merino, S., R. A. Vásquez, J. Martínez, J. L. Celis-Diez, L. Gutiérrez-Jiménez, S. Ippi, I. Sánchez-Monsalvez, and J. Martínez-de la Puente Molecular characterization of an ancient Hepatozoon species parasitizing the living fossil marsupial Monito del Monte Dromiciops gliroides from Chile. Biological Journal of the Linnean Society 98: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Barta, J. R., J. D. Ogedengbe, D. S. Martin, and T. G. Smith Phylogenetic position of the adeleorinid coccidia (Myzozoa, Apicomplexa, Coccidia, Eucoccidiorida, Adeleorina) inferred using 18S rdna sequences. The Journal of Eukaryotic Microbiology 59: Bataille, A., G. Fournié, M. Cruz, V. Cedeño, P. G. Parker, A. A. Cunningham, and S. J. Goodman Host selection and parasite infection in Aedes taeniorhynchus, endemic disease vector in the Galápagos Islands. Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases 12: Bataille, A., G. Fournié, M. Cruz, V. Cedeño, P. G. Parker, A. A. Cunningham, and S. J. Goodman Host selection and parasite infection in Aedes taeniorhynchus, endemic disease vector in the Galápagos Islands. Infection, genetics and evolution : journal of molecular epidemiology and evolutionary genetics in infectious diseases 12: O Dwyer, L. H., T. C. Moço, K. D. S. Paduan, C. Spenassatto, R. J. da Silva, and P. E. M. Ribolla Description of three new species of Hepatozoon (Apicomplexa, Hepatozoidae) from Rattlesnakes (Crotalus durissus terrificus) based on molecular, morphometric and morphologic characters. Experimental Parasitology 135: O Dwyer, L. H., T. C. Moço, K. D. S. Paduan, C. Spenassatto, R. J. da Silva, and P. E. M. Ribolla Description of three new species of Hepatozoon (Apicomplexa, Hepatozoidae) from Rattlesnakes (Crotalus durissus terrificus) based on molecular, morphometric and morphologic characters. Experimental Parasitology 135: O Dwyer, L. H., T. C. Moço, K. D. S. Paduan, C. Spenassatto, R. J. da Silva, and P. E. M. Ribolla Description of three new species of Hepatozoon (Apicomplexa, Hepatozoidae) from Rattlesnakes (Crotalus durissus terrificus) based on molecular, morphometric and morphologic characters. Experimental Parasitology 135: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Harris, D. J., D. M. Borges-Nojosa, and J. P. Maia Prevalence and Diversity of Hepatozoon in Native and Exotic Geckos from Brazil. Journal of Parasitology 101: Harris, D. J., D. M. Borges-Nojosa, and J. P. Maia Prevalence and Diversity of Hepatozoon in Native and Exotic Geckos from Brazil. Journal of Parasitology 101: Harris, D. J., D. M. Borges-Nojosa, and J. P. Maia Prevalence and Diversity of Hepatozoon in Native and Exotic Geckos from Brazil. Journal of Parasitology 101: Cook, C. A., S. P. Lawton, A. J. Davies, and N. J. Smit Reassignment of the land tortoise haemogregarine Haemogregarina fitzsimonsi Dias 1953 (Adeleorina: Haemogregarinidae) to the genus Hepatozoon Miller 1908 (Adeleorina: Hepatozoidae) based on parasite morphology, life cycle and phylogenetic analysis of 18S. Parasitology 1953: Ibáñez, A., A. Marzal, M. González-Blázquez, P. López, and J. Martín Basking activity is modulated by health state but is constrained by conspicuousness to predators in male Spanish Terrapins. Ethology 121: Cook, C. A., E. C. Netherlands, and N. J. Smit First Hemolivia from southern Africa: reassigning chelonian Haemogregarina parvula Dias, 1953 (Adeleorina: Haemogregarinidae) to Hemolivia (Adeleorina: Karyolysidae). African Zoology 50: Unpublished. Omondi,D. and Villinger,J. Apicomplexan sequences isolated from ticks sampled in Baringo County of Kenya. Carreno, R. A., D. S. Martin, and J. R. Barta Cryptosporidium is more closely related to the gregarines than to coccidia as shown by phylogenetic analysis of apicomplexan parasites inferred using small-subunit ribosomal RNA gene sequences. Parasitology research 85: Mathew, J. S., R. A. Van Den Bussche, S. A. Ewing, J. R. Malayer, B. R. Latha, and R. J. Panciera Phylogenetic relationships of Hepatozoon (Apicomplexa: Adeleorina) based on molecular, morphologic, and life-cycle characters. The Journal of parasitology 86: Barta, J. R., J. D. Ogedengbe, D. S. Martin, and T. G. Smith Phylogenetic position of the adeleorinid coccidia (Myzozoa, Apicomplexa, Coccidia, Eucoccidiorida, Adeleorina) inferred using 18S rdna sequences. The Journal of Eukaryotic Microbiology 59: Barta, J. R., J. D. Ogedengbe, D. S. Martin, and T. G. Smith Phylogenetic position of the adeleorinid coccidia (Myzozoa, Apicomplexa, Coccidia, Eucoccidiorida, Adeleorina) inferred using 18S rdna sequences. The Journal of Eukaryotic Microbiology 59: Barta, J. R., J. D. Ogedengbe, D. S. Martin, and T. G. Smith Phylogenetic position of the adeleorinid coccidia (Myzozoa, Apicomplexa, Coccidia, Eucoccidiorida, Adeleorina) inferred using 18S rdna sequences. The Journal of Eukaryotic Microbiology 59: Barta, J. R., J. D. Ogedengbe, D. S. Martin, and T. G. Smith Phylogenetic position of the adeleorinid coccidia (Myzozoa, Apicomplexa, Coccidia, Eucoccidiorida, Adeleorina) inferred using 18S rdna sequences. The Journal of Eukaryotic Microbiology 59: Harris, D. J., M. P. Spigonardi, J. P. M. C. Maia, and R. T. Cunha Molecular survey of parasites in introduced Pelophylax perezi (Ranidae) water frogs in the Azores. Acta parasitologica 58:

83 Netherlands, E. C., C. A. Cook, and N. J. Smit Hepatozoon species (Adeleorina: Hepatozoidae) of African bufonids, with morphological description and molecular diagnosis of Hepatozoon ixoxo sp. nov. parasitising three Amietophrynus species (Anura: Bufonidae). Parasites & vectors 7: 552. Netherlands, E. C., C. A. Cook, and N. J. Smit Hepatozoon species (Adeleorina: Hepatozoidae) of African bufonids, with morphological description and molecular diagnosis of Hepatozoon ixoxo sp. nov. parasitising three Amietophrynus species (Anura: Bufonidae). Parasites & vectors 7: 552. Netherlands, E. C., C. A. Cook, and N. J. Smit Hepatozoon species (Adeleorina: Hepatozoidae) of African bufonids, with morphological description and molecular diagnosis of Hepatozoon ixoxo sp. nov. parasitising three Amietophrynus species (Anura: Bufonidae). Parasites & vectors 7: 552. Netherlands, E. C., C. A. Cook, N. J. Smit, and L. H. du Preez Redescription and molecular diagnosis of Hepatozoon theileri (Laveran, 1905) (Apicomplexa: Adeleorina: Hepatozoidae), infecting Amietia quecketti (Anura: Pyxicephalidae). Folia Parasitologica 61: Netherlands, E. C., C. A. Cook, and N. J. Smit Hepatozoon species (Adeleorina: Hepatozoidae) of African bufonids, with morphological description and molecular diagnosis of Hepatozoon ixoxo sp. nov. parasitising three Amietophrynus species (Anura: Bufonidae). Parasites & vectors 7: 552. Unpublished. Dantrakool,A., Somboon,P. and Saito-Ito,A. First identification of a member of Genus Hepatozoon in wild rats (Bandicota indica) in Chiang Mai Province, Thailand. Unpublished. Jakes,K.A., O'Donoghue,P.J. and Adlard,R.D. The phylogeny of a Hepatozoon sp. from a brown tree snake, Boiga irregularis, from southeastern Queensland Australia. Ujvari, B., T. Madsen, and M. Olsson High prevalence of Hepatozoon spp. (Apicomplexa, Hepatozoidae) infection in water pythons (Liasis fuscus) from tropical Australia. Journal of parasitology 90: Ujvari, B., T. Madsen, and M. Olsson High prevalence of Hepatozoon spp. (Apicomplexa, Hepatozoidae) infection in water pythons (Liasis fuscus) from tropical Australia. Journal of parasitology 90: Ujvari, B., T. Madsen, and M. Olsson High prevalence of Hepatozoon spp. (Apicomplexa, Hepatozoidae) infection in water pythons (Liasis fuscus) from tropical Australia. Journal of parasitology 90: Ujvari, B., T. Madsen, and M. Olsson High prevalence of Hepatozoon spp. (Apicomplexa, Hepatozoidae) infection in water pythons (Liasis fuscus) from tropical Australia. Journal of parasitology 90: Ujvari, B., T. Madsen, and M. Olsson High prevalence of Hepatozoon spp. (Apicomplexa, Hepatozoidae) infection in water pythons (Liasis fuscus) from tropical Australia. Journal of parasitology 90: Ujvari, B., T. Madsen, and M. Olsson High prevalence of Hepatozoon spp. (Apicomplexa, Hepatozoidae) infection in water pythons (Liasis fuscus) from tropical Australia. Journal of parasitology 90: Ujvari, B., T. Madsen, and M. Olsson High prevalence of Hepatozoon spp. (Apicomplexa, Hepatozoidae) infection in water pythons (Liasis fuscus) from tropical Australia. Journal of parasitology 90: Ujvari, B., T. Madsen, and M. Olsson High prevalence of Hepatozoon spp. (Apicomplexa, Hepatozoidae) infection in water pythons (Liasis fuscus) from tropical Australia. Journal of parasitology 90: Ujvari, B., T. Madsen, and M. Olsson High prevalence of Hepatozoon spp. (Apicomplexa, Hepatozoidae) infection in water pythons (Liasis fuscus) from tropical Australia. Journal of parasitology 90: Criado-Fornelio, A., J. Ruas, N. Casado, N. A. R. Farias, M. P. Soares, G. Müller, J. G. W. Brumt, M. E. A. Berne, A. Buling-Saraña, and J. C. Barba-Carretero New molecular data on mammalian Hepatozoon species (Apicomplexa: Adeleorina) from Brazil and Spain. The Journal of parasitology 92: Vojta, L., V. Mrljak, S. Curković, T. Zivicnjak, A. Marinculić, and R. Beck Molecular epizootiology of canine hepatozoonosis in Croatia. International journal for parasitology 39: Vojta, L., V. Mrljak, S. Curković, T. Zivicnjak, A. Marinculić, and R. Beck Molecular epizootiology of canine hepatozoonosis in Croatia. International journal for parasitology 39: Dezdek, D., L. Vojta, S. Curković, Z. Lipej, Z. Mihaljević, Z. Cvetnić, and R. Beck Molecular detection of Theileria annae and Hepatozoon canis in foxes () in Croatia. Veterinary parasitology 172: Criado-Fornelio, A., J. Ruas, N. Casado, N. A. R. Farias, M. P. Soares, G. Müller, J. G. W. Brumt, M. E. A. Berne, A. Buling-Saraña, and J. C. Barba-Carretero New molecular data on mammalian Hepatozoon species (Apicomplexa: Adeleorina) from Brazil and Spain. The Journal of parasitology 92: Silaghi, C., D. Woll, D. Hamel, K. Pfister, M. Mahling, and M. Pfeffer Babesia spp. and Anaplasma phagocytophilum in questing ticks, ticks parasitizing rodents and the parasitized rodents--analyzing the host-pathogen-vector interface in a metropolitan area. Parasites & vectors 5: 191. Unpublished. Rigo,K., Majoros,G., Szekeres,S., Molnar,I., Jablonszky,M. and Foldvari,G. A Hepatozoon species from bank voles (Myodes glareolus) and observations on some European rodents' ability to eat ticks. Bajer, A., R. Welc-Falęciak, M. Bednarska, M. Alsarraf, J. Behnke-Borowczyk, E. Siński, and J. M. Behnke Long-Term Spatiotemporal Stability and Dynamic Changes in the Haemoparasite Community of Bank Voles (Myodes glareolus) in NE Poland. Microbial ecology Unpublished. Rigo,K., Majoros,G., Szekeres,S., Molnar,I., Jablonszky,M., Majlathova,V., Majlath,I. and Foldvari,G. Identification of Hepatozoon erhardovae from bank voles (Myodes glareolus) and fleas in Southern Hungary. Unpublished. Al-Khedhairy,A.A. and Arfin,M. Genetic Studies on Fauna of Saudi Arabia. Sloboda, M., M. Kamler, J. Bulantová, J. Votýpka, and D. Modrý A new species of Hepatozoon (Apicomplexa: Adeleorina) from Python regius (Serpentes: Pythonidae) and its experimental transmission by a mosquito vector. The Journal of parasitology 93: Criado-Fornelio, A., A. Buling, N. Casado, C. Gimenez, J. Ruas, L. Wendt, N. Rosa-Farias, M. Pinheiro, C. Rey-Valeiron, and J. C. Barba-Carretero Molecular characterization of arthropod-borne hematozoans in wild mammals from Brazil, Venezuela and Spain. Acta Parasitologica 54: Johnson, E. M., K. E. Allen, R. J. Panciera, S. A. Ewing, S. E. Little, and M. V Reichard Field survey of rodents for Hepatozoon infections in an endemic focus of American canine hepatozoonosis. Veterinary parasitology 150: Vilcins, I.-M. E., B. Ujvari, J. M. Old, and E. Deane Molecular and morphological description of a Hepatozoon species in reptiles and their ticks in the Northern Territory, Australia. The Journal of parasitology 95: Vilcins, I.-M. E., B. Ujvari, J. M. Old, and E. Deane Molecular and morphological description of a Hepatozoon species in reptiles and their ticks in the Northern Territory, Australia. The Journal of parasitology 95: Unpublished. Salakij,C., Sirinarumitr,T., Salakij,J., Phongphaew,W. and Kamolnorranath,S. Characterization of Hepatozoon Species in the Water Monitor (Varanus salvator salvator) and Black Jungle Monitor (Varanus salvator komaini) from Thailand.

84 Unpublished. Salakij,C., Sirinarumitr,T., Salakij,J., Phongphaew,W. and Kamolnorranath,S. Characterization of Hepatozoon Species in the Water Monitor (Varanus salvator salvator) and Black Jungle Monitor (Varanus salvator komaini) from Thailand. Unpublished. Salakij,C., Sirinarumitr,T., Salakij,J., Phongphaew,W. and Kamolnorranath,S. Characterization of Hepatozoon Species in the Water Monitor (Varanus salvator salvator) and Black Jungle Monitor (Varanus salvator komaini) from Thailand. Unpublished. Salakij,C., Sirinarumitr,T., Salakij,J., Phongphaew,W. and Kamolnorranath,S. Characterization of Hepatozoon Species in the Water Monitor (Varanus salvator salvator) and Black Jungle Monitor (Varanus salvator komaini) from Thailand. Unpublished. Salakij,C., Sirinarumitr,T., Salakij,J., Phongphaew,W. and Kamolnorranath,S. Characterization of Hepatozoon Species in the Water Monitor (Varanus salvator salvator) and Black Jungle Monitor (Varanus salvator komaini) from Thailand. Unpublished. Salakij,C., Sirinarumitr,T., Salakij,J., Phongphaew,W. and Kamolnorranath,S. Characterization of Hepatozoon Species in the Water Monitor (Varanus salvator salvator) and Black Jungle Monitor (Varanus salvator komaini) from Thailand. Unpublished. Salakij,C., Sirinarumitr,T., Salakij,J., Phongphaew,W. and Kamolnorranath,S. Characterization of Hepatozoon Species in the Water Monitor (Varanus salvator salvator) and Black Jungle Monitor (Varanus salvator komaini) from Thailand. Unpublished. Salakij,C., Sirinarumitr,T., Salakij,J., Phongphaew,W. and Kamolnorranath,S. Characterization of Hepatozoon Species in the Water Monitor (Varanus salvator salvator) and Black Jungle Monitor (Varanus salvator komaini) from Thailand. Sumrandee, C., V. Baimai, W. Trinachartvanit, and A. Ahantarig Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks and Tick-borne Diseases 6: Unpublished. Sumrandee,C., Trinachartvanit,W., Baimai,V. and Ahantarig,A. Detection of Hepatozoon spp. from ticks collected from 4 snake species in Thailand. Unpublished. Sumrandee,C., Trinachartvanit,W., Baimai,V. and Ahantarig,A. Detection of Hepatozoon spp. from ticks collected from 4 snake species in Thailand. Unpublished. Sumrandee,C., Trinachartvanit,W., Baimai,V. and Ahantarig,A. Detection of Hepatozoon spp. from ticks collected from 4 snake species in Thailand. Unpublished. Sumrandee,C., Trinachartvanit,W., Baimai,V. and Ahantarig,A. Detection of Hepatozoon spp. from ticks collected from 4 snake species in Thailand. Unpublished. Salakij,C., Lertwatcharasarakul,P., Chalalai,T., Salakij,J. and Kranjanapitukkul,K. Morphometry, ultrastructure and phylogenetic characterizations of Hepatozoon sp. of snakes in Thailand. Unpublished. Salakij,C., Lertwatcharasarakul,P., Chalalai,T., Salakij,J. and Kranjanapitukkul,K. Morphometry, ultrastructure and phylogenetic characterizations of Hepatozoon sp. of snakes in Thailand. Unpublished. Salakij,C., Lertwatcharasarakul,P., Chalalai,T., Salakij,J. and Kranjanapitukkul,K. Morphometry, ultrastructure and phylogenetic characterizations of Hepatozoon sp. of snakes in Thailand. Unpublished. Salakij,C., Lertwatcharasarakul,P., Chalalai,T., Salakij,J. and Kranjanapitukkul,K. Morphometry, ultrastructure and phylogenetic characterizations of Hepatozoon sp. of snakes in Thailand. Unpublished. Salakij,C., Lertwatcharasarakul,P., Chalalai,T., Salakij,J. and Kranjanapitukkul,K. Morphometry, ultrastructure and phylogenetic characterizations of Hepatozoon sp. of snakes in Thailand. Vilcins, I.-M. E., B. Ujvari, J. M. Old, and E. Deane Molecular and morphological description of a Hepatozoon species in reptiles and their ticks in the Northern Territory, Australia. The Journal of parasitology 95: Merino, S., R. A. Vásquez, J. Martínez, J. L. Celis-Diez, L. Gutiérrez-Jiménez, S. Ippi, I. Sánchez-Monsalvez, and J. Martínez-de la Puente Molecular characterization of an ancient Hepatozoon species parasitizing the living fossil marsupial Monito del Monte Dromiciops gliroides from Chile. Biological Journal of the Linnean Society 98: Merino, S., R. A. Vásquez, J. Martínez, J. L. Celis-Diez, L. Gutiérrez-Jiménez, S. Ippi, I. Sánchez-Monsalvez, and J. Martínez-de la Puente Molecular characterization of an ancient Hepatozoon species parasitizing the living fossil marsupial Monito del Monte Dromiciops gliroides from Chile. Biological Journal of the Linnean Society 98: Wolf, R. W., M. Aragona, S. Muñoz-Leal, L. B. Pinto, A. L. T. Melo, I. A. Braga, J. dos Santos Costa, T. F. Martins, A. Marcili, R. de Campos Pacheco, et al Novel Babesia and Hepatozoon agents infecting non-volant small mammals in the Brazilian Pantanal, with the first record of the tick Ornithodoros guaporensis in Brazil. Ticks and Tick-borne Diseases: Merino, S., R. A. Vásquez, J. Martínez, J. L. Celis-Diez, L. Gutiérrez-Jiménez, S. Ippi, I. Sánchez-Monsalvez, and J. Martínez-de la Puente Molecular characterization of an ancient Hepatozoon species parasitizing the living fossil marsupial Monito del Monte Dromiciops gliroides from Chile. Biological Journal of the Linnean Society 98: Merino, S., R. A. Vásquez, J. Martínez, J. L. Celis-Diez, L. Gutiérrez-Jiménez, S. Ippi, I. Sánchez-Monsalvez, and J. Martínez-de la Puente Molecular characterization of an ancient Hepatozoon species parasitizing the living fossil marsupial Monito del Monte Dromiciops gliroides from Chile. Biological Journal of the Linnean Society 98: Merino, S., R. A. Vásquez, J. Martínez, J. L. Celis-Diez, L. Gutiérrez-Jiménez, S. Ippi, I. Sánchez-Monsalvez, and J. Martínez-de la Puente Molecular characterization of an ancient Hepatozoon species parasitizing the living fossil marsupial Monito del Monte Dromiciops gliroides from Chile. Biological Journal of the Linnean Society 98: Unpublished. Salakij,C., Sirinarumitr,T., Salakij,J., Phongphaew,W. and Kamolnorranath,S. Characterization of Hepatozoon Species in the Water Monitor (Varanus salvator salvator) and Black Jungle Monitor (Varanus salvator komaini) from Thailand. Unpublished. Salakij,C., Sirinarumitr,T., Salakij,J., Phongphaew,W. and Kamolnorranath,S. Characterization of Hepatozoon Species in the Water Monitor (Varanus salvator salvator) and Black Jungle Monitor (Varanus salvator komaini) from Thailand. Johnson, E. M., K. E. Allen, R. J. Panciera, S. A. Ewing, S. E. Little, and M. V Reichard Field survey of rodents for Hepatozoon infections in an endemic focus of American canine hepatozoonosis. Veterinary parasitology 150: Unpublished. Salakij,C., Sirinarumitr,T., Salakij,J., Phongphaew,W. and Kamolnorranath,S. Characterization of Hepatozoon Species in the Water Monitor (Varanus salvator salvator) and Black Jungle Monitor (Varanus salvator komaini) from Thailand. Unpublished. Salakij,C., Sirinarumitr,T., Salakij,J., Phongphaew,W. and Kamolnorranath,S. Characterization of Hepatozoon Species in the Water Monitor (Varanus salvator salvator) and Black Jungle Monitor (Varanus salvator komaini) from Thailand. Harris, D. J., J. P. M. C. Maia, and A. Perera Molecular characterization of Hepatozoon species in reptiles from the Seychelles. Journal of Parasitology 97: Harris, D. J., J. P. M. C. Maia, and A. Perera Molecular characterization of Hepatozoon species in reptiles from the Seychelles. Journal of Parasitology 97: Harris, D. J., J. P. M. C. Maia, and A. Perera Molecular characterization of Hepatozoon species in reptiles from the Seychelles. Journal of Parasitology 97: Harris, D. J., J. P. M. C. Maia, and A. Perera Molecular characterization of Hepatozoon species in reptiles from the Seychelles. Journal of Parasitology 97: Harris, D. J., J. P. M. C. Maia, and A. Perera Molecular characterization of Hepatozoon species in reptiles from the Seychelles. Journal of Parasitology 97: Haklová, B., V. Majláthová, I. Majláth, D. J. Harris, V. Petrilla, T. Litschka-Koen, M. Oros, and B. Peťko Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia. Parasitology 141: Unpublished. Salakij,C., Sirinarumitr,T., Salakij,J., Phongphaew,W. and Kamolnorranath,S. Characterization of Hepatozoon Species in the Water Monitor (Varanus salvator salvator) and Black Jungle Monitor (Varanus salvator komaini) from Thailand. Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Tomé, B., J. P. M. C. Maia, and D. J. Harris Hepatozoon infection prevalence in four snake genera: Influence of diet, prey parasitemia levels, or parasite type? Journal of Parasitology 98: Tomé, B., J. P. M. C. Maia, and D. J. Harris Molecular assessment of apicomplexan parasites in the snake Psammophis from north Africa: Do multiple parasite lineages reflect the final vertebrate host diet. Journal of Parasitology 99: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Sumrandee, C., V. Baimai, W. Trinachartvanit, and A. Ahantarig Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks and Tick-borne Diseases 6:

