Myxobolus albi infection in cartilage of captive lumpfish (Cyclopterus lumpus)
|
|
- Oscar Hubbard
- 6 years ago
- Views:
Transcription
1 440990JVDXXX / Ca vin et al.myxobolus albi in lumpfish cartilage Myxobolus albi infection in cartilage of captive lumpfish (Cyclopterus lumpus) Journal of Veterinary Diagnostic Investigation 24(3) The Author(s) Reprints and permission: sagepub.com/journalspermissions.nav DOI: / Julie M. Cavin, 1 Shannon L. Donahoe, Salvatore Frasca Jr, Charles J. Innis, Michael J. Kinsel, Tomofumi Kurobe, Lisa M. Naples, Akinyi Nyaoke, Caryn P. Poll, E. P. Scott Weber III Abstract. Myxobolus albi was diagnosed in the cartilage of captive lumpfish (Cyclopterus lumpus) from 2 public aquaria. Eleven fish were affected, with the most common clinical signs being exophthalmos and grossly visible 1- to 2-mm white to tan. Myxozoan cysts were identified in the cartilage of the skull, branchial arch, sclera, vertebrae, tongue, all fin insertions, and the pectoral girdle. Cysts resulted in expansile, deforming, space-occupying lesions, resulting in exophthalmos but often lacking significant tissue damage or inflammation. Once cysts ruptured, free spores elicited a mild to marked inflammatory response. Spores measured 7.5 to 9.0 μm 3.0 to 6.0 μm and contained 2 pyriform polar capsules oriented at one pole as well as occasional 1-μm-diameter basophilic nuclei. Identification was based on spore morphology together with polymerase chain reaction and sequence comparison of 18S ribosomal DNA. Isolates had 99% similarity to M. albi. Key words: Cartilage; Cyclopterus lumpus; lumpfish; Myxobolus albi; myxozoa. Introduction Myxozoans are metazoan parasites that mainly infect poikilothermic animals. Over 700 species of myxozoans have been described in fishes. 19 Myxobolus cerebralis, Henneguya ictaluri, and Tetracapsuloides bryosalmonae, the species associated with whirling disease of the salmon, proliferative gill disease of the catfish, and proliferative kidney disease of the salmon, respectively, have been responsible for high morbidity and mortality and great economic losses. 7,14,33 Myxozoans have a complex life cycle that often alternates between vertebrate and invertebrate hosts with sporogony in each (i.e., alternating bisporogony). 4,11 Lumpfish (Cyclopterus lumpus) are semipelagic fish found in the eastern and western North Atlantic. Their pelvic fins have been modified into a single ventral sucker, allowing them to adhere to coastal rock structures and floating objects, such as algae and debris. They are an important commercial fish collected and reared for their meat and roe. 5,8 Due to their unique body shape and behavior, lumpfish are also a popular exhibit fish in public aquaria. The current report describes the clinical signs and pathology of Myxobolus albi infection in the cartilage of captive lumpfish at the New England Aquarium in Boston, Massachusetts (NEAq) and the John G. Shedd Aquarium in Chicago, Illinois (JGSAq). Animals Materials and methods Lumpfish were wild-caught by hand using SCUBA in Eastport, Maine, during October from 2005 through 2008 and were exhibited at the 2 aquaria. Cases 1 5 occurred at NEAq, while cases 6 11 originated from JGSAq. All animals completed routine quarantine protocols including immersion formalin at NEAq and immersion nitrofurazone, praziquantel, and oral fenbendazole at JGSAq as well as any other antimicrobial or antiparasitic medications required based on the results of skin scrapes and gill biopsies at the time of arrival. Animals were housed in multitaxa exhibits with various fishes and invertebrates at temperatures of 7 10 C. The fish were fed a mixture of live or frozen zooplankton and frozen fish or squid depending on the size of the lumpfish. Weights of affected animals ranged from 0.5 kg to 3.8 kg including both juveniles and adults. Cases 1, 2, and 11 were euthanized using an overdose of tricaine methanesulfonate a at approximately 250 ppm. Cytological and histological examination A premortem fine-needle aspirate was on case 2 in order to obtain cytological specimens