85 Sumrandee, C., V. Baimai, W. Trinachartvanit, and A. Ahantarig Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks and Tick-borne Diseases 6: Unpublished. Salakij,C., Lertwatcharasarakul,P., Chalalai,T., Salakij,J. and Kranjanapitukkul,K. Morphometry, ultrastructure and phylogenetic characterizations of Hepatozoon sp. of snakes in Thailand. Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Abdel-Baki, A.-A. S., S. Al-Quraishy, and J. Y. Zhang Redescription of Haemogregarina garnhami (Apicomplexa: Adeleorina) from the blood of Psammophis schokari (Serpentes: Colubridae) as Hepatozoon garnhami n. comb. based on molecular, morphometric and morphologic characters. Acta parasitologica 59: Unpublished. Rigo,K., Majoros,G., Szekeres,S., Molnar,I., Jablonszky,M. and Foldvari,G. A Hepatozoon species from bank voles (Myodes glareolus) and observations on some European rodents' ability to eat ticks. Unpublished. Rigo,K., Majoros,G., Szekeres,S., Molnar,I., Jablonszky,M. and Foldvari,G. A Hepatozoon species from bank voles (Myodes glareolus) and observations on some European rodents' ability to eat ticks. Blaňarová, L., M. Stanko, D. Miklisová, B. Víchová, L. Mošanský, J. Kraljik, M. Bona, and M. Derdáková Presence of Candidatus Neoehrlichia mikurensis and Babesia microti in rodents and two tick species (Ixodes ricinus and Ixodes trianguliceps) in Slovakia. Ticks and tick-borne diseases Leal, D. D. M., C. S. Dreyer, R. J. da Silva, P. E. M. Ribolla, K. dos Santos Paduan, I. Bianchi, and L. H. O Dwyer Characterization of Hepatozoon spp. in Leptodactylus chaquensis and Leptodactylus podicipinus from two regions of the Pantanal, state of Mato Grosso do Sul, Brazil. Parasitology Research 114: Almeida, A. P., T. D. Souza, A. Marcili, and B. Marcelo Novel Ehrlichia and Hepatozoon Agents Infecting the Crab-Eating Fox (Cerdocyon thous) in Southeastern Brazil. Journal of Medical Entomology 50: O Dwyer, L. H., T. C. Moço, K. D. S. Paduan, C. Spenassatto, R. J. da Silva, and P. E. M. Ribolla Description of three new species of Hepatozoon (Apicomplexa, Hepatozoidae) from Rattlesnakes (Crotalus durissus terrificus) based on molecular, morphometric and morphologic characters. Experimental Parasitology 135: O Dwyer, L. H., T. C. Moço, K. D. S. Paduan, C. Spenassatto, R. J. da Silva, and P. E. M. Ribolla Description of three new species of Hepatozoon (Apicomplexa, Hepatozoidae) from Rattlesnakes (Crotalus durissus terrificus) based on molecular, morphometric and morphologic characters. Experimental Parasitology 135: O Dwyer, L. H., T. C. Moço, K. D. S. Paduan, C. Spenassatto, R. J. da Silva, and P. E. M. Ribolla Description of three new species of Hepatozoon (Apicomplexa, Hepatozoidae) from Rattlesnakes (Crotalus durissus terrificus) based on molecular, morphometric and morphologic characters. Experimental Parasitology 135: O Dwyer, L. H., T. C. Moço, K. D. S. Paduan, C. Spenassatto, R. J. da Silva, and P. E. M. Ribolla Description of three new species of Hepatozoon (Apicomplexa, Hepatozoidae) from Rattlesnakes (Crotalus durissus terrificus) based on molecular, morphometric and morphologic characters. Experimental Parasitology 135: Tomé, B., J. P. M. C. Maia, and D. J. Harris Molecular assessment of apicomplexan parasites in the snake Psammophis from north Africa: Do multiple parasite lineages reflect the final vertebrate host diet. Journal of Parasitology 99: Tomé, B., J. P. M. C. Maia, and D. J. Harris Molecular assessment of apicomplexan parasites in the snake Psammophis from north Africa: Do multiple parasite lineages reflect the final vertebrate host diet. Journal of Parasitology 99: Haklová, B., V. Majláthová, I. Majláth, D. J. Harris, V. Petrilla, T. Litschka-Koen, M. Oros, and B. Peťko Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia. Parasitology 141: Rosado, D., J. C. Brito, and D. J. Harris Molecular screening of Hepatozoon ( Apicomplexa : Adeleorina ) infections in Python sebae from West Africa using 18S rrna gene sequences. Herpetology notes 8: Rosado, D., J. C. Brito, and D. J. Harris Molecular screening of Hepatozoon ( Apicomplexa : Adeleorina ) infections in Python sebae from West Africa using 18S rrna gene sequences. Herpetology notes 8: Haklová, B., V. Majláthová, I. Majláth, D. J. Harris, V. Petrilla, T. Litschka-Koen, M. Oros, and B. Peťko Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia. Parasitology 141: Haklová, B., V. Majláthová, I. Majláth, D. J. Harris, V. Petrilla, T. Litschka-Koen, M. Oros, and B. Peťko Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia. Parasitology 141: Haklová, B., V. Majláthová, I. Majláth, D. J. Harris, V. Petrilla, T. Litschka-Koen, M. Oros, and B. Peťko Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia. Parasitology 141: Haklová, B., V. Majláthová, I. Majláth, D. J. Harris, V. Petrilla, T. Litschka-Koen, M. Oros, and B. Peťko Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia. Parasitology 141: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Pinto, C. M., K. M. Helgen, R. C. Fleischer, and S. L. Perkins Hepatozoon parasites (Apicomplexa: Adeleorina) in bats. Journal of Parasitology 99: Pinto, C. M., K. M. Helgen, R. C. Fleischer, and S. L. Perkins Hepatozoon parasites (Apicomplexa: Adeleorina) in bats. Journal of Parasitology 99: Haklová, B., V. Majláthová, I. Majláth, D. J. Harris, V. Petrilla, T. Litschka-Koen, M. Oros, and B. Peťko Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia. Parasitology 141: Haklová, B., V. Majláthová, I. Majláth, D. J. Harris, V. Petrilla, T. Litschka-Koen, M. Oros, and B. Peťko Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia. Parasitology 141: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Haklová, B., V. Majláthová, I. Majláth, D. J. Harris, V. Petrilla, T. Litschka-Koen, M. Oros, and B. Peťko Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia. Parasitology 141: Harris, D. J., I. Damas-Moreira, J. P. M. C. Maia, and A. Perera First report of Hepatozoon (Apicomplexa: Adeleorina) in caecilians, with description of a new species. Journal of Parasitology 100: Harris, D. J., I. Damas-Moreira, J. P. M. C. Maia, and A. Perera First report of Hepatozoon (Apicomplexa: Adeleorina) in caecilians, with description of a new species. Journal of Parasitology 100: Bajer, A., R. Welc-Falęciak, M. Bednarska, M. Alsarraf, J. Behnke-Borowczyk, E. Siński, and J. M. Behnke Long-Term Spatiotemporal Stability and Dynamic Changes in the Haemoparasite Community of Bank Voles (Myodes glareolus) in NE Poland. Microbial ecology Han, H., Y. Wu, H. Dong, S. Zhu, L. Li, Q. Zhao, D. Wu, E. Pei, Y. Wang, and B. Huang First report of Hepatozoon (Apicomplexa: Adeleorina) from king ratsnakes (Elaphe carinata) in Shanghai, with description of a new species. Acta Parasitologica 60: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil. Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil. Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil. Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil. Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil. Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil. Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil. Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil. Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil. Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil. Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil. Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil. Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil. Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil.

86 Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil. Unpublished. Bouer,A., Andre,M.R., Luzzi,M.C., Goncalvez,L.R., Varani,A.M. and Machado,R.Z. The diversity of Hepatozoon genotypes in Caiman crocodilus yacare (Crocodylia, Alligatoridae) from North Pantanal, Brazil. Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Tomé, B., J. P. M. C. Maia, and D. J. Harris Hepatozoon infection prevalence in four snake genera: Influence of diet, prey parasitemia levels, or parasite type? Journal of Parasitology 98: Tomé, B., J. P. M. C. Maia, and D. J. Harris Molecular assessment of apicomplexan parasites in the snake Psammophis from north Africa: Do multiple parasite lineages reflect the final vertebrate host diet. Journal of Parasitology 99: Tomé, B., J. P. M. C. Maia, and D. J. Harris Molecular assessment of apicomplexan parasites in the snake Psammophis from north Africa: Do multiple parasite lineages reflect the final vertebrate host diet. Journal of Parasitology 99: Pinto, C. M., K. M. Helgen, R. C. Fleischer, and S. L. Perkins Hepatozoon parasites (Apicomplexa: Adeleorina) in bats. Journal of Parasitology 99: Unpublished. Salakij,C., Lertwatcharasarakul,P., Chalalai,T., Salakij,J. and Kranjanapitukkul,K. Morphometry, ultrastructure and phylogenetic characterizations of Hepatozoon sp. of snakes in Thailand. Unpublished. Salakij,C., Lertwatcharasarakul,P., Chalalai,T., Salakij,J. and Kranjanapitukkul,K. Morphometry, ultrastructure and phylogenetic characterizations of Hepatozoon sp. of snakes in Thailand. Han, H., Y. Wu, H. Dong, S. Zhu, L. Li, Q. Zhao, D. Wu, E. Pei, Y. Wang, and B. Huang First report of Hepatozoon (Apicomplexa: Adeleorina) from king ratsnakes (Elaphe carinata) in Shanghai, with description of a new species. Acta Parasitologica 60: Han, H., Y. Wu, H. Dong, S. Zhu, L. Li, Q. Zhao, D. Wu, E. Pei, Y. Wang, and B. Huang First report of Hepatozoon (Apicomplexa: Adeleorina) from king ratsnakes (Elaphe carinata) in Shanghai, with description of a new species. Acta Parasitologica 60: Han, H., Y. Wu, H. Dong, S. Zhu, L. Li, Q. Zhao, D. Wu, E. Pei, Y. Wang, and B. Huang First report of Hepatozoon (Apicomplexa: Adeleorina) from king ratsnakes (Elaphe carinata) in Shanghai, with description of a new species. Acta Parasitologica 60: Han, H., Y. Wu, H. Dong, S. Zhu, L. Li, Q. Zhao, D. Wu, E. Pei, Y. Wang, and B. Huang First report of Hepatozoon (Apicomplexa: Adeleorina) from king ratsnakes (Elaphe carinata) in Shanghai, with description of a new species. Acta Parasitologica 60: Han, H., Y. Wu, H. Dong, S. Zhu, L. Li, Q. Zhao, D. Wu, E. Pei, Y. Wang, and B. Huang First report of Hepatozoon (Apicomplexa: Adeleorina) from king ratsnakes (Elaphe carinata) in Shanghai, with description of a new species. Acta Parasitologica 60: Han, H., Y. Wu, H. Dong, S. Zhu, L. Li, Q. Zhao, D. Wu, E. Pei, Y. Wang, and B. Huang First report of Hepatozoon (Apicomplexa: Adeleorina) from king ratsnakes (Elaphe carinata) in Shanghai, with description of a new species. Acta Parasitologica 60: Han, H., Y. Wu, H. Dong, S. Zhu, L. Li, Q. Zhao, D. Wu, E. Pei, Y. Wang, and B. Huang First report of Hepatozoon (Apicomplexa: Adeleorina) from king ratsnakes (Elaphe carinata) in Shanghai, with description of a new species. Acta Parasitologica 60: Han, H., Y. Wu, H. Dong, S. Zhu, L. Li, Q. Zhao, D. Wu, E. Pei, Y. Wang, and B. Huang First report of Hepatozoon (Apicomplexa: Adeleorina) from king ratsnakes (Elaphe carinata) in Shanghai, with description of a new species. Acta Parasitologica 60: Harris, D. J., D. M. Borges-Nojosa, and J. P. Maia Prevalence and Diversity of Hepatozoon in Native and Exotic Geckos from Brazil. Journal of Parasitology 101: Unpublished. Salama,A.S., Adham,F.K. and Abdel Samie,E.M. Confirmation the presence of the blood parasite Hepatozoon sp. From Cerastes cerastes cerastes, and its effect on some biological parameters of the Culex pipiens complex. Harris, D. J., D. M. Borges-Nojosa, and J. P. Maia Prevalence and Diversity of Hepatozoon in Native and Exotic Geckos from Brazil. Journal of Parasitology 101: Harris, D. J., D. M. Borges-Nojosa, and J. P. Maia Prevalence and Diversity of Hepatozoon in Native and Exotic Geckos from Brazil. Journal of Parasitology 101: Harris, D. J., D. M. Borges-Nojosa, and J. P. Maia Prevalence and Diversity of Hepatozoon in Native and Exotic Geckos from Brazil. Journal of Parasitology 101: Maia, J. P., A. Crottini, and D. J. Harris Microscopic and molecular characterization of Hepatozoon domerguei (Apicomplexa) and Foleyella furcata (Nematoda) in wild endemic reptiles from Madagascar. Parasite (Paris, France) 21: 47. Maia, J. P., A. Crottini, and D. J. Harris Microscopic and molecular characterization of Hepatozoon domerguei (Apicomplexa) and Foleyella furcata (Nematoda) in wild endemic reptiles from Madagascar. Parasite (Paris, France) 21: 47. Maia, J. P., A. Crottini, and D. J. Harris Microscopic and molecular characterization of Hepatozoon domerguei (Apicomplexa) and Foleyella furcata (Nematoda) in wild endemic reptiles from Madagascar. Parasite (Paris, France) 21: 47. Maia, J. P., A. Crottini, and D. J. Harris Microscopic and molecular characterization of Hepatozoon domerguei (Apicomplexa) and Foleyella furcata (Nematoda) in wild endemic reptiles from Madagascar. Parasite (Paris, France) 21: 47. Maia, J. P., A. Crottini, and D. J. Harris Microscopic and molecular characterization of Hepatozoon domerguei (Apicomplexa) and Foleyella furcata (Nematoda) in wild endemic reptiles from Madagascar. Parasite (Paris, France) 21: 47. Unpublished. Alsarraf,M.F., Bednarska,M., Mohallal,E.M.E., Mierzejewska,E.J., Behnke-Borowczyk,J., Zalat,S., Gilbert,F., Welc-Faleciak,R., Behnke,J.M. and Bajer,A. Long-term spatiotemporal stability and dynamic changes in haemoparasite community of spiny mice (Acomys dimidiatus) in four montane wadis in the St. Katherine Protectorate, Sinai, Egypt. Unpublished. Alsarraf,M.F., Bednarska,M., Mohallal,E.M.E., Mierzejewska,E.J., Behnke-Borowczyk,J., Zalat,S., Gilbert,F., Welc-Faleciak,R., Behnke,J.M. and Bajer,A. Long-term spatiotemporal stability and dynamic changes in haemoparasite community of spiny mice (Acomys dimidiatus) in four montane wadis in the St. Katherine Protectorate, Sinai, Egypt. Unpublished. Alsarraf,M.F., Bednarska,M., Mohallal,E.M.E., Mierzejewska,E.J., Behnke-Borowczyk,J., Zalat,S., Gilbert,F., Welc-Faleciak,R., Behnke,J.M. and Bajer,A. Long-term spatiotemporal stability and dynamic changes in haemoparasite community of spiny mice (Acomys dimidiatus) in four montane wadis in the St. Katherine Protectorate, Sinai, Egypt. Unpublished. Alsarraf,M.F., Bednarska,M., Mohallal,E.M.E., Mierzejewska,E.J., Behnke-Borowczyk,J., Zalat,S., Gilbert,F., Welc-Faleciak,R., Behnke,J.M. and Bajer,A. Long-term spatiotemporal stability and dynamic changes in haemoparasite community of spiny mice (Acomys dimidiatus) in four montane wadis in the St. Katherine Protectorate, Sinai, Egypt. Unpublished. Alsarraf,M.F., Bednarska,M., Mohallal,E.M.E., Mierzejewska,E.J., Behnke-Borowczyk,J., Zalat,S., Gilbert,F., Welc-Faleciak,R., Behnke,J.M. and Bajer,A. Long-term spatiotemporal stability and dynamic changes in haemoparasite community of spiny mice (Acomys dimidiatus) in four montane wadis in the St. Katherine Protectorate, Sinai, Egypt. Unpublished. Alsarraf,M.F., Bednarska,M., Mohallal,E.M.E., Mierzejewska,E.J., Behnke-Borowczyk,J., Zalat,S., Gilbert,F., Welc-Faleciak,R., Behnke,J.M. and Bajer,A. Long-term spatiotemporal stability and dynamic changes in haemoparasite community of spiny mice (Acomys dimidiatus) in four montane wadis in the St. Katherine Protectorate, Sinai, Egypt. Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology

87 Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology

88 Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Unpublished. Majlathova,V., Majlath,I., Vichova,B., Hromada,M., Ekner,A. And Tryjanowski,P. Molecular characterization of blood parasites infecting lizards in Poland. Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Harris, D. J., J. P. M. C. Maia, and A. Perera Molecular survey of Apicomplexa in Podarcis wall lizards detects Hepatozoon, Sarcocystis, and Eimeria species. Journal of Parasitology 98: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Tomé, B., J. P. M. C. Maia, and D. J. Harris Hepatozoon infection prevalence in four snake genera: Influence of diet, prey parasitemia levels, or parasite type? Journal of Parasitology 98: Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97: Maia, J. P. M. C., D. J. Harris, and A. Perera Molecular survey of Hepatozoon species in lizards from North Africa. Journal of parasitology 97:

89 Harris, D. J., J. P. M. C. Maia, and A. Perera Molecular survey of Apicomplexa in Podarcis wall lizards detects Hepatozoon, Sarcocystis, and Eimeria species. Journal of Parasitology 98: Harris, D. J., J. P. M. C. Maia, and A. Perera Molecular survey of Apicomplexa in Podarcis wall lizards detects Hepatozoon, Sarcocystis, and Eimeria species. Journal of Parasitology 98: Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Damas-Moreira, I., D. J. Harris, D. Rosado, I. Tavares, J. P. Maia, and A. Perera Consequences of haemogregarine infection on the escape distance in the lacertid lizard, Podarcis vaucheri. Acta Herpetologica 9: Damas-Moreira, I., D. J. Harris, D. Rosado, I. Tavares, J. P. Maia, and A. Perera Consequences of haemogregarine infection on the escape distance in the lacertid lizard, Podarcis vaucheri. Acta Herpetologica 9: Damas-Moreira, I., D. J. Harris, D. Rosado, I. Tavares, J. P. Maia, and A. Perera Consequences of haemogregarine infection on the escape distance in the lacertid lizard, Podarcis vaucheri. Acta Herpetologica 9: Damas-Moreira, I., D. J. Harris, D. Rosado, I. Tavares, J. P. Maia, and A. Perera Consequences of haemogregarine infection on the escape distance in the lacertid lizard, Podarcis vaucheri. Acta Herpetologica 9: Damas-Moreira, I., D. J. Harris, D. Rosado, I. Tavares, J. P. Maia, and A. Perera Consequences of haemogregarine infection on the escape distance in the lacertid lizard, Podarcis vaucheri. Acta Herpetologica 9:

90 Tomé, B., J. P. M. C. Maia, and D. J. Harris Hepatozoon infection prevalence in four snake genera: Influence of diet, prey parasitemia levels, or parasite type? Journal of Parasitology 98: Tomé, B., J. P. M. C. Maia, and D. J. Harris Molecular assessment of apicomplexan parasites in the snake Psammophis from north Africa: Do multiple parasite lineages reflect the final vertebrate host diet. Journal of Parasitology 99: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Tomé, B., J. P. Maia, D. Salvi, J. C. Brito, M. a Carretero, A. Perera, H. Meimberg, and D. J. Harris Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin. Systematic Parasitology 87: Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Maia, J. P., D. J. Harris, S. Carranza, and E. Gómez-Díaz A comparison of multiple methods for estimating parasitemia of Hemogregarine Hemoparasites (Apicomplexa: Adeleorina) and its application for studying infection in natural populations. PloS one 9: e Haklová-Kočíková, B., A. Hižňanová, I. Majláth, K. Račka, D. Harris, G. Földvári, P. Tryjanowski, N. Kokošová, B. Malčeková, and V. Majláthová Morphological and molecular characterization of Karyolysus a neglected but common parasite infecting some European lizards. Parasites & Vectors 7: 555. Haklová-Kočíková, B., A. Hižňanová, I. Majláth, K. Račka, D. Harris, G. Földvári, P. Tryjanowski, N. Kokošová, B. Malčeková, and V. Majláthová Morphological and molecular characterization of Karyolysus a neglected but common parasite infecting some European lizards. Parasites & Vectors 7: 555. Haklová-Kočíková, B., A. Hižňanová, I. Majláth, K. Račka, D. Harris, G. Földvári, P. Tryjanowski, N. Kokošová, B. Malčeková, and V. Majláthová Morphological and molecular characterization of Karyolysus a neglected but common parasite infecting some European lizards. Parasites & Vectors 7: 555. Haklová-Kočíková, B., A. Hižňanová, I. Majláth, K. Račka, D. Harris, G. Földvári, P. Tryjanowski, N. Kokošová, B. Malčeková, and V. Majláthová Morphological and molecular characterization of Karyolysus a neglected but common parasite infecting some European lizards. Parasites & Vectors 7: 555. Haklová-Kočíková, B., A. Hižňanová, I. Majláth, K. Račka, D. Harris, G. Földvári, P. Tryjanowski, N. Kokošová, B. Malčeková, and V. Majláthová Morphological and molecular characterization of Karyolysus a neglected but common parasite infecting some European lizards. Parasites & Vectors 7: 555. Haklová-Kočíková, B., A. Hižňanová, I. Majláth, K. Račka, D. Harris, G. Földvári, P. Tryjanowski, N. Kokošová, B. Malčeková, and V. Majláthová Morphological and molecular characterization of Karyolysus a neglected but common parasite infecting some European lizards. Parasites & Vectors 7: 555.

91 Haklová-Kočíková, B., A. Hižňanová, I. Majláth, K. Račka, D. Harris, G. Földvári, P. Tryjanowski, N. Kokošová, B. Malčeková, and V. Majláthová Morphological and molecular characterization of Karyolysus a neglected but common parasite infecting some European lizards. Parasites & Vectors 7: 555. Haklová-Kočíková, B., A. Hižňanová, I. Majláth, K. Račka, D. Harris, G. Földvári, P. Tryjanowski, N. Kokošová, B. Malčeková, and V. Majláthová Morphological and molecular characterization of Karyolysus a neglected but common parasite infecting some European lizards. Parasites & Vectors 7: 555. Tomé, B., C. Rato, A. Perera, and D. J. Harris High diversity of Hepatozoon spp. in geckos of the genus Tarentola. The Journal of parasitology Sakuma, M., T. Nishio, N. Nakanishi, M. Izawa, Y. Asari, M. Okamura, T. Shimokawa Miyama, A. Setoguchi, and Y. Endo A case of Iriomote cat (Prionailurus bengalensis iriomotensis) with Hepatozoon felis parasitemia. The Journal of veterinary medical science / the Japanese Society of Veterinary Science 73: Salakij, C., J. Salakij, N. A. Narkkong, T. Sirinarumitr, and R. Pattanarangsan Hematologic, cytochemical, ultrastructural, and molecular findings of Hepatozoon-infected flatheaded cats (Prionailurus planiceps). Veterinary Clinical Pathology 37: Sakuma, M., T. Nishio, N. Nakanishi, M. Izawa, Y. Asari, M. Okamura, T. Shimokawa Miyama, A. Setoguchi, and Y. Endo A case of Iriomote cat (Prionailurus bengalensis iriomotensis) with Hepatozoon felis parasitemia. The Journal of veterinary medical science / the Japanese Society of Veterinary Science 73: Sakuma, M., T. Nishio, N. Nakanishi, M. Izawa, Y. Asari, M. Okamura, T. Shimokawa Miyama, A. Setoguchi, and Y. Endo A case of Iriomote cat (Prionailurus bengalensis iriomotensis) with Hepatozoon felis parasitemia. The Journal of veterinary medical science / the Japanese Society of Veterinary Science 73:

92

93 Johnson, E. M., K. E. Allen, R. J. Panciera, S. A. Ewing, and S. E. Little Experimental transmission of Hepatozoon americanum to New Zealand White rabbits (Oryctolagus cuniculus) and infectivity of cystozoites for a dog. Veterinary parasitology 164: Johnson, E. M., K. E. Allen, R. J. Panciera, S. A. Ewing, and S. E. Little Experimental transmission of Hepatozoon americanum to New Zealand White rabbits (Oryctolagus cuniculus) and infectivity of cystozoites for a dog. Veterinary parasitology 164: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Sumrandee, C., V. Baimai, W. Trinachartvanit, and A. Ahantarig Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks and Tick-borne Diseases 6: Sumrandee, C., V. Baimai, W. Trinachartvanit, and A. Ahantarig Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks and Tick-borne Diseases 6: Unpublished. Braga,I.A., Dias,I.S.O., Ramos,D.G.S., Chitarra,C.S., Nakazato,L., Dutra,V., Pacheco,R.C., Amude,A.M. and de Aguiar,D.M. Hepatozoon felis in domestic cats from Brazil. André, M. R., H. M. Herrera, S. de Jesus Fernandes, K. C. M. de Sousa, L. R. Gonçalves, I. H. Domingos, G. C. de Macedo, and R. Z. Machado Tick-borne agents in domesticated and stray cats from the city of Campo Grande, state of Mato Grosso do Sul, midwestern Brazil. Ticks and Tick-borne Diseases 6: Sumrandee, C., V. Baimai, W. Trinachartvanit, and A. Ahantarig Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks and Tick-borne Diseases 6: Sumrandee, C., V. Baimai, W. Trinachartvanit, and A. Ahantarig Hepatozoon and Theileria species detected in ticks collected from mammals and snakes in Thailand. Ticks and Tick-borne Diseases 6: Unpublished. Matsuo,K. and Abe,N. Molecular identification of Hepatozoon found in a wild boar in Gifu Prefecture. Maia, C., C. Ramos, M. Coimbra, F. Bastos, A. Martins, P. Pinto, M. Nunes, M. L. Vieira, L. Cardoso, and L. Campino Bacterial and protozoal agents of feline vector-borne diseases in domestic and stray cats from southern Portugal. Parasites & vectors 7: 115. Maia, C., C. Ramos, M. Coimbra, F. Bastos, A. Martins, P. Pinto, M. Nunes, M. L. Vieira, L. Cardoso, and L. Campino Bacterial and protozoal agents of feline vector-borne diseases in domestic and stray cats from southern Portugal. Parasites & vectors 7: 115. Maia, C., C. Ramos, M. Coimbra, F. Bastos, A. Martins, P. Pinto, M. Nunes, M. L. Vieira, L. Cardoso, and L. Campino Bacterial and protozoal agents of feline vector-borne diseases in domestic and stray cats from southern Portugal. Parasites & vectors 7: 115. Maia, C., C. Ramos, M. Coimbra, F. Bastos, A. Martins, P. Pinto, M. Nunes, M. L. Vieira, L. Cardoso, and L. Campino Bacterial and protozoal agents of feline vector-borne diseases in domestic and stray cats from southern Portugal. Parasites & vectors 7: 115. Maia, C., C. Ramos, M. Coimbra, F. Bastos, A. Martins, P. Pinto, M. Nunes, M. L. Vieira, L. Cardoso, and L. Campino Bacterial and protozoal agents of feline vector-borne diseases in domestic and stray cats from southern Portugal. Parasites & vectors 7: 115. Maia, C., C. Ramos, M. Coimbra, F. Bastos, A. Martins, P. Pinto, M. Nunes, M. L. Vieira, L. Cardoso, and L. Campino Bacterial and protozoal agents of feline vector-borne diseases in domestic and stray cats from southern Portugal. Parasites & vectors 7: 115. Maia, C., C. Ramos, M. Coimbra, F. Bastos, A. Martins, P. Pinto, M. Nunes, M. L. Vieira, L. Cardoso, and L. Campino Bacterial and protozoal agents of feline vector-borne diseases in domestic and stray cats from southern Portugal. Parasites & vectors 7: 115. Maia, C., C. Ramos, M. Coimbra, F. Bastos, A. Martins, P. Pinto, M. Nunes, M. L. Vieira, L. Cardoso, and L. Campino Bacterial and protozoal agents of feline vector-borne diseases in domestic and stray cats from southern Portugal. Parasites & vectors 7: 115. Criado-Fornelio, A., J. Ruas, N. Casado, N. A. R. Farias, M. P. Soares, G. Müller, J. G. W. Brumt, M. E. A. Berne, A. Buling-Saraña, and J. C. Barba-Carretero New molecular data on mammalian Hepatozoon species (Apicomplexa: Adeleorina) from Brazil and Spain. The Journal of parasitology 92: Criado-Fornelio, A., J. Ruas, N. Casado, N. A. R. Farias, M. P. Soares, G. Müller, J. G. W. Brumt, M. E. A. Berne, A. Buling-Saraña, and J. C. Barba-Carretero New molecular data on mammalian Hepatozoon species (Apicomplexa: Adeleorina) from Brazil and Spain. The Journal of parasitology 92: Pawar, R. M., A. Poornachandar, P. Srinivas, K. R. Rao, U. Lakshmikantan, and S. Shivaji Molecular characterization of Hepatozoon spp. infection in endangered Indian wild felids and canids. Veterinary parasitology 186: Salakij, C., J. Salakij, N. A. Narkkong, T. Sirinarumitr, and R. Pattanarangsan Hematologic, cytochemical, ultrastructural, and molecular findings of Hepatozoon-infected flatheaded cats (Prionailurus planiceps). Veterinary Clinical Pathology 37: Pawar, R. M., A. Poornachandar, P. Srinivas, K. R. Rao, U. Lakshmikantan, and S. Shivaji Molecular characterization of Hepatozoon spp. infection in endangered Indian wild felids and canids. Veterinary parasitology 186: Pawar, R. M., A. Poornachandar, P. Srinivas, K. R. Rao, U. Lakshmikantan, and S. Shivaji Molecular characterization of Hepatozoon spp. infection in endangered Indian wild felids and canids. Veterinary parasitology 186: Pawar, R. M., A. Poornachandar, P. Srinivas, K. R. Rao, U. Lakshmikantan, and S. Shivaji Molecular characterization of Hepatozoon spp. infection in endangered Indian wild felids and canids. Veterinary parasitology 186: Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research East, M. L., G. Wibbelt, D. Lieckfeldt, A. Ludwig, K. Goller, K. Wilhelm, G. Schares, D. Thierer, and H. Hofer A Hepatozoon species genetically distinct from H. canis infecting spotted hyenas in the Serengeti ecosystem, Tanzania. Journal of wildlife diseases 44: Unpublished. Shock,B.C. and Yabsley,M.J. Piroplasms detected in blood-fed and questing ticks from five states: zoonotic potential, wildlife reservoirs, and a possible vector for Babesia sp. Coco. Unpublished. Shock,B.C. and Yabsley,M.J. Piroplasms detected in blood-fed and questing ticks from five states: zoonotic potential, wildlife reservoirs, and a possible vector for Babesia sp. Coco. Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research