from. Samples were expressed onto glass slides and stained with Romanowsky staining for microscopic examination. Tissues from enucleations and gross necropsies were fixed From the New England Aquarium, Boston, MA (Cavin, Innis), the Zoological Pathology Program, University of Illinois, Maywood, IL (Donahoe, Kinsel), the Connecticut Veterinary Medical Diagnostic Laboratory, Department of Pathobiology and Veterinary Science, University of Connecticut, Storrs, CT (Frasca, Nyaoke), the Fish Pathology Laboratory, University of California, Davis, CA (Kurobe), the John G. Shedd Aquarium, Chicago, IL (Naples, Poll), and the Aquatic Animal Health Laboratory, University of California, Davis, CA (Weber). 1 Corresponding Author: Julie M. Cavin, New England Aquarium, Central Wharf, Boston, MA jcavin@neaq.org
2 Myxobolus albi in lumpfish cartilage 517 Table 1. Primers used for amplification of 18S ribosomal DNA from a myxozoan parasite of lumpfish (Cyclopterus lumpus). Forward primer Sequence 5 3 Reverse primer Sequence 5 3 Target size (bp) Myxgen4f GTGCCTTGAATAAATCAGAG ACT1r AATTTCACCTCTCGCTGCCA 230 Myxgen2r CARATGCYTTCGCWYTTGTTA MyxFw CAGCAGGCGCGCAACTTTCC 540MyxRv CCTACGAATACCTTGTTACGAC 1,500 by immersion in 10% neutral buffered formalin and submitted to the Connecticut Veterinary Medical Diagnostic Laboratory, University of Connecticut (Storrs, CT; cases 1 5) and the Zoological Pathology Program, University of Illinois (Maywood, IL; cases 6 11) for histopathological evaluation. The tissues were fixed for a minimum of 48 hours, grossly evaluated, trimmed to fit plastic cassettes, processed routinely, embedded in paraffin, sectioned at 4 or 5 µm, and stained with hematoxylin and eosin and Ziehl Neelsen acid-fast stains for light microscopic examination. The dimensions and shapes of myxozoan spores in histological sections of formalin-fixed tissues as well as the number, size, and location of polar capsules were compared to previously identified species. 25 Molecular analysis Myxozoan identification was performed by polymerase chain reaction (PCR) and sequence comparison of 18S ribosomal DNA (rdna) of the species in question and other known myxozoans. Formalin-fixed, paraffin-embedded tissue blocks from case 2 were submitted to the Fish Pathology Laboratory, University of California (Davis, CA). Portions of the paraffin-containing myxozoan cysts in scleral cartilage were cut from blocks, and genomic DNA was extracted using a silica membrane based genomic DNA extraction kit b with deparaffinization according to the manufacturer s instructions. Concentrations of genomic DNA samples were measured by a spectrophotometer, c and approximately 100 ng of genomic DNA was used for degenerate PCR. Combinations of degenerate primers (Myxgen4f and ACT1r, Myxgen4f and Myxgen2r; Table 1) targeting short fragments of the myxozoan 18S rdna (<250 bp) were used for the reactions, as degradation of DNA was suspected due to formalin fixation. 16,20 Polymerase chain reaction was in 50-μl reaction volumes that included 200 μm of each dntp, 1.5 mm of MgCl 2, 40 pmol of each primer, 1 U of Taq DNA polymerase, d and 5 μl of 10 reaction buffer. The cycling conditions were as follows: initial denaturation step at 95 C for 5 min and then 40 cycles at 95 C for 30 sec, 50 C for 30 sec, and 72 C for 1 min, followed by a final extension step at 72 C for 5 min and then held at 4 C. The PCR products were separated on 2% agarose gels followed by ethidium bromide staining. The DNA bands were observed under ultraviolet transillumination, and amplicons of the expected size were excised and recovered using a gel extraction kit. e Extracted DNA was ligated into a cloning plasmid vector f for transformation of Escherichia coli DH5α competent cells. g The plasmid carrying the PCR product was extracted using a plasmid DNA extraction kit h according to the manufacturer s instructions. The sequence of the inserted fragment was determined using M13 forward and reverse primers by fluorescently labeled dideoxynucleotide terminator sequencing using an automated DNA sequencer i from 3 clones with the suspected M. albi genomic DNA fragment. Sequence similarity searches were performed using the Basic Local Alignment Search Tool for Nucleotide sequences (BLASTn) program available at the National Center for Biotechnology Information (NCBI) website ( Blast.cgi). 