94 Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research Unpublished. Zhang,J. Molecular detection of tick-borne pathogens in cheetah and lions from Zimbabwe. Unpublished. Zhang,J. Molecular detection of tick-borne pathogens in cheetah and lions from Zimbabwe. Criado-Fornelio, A., A. Buling, N. Casado, C. Gimenez, J. Ruas, L. Wendt, N. Rosa-Farias, M. Pinheiro, C. Rey-Valeiron, and J. C. Barba-Carretero Molecular characterization of arthropod-borne hematozoans in wild mammals from Brazil, Venezuela and Spain. Acta Parasitologica 54: Simpson, V. R., R. J. Panciera, J. Hargreaves, J. W. McGarry, S. F. E. Scholes, K. J. Bown, and R. J. Birtles Myocarditis and myositis due to infection with Hepatozoon species in pine martens (Martes martes) in Scotland. Veterinary Record 156: Ikawa, K., M. Aoki, M. Ichikawa, and T. Itagaki The first detection of Babesia species DNA from Japanese black bears (Ursus thibetanus japonicus) in Japan. Parasitology International 60: Kubo, M., S. Uni, T. Agatsuma, M. Nagataki, R. J. Panciera, T. Tsubota, S. Nakamura, H. Sakai, T. Masegi, and T. Yanai Hepatozoon ursi n. sp. (Apicomplexa: Hepatozoidae) in Japanese black bear (Ursus thibetanus japonicus). Parasitology international 57: Kubo, M., S. Uni, T. Agatsuma, M. Nagataki, R. J. Panciera, T. Tsubota, S. Nakamura, H. Sakai, T. Masegi, and T. Yanai Hepatozoon ursi n. sp. (Apicomplexa: Hepatozoidae) in Japanese black bear (Ursus thibetanus japonicus). Parasitology international 57: Pawar, R. M., A. Poornachandar, A. S. Arun, S. Manikandan, and S. Shivaji Molecular prevalence and characterization of Hepatozoon ursi infection in Indian sloth bears (Melursus ursinus). Veterinary Parasitology 182: Pawar, R. M., A. Poornachandar, A. S. Arun, S. Manikandan, and S. Shivaji Molecular prevalence and characterization of Hepatozoon ursi infection in Indian sloth bears (Melursus ursinus). Veterinary Parasitology 182: Pawar, R. M., A. Poornachandar, A. S. Arun, S. Manikandan, and S. Shivaji Molecular prevalence and characterization of Hepatozoon ursi infection in Indian sloth bears (Melursus ursinus). Veterinary Parasitology 182: Pawar, R. M., A. Poornachandar, A. S. Arun, S. Manikandan, and S. Shivaji Molecular prevalence and characterization of Hepatozoon ursi infection in Indian sloth bears (Melursus ursinus). Veterinary Parasitology 182: Pawar, R. M., A. Poornachandar, A. S. Arun, S. Manikandan, and S. Shivaji Molecular prevalence and characterization of Hepatozoon ursi infection in Indian sloth bears (Melursus ursinus). Veterinary Parasitology 182: Pawar, R. M., A. Poornachandar, A. S. Arun, S. Manikandan, and S. Shivaji Molecular prevalence and characterization of Hepatozoon ursi infection in Indian sloth bears (Melursus ursinus). Veterinary Parasitology 182: Pawar, R. M., A. Poornachandar, A. S. Arun, S. Manikandan, and S. Shivaji Molecular prevalence and characterization of Hepatozoon ursi infection in Indian sloth bears (Melursus ursinus). Veterinary Parasitology 182: Pawar, R. M., A. Poornachandar, A. S. Arun, S. Manikandan, and S. Shivaji Molecular prevalence and characterization of Hepatozoon ursi infection in Indian sloth bears (Melursus ursinus). Veterinary Parasitology 182: Pawar, R. M., A. Poornachandar, A. S. Arun, S. Manikandan, and S. Shivaji Molecular prevalence and characterization of Hepatozoon ursi infection in Indian sloth bears (Melursus ursinus). Veterinary Parasitology 182: Kubo, M., M. Nagataki, T. Agatsuma, H. Sakai, T. Masegi, R. J. Panciera, and T. Yanai Parasitological and molecular features of the hepatozoon species in the myocardium of Japanese Martens (Martes melampus melampus). Journal of Parasitology 95: Kubo, M., M. Nagataki, T. Agatsuma, H. Sakai, T. Masegi, R. J. Panciera, and T. Yanai Parasitological and molecular features of the hepatozoon species in the myocardium of Japanese Martens (Martes melampus melampus). Journal of Parasitology 95: Kubo, M., M. Nagataki, T. Agatsuma, H. Sakai, T. Masegi, R. J. Panciera, and T. Yanai Parasitological and molecular features of the hepatozoon species in the myocardium of Japanese Martens (Martes melampus melampus). Journal of Parasitology 95: Kubo, M., M. Nagataki, T. Agatsuma, H. Sakai, T. Masegi, R. J. Panciera, and T. Yanai Parasitological and molecular features of the hepatozoon species in the myocardium of Japanese Martens (Martes melampus melampus). Journal of Parasitology 95: Kubo, M., M. Nagataki, T. Agatsuma, H. Sakai, T. Masegi, R. J. Panciera, and T. Yanai Parasitological and molecular features of the hepatozoon species in the myocardium of Japanese Martens (Martes melampus melampus). Journal of Parasitology 95: Kubo, M., M. Nagataki, T. Agatsuma, H. Sakai, T. Masegi, R. J. Panciera, and T. Yanai Parasitological and molecular features of the hepatozoon species in the myocardium of Japanese Martens (Martes melampus melampus). Journal of Parasitology 95: Kubo, M., M. Nagataki, T. Agatsuma, H. Sakai, T. Masegi, R. J. Panciera, and T. Yanai Parasitological and molecular features of the hepatozoon species in the myocardium of Japanese Martens (Martes melampus melampus). Journal of Parasitology 95: Kubo, M., M. Nagataki, T. Agatsuma, H. Sakai, T. Masegi, R. J. Panciera, and T. Yanai Parasitological and molecular features of the hepatozoon species in the myocardium of Japanese Martens (Martes melampus melampus). Journal of Parasitology 95: Najm, N. A., E. Meyer-Kayser, L. Hoffmann, I. Herb, V. Fensterer, K. Pfister, and C. Silaghi A molecular survey of Babesia spp. and Theileria spp. in red foxes () and their ticks from Thuringia, Germany. Ticks and Tick-borne Diseases 5: Unpublished. Shock,B.C. and Yabsley,M.J. Piroplasms detected in blood-fed and questing ticks from five states: zoonotic potential, wildlife reservoirs, and a possible vector for Babesia sp. Coco. Najm, N.-A., E. Meyer-Kayser, L. Hoffmann, K. Pfister, and C. Silaghi Hepatozoon canis in German red foxes () and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp. Parasitology research 113: Mathew, J. S., R. A. Van Den Bussche, S. A. Ewing, J. R. Malayer, B. R. Latha, and R. J. Panciera Phylogenetic relationships of Hepatozoon (Apicomplexa: Adeleorina) based on molecular, morphologic, and life-cycle characters. The Journal of parasitology 86: Criado-Fornelio, A., J. Ruas, N. Casado, N. A. R. Farias, M. P. Soares, G. Müller, J. G. W. Brumt, M. E. A. Berne, A. Buling-Saraña, and J. C. Barba-Carretero New molecular data on mammalian Hepatozoon species (Apicomplexa: Adeleorina) from Brazil and Spain. The Journal of parasitology 92: Paludo, G. R., H. Friedmann, A. Dell Porto, D. K. Macintire, E. M. Whitley, M. K. Boudreaux, G. Baneth, B. L. Blagburn, and C. C. Dykstra Hepatozoon spp.: pathological and partial 18S rrna sequence analysis from three Brazilian dogs. Parasitology research 97: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Johnson, E. M., K. E. Allen, M. A. Breshears, R. J. Panciera, S. E. Little, and S. A. Ewing Experimental transmission of Hepatozoon americanum to rodents. Veterinary parasitology 151: Johnson, E. M., K. E. Allen, M. A. Breshears, R. J. Panciera, S. E. Little, and S. A. Ewing Experimental transmission of Hepatozoon americanum to rodents. Veterinary parasitology 151: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99:

95 Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Almeida, A. P., T. D. Souza, A. Marcili, and B. Marcelo Novel Ehrlichia and Hepatozoon Agents Infecting the Crab-Eating Fox (Cerdocyon thous) in Southeastern Brazil. Journal of Medical Entomology 50: Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research Williams, B. M., A. Berentsen, B. C. Shock, M. Teixiera, M. R. Dunbar, M. S. Becker, and M. J. Yabsley Prevalence and diversity of Babesia, Hepatozoon, Ehrlichia, and Bartonella in wild and domestic carnivores from Zambia, Africa. Parasitology research Unpublished. Metzger,B., Furtado,M.M., Spenassatto,C., Demoner,L.C., Jacomo,A.T.A., Porfirio,G.E.O., Silveira,L., Sollmann,R., Torres,N.M., Ferreira Neto,J.S. and O'Dwyer,L.H. The first molecular identification of Hepatozoon sp. (Apicomplexa: Hepatozoidae) in Nasua nasua (Carnivora: Procyonidae) from Brazil. Sasaki, M., O. Omobowale, K. Ohta, M. Tozuka, A. Matsuu, H. Hirata, H. O. Nottidge, H. Ikadai, and T. Oyamada A PCR-based epidemiological survey of Hepatozoon canis in dogs in Nigeria. The Journal of veterinary medical science / the Japanese Society of Veterinary Science 70: Götsch, S., M. Leschnik, G. G. Duscher, J. P. Burgstaller, W. Wille-Piazzai, and A. Joachim Ticks and haemoparasites of dogs from Praia, Cape Verde. Veterinary parasitology 166: Inokuma, H., M. Okuda, K. Ohno, K. Shimoda, and T. Onishi Analysis of the 18S rrna gene sequence of a Hepatozoon detected in two Japanese dogs. Veterinary parasitology 106: Criado-Fornelio, A., A. Martinez-Marcos, A. Buling-Saraña, and J. C. Barba-Carretero Molecular studies on Babesia, Theileria and Hepatozoon in southern Europe. Veterinary Parasitology 113: Criado-Fornelio, A., J. Ruas, N. Casado, N. A. R. Farias, M. P. Soares, G. Müller, J. G. W. Brumt, M. E. A. Berne, A. Buling-Saraña, and J. C. Barba-Carretero New molecular data on mammalian Hepatozoon species (Apicomplexa: Adeleorina) from Brazil and Spain. The Journal of parasitology 92: Criado-Fornelio, A., J. Ruas, N. Casado, N. A. R. Farias, M. P. Soares, G. Müller, J. G. W. Brumt, M. E. A. Berne, A. Buling-Saraña, and J. C. Barba-Carretero New molecular data on mammalian Hepatozoon species (Apicomplexa: Adeleorina) from Brazil and Spain. The Journal of parasitology 92: Paludo, G. R., H. Friedmann, A. Dell Porto, D. K. Macintire, E. M. Whitley, M. K. Boudreaux, G. Baneth, B. L. Blagburn, and C. C. Dykstra Hepatozoon spp.: pathological and partial 18S rrna sequence analysis from three Brazilian dogs. Parasitology research 97: Paludo, G. R., H. Friedmann, A. Dell Porto, D. K. Macintire, E. M. Whitley, M. K. Boudreaux, G. Baneth, B. L. Blagburn, and C. C. Dykstra Hepatozoon spp.: pathological and partial 18S rrna sequence analysis from three Brazilian dogs. Parasitology research 97: Paludo, G. R., H. Friedmann, A. Dell Porto, D. K. Macintire, E. M. Whitley, M. K. Boudreaux, G. Baneth, B. L. Blagburn, and C. C. Dykstra Hepatozoon spp.: pathological and partial 18S rrna sequence analysis from three Brazilian dogs. Parasitology research 97: Forlano, M. D., K. R. S. Teixeira, A. Scofield, C. Elisei, K. S. C. Yotoko, K. R. Fernandes, G. F. C. Linhares, S. A. Ewing, and C. L. Massard Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp. Veterinary Parasitology 145: Rubini, A. S., K. dos Santos Paduan, G. G. Cavalcante, P. E. M. Ribolla, and L. H. O Dwyer Molecular identification and characterization of canine Hepatozoon species from Brazil. Parasitology research 97: Lasta, C. S., A. P. dos Santos, F. P. da S. Mello, L. D. A. Lacerda, J. B. Messick, and F. H. Díaz González Hepatozoon canis infection in a domestic dog in Southern Brazil confirmed by molecular techniques. Ciência Rural 39: Vojta, L., V. Mrljak, S. Curković, T. Zivicnjak, A. Marinculić, and R. Beck Molecular epizootiology of canine hepatozoonosis in Croatia. International journal for parasitology 39: Rubini, A. S., K. S. Paduan, T. F. Martins, M. B. Labruna, and L. H. O Dwyer Acquisition and transmission of Hepatozoon canis (Apicomplexa: Hepatozoidae) by the tick Amblyomma ovale (Acari: Ixodidae). Veterinary parasitology 164: Ramos, R., C. Ramos, F. Araújo, R. Oliveira, I. Souza, D. Pimentel, M. Galindo, M. Santana, E. Rosas, M. Faustino, et al Molecular survey and genetic characterization of tickborne pathogens in dogs in metropolitan Recife (north-eastern Brazil). Parasitology Research 107: Pereira, A. M., A. de M. F. Cerqueira, P. B. Velho, A. G. de Sá, R. F. Ferreira, D. de B. Macieira, N. S. Moreira, C. N. Fonseca, M. de S. Xavier, S. G. Leite, et al Occurrence of Hepatozoon spp. in naturally infected dogs from Piraí, Rio de Janeiro, Brazil. R. Bras. Ci. Vet. 18: Gabrielli, S., S. Kumlien, P. Calderini, A. Brozzi, A. Iori, and G. Cancrini The first report of Hepatozoon canis identified in and ticks from Italy. Vector borne and zoonotic diseases 10: Gabrielli, S., S. Kumlien, P. Calderini, A. Brozzi, A. Iori, and G. Cancrini The first report of Hepatozoon canis identified in and ticks from Italy. Vector borne and zoonotic diseases 10: Gabrielli, S., S. Kumlien, P. Calderini, A. Brozzi, A. Iori, and G. Cancrini The first report of Hepatozoon canis identified in and ticks from Italy. Vector borne and zoonotic diseases 10: Gabrielli, S., S. Kumlien, P. Calderini, A. Brozzi, A. Iori, and G. Cancrini The first report of Hepatozoon canis identified in and ticks from Italy. Vector borne and zoonotic diseases 10: Gabrielli, S., S. Kumlien, P. Calderini, A. Brozzi, A. Iori, and G. Cancrini The first report of Hepatozoon canis identified in and ticks from Italy. Vector borne and zoonotic diseases 10: Gabrielli, S., S. Kumlien, P. Calderini, A. Brozzi, A. Iori, and G. Cancrini The first report of Hepatozoon canis identified in and ticks from Italy. Vector borne and zoonotic diseases 10: de Miranda, R. L., J. R. de Castro, M. M. M. Oleg??rio, M. E. Beletti, A. V. Mundim, L. H. O&apos;Dwyer, O. Eyal, D. Talmi-Frank, M. C. Cury, and G. Baneth Oocysts of Hepatozoon canis in Rhipicephalus (Boophilus) microplus collected from a naturally infected dog. Veterinary Parasitology 177: Spolidorio, M. G., M. D. M. Torres, W. N. D. S. Campos, A. L. T. Melo, M. Igarashi, A. M. Amude, M. B. Labruna, and D. M. Aguiar Molecular detection of Hepatozoon canis and Babesia canis vogeli in domestic dogs from Cuiabá, Brazil. Revista brasileira de parasitologia veterinária = Brazilian journal of veterinary parasitology : Órgão Oficial do Colégio Ramos, C. A. do N., V. J. Babo-Terra, T. C. Pedroso, A. F. Souza Filho, F. Ribeiro de Araújo, and H. P. K. Cleveland Molecular identification of Hepatozoon canis in dogs from Campo Grande, Mato Grosso do Sul, Brazil. Revista Brasileira de Parasitologia Veterinária 24: Hornok, S., B. Tánczos, I. G. F. De Mera, J. de la Fuente, R. Hofmann-Lehmann, and R. Farkas High prevalence of Hepatozoon-infection among shepherd dogs in a region considered to be free of Rhipicephalus sanguineus. Veterinary Parasitology Hornok, S., B. Tánczos, I. G. F. De Mera, J. de la Fuente, R. Hofmann-Lehmann, and R. Farkas High prevalence of Hepatozoon-infection among shepherd dogs in a region considered to be free of Rhipicephalus sanguineus. Veterinary Parasitology Hornok, S., B. Tánczos, I. G. F. De Mera, J. de la Fuente, R. Hofmann-Lehmann, and R. Farkas High prevalence of Hepatozoon-infection among shepherd dogs in a region considered to be free of Rhipicephalus sanguineus. Veterinary Parasitology Hornok, S., B. Tánczos, I. G. F. De Mera, J. de la Fuente, R. Hofmann-Lehmann, and R. Farkas High prevalence of Hepatozoon-infection among shepherd dogs in a region considered to be free of Rhipicephalus sanguineus. Veterinary Parasitology Hornok, S., B. Tánczos, I. G. F. De Mera, J. de la Fuente, R. Hofmann-Lehmann, and R. Farkas High prevalence of Hepatozoon-infection among shepherd dogs in a region considered to be free of Rhipicephalus sanguineus. Veterinary Parasitology Najm, N.-A., E. Meyer-Kayser, L. Hoffmann, K. Pfister, and C. Silaghi Hepatozoon canis in German red foxes () and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp. Parasitology research 113: Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303.

96 Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Unpublished. Aktas,M. and Ozubek,S. Molecular detection of tick-borne diseases in ixodid ticks removed from humans in Turkey. Unpublished. Aktas,M. and Ozubek,S. Molecular detection of tick-borne diseases in ixodid ticks removed from humans in Turkey. Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. de Miranda, R. L., L. H. O Dwyer, J. R. de Castro, B. Metzger, A. S. Rubini, A. V Mundim, O. Eyal, D. Talmi-Frank, M. C. Cury, and G. Baneth Prevalence and molecular characterization of Hepatozoon canis in dogs from urban and rural areas in Southeast Brazil. Research in veterinary science 97: Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Unpublished. Latrofa,M.S., Dantas-Torres,F., Giannelli,A. and Otranto,D. New Insights on the Vector Role of Rhipicephalus sanguineus Group Ticks. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88.

97 Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Karagenc, T. I., S. Pasa, G. Kirli, M. Hosgor, H. B. Bilgic, Y. H. Ozon, A. Atasoy, and H. Eren A parasitological, molecular and serological survey of Hepatozoon canis infection in dogs around the Aegean coast of Turkey. Veterinary parasitology 135: Karagenc, T. I., S. Pasa, G. Kirli, M. Hosgor, H. B. Bilgic, Y. H. Ozon, A. Atasoy, and H. Eren A parasitological, molecular and serological survey of Hepatozoon canis infection in dogs around the Aegean coast of Turkey. Veterinary parasitology 135: Karagenc, T. I., S. Pasa, G. Kirli, M. Hosgor, H. B. Bilgic, Y. H. Ozon, A. Atasoy, and H. Eren A parasitological, molecular and serological survey of Hepatozoon canis infection in dogs around the Aegean coast of Turkey. Veterinary parasitology 135: Karagenc, T. I., S. Pasa, G. Kirli, M. Hosgor, H. B. Bilgic, Y. H. Ozon, A. Atasoy, and H. Eren A parasitological, molecular and serological survey of Hepatozoon canis infection in dogs around the Aegean coast of Turkey. Veterinary parasitology 135: Oyamada, M., B. Davoust, M. Boni, J. Dereure, B. Bucheton, A. Hammad, K. Itamoto, M. Okuda, and H. Inokuma Detection of Babesia canis rossi, B. canis vogeli, and Hepatozoon canis in dogs in a village of eastern Sudan by using a screening PCR and sequencing methodologies. Clinical and diagnostic laboratory immunology 12: Oyamada, M., B. Davoust, M. Boni, J. Dereure, B. Bucheton, A. Hammad, K. Itamoto, M. Okuda, and H. Inokuma Detection of Babesia canis rossi, B. canis vogeli, and Hepatozoon canis in dogs in a village of eastern Sudan by using a screening PCR and sequencing methodologies. Clinical and diagnostic laboratory immunology 12: Oyamada, M., B. Davoust, M. Boni, J. Dereure, B. Bucheton, A. Hammad, K. Itamoto, M. Okuda, and H. Inokuma Detection of Babesia canis rossi, B. canis vogeli, and Hepatozoon canis in dogs in a village of eastern Sudan by using a screening PCR and sequencing methodologies. Clinical and diagnostic laboratory immunology 12: Oyamada, M., B. Davoust, M. Boni, J. Dereure, B. Bucheton, A. Hammad, K. Itamoto, M. Okuda, and H. Inokuma Detection of Babesia canis rossi, B. canis vogeli, and Hepatozoon canis in dogs in a village of eastern Sudan by using a screening PCR and sequencing methodologies. Clinical and diagnostic laboratory immunology 12: Oyamada, M., B. Davoust, M. Boni, J. Dereure, B. Bucheton, A. Hammad, K. Itamoto, M. Okuda, and H. Inokuma Detection of Babesia canis rossi, B. canis vogeli, and Hepatozoon canis in dogs in a village of eastern Sudan by using a screening PCR and sequencing methodologies. Clinical and diagnostic laboratory immunology 12: Oyamada, M., B. Davoust, M. Boni, J. Dereure, B. Bucheton, A. Hammad, K. Itamoto, M. Okuda, and H. Inokuma Detection of Babesia canis rossi, B. canis vogeli, and Hepatozoon canis in dogs in a village of eastern Sudan by using a screening PCR and sequencing methodologies. Clinical and diagnostic laboratory immunology 12: Rubini, A. S., K. dos Santos Paduan, G. G. Cavalcante, P. E. M. Ribolla, and L. H. O Dwyer Molecular identification and characterization of canine Hepatozoon species from Brazil. Parasitology research 97: Rubini, A. S., K. dos Santos Paduan, G. G. Cavalcante, P. E. M. Ribolla, and L. H. O Dwyer Molecular identification and characterization of canine Hepatozoon species from Brazil. Parasitology research 97: Rubini, A. S., K. dos Santos Paduan, G. G. Cavalcante, P. E. M. Ribolla, and L. H. O Dwyer Molecular identification and characterization of canine Hepatozoon species from Brazil. Parasitology research 97: Criado-Fornelio, A., J. Ruas, N. Casado, N. A. R. Farias, M. P. Soares, G. Müller, J. G. W. Brumt, M. E. A. Berne, A. Buling-Saraña, and J. C. Barba-Carretero New molecular data on mammalian Hepatozoon species (Apicomplexa: Adeleorina) from Brazil and Spain. The Journal of parasitology 92: Criado-Fornelio, A., J. Ruas, N. Casado, N. A. R. Farias, M. P. Soares, G. Müller, J. G. W. Brumt, M. E. A. Berne, A. Buling-Saraña, and J. C. Barba-Carretero New molecular data on mammalian Hepatozoon species (Apicomplexa: Adeleorina) from Brazil and Spain. The Journal of parasitology 92: Oyamada, M., B. Davoust, M. Boni, J. Dereure, B. Bucheton, A. Hammad, K. Itamoto, M. Okuda, and H. Inokuma Detection of Babesia canis rossi, B. canis vogeli, and Hepatozoon canis in dogs in a village of eastern Sudan by using a screening PCR and sequencing methodologies. Clinical and diagnostic laboratory immunology 12: Oyamada, M., B. Davoust, M. Boni, J. Dereure, B. Bucheton, A. Hammad, K. Itamoto, M. Okuda, and H. Inokuma Detection of Babesia canis rossi, B. canis vogeli, and Hepatozoon canis in dogs in a village of eastern Sudan by using a screening PCR and sequencing methodologies. Clinical and diagnostic laboratory immunology 12: Oyamada, M., B. Davoust, M. Boni, J. Dereure, B. Bucheton, A. Hammad, K. Itamoto, M. Okuda, and H. Inokuma Detection of Babesia canis rossi, B. canis vogeli, and Hepatozoon canis in dogs in a village of eastern Sudan by using a screening PCR and sequencing methodologies. Clinical and diagnostic laboratory immunology 12: Criado-Fornelio, A., C. Rey-Valeiron, A. Buling, J. C. Barba-Carretero, R. Jefferies, and P. J. Irwin New advances in molecular epizootiology of canine hematic protozoa from Venezuela, Thailand and Spain. Veterinary parasitology 144: Criado-Fornelio, A., C. Rey-Valeiron, A. Buling, J. C. Barba-Carretero, R. Jefferies, and P. J. Irwin New advances in molecular epizootiology of canine hematic protozoa from Venezuela, Thailand and Spain. Veterinary parasitology 144: Criado-Fornelio, A., C. Rey-Valeiron, A. Buling, J. C. Barba-Carretero, R. Jefferies, and P. J. Irwin New advances in molecular epizootiology of canine hematic protozoa from Venezuela, Thailand and Spain. Veterinary parasitology 144: Otranto, D., F. Dantas-Torres, S. Weigl, M. S. Latrofa, D. Stanneck, D. Decaprariis, G. Capelli, and G. Baneth Diagnosis of Hepatozoon canis in young dogs by cytology and PCR. Parasites & vectors 4: 55. Dantas-Torres, F., M. S. Latrofa, S. Weigl, V. D. Tarallo, R. P. Lia, and D. Otranto Hepatozoon canis infection in ticks during spring and summer in Italy. Parasitology research 110: Qablan, M. A., M. Kubelová, P. Široký, D. Modrý, and Z. S. Amr Stray dogs of northern Jordan as reservoirs of ticks and tick-borne hemopathogens. Parasitology research 111: Pawar, R. M., A. Poornachandar, P. Srinivas, K. R. Rao, U. Lakshmikantan, and S. Shivaji Molecular characterization of Hepatozoon spp. infection in endangered Indian wild felids and canids. Veterinary parasitology 186: Pawar, R. M., A. Poornachandar, P. Srinivas, K. R. Rao, U. Lakshmikantan, and S. Shivaji Molecular characterization of Hepatozoon spp. infection in endangered Indian wild felids and canids. Veterinary parasitology 186: Aktas, M., S. Ozübek, and D. N. S. Ipek Molecular investigations of Hepatozoon species in dogs and developmental stages of Rhipicephalus sanguineus. Parasitology research 112: Unpublished. Iqbal,Z., Mukherjee,N., Adamson,S., Sindhu,Z.-U.-D., Ullah,S., Arijo,A., Apanskevich,D. and Karim,S. Molecular detection of tick-borne pathogens in ixodid ticks from Pakistan. Kistler, W. M., J. D. Brown, A. B. Allison, N. M. Nemeth, and M. J. Yabsley First report of Angiostrongylus vasorum and Hepatozoon from a red fox () from West Virginia, USA. Veterinary parasitology 200: Düzlü, Ö., A. İ. N. C. İ, A. Yildirim, Z. Önder, and A. Ç. İ. L. O. Ğ. Lu The investigation of vector-borne some protozoon and rickettsial infections in dogs by Real Time PCR and the molecular characterizations of the obtained isolates. Veterinary Journal of Ankara University 61: Düzlü, Ö., A. İ. N. C. İ, A. Yildirim, Z. Önder, and A. Ç. İ. L. O. Ğ. Lu The investigation of vector-borne some protozoon and rickettsial infections in dogs by Real Time PCR and the molecular characterizations of the obtained isolates. Veterinary Journal of Ankara University 61: Unpublished. Latrofa,M.S., Dantas-Torres,F., Giannelli,A. and Otranto,D. New Insights on the Vector Role of Rhipicephalus sanguineus Group Ticks. Unpublished. Farkas,R. and Takacs,N. Pathogens isolated from Maltese dogs. Unpublished. Farkas,R. and Takacs,N. Pathogens isolated from Maltese dogs. Criado-Fornelio, A., C. Rey-Valeiron, A. Buling, J. C. Barba-Carretero, R. Jefferies, and P. J. Irwin New advances in molecular epizootiology of canine hematic protozoa from Venezuela, Thailand and Spain. Veterinary parasitology 144: Criado-Fornelio, A., C. Rey-Valeiron, A. Buling, J. C. Barba-Carretero, R. Jefferies, and P. J. Irwin New advances in molecular epizootiology of canine hematic protozoa from Venezuela, Thailand and Spain. Veterinary parasitology 144: Criado-Fornelio, A., J. Ruas, N. Casado, N. A. R. Farias, M. P. Soares, G. Müller, J. G. W. Brumt, M. E. A. Berne, A. Buling-Saraña, and J. C. Barba-Carretero New molecular data on mammalian Hepatozoon species (Apicomplexa: Adeleorina) from Brazil and Spain. The Journal of parasitology 92: Criado-Fornelio, A., C. Rey-Valeiron, A. Buling, J. C. Barba-Carretero, R. Jefferies, and P. J. Irwin New advances in molecular epizootiology of canine hematic protozoa from Venezuela, Thailand and Spain. Veterinary parasitology 144: Criado-Fornelio, A., C. Rey-Valeiron, A. Buling, J. C. Barba-Carretero, R. Jefferies, and P. J. Irwin New advances in molecular epizootiology of canine hematic protozoa from Venezuela, Thailand and Spain. Veterinary parasitology 144: Criado-Fornelio, A., A. Buling, N. Casado, C. Gimenez, J. Ruas, L. Wendt, N. Rosa-Farias, M. Pinheiro, C. Rey-Valeiron, and J. C. Barba-Carretero Molecular characterization of arthropod-borne hematozoans in wild mammals from Brazil, Venezuela and Spain. Acta Parasitologica 54: Karbowiak, G., V. Majláthová, J. Hapunik, B. Pet ko, and I. Wita Apicomplexan parasites of red foxes () in northeastern Poland. Acta Parasitologica 55:

98 Mathew, J. S., R. A. Van Den Bussche, S. A. Ewing, J. R. Malayer, B. R. Latha, and R. J. Panciera Phylogenetic relationships of Hepatozoon (Apicomplexa: Adeleorina) based on molecular, morphologic, and life-cycle characters. The Journal of parasitology 86: Unpublished. Huang,C.-C., Hsieh,Y.-C., Tsang,C.-L. and Chung,Y.-T. Molecular characterization of Hepatozoon sp. from Taiwanese dogs and its phylogenetic relationship with other Hepatozoon spp. Pawar, R. M., A. Poornachandar, P. Srinivas, K. R. Rao, U. Lakshmikantan, and S. Shivaji Molecular characterization of Hepatozoon spp. infection in endangered Indian wild felids and canids. Veterinary parasitology 186: Pawar, R. M., A. Poornachandar, P. Srinivas, K. R. Rao, U. Lakshmikantan, and S. Shivaji Molecular characterization of Hepatozoon spp. infection in endangered Indian wild felids and canids. Veterinary parasitology 186: Unpublished. Huang,C.C. and Tsang,C.L. First molecular characterization of Hepatozoon canis in dogs in Taiwan. Vargas-Hernandez, G., M. R. André, T. D. Munhoz, J. M. L. Faria, R. Z. Machado, and M. Tinucci-Costa Molecular characterization of Hepatozoon canis in dogs from Colombia. Parasitology research 110: Vargas-Hernandez, G., M. R. André, T. D. Munhoz, J. M. L. Faria, R. Z. Machado, and M. Tinucci-Costa Molecular characterization of Hepatozoon canis in dogs from Colombia. Parasitology research 110: Aktas, M., S. Ozübek, and D. N. S. Ipek Molecular investigations of Hepatozoon species in dogs and developmental stages of Rhipicephalus sanguineus. Parasitology research 112: Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Baneth, G., A. Sheiner, O. Eyal, S. Hahn, J.-P. Beaufils, Y. Anug, and D. Talmi-Frank Redescription of hepatozoon felis (apicomplexa: hepatozoidae) based on phylogenetic analysis, tissue and blood form morphology, and possible transplacental transmission. Parasites & vectors 6: 102. Kongklieng, A., P. M. Intapan, T. Boonmars, T. Thanchomnang, P. Janwan, O. Sanpool, V. Lulitanond, P. Taweethavonsawat, S. Chungpivat, and W. Maleewong Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve Kongklieng, A., P. M. Intapan, T. Boonmars, T. Thanchomnang, P. Janwan, O. Sanpool, V. Lulitanond, P. Taweethavonsawat, S. Chungpivat, and W. Maleewong Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve Kongklieng, A., P. M. Intapan, T. Boonmars, T. Thanchomnang, P. Janwan, O. Sanpool, V. Lulitanond, P. Taweethavonsawat, S. Chungpivat, and W. Maleewong Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve Kongklieng, A., P. M. Intapan, T. Boonmars, T. Thanchomnang, P. Janwan, O. Sanpool, V. Lulitanond, P. Taweethavonsawat, S. Chungpivat, and W. Maleewong Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve Kongklieng, A., P. M. Intapan, T. Boonmars, T. Thanchomnang, P. Janwan, O. Sanpool, V. Lulitanond, P. Taweethavonsawat, S. Chungpivat, and W. Maleewong Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve Unpublished. Latrofa,M.S., Dantas-Torres,F., Giannelli,A. and Otranto,D. New Insights on the Vector Role of Rhipicephalus sanguineus Group Ticks. Unpublished. Farkas,R. and Takacs,N. Pathogens isolated from Maltese dogs. Unpublished. Adao,D.E.V., Herrera,C.M.T., Carlos,S.S., Carlos,R.S., Carlos,E.T. and Rivera,W.L. Development of multiplex PCR for detection of Ehrlichia canis, Babesia canis and Hepatozoon canis in canine blood. Unpublished. Adao,D.E.V., Herrera,C.M.T., Carlos,S.S., Carlos,R.S., Carlos,E.T. and Rivera,W.L. Development of multiplex PCR for detection of Ehrlichia canis, Babesia canis and Hepatozoon canis in canine blood. Unpublished. Adao,D.E.V., Herrera,C.M.T., Carlos,S.S., Carlos,R.S., Carlos,E.T. and Rivera,W.L. Development of multiplex PCR for detection of Ehrlichia canis, Babesia canis and Hepatozoon canis in canine blood. Unpublished. Adao,D.E.V., Herrera,C.M.T., Carlos,S.S., Carlos,R.S., Carlos,E.T. and Rivera,W.L. Development of multiplex PCR for detection of Ehrlichia canis, Babesia canis and Hepatozoon canis in canine blood. Unpublished. Adao,D.E.V., Herrera,C.M.T., Carlos,S.S., Carlos,R.S., Carlos,E.T. and Rivera,W.L. Development of multiplex PCR for detection of Ehrlichia canis, Babesia canis and Hepatozoon canis in canine blood. Unpublished. Bollo,E., Scaglione,F.E., Trisciuoglio,A. and Grande,D. Parasitological survey on foxes () in Piedmont. Unpublished. Bollo,E., Scaglione,F.E., Trisciuoglio,A. and Grande,D. Parasitological survey on foxes () in Piedmont. Unpublished. Konto,M., Watanabe,M., Abd-Rani,P.A.M., Sharma,R.S.K., Watanabe,M., Tukur,S.M., Fong,L.S., Bande,F., Gimba,F.I., Goni,D.M., Abba,Y., Shettima,Y.M., Ola- Fadunsin,S.D. and Abatcha,M.G. Molecular epidemiology of Hepatozoon canis from stray dogs in Malaysia. Unpublished. Konto,M., Watanabe,M., Abd-Rani,P.A.M., Sharma,R.S.K., Watanabe,M., Tukur,S.M., Fong,L.S., Bande,F., Gimba,F.I., Goni,D.M., Abba,Y., Shettima,Y.M., Ola- Fadunsin,S.D. and Abatcha,M.G. Molecular epidemiology of Hepatozoon canis from stray dogs in Malaysia. Unpublished. Konto,M., Watanabe,M., Abd-Rani,P.A.M., Sharma,R.S.K., Watanabe,M., Tukur,S.M., Fong,L.S., Bande,F., Gimba,F.I., Goni,D.M., Abba,Y., Shettima,Y.M., Ola- Fadunsin,S.D. and Abatcha,M.G. Molecular epidemiology of Hepatozoon canis from stray dogs in Malaysia. Unpublished. Konto,M., Watanabe,M., Abd-Rani,P.A.M., Sharma,R.S.K., Watanabe,M., Tukur,S.M., Fong,L.S., Bande,F., Gimba,F.I., Goni,D.M., Abba,Y., Shettima,Y.M., Ola- Fadunsin,S.D. and Abatcha,M.G. Molecular epidemiology of Hepatozoon canis from stray dogs in Malaysia. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Vojta, L., V. Mrljak, S. Curković, T. Zivicnjak, A. Marinculić, and R. Beck Molecular epizootiology of canine hepatozoonosis in Croatia. International journal for parasitology 39: Vojta, L., V. Mrljak, S. Curković, T. Zivicnjak, A. Marinculić, and R. Beck Molecular epizootiology of canine hepatozoonosis in Croatia. International journal for parasitology 39: Vojta, L., V. Mrljak, S. Curković, T. Zivicnjak, A. Marinculić, and R. Beck Molecular epizootiology of canine hepatozoonosis in Croatia. International journal for parasitology 39: Vojta, L., V. Mrljak, S. Curković, T. Zivicnjak, A. Marinculić, and R. Beck Molecular epizootiology of canine hepatozoonosis in Croatia. International journal for parasitology 39: Karagenc, T. I., S. Pasa, G. Kirli, M. Hosgor, H. B. Bilgic, Y. H. Ozon, A. Atasoy, and H. Eren A parasitological, molecular and serological survey of Hepatozoon canis infection in dogs around the Aegean coast of Turkey. Veterinary parasitology 135: Karagenc, T. I., S. Pasa, G. Kirli, M. Hosgor, H. B. Bilgic, Y. H. Ozon, A. Atasoy, and H. Eren A parasitological, molecular and serological survey of Hepatozoon canis infection in dogs around the Aegean coast of Turkey. Veterinary parasitology 135: Vojta, L., V. Mrljak, S. Curković, T. Zivicnjak, A. Marinculić, and R. Beck Molecular epizootiology of canine hepatozoonosis in Croatia. International journal for parasitology 39: Vojta, L., V. Mrljak, S. Curković, T. Zivicnjak, A. Marinculić, and R. Beck Molecular epizootiology of canine hepatozoonosis in Croatia. International journal for parasitology 39: de Miranda, R. L., L. H. O Dwyer, J. R. de Castro, B. Metzger, A. S. Rubini, A. V Mundim, O. Eyal, D. Talmi-Frank, M. C. Cury, and G. Baneth Prevalence and molecular characterization of Hepatozoon canis in dogs from urban and rural areas in Southeast Brazil. Research in veterinary science 97:

99 Unpublished. Latrofa,M.S., Dantas-Torres,F., Giannelli,A. and Otranto,D. New Insights on the Vector Role of Rhipicephalus sanguineus Group Ticks. Vojta, L., V. Mrljak, S. Curković, T. Zivicnjak, A. Marinculić, and R. Beck Molecular epizootiology of canine hepatozoonosis in Croatia. International journal for parasitology 39: Vojta, L., V. Mrljak, S. Curković, T. Zivicnjak, A. Marinculić, and R. Beck Molecular epizootiology of canine hepatozoonosis in Croatia. International journal for parasitology 39: Vojta, L., V. Mrljak, S. Curković, T. Zivicnjak, A. Marinculić, and R. Beck Molecular epizootiology of canine hepatozoonosis in Croatia. International journal for parasitology 39: Dezdek, D., L. Vojta, S. Curković, Z. Lipej, Z. Mihaljević, Z. Cvetnić, and R. Beck Molecular detection of Theileria annae and Hepatozoon canis in foxes () in Croatia. Veterinary parasitology 172: Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Gabrielli, S., S. Kumlien, P. Calderini, A. Brozzi, A. Iori, and G. Cancrini The first report of Hepatozoon canis identified in and ticks from Italy. Vector borne and zoonotic diseases 10: Gabrielli, S., S. Kumlien, P. Calderini, A. Brozzi, A. Iori, and G. Cancrini The first report of Hepatozoon canis identified in and ticks from Italy. Vector borne and zoonotic diseases 10: Gabrielli, S., S. Kumlien, P. Calderini, A. Brozzi, A. Iori, and G. Cancrini The first report of Hepatozoon canis identified in and ticks from Italy. Vector borne and zoonotic diseases 10: Gabrielli, S., S. Kumlien, P. Calderini, A. Brozzi, A. Iori, and G. Cancrini The first report of Hepatozoon canis identified in and ticks from Italy. Vector borne and zoonotic diseases 10: Gabrielli, S., S. Kumlien, P. Calderini, A. Brozzi, A. Iori, and G. Cancrini The first report of Hepatozoon canis identified in and ticks from Italy. Vector borne and zoonotic diseases 10: Gabrielli, S., S. Kumlien, P. Calderini, A. Brozzi, A. Iori, and G. Cancrini The first report of Hepatozoon canis identified in and ticks from Italy. Vector borne and zoonotic diseases 10: Gabrielli, S., S. Kumlien, P. Calderini, A. Brozzi, A. Iori, and G. Cancrini The first report of Hepatozoon canis identified in and ticks from Italy. Vector borne and zoonotic diseases 10: Reye, A. L., J. M. Hübschen, A. Sausy, and C. P. Muller Prevalence and seasonality of tick-borne pathogens in questing Ixodes ricinus ticks from Luxembourg. Applied and environmental microbiology 76: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: de Miranda, R. L., L. H. O Dwyer, J. R. de Castro, B. Metzger, A. S. Rubini, A. V Mundim, O. Eyal, D. Talmi-Frank, M. C. Cury, and G. Baneth Prevalence and molecular characterization of Hepatozoon canis in dogs from urban and rural areas in Southeast Brazil. Research in veterinary science 97: Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Loftis, A. D., P. J. Kelly, M. D. Freeman, S. Fitzharris, J. Beeler-Marfisi, and C. Wang Tick-borne pathogens and disease in dogs on St. Kitts, West Indies. Veterinary Parasitology 196: Gonçalves, L. R., K. D. Filgueira, S. M. M. Ahid, J. S. Pereira, A. M. do Vale, R. Z. Machado, and M. R. André Study on coinfecting vector-borne pathogens in dogs and ticks in Rio Grande do Norte, Brazil. Revista Brasileira de Parasitologia Veterinária 23: Gonçalves, L. R., K. D. Filgueira, S. M. M. Ahid, J. S. Pereira, A. M. do Vale, R. Z. Machado, and M. R. André Study on coinfecting vector-borne pathogens in dogs and ticks in Rio Grande do Norte, Brazil. Revista Brasileira de Parasitologia Veterinária 23: Gonçalves, L. R., K. D. Filgueira, S. M. M. Ahid, J. S. Pereira, A. M. do Vale, R. Z. Machado, and M. R. André Study on coinfecting vector-borne pathogens in dogs and ticks in Rio Grande do Norte, Brazil. Revista Brasileira de Parasitologia Veterinária 23: Gonçalves, L. R., K. D. Filgueira, S. M. M. Ahid, J. S. Pereira, A. M. do Vale, R. Z. Machado, and M. R. André Study on coinfecting vector-borne pathogens in dogs and ticks in Rio Grande do Norte, Brazil. Revista Brasileira de Parasitologia Veterinária 23: Gonçalves, L. R., K. D. Filgueira, S. M. M. Ahid, J. S. Pereira, A. M. do Vale, R. Z. Machado, and M. R. André Study on coinfecting vector-borne pathogens in dogs and ticks in Rio Grande do Norte, Brazil. Revista Brasileira de Parasitologia Veterinária 23: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Allen, K. E., Y. Li, B. Kaltenboeck, E. M. Johnson, M. V Reichard, R. J. Panciera, and S. E. Little Diversity of Hepatozoon species in naturally infected dogs in the southern United States. Veterinary parasitology 154: Starkey, L. a, R. J. Panciera, K. Paras, K. E. Allen, M. H. Reiskind, M. V Reichard, E. M. Johnson, and S. E. Little Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States. The Journal of parasitology 99: Duscher, G. G., A. Kübber-Heiss, B. Richter, and F. Suchentrunk A golden jackal (Canis aureus) from Austria bearing Hepatozoon canis--import due to immigration into a nonendemic area? Ticks and tick-borne diseases 4: Unpublished. Aktas,M. and Ozubek,S. Molecular detection of tick-borne diseases in ixodid ticks removed from humans in Turkey. Unpublished. Aktas,M. and Ozubek,S. Molecular detection of tick-borne diseases in ixodid ticks removed from humans in Turkey. Duscher, G. G., A. Kübber-Heiss, B. Richter, and F. Suchentrunk A golden jackal (Canis aureus) from Austria bearing Hepatozoon canis--import due to immigration into a nonendemic area? Ticks and tick-borne diseases 4: Duscher, G. G., A. Kübber-Heiss, B. Richter, and F. Suchentrunk A golden jackal (Canis aureus) from Austria bearing Hepatozoon canis--import due to immigration into a nonendemic area? Ticks and tick-borne diseases 4: Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Duscher, G. G., A. Kübber-Heiss, B. Richter, and F. Suchentrunk A golden jackal (Canis aureus) from Austria bearing Hepatozoon canis--import due to immigration into a nonendemic area? Ticks and tick-borne diseases 4: Aydin, M. F., F. Sevinc, and M. Sevinc Molecular detection and characterization of Hepatozoon spp. in dogs from the Central part of Turkey. Ticks and Tick-borne Diseases 6: Aydin, M. F., F. Sevinc, and M. Sevinc Molecular detection and characterization of Hepatozoon spp. in dogs from the Central part of Turkey. Ticks and Tick-borne Diseases 6: Aydin, M. F., F. Sevinc, and M. Sevinc Molecular detection and characterization of Hepatozoon spp. in dogs from the Central part of Turkey. Ticks and Tick-borne Diseases 6: Aydin, M. F., F. Sevinc, and M. Sevinc Molecular detection and characterization of Hepatozoon spp. in dogs from the Central part of Turkey. Ticks and Tick-borne Diseases 6: de Miranda, R. L., L. H. O Dwyer, J. R. de Castro, B. Metzger, A. S. Rubini, A. V Mundim, O. Eyal, D. Talmi-Frank, M. C. Cury, and G. Baneth Prevalence and molecular characterization of Hepatozoon canis in dogs from urban and rural areas in Southeast Brazil. Research in veterinary science 97: Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521.