1 Pairwise comparisons of the parasite obtained in the current study with closely related species were performed using BioEdit software. j Another primer set targeting 1.5 kb of M. albi 18S rdna (538MyxFw and 540MyxRv; Table 1) was designed based on the reference sequence (EU420055). 30 Genomic DNA was extracted from frozen material of myxozoan cysts within the ocular cartilage from cases 9 and 10 using the silica membrane based genomic DNA extraction kit, a as described previously, without deparaffinization. Polymerase chain reaction using this second primer set was performed using the same composition of PCR reagents but with a longer extension time: 95 C for 5 min and then 30 cycles at 95 C for 30 sec, 50 C for 30 sec, and 72 C for 2 min. The sequence of the amplified fragment (1.5 kb) was determined as described previously. Clinical findings Results Mild to severe unilateral or bilateral exophthalmos was noted in all cases (Fig. 1). Case 1 was observed acutely spinning and then lying on its side with increased respiratory rate and effort. The fish was euthanized due to a poor prognosis. Bilateral exophthalmos was noted at gross necropsy. White or tan 1- to 2-mm-diameter nodules affected approximately 70 90% of the sclera in all cases. Hyphema was noted in case 2 (Fig. 1). Microscopic examination of scleral fineneedle aspirate from case 2 revealed multiple aggregates of 10- to 13-µm basophilic, circular to ovoid spores with 2 similarly sized pyriform polar capsules at one end. Occasional spores contained a darkly basophilic nucleus (Fig. 2). Case 3 had
3 518 Cavin et al. Pathological findings Figure 1. Severe bilateral exophthalmos and hyphema of the left eye are observed in a lumpfish (Cyclopterus lumpus) infected with Myxobolus albi (case 2). Figure 2. Lumpfish (Cyclopterus lumpus). Multiple, round myxozoan spores are present in this cytology of a fine-needle aspirate from the sclera of case 2. A pair of ovoid to pyriform polar capsules is discernable in several of these spores. Romanowsky stain. Bar = 10 μm. emphysema in the anterior and posterior chambers and a cranioventrally subluxated lens at initial examination of the right eye. Cases 5, 6, and 11 were initially examined due to unrelated causes, and exophthalmos was incidentally noted at that time. Cases 8 and 10 presented with unilateral exophthalmos, each undergoing enucleation of the affected eye. All of the cases either died or were euthanized at NEAq or JGSAq between August 2006 and January 2011 due to the severity of the myxozoan infection (cases 2 4) or unrelated causes including potential drug reaction (case 5), bacterial septicemia (cases 6, 11), disseminated mycotic infection (cases 7, 8, 11), jejunitis secondary to foreign material impaction (case 9), and acute, severe postovariectomy blood loss (case 10). Gross findings included multifocal to coalescing myxozoan cysts, each composed of sporogonic plasmodia up to 2 mm in diameter. Cysts were identified in the cartilage of the skull, branchial arch, sclera, vertebrae, tongue, all fin insertions, and the pectoral girdle (Fig. 3A C). Cysts most commonly resulted in expansile, deforming, space-occupying lesions lacking significant tissue damage and inflammation (Fig. 4A C). Cysts contained numerous 7.5- to 9-µm-long 3.0- to 6.0-µm-wide ovoid spores, each with a 1- to 3-µm-thick refractile wall, 2 pyriform polar capsules oriented at 1 pole, and occasionally a 1-µm-diameter basophilic nucleus. However, in some areas, large and coalescing cysts were associated with cartilage degeneration and necrosis, disruption of cortices of adjacent bone, and extension into surrounding tissue. Outside of cysts, free spores elicited a mild to marked granulomatous inflammatory response of the surrounding cartilage. In case 8, aggregates of myxozoan spores separated