100 Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Qablan, M. A., M. Kubelová, P. Široký, D. Modrý, and Z. S. Amr Stray dogs of northern Jordan as reservoirs of ticks and tick-borne hemopathogens. Parasitology research 111: Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Unpublished. Melo,A.L., Martins,T.F., Alves,A.S., Witter,R., Pacheco,T.A., Dutra,V., Nakazato,L., Pacheco,R.C., Labruna,M.B. and Aguiar,D.M. Molecular detection of 'Candidatus Rickettsia amblyommii', Rickettsia parkeri Atlantic Rainforest Strain, Ehrlichia canis and Anaplasma platys in ticks and Babesia vogeli and Hepatozoon canis in dogs from the Pantanal Imre, M., A. Dudu, M. S. Ilie, S. Morariu, K. Imre, and G. Dărăbuş Molecular Survey of Hepatozoon canis in Red Foxes ( ) from Romania. Journal of Parasitology 101: Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Unpublished. Adao,D.E.V., Herrera,C.M.T., Carlos,S.S., Carlos,R.S., Carlos,E.T. and Rivera,W.L. Development of multiplex PCR for detection of Ehrlichia canis, Babesia canis and Hepatozoon canis in canine blood. Vojta, L., V. Mrljak, S. Curković, T. Zivicnjak, A. Marinculić, and R. Beck Molecular epizootiology of canine hepatozoonosis in Croatia. International journal for parasitology 39: Vojta, L., V. Mrljak, S. Curković, T. Zivicnjak, A. Marinculić, and R. Beck Molecular epizootiology of canine hepatozoonosis in Croatia. International journal for parasitology 39: Vojta, L., V. Mrljak, S. Curković, T. Zivicnjak, A. Marinculić, and R. Beck Molecular epizootiology of canine hepatozoonosis in Croatia. International journal for parasitology 39: Dezdek, D., L. Vojta, S. Curković, Z. Lipej, Z. Mihaljević, Z. Cvetnić, and R. Beck Molecular detection of Theileria annae and Hepatozoon canis in foxes () in Croatia. Veterinary parasitology 172: Duscher, G. G., A. Kübber-Heiss, B. Richter, and F. Suchentrunk A golden jackal (Canis aureus) from Austria bearing Hepatozoon canis--import due to immigration into a nonendemic area? Ticks and tick-borne diseases 4: Duscher, G. G., A. Kübber-Heiss, B. Richter, and F. Suchentrunk A golden jackal (Canis aureus) from Austria bearing Hepatozoon canis--import due to immigration into a nonendemic area? Ticks and tick-borne diseases 4: Duscher, G. G., A. Kübber-Heiss, B. Richter, and F. Suchentrunk A golden jackal (Canis aureus) from Austria bearing Hepatozoon canis--import due to immigration into a nonendemic area? Ticks and tick-borne diseases 4: Hornok, S., B. Tánczos, I. G. F. De Mera, J. de la Fuente, R. Hofmann-Lehmann, and R. Farkas High prevalence of Hepatozoon-infection among shepherd dogs in a region considered to be free of Rhipicephalus sanguineus. Veterinary Parasitology Hornok, S., B. Tánczos, I. G. F. De Mera, J. de la Fuente, R. Hofmann-Lehmann, and R. Farkas High prevalence of Hepatozoon-infection among shepherd dogs in a region considered to be free of Rhipicephalus sanguineus. Veterinary Parasitology Najm, N.-A., E. Meyer-Kayser, L. Hoffmann, K. Pfister, and C. Silaghi Hepatozoon canis in German red foxes () and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp. Parasitology research 113: Najm, N.-A., E. Meyer-Kayser, L. Hoffmann, K. Pfister, and C. Silaghi Hepatozoon canis in German red foxes () and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp. Parasitology research 113: Najm, N.-A., E. Meyer-Kayser, L. Hoffmann, K. Pfister, and C. Silaghi Hepatozoon canis in German red foxes () and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp. Parasitology research 113: Najm, N.-A., E. Meyer-Kayser, L. Hoffmann, K. Pfister, and C. Silaghi Hepatozoon canis in German red foxes () and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp. Parasitology research 113: Najm, N.-A., E. Meyer-Kayser, L. Hoffmann, K. Pfister, and C. Silaghi Hepatozoon canis in German red foxes () and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp. Parasitology research 113: Najm, N.-A., E. Meyer-Kayser, L. Hoffmann, K. Pfister, and C. Silaghi Hepatozoon canis in German red foxes () and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp. Parasitology research 113: Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Farkas, R., N. Solymosi, N. Takács, A. Hornyák, S. Hornok, Y. Nachum-Biala, and G. Baneth First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary. Parasites & vectors 7: 303. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Kamani, J., G. Baneth, K. Y. Mumcuoglu, N. E. Waziri, O. Eyal, Y. Guthmann, and S. Harrus Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria (J Foley, Ed.). PLoS Neglected Tropical Diseases 7: e2108. Oliveira, A. C. de Density gradient centrifugation, molecular biology and hematological changes in the diagnosis of canine hemoparasitoses. PhD Thesis. Medicina Veterinária, Universidade Federal de Viçosa.

101 Unpublished. Iqbal,F., Qamar,M., Malik,M.I., Shaikh,R.S. and Aktas,M. Molecular Detection of Hepatozoan canis in Dogs from Pakistan. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Quadros, R. M. de, J. F. Soares, J. S. Xavier, C. Pilati, J. L. da Costa, B. A. Miotto, L. C. Miletti, and M. B. Labruna Natural Infection of the Wild Canid Lycalopex gymnocercus by the Protozoan Rangelia vitalii, the Agent of Canine Rangeliosis. Journal of Wildlife Diseases 51: Duscher, G. G., H.-P. Fuehrer, and A. Kübber-Heiss Fox on the run - molecular surveillance of fox blood and tissue for the occurrence of tick-borne pathogens in Austria. Parasites & vectors 7: 521. Unpublished. Melo,A.L., Martins,T.F., Alves,A.S., Witter,R., Pacheco,T.A., Dutra,V., Nakazato,L., Pacheco,R.C., Labruna,M.B. and Aguiar,D.M. Molecular detection of 'Candidatus Rickettsia amblyommii', Rickettsia parkeri Atlantic Rainforest Strain, Ehrlichia canis and Anaplasma platys in ticks and Babesia vogeli and Hepatozoon canis in dogs from the Pantanal Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Hodžić, A., A. Alić, H.-P. Fuehrer, J. Harl, W. Wille-Piazzai, and G. G. Duscher A molecular survey of vector-borne pathogens in red foxes () from Bosnia and Herzegovina. Parasites & vectors 8: 88. Oliveira, A. C. de Density gradient centrifugation, molecular biology and hematological changes in the diagnosis of canine hemoparasitoses. PhD Thesis. Medicina Veterinária, Universidade Federal de Viçosa. Oliveira, A. C. de Density gradient centrifugation, molecular biology and hematological changes in the diagnosis of canine hemoparasitoses. PhD Thesis. Medicina Veterinária, Universidade Federal de Viçosa. Unpublished. Ferroglio,E. and Bruno,S. Parasitological survey on foxes () in Piedmont. Unpublished. Bollo,E., Scaglione,F.E., Trisciuoglio,A. and Grande,D. Parasitological survey on foxes () in Piedmont. Unpublished. Bollo,E., Scaglione,F.E., Trisciuoglio,A. and Grande,D. Parasitological survey on foxes () in Piedmont. Unpublished. Bollo,E., Scaglione,F.E., Trisciuoglio,A. and Grande,D. Parasitological survey on foxes () in Piedmont. Unpublished. Konto,M., Watanabe,M., Abd-Rani,P.A.M., Sharma,R.S.K., Watanabe,M., Tukur,S.M., Fong,L.S., Bande,F., Gimba,F.I., Goni,D.M., Abba,Y., Shettima,Y.M., Ola- Fadunsin,S.D. and Abatcha,M.G. Molecular epidemiology of Hepatozoon canis from stray dogs in Malaysia. Unpublished. Konto,M., Watanabe,M., Abd-Rani,P.A.M., Sharma,R.S.K., Watanabe,M., Tukur,S.M., Fong,L.S., Bande,F., Gimba,F.I., Goni,D.M., Abba,Y., Shettima,Y.M., Ola- Fadunsin,S.D. and Abatcha,M.G. Molecular epidemiology of Hepatozoon canis from stray dogs in Malaysia. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Jarquin-Diaz,V.-H., Aguilar-Faisal,L., Maldonado-Rodriguez,R. and Barbachano-Guerrero,A. First molecular evidence of Hepatozoon canis in domestic dogs and ticks from Mexico. Unpublished. Panda,C., Dehuri,M., Panda,M.R., Panda,S.K. and Sahoo,L. Molecular detection of Babesis infection in canine. Unpublished. Konto,M., Watanabe,M., Abd-Rani,P.A.M., Sharma,R.S.K., Watanabe,M., Tukur,S.M., Fong,L.S., Bande,F., Gimba,F.I., Goni,D.M., Abba,Y., Shettima,Y.M., Ola- Fadunsin,S.D. and Abatcha,M.G. Molecular epidemiology of Hepatozoon canis from stray dogs in Malaysia. Unpublished. Konto,M., Watanabe,M., Abd-Rani,P.A.M., Sharma,R.S.K., Watanabe,M., Tukur,S.M., Fong,L.S., Bande,F., Gimba,F.I., Goni,D.M., Abba,Y., Shettima,Y.M., Ola- Fadunsin,S.D. and Abatcha,M.G. Molecular epidemiology of Hepatozoon canis from stray dogs in Malaysia. Unpublished. Konto,M., Watanabe,M., Abd-Rani,P.A.M., Sharma,R.S.K., Watanabe,M., Tukur,S.M., Fong,L.S., Bande,F., Gimba,F.I., Goni,D.M., Abba,Y., Shettima,Y.M., Ola- Fadunsin,S.D. and Abatcha,M.G. Molecular epidemiology of Hepatozoon canis from stray dogs in Malaysia. Unpublished. Konto,M., Watanabe,M., Abd-Rani,P.A.M., Sharma,R.S.K., Watanabe,M., Tukur,S.M., Fong,L.S., Bande,F., Gimba,F.I., Goni,D.M., Abba,Y., Shettima,Y.M., Ola- Fadunsin,S.D. and Abatcha,M.G. Molecular epidemiology of Hepatozoon canis from stray dogs in Malaysia. Kongklieng, A., P. M. Intapan, T. Boonmars, T. Thanchomnang, P. Janwan, O. Sanpool, V. Lulitanond, P. Taweethavonsawat, S. Chungpivat, and W. Maleewong Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve Kongklieng, A., P. M. Intapan, T. Boonmars, T. Thanchomnang, P. Janwan, O. Sanpool, V. Lulitanond, P. Taweethavonsawat, S. Chungpivat, and W. Maleewong Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve Kongklieng, A., P. M. Intapan, T. Boonmars, T. Thanchomnang, P. Janwan, O. Sanpool, V. Lulitanond, P. Taweethavonsawat, S. Chungpivat, and W. Maleewong Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve Kongklieng, A., P. M. Intapan, T. Boonmars, T. Thanchomnang, P. Janwan, O. Sanpool, V. Lulitanond, P. Taweethavonsawat, S. Chungpivat, and W. Maleewong Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve Kongklieng, A., P. M. Intapan, T. Boonmars, T. Thanchomnang, P. Janwan, O. Sanpool, V. Lulitanond, P. Taweethavonsawat, S. Chungpivat, and W. Maleewong Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve

102 Kongklieng, A., P. M. Intapan, T. Boonmars, T. Thanchomnang, P. Janwan, O. Sanpool, V. Lulitanond, P. Taweethavonsawat, S. Chungpivat, and W. Maleewong Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve Kongklieng, A., P. M. Intapan, T. Boonmars, T. Thanchomnang, P. Janwan, O. Sanpool, V. Lulitanond, P. Taweethavonsawat, S. Chungpivat, and W. Maleewong Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve Kongklieng, A., P. M. Intapan, T. Boonmars, T. Thanchomnang, P. Janwan, O. Sanpool, V. Lulitanond, P. Taweethavonsawat, S. Chungpivat, and W. Maleewong Detection of Babesia canis vogeli and Hepatozoon canis in canine blood by a single-tube real-time fluorescence resonance energy transfer polymerase chain reaction assay and melting curve Unpublished. Konto,M., Watanabe,M., Abd-Rani,P.A.M., Sharma,R.S.K., Watanabe,M., Tukur,S.M., Fong,L.S., Bande,F., Gimba,F.I., Goni,D.M., Abba,Y., Shettima,Y.M., Ola- Fadunsin,S.D. and Abatcha,M.G. Molecular epidemiology of Hepatozoon canis from stray dogs in Malaysia. Unpublished. Konto,M., Watanabe,M., Abd-Rani,P.A.M., Sharma,R.S.K., Watanabe,M., Tukur,S.M., Fong,L.S., Bande,F., Gimba,F.I., Goni,D.M., Abba,Y., Shettima,Y.M., Ola- Fadunsin,S.D. and Abatcha,M.G. Molecular epidemiology of Hepatozoon canis from stray dogs in Malaysia. Unpublished. Konto,M., Watanabe,M., Abd-Rani,P.A.M., Sharma,R.S.K., Watanabe,M., Tukur,S.M., Fong,L.S., Bande,F., Gimba,F.I., Goni,D.M., Abba,Y., Shettima,Y.M., Ola- Fadunsin,S.D. and Abatcha,M.G. Molecular epidemiology of Hepatozoon canis from stray dogs in Malaysia. Unpublished. Konto,M., Watanabe,M., Abd-Rani,P.A.M., Sharma,R.S.K., Watanabe,M., Tukur,S.M., Fong,L.S., Bande,F., Gimba,F.I., Goni,D.M., Abba,Y., Shettima,Y.M., Ola- Fadunsin,S.D. and Abatcha,M.G. Molecular epidemiology of Hepatozoon canis from stray dogs in Malaysia. Unpublished. Konto,M., Watanabe,M., Abd-Rani,P.A.M., Sharma,R.S.K., Watanabe,M., Tukur,S.M., Fong,L.S., Bande,F., Gimba,F.I., Goni,D.M., Abba,Y., Shettima,Y.M., Ola- Fadunsin,S.D. and Abatcha,M.G. Molecular epidemiology of Hepatozoon canis from stray dogs in Malaysia. Unpublished Azmi,K., Nasereddin,A., Ereqat,S. and Abdeen,Z. First detection of Theileria, Hepatozoon, Babesia in hard ticks collected from Palestine. Unpublished Azmi,K., Nasereddin,A., Ereqat,S. and Abdeen,Z. First detection of Theileria, Hepatozoon, Babesia in hard ticks collected from Palestine. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Maia, C., B. Almeida, M. Coimbra, M. C. Fernandes, J. M. Cristóvão, C. Ramos, Â. Martins, F. Martinho, P. Silva, N. Neves, et al Bacterial and protozoal agents of canine vector-borne diseases in the blood of domestic and stray dogs from southern Portugal. Parasites & vectors 8: 138. Unpublished. Singla,L.D., Sumbria,D., Mandhotra,A., Bal,M.S. and Kaur,P. Canine vector-borne infections: Babesia canis, Babesia gibsoni, Ehrlichia canis and Hepatozoon canis in Punjab, India.

103 Copyright Form Click here to access/download Copyright Form _JP_Copyright_Form.pdf

104 Cover Letter Click here to access/download Cover Letter R1_response-to-reviewers.docx

BLOOD PARASITES MORPHOTYPES OF ROCK LIZARDS OF ARMENIA

BLOOD PARASITES MORPHOTYPES OF ROCK LIZARDS OF ARMENIA PROCEEDINGS OF THE YEREVAN STATE UNIVERSITY C h e m i s t r y a n d B i o l o g y 2015, 2, p. 45 49 B i o l o g y BLOOD PARASITES MORPHOTYPES OF ROCK LIZARDS OF ARMENIA T. K. HARUTYUNYAN, F. D. DANIELYAN,

More information

Courtney A. Cook 1*, Edward C. Netherlands 1,2 and Nico J. Smit 1

Courtney A. Cook 1*, Edward C. Netherlands 1,2 and Nico J. Smit 1 Cook et al. Parasites & Vectors (2016) 9:347 DOI 10.1186/s13071-016-1600-8 RESEARCH Redescription, molecular characterisation and taxonomic re-evaluation of a unique African monitor lizard haemogregarine

More information

Two new species of Hepatozoon (Apicomplexa: Hepatozoidae) parasitising species of Philothamnus (Ophidia: Colubridae) from South Africa

Two new species of Hepatozoon (Apicomplexa: Hepatozoidae) parasitising species of Philothamnus (Ophidia: Colubridae) from South Africa Institute of Parasitology, Biology Centre CAS Folia Parasitologica 2018, 65: 004 doi: 10.14411/fp.2018.004 http://folia.paru.cas.cz Research Article Two new species of Hepatozoon (Apicomplexa: Hepatozoidae)

More information

Modern Evolutionary Classification. Lesson Overview. Lesson Overview Modern Evolutionary Classification

Modern Evolutionary Classification. Lesson Overview. Lesson Overview Modern Evolutionary Classification Lesson Overview 18.2 Modern Evolutionary Classification THINK ABOUT IT Darwin s ideas about a tree of life suggested a new way to classify organisms not just based on similarities and differences, but

More information

MOLECULAR SURVEY OF HEPATOZOON SPECIES IN LIZARDS FROM NORTH AFRICA

MOLECULAR SURVEY OF HEPATOZOON SPECIES IN LIZARDS FROM NORTH AFRICA J. Parasitol., 97(3), 2011, pp. 000 000 F American Society of Parasitologists 2011 MOLECULAR SURVEY OF HEPATOZOON SPECIES IN LIZARDS FROM NORTH AFRICA João P. M. C. Maia, D. James Harris, and Ana Perera

More information

Title: Phylogenetic Methods and Vertebrate Phylogeny

Title: Phylogenetic Methods and Vertebrate Phylogeny Title: Phylogenetic Methods and Vertebrate Phylogeny Central Question: How can evolutionary relationships be determined objectively? Sub-questions: 1. What affect does the selection of the outgroup have

More information

Lecture 11 Wednesday, September 19, 2012

Lecture 11 Wednesday, September 19, 2012 Lecture 11 Wednesday, September 19, 2012 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean

More information

Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia

Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia 389 B. HAKLOVÁ 1 *, V. MAJLÁTHOVÁ 1,I.MAJLÁTH 1,2, D. J. HARRIS 3, V. PETRILLA 4, T. LITSCHKA-KOEN

More information

Haemogregarine blood parasites in the lizards Podarcis bocagei (Seoane) and P. carbonelli (Pérez-Mellado) (Sauria: Lacertidae) from NW Portugal

Haemogregarine blood parasites in the lizards Podarcis bocagei (Seoane) and P. carbonelli (Pérez-Mellado) (Sauria: Lacertidae) from NW Portugal Syst Parasitol (2010) 75:75 79 DOI 10.1007/s10-009-9206-6 Haemogregarine blood parasites in the lizards Podarcis bocagei (Seoane) and P. carbonelli (Pérez-Mellado) (Sauria: Lacertidae) from NW Portugal

More information

Bio 1B Lecture Outline (please print and bring along) Fall, 2006

Bio 1B Lecture Outline (please print and bring along) Fall, 2006 Bio 1B Lecture Outline (please print and bring along) Fall, 2006 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #4 -- Phylogenetic Analysis (Cladistics) -- Oct.

More information

Bioinformatics: Investigating Molecular/Biochemical Evidence for Evolution

Bioinformatics: Investigating Molecular/Biochemical Evidence for Evolution Bioinformatics: Investigating Molecular/Biochemical Evidence for Evolution Background How does an evolutionary biologist decide how closely related two different species are? The simplest way is to compare

More information

for presence of cryptosporidia by microscopy using aniline-carbol-methyl violet staining, and Cryptosporidium

for presence of cryptosporidia by microscopy using aniline-carbol-methyl violet staining, and Cryptosporidium doi: http://folia.paru.cas.cz Research Article Cryptosporidium testudinis sp. n., Cryptosporidium ducismarci Traversa, 2010 and Cryptosporidium tortoise genotype III (Apicomplexa: Cryptosporidiidae) in

More information

CLADISTICS Student Packet SUMMARY Phylogeny Phylogenetic trees/cladograms

CLADISTICS Student Packet SUMMARY Phylogeny Phylogenetic trees/cladograms CLADISTICS Student Packet SUMMARY PHYLOGENETIC TREES AND CLADOGRAMS ARE MODELS OF EVOLUTIONARY HISTORY THAT CAN BE TESTED Phylogeny is the history of descent of organisms from their common ancestor. Phylogenetic

More information

Chris T. McAllister Science and Mathematics Division, Eastern Oklahoma State College, Idabel, OK Hematozoans

Chris T. McAllister Science and Mathematics Division, Eastern Oklahoma State College, Idabel, OK Hematozoans Hematozoa (Apicomplexa: Haemogregarinidae, Hepatozoidae) from Two Turtles (Testudines: Chelydridae, Emydidae) and Two Snakes (Ophidia: Colubridae, Viperidae), in Southeastern Oklahoma 119 Chris T. McAllister

More information

Myxosporeans and myxosporidiosis of allogynogenetic gibel carp (Carassius auratus gibelio Bloch) in China

Myxosporeans and myxosporidiosis of allogynogenetic gibel carp (Carassius auratus gibelio Bloch) in China Myxosporeans and myxosporidiosis of allogynogenetic gibel carp (Carassius auratus gibelio Bloch) in China Zhang Jinyong zhangjy@ihb.ac.cn Laboratory of Fish Diseases; Institute of Hydrobiology (IHB), Chinese

More information

Myxosporeans and myxosporidiosis of common carp and gibel carp in China

Myxosporeans and myxosporidiosis of common carp and gibel carp in China Myxosporeans and myxosporidiosis of common carp and gibel carp in China Zhang Jinyong, Liu Xinhua, Xi Bingwen, Kálmán Molnár zhangjy@ihb.ac.cn Hungary 2015 June.3 Laboratory of Fish Diseases; Institute

More information

Cladistics (reading and making of cladograms)

Cladistics (reading and making of cladograms) Cladistics (reading and making of cladograms) Definitions Systematics The branch of biological sciences concerned with classifying organisms Taxon (pl: taxa) Any unit of biological diversity (eg. Animalia,

More information

The life cycle of Haemogregarina bigemina (Adeleina: Haemogregarinidae) in South African hosts

The life cycle of Haemogregarina bigemina (Adeleina: Haemogregarinidae) in South African hosts FOLIA PARASITOLOGICA 48: 169-177, 2001 The life cycle of Haemogregarina bigemina (Adeleina: Haemogregarinidae) in South African hosts Angela J. Davies 1 and Nico J. Smit 2 1 School of Life Sciences, Faculty

More information

What are taxonomy, classification, and systematics?

What are taxonomy, classification, and systematics? Topic 2: Comparative Method o Taxonomy, classification, systematics o Importance of phylogenies o A closer look at systematics o Some key concepts o Parts of a cladogram o Groups and characters o Homology

More information

Species: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum: Chordata

Species: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum: Chordata CHAPTER 6: PHYLOGENY AND THE TREE OF LIFE AP Biology 3 PHYLOGENY AND SYSTEMATICS Phylogeny - evolutionary history of a species or group of related species Systematics - analytical approach to understanding

More information

Prof. Neil. J.L. Heideman

Prof. Neil. J.L. Heideman Prof. Neil. J.L. Heideman Position Office Mailing address E-mail : Vice-dean (Professor of Zoology) : No. 10, Biology Building : P.O. Box 339 (Internal Box 44), Bloemfontein 9300, South Africa : heidemannj.sci@mail.uovs.ac.za

More information

UNIT III A. Descent with Modification(Ch19) B. Phylogeny (Ch20) C. Evolution of Populations (Ch21) D. Origin of Species or Speciation (Ch22)

UNIT III A. Descent with Modification(Ch19) B. Phylogeny (Ch20) C. Evolution of Populations (Ch21) D. Origin of Species or Speciation (Ch22) UNIT III A. Descent with Modification(Ch9) B. Phylogeny (Ch2) C. Evolution of Populations (Ch2) D. Origin of Species or Speciation (Ch22) Classification in broad term simply means putting things in classes

More information

Testing Phylogenetic Hypotheses with Molecular Data 1

Testing Phylogenetic Hypotheses with Molecular Data 1 Testing Phylogenetic Hypotheses with Molecular Data 1 How does an evolutionary biologist quantify the timing and pathways for diversification (speciation)? If we observe diversification today, the processes

More information

The good, the bad and the ugly: Emys trinacris, Placobdella costata and Haemogregarina stepanowi in Sicily (Testudines, Annelida and Apicomplexa)

The good, the bad and the ugly: Emys trinacris, Placobdella costata and Haemogregarina stepanowi in Sicily (Testudines, Annelida and Apicomplexa) Institute of Parasitology, Biology Centre CAS Folia Parasitologica 2016, 63: 029 doi: 10.14411/fp.2016.029 http://folia.paru.cas.cz Research Article The good, the bad and the ugly: Emys trinacris, Placobdella

More information

Studied tortoises, Testudo graeca, were collected from

Studied tortoises, Testudo graeca, were collected from Article available at http://www.parasite-journal.org or http://dx.doi.org/10.1051/parasite/2006134267 HEMOLIVIA MAURITANICA (HAEMOGREGARINIDAE: APICOMPLEXA) INFECTION IN THE TORTOISE TESTUDO GRAECA IN

More information

Systematics and taxonomy of the genus Culicoides what is coming next?

Systematics and taxonomy of the genus Culicoides what is coming next? Systematics and taxonomy of the genus Culicoides what is coming next? Claire Garros 1, Bruno Mathieu 2, Thomas Balenghien 1, Jean-Claude Delécolle 2 1 CIRAD, Montpellier, France 2 IPPTS, Strasbourg, France

More information

Supporting information

Supporting information Supporting information Reassortment and distinct evolutionary dynamics of Rift Valley Fever virus genomic segments Caio C. M. Freire 1, Atila Iamarino 1, Peinda O. Ly Soumaré 2, Ousmane Faye 2, Amadou

More information

Comparing DNA Sequence to Understand

Comparing DNA Sequence to Understand Comparing DNA Sequence to Understand Evolutionary Relationships with BLAST Name: Big Idea 1: Evolution Pre-Reading In order to understand the purposes and learning objectives of this investigation, you

More information

DOI: / Journal of Wildlife Diseases, 50(4), 2014, pp # Wildlife Disease Association 2014

DOI: / Journal of Wildlife Diseases, 50(4), 2014, pp # Wildlife Disease Association 2014 DOI: 10.7589/2013-10-280 Journal of Wildlife Diseases, 50(4), 2014, pp. 837 848 # Wildlife Disease Association 2014 MOLECULAR ASSESSMENT OF HEPATOZOON (APICOMPLEXA: ADELEORINA) INFECTIONS IN WILD CANIDS

More information

Supplementary Table 1. Primers used in the study.

Supplementary Table 1. Primers used in the study. Supplementary Table 1. Primers used in the study. Primer Position (bp) Upstream primer (5 3 ) Downstream primer (5 3 ) Expected (bp) size 1 1 278 ACCAAACAGAGAATCTGTGAG CAGCAATCCGAAGGCAGAATAC 299 2 48 946

More information

Ecography. Supplementary material

Ecography. Supplementary material Ecography ECOG-2343 Lin, L.-H. and Wiens, J. J. 216. Comparing macroecological patterns across continents: evolution of climatic niche breadth in varanid lizards. Ecography doi: 1.1111/ecog.2343 Supplementary

More information

6. The lifetime Darwinian fitness of one organism is greater than that of another organism if: A. it lives longer than the other B. it is able to outc

6. The lifetime Darwinian fitness of one organism is greater than that of another organism if: A. it lives longer than the other B. it is able to outc 1. The money in the kingdom of Florin consists of bills with the value written on the front, and pictures of members of the royal family on the back. To test the hypothesis that all of the Florinese $5

More information

Fig Phylogeny & Systematics

Fig Phylogeny & Systematics Fig. 26- Phylogeny & Systematics Tree of Life phylogenetic relationship for 3 clades (http://evolution.berkeley.edu Fig. 26-2 Phylogenetic tree Figure 26.3 Taxonomy Taxon Carolus Linnaeus Species: Panthera

More information

Geo 302D: Age of Dinosaurs LAB 4: Systematics Part 1

Geo 302D: Age of Dinosaurs LAB 4: Systematics Part 1 Geo 302D: Age of Dinosaurs LAB 4: Systematics Part 1 Systematics is the comparative study of biological diversity with the intent of determining the relationships between organisms. Humankind has always

More information

The good, the bad and the ugly: Emys trinacris, Placobdella costata and Haemogregarina stepanowi in Sicily (Testudines, Annelida and Apicomplexa)

The good, the bad and the ugly: Emys trinacris, Placobdella costata and Haemogregarina stepanowi in Sicily (Testudines, Annelida and Apicomplexa) Institute of Parasitology, Biology Centre CAS doi: http://folia.paru.cas.cz Research Article The good, the bad and the ugly: Emys trinacris, Placobdella costata and Haemogregarina stepanowi in Sicily (Testudines,

More information

1 EEB 2245/2245W Spring 2014: exercises working with phylogenetic trees and characters

1 EEB 2245/2245W Spring 2014: exercises working with phylogenetic trees and characters 1 EEB 2245/2245W Spring 2014: exercises working with phylogenetic trees and characters 1. Answer questions a through i below using the tree provided below. a. The sister group of J. K b. The sister group

More information

The melanocortin 1 receptor (mc1r) is a gene that has been implicated in the wide

The melanocortin 1 receptor (mc1r) is a gene that has been implicated in the wide Introduction The melanocortin 1 receptor (mc1r) is a gene that has been implicated in the wide variety of colors that exist in nature. It is responsible for hair and skin color in humans and the various

More information

Range extension of the critically endangered true poison-dart frog, Phyllobates terribilis (Anura: Dendrobatidae), in western Colombia

Range extension of the critically endangered true poison-dart frog, Phyllobates terribilis (Anura: Dendrobatidae), in western Colombia Acta Herpetologica 7(2): 365-x, 2012 Range extension of the critically endangered true poison-dart frog, Phyllobates terribilis (Anura: Dendrobatidae), in western Colombia Roberto Márquez 1, *, Germán

More information

Centre of Macaronesian Studies, University of Madeira, Penteada, 9000 Funchal, Portugal b

Centre of Macaronesian Studies, University of Madeira, Penteada, 9000 Funchal, Portugal b Molecular Phylogenetics and Evolution 34 (2005) 480 485 www.elsevier.com/locate/ympev Phylogenetic relationships of Hemidactylus geckos from the Gulf of Guinea islands: patterns of natural colonizations

More information

Phylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA.

Phylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA. Zoology Department Phylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA By HAGAR IBRAHIM HOSNI BAYOUMI A thesis submitted in

More information

Herpetology Biol 119. Herpetology Introduction. Philip Bergmann. Philip Bergmann - Research. TA: Allegra Mitchell. Philip Bergmann - Personal

Herpetology Biol 119. Herpetology Introduction. Philip Bergmann. Philip Bergmann - Research. TA: Allegra Mitchell. Philip Bergmann - Personal Herpetology Biol 119 Clark University Fall 2011 Lecture: Tuesday, Thursday 9:00-10:15 in Lasry 124 Lab: Tuesday 13:25-16:10 in Lasry 150 Office hours: T 10:15-11:15 in Lasry 331 Contact: pbergmann@clarku.edu

More information

Cover Page. The handle holds various files of this Leiden University dissertation.

Cover Page. The handle   holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/20908 holds various files of this Leiden University dissertation. Author: Kok, Philippe Jacques Robert Title: Islands in the sky : species diversity, evolutionary

More information

The impact of the recognizing evolution on systematics

The impact of the recognizing evolution on systematics The impact of the recognizing evolution on systematics 1. Genealogical relationships between species could serve as the basis for taxonomy 2. Two sources of similarity: (a) similarity from descent (b)

More information

INQUIRY & INVESTIGATION

INQUIRY & INVESTIGATION INQUIRY & INVESTIGTION Phylogenies & Tree-Thinking D VID. UM SUSN OFFNER character a trait or feature that varies among a set of taxa (e.g., hair color) character-state a variant of a character that occurs

More information

17.2 Classification Based on Evolutionary Relationships Organization of all that speciation!

17.2 Classification Based on Evolutionary Relationships Organization of all that speciation! Organization of all that speciation! Patterns of evolution.. Taxonomy gets an over haul! Using more than morphology! 3 domains, 6 kingdoms KEY CONCEPT Modern classification is based on evolutionary relationships.

More information

Modern taxonomy. Building family trees 10/10/2011. Knowing a lot about lots of creatures. Tom Hartman. Systematics includes: 1.

Modern taxonomy. Building family trees 10/10/2011. Knowing a lot about lots of creatures. Tom Hartman. Systematics includes: 1. Modern taxonomy Building family trees Tom Hartman www.tuatara9.co.uk Classification has moved away from the simple grouping of organisms according to their similarities (phenetics) and has become the study

More information

The Making of the Fittest: LESSON STUDENT MATERIALS USING DNA TO EXPLORE LIZARD PHYLOGENY

The Making of the Fittest: LESSON STUDENT MATERIALS USING DNA TO EXPLORE LIZARD PHYLOGENY The Making of the Fittest: Natural The The Making Origin Selection of the of Species and Fittest: Adaptation Natural Lizards Selection in an Evolutionary and Adaptation Tree INTRODUCTION USING DNA TO EXPLORE

More information

Ticks and tick-borne pathogens Jordi Tarrés-Call, Scientific Officer of the AHAW unit

Ticks and tick-borne pathogens Jordi Tarrés-Call, Scientific Officer of the AHAW unit Ticks and tick-borne pathogens Jordi Tarrés-Call, Scientific Officer of the AHAW unit Antwerp, June 2 nd 2010 1 The role of EFSA! To assess and communicate all risks associated with the food chain! We

More information

History of Lineages. Chapter 11. Jamie Oaks 1. April 11, Kincaid Hall 524. c 2007 Boris Kulikov boris-kulikov.blogspot.

History of Lineages. Chapter 11. Jamie Oaks 1. April 11, Kincaid Hall 524. c 2007 Boris Kulikov boris-kulikov.blogspot. History of Lineages Chapter 11 Jamie Oaks 1 1 Kincaid Hall 524 joaks1@gmail.com April 11, 2014 c 2007 Boris Kulikov boris-kulikov.blogspot.com History of Lineages J. Oaks, University of Washington 1/46

More information

Sleepy lizards Tiliqua rugosa Gray (Scincidae)

Sleepy lizards Tiliqua rugosa Gray (Scincidae) Article available at http://www.parasite-journal.org or http://dx.doi.org/10.1051/parasite/1997044359 THE TICK-TRANSMITTED HAEMOGREGARINID OF THE AUSTRALIAN SLEEPY LIZARD TILIQUA RUGOSA TO THE GENUS HEMOLIVIA

More information

ON TWO NEW HAEMOGREGARINES (PROTOZOA: APICOMPLEXA) FROM COLUBRID AND ELAPIDAE SNAKES IN EGYPT. ~~~l.a!ji~ ~ ~ c_l.:al\4- ~ ~ J. ~~~~u.

ON TWO NEW HAEMOGREGARINES (PROTOZOA: APICOMPLEXA) FROM COLUBRID AND ELAPIDAE SNAKES IN EGYPT. ~~~l.a!ji~ ~ ~ c_l.:al\4- ~ ~ J. ~~~~u. Qatar Univ. Sci. J. (1996), 16(1): 127-139 ON TWO NEW HAEMOGREGARINES (PROTOZOA: APICOMPLEXA) FROM COLUBRID AND ELAPIDAE SNAKES IN EGYPT By MOHAMMAD FATHY A. SAOUD, 1 2 NADIA F. RAMDAN, 1 SHADIA H. MOHAMMED

More information

8/19/2013. Topic 5: The Origin of Amniotes. What are some stem Amniotes? What are some stem Amniotes? The Amniotic Egg. What is an Amniote?