the retina from retinal pigmented epithelium and extended throughout the choroid, vitreous, posterior, and anterior chambers and into the ciliary body and iris. Drainage angles were obscured by myxozoan spores, histiocytes, erythrocytes, fibrin, and necrotic cellular debris. Myxozoan spores with similar morphology to those identified in the sclera or histiocytes with phagocytized fragments of spores were also scattered throughout parenchyma, interstitium, tubules, and glomeruli of the kidneys of cases 3 and 9, sometimes associated with inflammation or necrosis. Other significant pathological findings included acute, severe myocardial necrosis (case 1), marked diffuse atrial endothelial hypertrophy (cases 3, 10), granulomatous nephritis without identification of myxozoan spores (case 2), and multiorgan changes due to fungal or bacterial septicemia (cases 6 8, 11). These findings were considered evidence of intercurrent disease processes unrelated to the myxozoan infection. Molecular analysis An 18S rdna fragment (153 bp) was successfully amplified by the Myxgen4f and ACT1r primer set from a NEAq lumpfish (case 2) with unknown myxozoan parasites using formalin-fixed, paraffin-embedded material. The longer fragment (1,496 bp; JF776164) covering almost the entire 18S rdna sequence was amplified from frozen tissue from cases 9 and 10 submitted by JGSAq using the 538MyxFw and 540MyxRv primer set. Both amplified DNA sequences had 99% similarity to M. albi 18S rdna at the nucleotide level (EU420055). Pairwise comparisons with other myxozoan parasites shown in Table 2 indicate that the sequence is distinct from other myxozoan species. A summary of clinical, pathological, and molecular findings is provided in Table 3.
4 Myxobolus albi in lumpfish cartilage 519 Figure 3. Lumpfish (Cyclopterus lumpus). Myxobolus albi cysts are dispersed throughout the sclera (A) and form multiple aggregates located in the cartilage of the branchial arch (B) and cranial calvarium (C). Figure 4. Lumpfish (Cyclopterus lumpus). A, multiple, expansile, and deforming, round myxozoan cysts (*) are located along the length of the scleral cartilage (sc), along the posterior segment of the globe (e.g., choroid rete [cr] and vitreous chamber [vc]). Hematoxylin and eosin (HE). Bar = 500 μm. B, examination of myxozoan cysts at higher magnification reveals that spores are aggregated toward the center of cysts, whereas earlier developmental stages (*) are located along the periphery of the cyst at its margin with the sc. Spores, as evidenced by the aggregate circled, are present in multiple different planes of the section but, where visible, have 2 pyriform polar capsules at 1 pole. HE. Bar = 25 μm. Discussion Myxobolus albi was recently described as a new myxozoan species in the gill arch of the common goby (Pomatoschistus microps) in Scotland.30 Several myxozoan species are known to infect cartilage and have been associated with some of the most economically significant diseases of fish including proliferative gill disease of the channel catfish and whirling disease of salmonids.14,33 Once mostly a disease of farmed fish, whirling disease has recently been found in wild stock, causing concerns of population decline.14,27
5 520 Cavin et al. Table 2. Pairwise comparison of 18S ribosomal DNA sequence of lumpfish (Cyclopterus lumpus) myxozoan found in the current study and other myxozoan parasites. 30 * Sample no. Sample no. Species Accession no Lumpfish myxozoan (current study) JF Myxobolus albi EU Myxobolus acanthogobii AY Henneguya salminicola AF Henneguya ictaluri AF Myxidium truttae AJ Myxobolus cerebralis MCU * Numbers represent the percentage of similarity at the nucleotide level. While several species of myxozoans cause clinical illness, 22,25 the majority of infections cause chronic subclinical diseases with little to no clinical signs or host immune response. 