8/19/2013. Topic 5: The Origin of Amniotes. What are some stem Amniotes? What are some stem Amniotes? The Amniotic Egg. What is an Amniote? Topic 5: The Origin of Amniotes Where do amniotes fall out on the vertebrate phylogeny? What are some stem Amniotes? What is an Amniote? What changes were involved with the transition to dry habitats?

More information

Introduction to phylogenetic trees and tree-thinking Copyright 2005, D. A. Baum (Free use for non-commercial educational pruposes)

Introduction to phylogenetic trees and tree-thinking Copyright 2005, D. A. Baum (Free use for non-commercial educational pruposes) Introduction to phylogenetic trees and tree-thinking Copyright 2005, D. A. Baum (Free use for non-commercial educational pruposes) Phylogenetics is the study of the relationships of organisms to each other.

More information

Question Set 1: Animal EVOLUTIONARY BIODIVERSITY

Question Set 1: Animal EVOLUTIONARY BIODIVERSITY Biology 162 LAB EXAM 2, AM Version Thursday 24 April 2003 page 1 Question Set 1: Animal EVOLUTIONARY BIODIVERSITY (a). We have mentioned several times in class that the concepts of Developed and Evolved

More information

VARIABILITY OF AMPHIBIANS AND REPTILES OF RUSSIAN PLAIN: EVOLUTIONARY, ECOLOGICAL AND PRESERVATION ASPECTS

VARIABILITY OF AMPHIBIANS AND REPTILES OF RUSSIAN PLAIN: EVOLUTIONARY, ECOLOGICAL AND PRESERVATION ASPECTS VARIABILITY OF AMPHIBIANS AND REPTILES OF RUSSIAN PLAIN: EVOLUTIONARY, ECOLOGICAL AND PRESERVATION ASPECTS G.A. Lada Derzhavin Tambov State University Amphibians and reptiles play a great role in trophy

More information

1 EEB 2245/2245W Spring 2017: exercises working with phylogenetic trees and characters

1 EEB 2245/2245W Spring 2017: exercises working with phylogenetic trees and characters 1 EEB 2245/2245W Spring 2017: exercises working with phylogenetic trees and characters 1. Answer questions a through i below using the tree provided below. a. Identify the taxon (or taxa if there is more

More information

No limbs Eastern glass lizard. Monitor lizard. Iguanas. ANCESTRAL LIZARD (with limbs) Snakes. No limbs. Geckos Pearson Education, Inc.

No limbs Eastern glass lizard. Monitor lizard. Iguanas. ANCESTRAL LIZARD (with limbs) Snakes. No limbs. Geckos Pearson Education, Inc. No limbs Eastern glass lizard Monitor lizard guanas ANCESTRAL LZARD (with limbs) No limbs Snakes Geckos Species: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum:

More information

Temporal mitochondrial DNA variation in honeybee populations from Tenerife (Canary Islands, Spain)

Temporal mitochondrial DNA variation in honeybee populations from Tenerife (Canary Islands, Spain) Temporal mitochondrial DNA variation in honeybee populations from Tenerife (Canary Islands, Spain) Mª Jesús Madrid-Jiménez, Irene Muñoz, Pilar De la Rúa Dpto. de Zoología y Antropología Física, Facultad

More information

Who Cares? The Evolution of Parental Care in Squamate Reptiles. Ben Halliwell Geoffrey While, Tobias Uller

Who Cares? The Evolution of Parental Care in Squamate Reptiles. Ben Halliwell Geoffrey While, Tobias Uller Who Cares? The Evolution of Parental Care in Squamate Reptiles Ben Halliwell Geoffrey While, Tobias Uller 1 Parental Care any instance of parental investment that increases the fitness of offspring 2 Parental

More information

8/19/2013. What is convergence? Topic 11: Convergence. What is convergence? What is convergence? What is convergence? What is convergence?

8/19/2013. What is convergence? Topic 11: Convergence. What is convergence? What is convergence? What is convergence? What is convergence? Topic 11: Convergence What are the classic herp examples? Have they been formally studied? Emerald Tree Boas and Green Tree Pythons show a remarkable level of convergence Photos KP Bergmann, Philadelphia

More information

COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST

COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST Big Idea 1 Evolution INVESTIGATION 3 COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST How can bioinformatics be used as a tool to determine evolutionary relationships and to

More information

LABORATORY EXERCISE 6: CLADISTICS I

LABORATORY EXERCISE 6: CLADISTICS I Biology 4415/5415 Evolution LABORATORY EXERCISE 6: CLADISTICS I Take a group of organisms. Let s use five: a lungfish, a frog, a crocodile, a flamingo, and a human. How to reconstruct their relationships?

More information

Regional research activities and state of the art of Vmerge Project: Emerging viralvector

Regional research activities and state of the art of Vmerge Project: Emerging viralvector Regional research activities and state of the art of Vmerge Project: Emerging viralvector borne diseases Joint permanent committee 4th November 2014 Cirad Key features of Vmerge Cirad - F Borne Objectives

More information

Your web browser (Safari 7) is out of date. For more security, comfort and the best experience on this site: Update your browser Ignore

Your web browser (Safari 7) is out of date. For more security, comfort and the best experience on this site: Update your browser Ignore Your web browser (Safari 7) is out of date. For more security, comfort and the best experience on this site: Update your browser Ignore Activitydevelop EXPLO RING VERTEBRATE CL ASSIFICATIO N What criteria

More information

Blood parasites of some Anurans from southern Nigeria

Blood parasites of some Anurans from southern Nigeria Tropical Biomedicine 32(4): 598 607 (2015) Blood parasites of some Anurans from southern Nigeria Aisien, M.S.O. *, Aigbirior, P.O., Ovwah, E. and Edo-Taiwo, O. Laboratory of Parasitology Research, Department

More information

These small issues are easily addressed by small changes in wording, and should in no way delay publication of this first- rate paper.

These small issues are easily addressed by small changes in wording, and should in no way delay publication of this first- rate paper. Reviewers' comments: Reviewer #1 (Remarks to the Author): This paper reports on a highly significant discovery and associated analysis that are likely to be of broad interest to the scientific community.

More information

Tortoises And Freshwater Turtles: The Trade In Southeast Asia (Species In Danger) By Martin Jenkins READ ONLINE

Tortoises And Freshwater Turtles: The Trade In Southeast Asia (Species In Danger) By Martin Jenkins READ ONLINE Tortoises And Freshwater Turtles: The Trade In Southeast Asia (Species In Danger) By Martin Jenkins READ ONLINE If searching for the ebook Tortoises and Freshwater Turtles: The Trade in Southeast Asia

More information

Isolation and molecular identification of Moraxella ovis and Moraxella spp. from IKC in sheep in India

Isolation and molecular identification of Moraxella ovis and Moraxella spp. from IKC in sheep in India Isolation and molecular identification of Moraxella ovis and Moraxella spp. from IKC in sheep in India R K Vaid*, T Anand, B C Bera, B N Shukla, D K Nagar, Gagandeep Singh, N Virmani, S Barua, B K Singh

More information

muscles (enhancing biting strength). Possible states: none, one, or two.

muscles (enhancing biting strength). Possible states: none, one, or two. Reconstructing Evolutionary Relationships S-1 Practice Exercise: Phylogeny of Terrestrial Vertebrates In this example we will construct a phylogenetic hypothesis of the relationships between seven taxa

More information

Area: 1,221,037 sq km (9 provinces)(25 th ) Birds: 865 spp (Avibase) Frogs: 110 spp Mammals: 300 spp (Bats 56)

Area: 1,221,037 sq km (9 provinces)(25 th ) Birds: 865 spp (Avibase) Frogs: 110 spp Mammals: 300 spp (Bats 56) Dr Ali Halajian Area: 1,221,037 sq km (9 provinces)(25 th ) Birds: 865 spp (Avibase) Frogs: 110 spp Mammals: 300 spp (Bats 56) With nearly 8% of all known species of Birds 6% of the World`s Mammal species,

More information

LABORATORY EXERCISE 7: CLADISTICS I

LABORATORY EXERCISE 7: CLADISTICS I Biology 4415/5415 Evolution LABORATORY EXERCISE 7: CLADISTICS I Take a group of organisms. Let s use five: a lungfish, a frog, a crocodile, a flamingo, and a human. How to reconstruct their relationships?

More information

Addressing the Wallacean Shortfall for small vertebrates in the Western Ghats across space

Addressing the Wallacean Shortfall for small vertebrates in the Western Ghats across space Addressing the Wallacean Shortfall for small vertebrates in the Western Ghats across space S.P.Vijayakumar Centre for Ecological Sciences, Indian Institute of Science (IISc), Bangalore Why this project?

More information

Phylogeny Reconstruction

Phylogeny Reconstruction Phylogeny Reconstruction Trees, Methods and Characters Reading: Gregory, 2008. Understanding Evolutionary Trees (Polly, 2006) Lab tomorrow Meet in Geology GY522 Bring computers if you have them (they will

More information

High prevalence of Hepatozoon spp. (Apicomplexa, hepatozoidae) infection in water pythons (Liasis fuscus) from tropical Australia

High prevalence of Hepatozoon spp. (Apicomplexa, hepatozoidae) infection in water pythons (Liasis fuscus) from tropical Australia University of Wollongong Research Online Faculty of Science, Medicine and Health - Papers Faculty of Science, Medicine and Health 2004 High prevalence of Hepatozoon spp. (Apicomplexa, hepatozoidae) infection

More information

Name: Per. Date: 1. How many different species of living things exist today?

Name: Per. Date: 1. How many different species of living things exist today? Name: Per. Date: Life Has a History We will be using this website for the activity: http://www.ucmp.berkeley.edu/education/explorations/tours/intro/index.html Procedure: A. Open the above website and click

More information

A NEW SPECIES OF HEPATOZOON

A NEW SPECIES OF HEPATOZOON A NEW SPECIES OF HEPATOZOON (APICOMPLEXA: ADELEORINA) FROM PYTHON REGIUS (SERPENTES: PYTHONIDAE) AND ITS EXPERIMENTAL TRANSMISSION BY A MOSQUITO VECTOR Author(s): Michal Sloboda, Martin Kamler, Jana Bulantová,

More information

Systematics, Taxonomy and Conservation. Part I: Build a phylogenetic tree Part II: Apply a phylogenetic tree to a conservation problem

Systematics, Taxonomy and Conservation. Part I: Build a phylogenetic tree Part II: Apply a phylogenetic tree to a conservation problem Systematics, Taxonomy and Conservation Part I: Build a phylogenetic tree Part II: Apply a phylogenetic tree to a conservation problem What is expected of you? Part I: develop and print the cladogram there

More information

Animal Diversity wrap-up Lecture 9 Winter 2014

Animal Diversity wrap-up Lecture 9 Winter 2014 Animal Diversity wrap-up Lecture 9 Winter 2014 1 Animal phylogeny based on morphology & development Fig. 32.10 2 Animal phylogeny based on molecular data Fig. 32.11 New Clades 3 Lophotrochozoa Lophophore:

More information

Criteria for Selecting Species of Greatest Conservation Need

Criteria for Selecting Species of Greatest Conservation Need Criteria for Selecting Species of Greatest Conservation Need To develop New Jersey's list of Species of Greatest Conservation Need (SGCN), all of the state's indigenous wildlife species were evaluated

More information

Our ref: Your ref: PPL - D. Clendon. Date: 1/10/2015. From: Technical Advisor Ecology - J. Marshall. Waitaha Hydro - Lizards

Our ref: Your ref: PPL - D. Clendon. Date: 1/10/2015. From: Technical Advisor Ecology - J. Marshall. Waitaha Hydro - Lizards Internal Correspondence To: PPL - D. Clendon Our ref: Your ref: Date: 1/10/2015 From: Technical Advisor Ecology - J. Marshall Subject: Waitaha Hydro - Lizards Summary The applicant has employed a respected

More information

Mitochondrial Phylogenomics yields Strongly Supported Hypotheses for Ascaridomorph Nematodes

Mitochondrial Phylogenomics yields Strongly Supported Hypotheses for Ascaridomorph Nematodes Supplementary Info Mitochondrial Phylogenomics yields Strongly Supported Hypotheses for Ascaridomorph Nematodes Guo-Hua Liu 1,2, Steven A. Nadler 3, Shan-Shan Liu 1, Magdalena Podolska Stefano D Amelio

More information

Required and Recommended Supporting Information for IUCN Red List Assessments

Required and Recommended Supporting Information for IUCN Red List Assessments Required and Recommended Supporting Information for IUCN Red List Assessments This is Annex 1 of the Rules of Procedure for IUCN Red List Assessments 2017 2020 as approved by the IUCN SSC Steering Committee

More information

Ch. 17: Classification

Ch. 17: Classification Ch. 17: Classification Who is Carolus Linnaeus? Linnaeus developed the scientific naming system still used today. Taxonomy What is? the science of naming and classifying organisms. A taxon group of organisms

More information

PLASMA BIOCHEMISTRY, HEMATOLOGY, AND BLOOD PARASITES OF A TRANSLOCATED POPULATION OF GOPHER TORTOISES (GOPHERUS POLYPHEMUS) FROM GEORGIA

PLASMA BIOCHEMISTRY, HEMATOLOGY, AND BLOOD PARASITES OF A TRANSLOCATED POPULATION OF GOPHER TORTOISES (GOPHERUS POLYPHEMUS) FROM GEORGIA PLASMA BIOCHEMISTRY, HEMATOLOGY, AND BLOOD PARASITES OF A TRANSLOCATED POPULATION OF GOPHER TORTOISES (GOPHERUS POLYPHEMUS) FROM GEORGIA by KIMBERLY ANNETTE FREEMAL SONDERMAN (Under the Direction of Michael

More information

Do the traits of organisms provide evidence for evolution?

Do the traits of organisms provide evidence for evolution? PhyloStrat Tutorial Do the traits of organisms provide evidence for evolution? Consider two hypotheses about where Earth s organisms came from. The first hypothesis is from John Ray, an influential British

More information

DP.1. Control tables

DP.1. Control tables Data inclusion criteria Report year: 2015 Country: Croatia EU Submission: ALL Genetic status: ALL Animal Species: ALL Species grouping Level 1: ALL Species grouping Level 2: ALL Mammals: ALL Non-human

More information

DP.1. Control tables

DP.1. Control tables Data inclusion criteria Report year: 2014 Country: Croatia EU Submission: ALL Genetic status: ALL Animal Species: ALL Species grouping Level 1: ALL Species grouping Level 2: ALL Mammals: ALL Non-human

More information

Introduction to Herpetology

Introduction to Herpetology Introduction to Herpetology Lesson Aims Discuss the nature and scope of reptiles. Identify credible resources, and begin to develop networking with organisations and individuals involved with the study

More information

Phylogeny of genus Vipio latrielle (Hymenoptera: Braconidae) and the placement of Moneilemae group of Vipio species based on character weighting

Phylogeny of genus Vipio latrielle (Hymenoptera: Braconidae) and the placement of Moneilemae group of Vipio species based on character weighting International Journal of Biosciences IJB ISSN: 2220-6655 (Print) 2222-5234 (Online) http://www.innspub.net Vol. 3, No. 3, p. 115-120, 2013 RESEARCH PAPER OPEN ACCESS Phylogeny of genus Vipio latrielle

More information

Short course in Herpetology

Short course in Herpetology Short course in Herpetology November 1-6, 2016 Venue: CES Seminar hall, IISc, Bangalore Day 1: 01/11/2016 Tuesday Introduction Sushil Dutta History of Herpetology & Herpetology in India Varad Giri 11:00

More information

Course Offerings: Associate of Applied Science Veterinary Technology. Course Number Name Credits

Course Offerings: Associate of Applied Science Veterinary Technology. Course Number Name Credits Course Offerings: Associate of Applied Science Veterinary Technology Course Number Name Credits Required Courses in Major: Fall Semester, First Year *VETT-101 Animal Health Careers 1-0-1 *VETT-102 Veterinary

More information

Research article. Acta Veterinaria-Beograd 2015, 65 (4), UDK: : /-076; 59: (497.11) DOI: /acve

Research article. Acta Veterinaria-Beograd 2015, 65 (4), UDK: : /-076; 59: (497.11) DOI: /acve Research article Acta Veterinaria-Beograd 2015, 65 (4), 443-453 UDK: 598.13-12:616.993.19-074/-076; 59:069.029(497.11) DOI: 10.1515/acve-2015-0037 CYTOLOGICAL AND MOLECULAR IDENTIFICATION OF HAEMOGREGARINA

More information

Quiz Flip side of tree creation: EXTINCTION. Knock-on effects (Crooks & Soule, '99)

Quiz Flip side of tree creation: EXTINCTION. Knock-on effects (Crooks & Soule, '99) Flip side of tree creation: EXTINCTION Quiz 2 1141 1. The Jukes-Cantor model is below. What does the term µt represent? 2. How many ways can you root an unrooted tree with 5 edges? Include a drawing. 3.

More information

The effect of invasive plant species on the biodiversity of herpetofauna at the Cincinnati Nature Center

The effect of invasive plant species on the biodiversity of herpetofauna at the Cincinnati Nature Center The effect of invasive plant species on the biodiversity of herpetofauna at the Cincinnati Nature Center Nicholas L. McEvoy and Dr. Richard D. Durtsche Department of Biological Sciences Northern Kentucky

More information

Objectives: Outline: Idaho Amphibians and Reptiles. Characteristics of Amphibians. Types and Numbers of Amphibians

Objectives: Outline: Idaho Amphibians and Reptiles. Characteristics of Amphibians. Types and Numbers of Amphibians Natural History of Idaho Amphibians and Reptiles Wildlife Ecology, University of Idaho Fall 2005 Charles R. Peterson Herpetology Laboratory Department of Biological Sciences, Idaho Museum of Natural History

More information

DOWNLOAD OR READ : PRELIMINARY AMPHIBIAN AND REPTILE SURVEY OF THE SIOUX DISTRICT OF THE CUSTER NATIONAL FOREST PDF EBOOK EPUB MOBI

DOWNLOAD OR READ : PRELIMINARY AMPHIBIAN AND REPTILE SURVEY OF THE SIOUX DISTRICT OF THE CUSTER NATIONAL FOREST PDF EBOOK EPUB MOBI DOWNLOAD OR READ : PRELIMINARY AMPHIBIAN AND REPTILE SURVEY OF THE SIOUX DISTRICT OF THE CUSTER NATIONAL FOREST PDF EBOOK EPUB MOBI Page 1 Page 2 preliminary amphibian and reptile survey of the sioux district

More information

COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST

COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST In this laboratory investigation, you will use BLAST to compare several genes, and then use the information to construct a cladogram.

More information

What is the evidence for evolution?

What is the evidence for evolution? What is the evidence for evolution? 1. Geographic Distribution 2. Fossil Evidence & Transitional Species 3. Comparative Anatomy 1. Homologous Structures 2. Analogous Structures 3. Vestigial Structures

More information

Introduction to Cladistic Analysis

Introduction to Cladistic Analysis 3.0 Copyright 2008 by Department of Integrative Biology, University of California-Berkeley Introduction to Cladistic Analysis tunicate lamprey Cladoselache trout lungfish frog four jaws swimbladder or

More information

A Mitochondrial DNA Phylogeny of Extant Species of the Genus Trachemys with Resulting Taxonomic Implications

A Mitochondrial DNA Phylogeny of Extant Species of the Genus Trachemys with Resulting Taxonomic Implications NOTES AND FIELD REPORTS 131 Chelonian Conservation and Biology, 2008, 7(1): 131 135 Ó 2008 Chelonian Research Foundation A Mitochondrial DNA Phylogeny of Extant Species of the Genus Trachemys with Resulting

More information