15 In the current cases, all lumpfish exhibited unilateral or bilateral exophthalmos. Despite extensive cartilaginous expansion and deformation, there was often little inflammation unless there was rupture of the plasmodia and release of spores into the surrounding tissue, allowing interaction of antigenic spores with host macrophages and lymphocytes and thus promoting the host inflammatory response. This release of spores and degeneration of ocular tissues and systemic cartilage are likely important to the natural life cycle of the myxozoan, allowing the release of spores into the environment. Case 1 exhibited increased respiratory effort and acute spinning behavior prior to euthanasia, the latter likely being a nonspecific sign of illness, as no central nervous system lesions were observed in infections by this myxozoan. Case 3 was 1 of only 3 cases in which myxozoan infection was considered significant in the death of a lumpfish. During gross necropsy, cysts were noted within the sclera and other cartilage as in all other cases. Renal tubular necrosis was associated with myxospores having similar morphology to those identified in cartilage, which were observed in glomeruli and renal tubules. Several reports have suggested that such a severe reaction may be due to infection of an inappropriate tissue or host. 23,25,26 However, the kidney was not tested by PCR to confirm the identity of these myxospores. Atrial endothelial hypertrophy was attributed to systemically circulating myxozoan antigen. Renal mineralization was also observed, but this could have been the result of a concurrent disease process. The method of transmission of M. albi in lumpfish is not fully understood. It is widely demonstrated that an invertebrate host is usually needed to complete the myxozoan life cycle. 4,11,34 However, direct fish-to-fish transmission has been shown in some circumstances. 9,24,31 Lumpfish were wild-caught by NEAq staff and subjected to quarantine prior to mixing with previously collected animals or being transported to other institutions. It seems most plausible that animals arrived infected, although transmission directly between fish and acquisition of infection via an unrecognized invertebrate host within the exhibit systems are hypothetical alternatives. It is notable that 2 adult lumpfish born at NEAq have no grossly visible at the time of publication and that all cases to date have been diagnosed in lumpfish weighing over 400 g, despite the presence of smaller specimens in the collection. It is possible that animals under 400 g are too small to have grossly visible scleral cysts or that there is a latent subclinical period, with clinical signs developing after a certain age or body size or after a period of acute or chronic stress. 29 To date, there are no consistently effective medical treatments for myxozoan infections in fish. Several methods of disinfection including ultraviolet exposure, chlorine bleach, and hydrogen peroxide have been previously used to kill environmental infective stages. 18,32 The coccidiostat salinomycin with or without amprolium has successfully reduced the severity of branchial and renal myxozoan infection in sharpsnout sea bream (Diplodus puntazzo) and tapir fish (or elephantnose fish, Gnathonemus petersii). 3,10,21 Fumagillin also has some efficacy against myxozoa but has a high incidence of toxic side effects. 3,17,21 Multiple individualized treatments including, but not limited to, systemic acetazolamide, intraocular gentamicin, and systemic and topical broad-spectrum antibiotics were unsuccessfully attempted in the current cases to correct the exophthalmos but were not specifically aimed at eliminating the myxozoan infection. Further investigations into therapeutic agents for the treatment of myxozoan infections are warranted. Clinical and pharmacokinetic trials using salinomycin or other coccidiostats would be beneficial in determining the effectiveness of these drugs on myxospores in specific tissues and organs (e.g., therapeutic drug levels in the cartilage and scleral ossicle). The pairwise comparisons of the amplified 18S rdna sequences from infected lumpfish at JGSAq revealed
6 Myxobolus albi in lumpfish cartilage 521 Table 3. Clinical, pathological, and molecular findings for 11 lumpfish (Cyclopterus lumpus) infected with Myxobolus albi.* Case no. Source Clinical findings 1 NEAq Increased respiratory effort; acute spinning; emaciation; bilateral 2 NEAq Bilateral hyphema OS; 3 NEAq Ocular emphysema; subluxated lens; exophthalmos OD; mydriasis; scleral nodules 4 NEAq Exophthalmos; 5 NEAq Exophthalmos; ; corneal edema; acute decline during formalin treatment 6 JGSAq Bilateral ; corneal edema; acute lethargy and positive buoyancy 7 JGSAq Acute bilateral 8 JGSAq Exophthalmos OS; corneal edema; ; nonspecific abnormal appearance to anterior and posterior chambers 9 JGSAq Bilateral Diagnostic procedures Mortality Cause of death Pathological findings None Euthanasia Acute severe myocardial necrosis of unknown origin FNA of scleral nodule Euthanasia Poor prognosis due to severity of myxozoan infection None Natural Myxozoan infection with acute renal necrosis None Not recorded Myxozoan infection None Natural Potential formalin reaction None Natural Bacterial sepsis Retrobulbar and intraocular FNA Ocular ultrasound; enucleation OS Natural Natural Fungal septicemia Fungal septicemia None Natural Jejunal foreign body impaction Myocardial necrosis; branchial chondroplasia; chondral myxozoanosis (sclera) Chondral myxozoanosis (sclera, fin insertions, skull) with chondronecrosis and granulomatous chondritis; granulomatous nephritis Renal tubular necrosis with interstitial, intraluminal, and glomerular myxospores; chondral myxozoanosis (sclera, gill arches, skull); cataract; atrial endothelial hypertrophy Chondral myxozoanosis (all fin insertions, gill arches, opercula, mandible, sclera) Chondral myxozoanosis Coelomic effusion; chondral myxozoanosis (sclera, gill arches, skull, vertebrae) with chondritis; granulomatous inflammation with intralesional bacteria Retrobulbar, subcutaneous, and skeletal muscle edema; chondral myxozoanosis (skull, gill arches, sclera) with chondronecrosis and chondritis; disseminated fungal infection with necrosis of multiple tissues Chondral myxozoanosis (sclera, skeletal system); granulomatous and necrotizing panophthalmitis with myriad myxospores; disseminated fungal infection Transmural and ulcerative granulomatous jejunitis with stones; chondral myxozoanosis (skull, gill arches, vertebrae, fin insertions, sclera); mycotic dermatitis; histiocytes with phagocytized myxospores within renal parenchyma Molecular findings 99% similarity with M. albi 18S rdna (EU420055) 99% similarity with M. albi 18S rdna (EU420055) (continued)
7 522 Cavin et al. Table 3. (continued) Case no. Source Clinical findings 10 JGSAq Ulceration with possible perforation of cornea OD; ; exophthalmos OS 11 JGSAq Exophthalmos; ; multifocal refractory fungal dermatitis Diagnostic procedures Mortality Cause of death Pathological findings Enucleation OD Natural Postsurgical blood loss None Euthanasia Bacterial septicemia and disseminated mycosis Chondral myxozoanosis (gill arches, tongue, operculum, mandible, vertebrae, fin insertions, sclera) with chondronecrosis and chondritis; panophthalmitis with myxospores in subretinal space and vitreous and posterior chambers OD; atrial endocardial hypertrophy Chondral myxozoanosis (skull, sclera); ulcerative fungal dermatitis and multiorgan fungal infection; bacterial epicarditis Molecular findings 99% similarity with M. albi 18S rdna (EU420055) * NEAq = New England Aquarium (Boston, MA); OS = oculus sinister (left eye); FNA = fine-needle aspirate; OD = oculus dexter (right eye); JGSAq = John G. Shedd Aquarium (Chicago, IL); rdna = ribosomal DNA. significantly high similarity at the nucleotide level to that of M. albi (99%) and lower similarity to those of other representative myxozoans (<60%) as shown in Table 2, suggesting that the myxozoan found in the cartilage of these lumpfish is most likely one of the isolates in the species M. albi. Prior to molecular testing, the parasites were presumptively identified as Myxobolus aeglefini Auerbach, 1906 based on myxospore morphology and previous reports of M. aeglefini in the cartilage and bone of the head of lumpfish and in the cornea of the blue whiting (Micromesistius poutassou). 25 Spores from M. aeglefini and M. albi share several morphological features including similar size, shape, and location and number of polar capsules. 25,28,30 Multiple recent studies of other myxozoan species have reported that re-evaluations of isolates based on 18S rdna sequence comparisons often confirm the presumptive identification of isolates but occasionally determine that myxozoans previously identified as different species are the same. 19,28,35 Currently, DNA sequences from M. aeglefini are not available; therefore, it is possible that previously described parasites in the cartilage of lumpfish 25 were misidentified as M. aeglefini based on myxospore morphology and were actually the yet unknown M. albi or that the 2 species are actually the same. The current study and other reports regarding the use of molecular techniques to further describe myxozoan species or their phylogenetic relationships suggest the need for a comprehensive database linking genetic information and morphological features of the organisms. 2,6,12,13 Historically, myxozoans have been grouped based on spore morphology, host, or site fidelity and geographic location. In the present study, the presence of M. albi was demonstrated in a different host, distant geographic location, and different environment (marine vs. estuarine) from that in which it was originally described, a link made possible by comparison of 18S rdna. Acknowledgements The authors acknowledge Stephen Atkinson at Oregon State University for providing the primer sequences, Dr. Ronald P. Hedrick for guiding the molecular procedures, Pilar J. Nelson for Figure 1, and Alexandra Young for assistance with graphics and digital artistry. The authors also appreciate the husbandry and veterinary staff of the New England Aquarium and John G. Shedd Aquarium for their care of the affected animals and assistance with necessary medical treatments. Sources and manufacturers a. Finquel, Argent Chemical Laboratories, Redmond, WA. b. QIAamp DNA Mini Kit, Qiagen Inc., Valencia, CA. c. BioPhotometer plus, Eppendorf North America, Hauppauge, NY. d. Platinum Taq DNA Polymerase, Invitrogen Corp., Carlsbad, CA. e. QIAEX II Gel Extraction Kit, Qiagen Inc., Valencia, CA. f. pgem -T Easy Vector System, Promega BioSciences, San Luis Obispo, CA. g. Escherichia coli DH5α Competent cells, Invitrogen Corp., Carlsbad, CA. h QIAprep Spin Miniprep Kit, Qiagen Inc., Valencia, CA. i. ABI PRISM 3730 DNA Analyzer, Applied Biosystems, Carlsbad, CA. j. Available at: Declaration of conflicting interests The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article. Funding The author(s) declared that they received no financial support for their research and/or authorship of this article.
8 Myxobolus albi in lumpfish cartilage 523 References 1. Altschul SF, Gish W, Miller W, et al.: 1990, Basic local alignment search tool. J Mol Biol 215: Andree KB, Székely C, Molnár K, et al.: 1999, Relationships among members of the genus Myxobolus (Myxozoa: Bilvalvidae) based on small subunit ribosomal DNA sequences. J Parasitol 85: Athanassopoulou F, Karagouni E, Dotsika E, et al.: 2004, Efficacy and toxicity of orally administrated anti-coccidial drugs for innovative treatments of Myxobolus sp. infection in Puntazzo puntazzo. Dis Aquat Organ 62: Bartholomew JL, Whipple MJ, Stevens DG, Fryer JL: 1997, The life cycle of Ceratomyxa shasta, a myxosporean parasite of salmonids, requires a freshwater polychaete as an alternate host. J Parasitol 83: Benfey TJ, Methven DA: 1986, Pilot-scale rearing of larval and juvenile lumpfish (Cyclopterus lumpus L.), with some notes on early development. Aquaculture 56: Camus AC, Griffin MJ: 2010, Molecular characterization and histopathology of Myxobolus koi infecting the gills of a koi, Cyprinus carpio, with an amended morphological description of the agent. J Parasitol 96: Canning EU, Tops S, Curry A, et al.: 2002, Ecology, development and pathogenicity of Buddenbrockia plumatellae Schröder, 1910 (Myxozoa, Malacosporea) (syn. Tetracapsula bryozoides) and establishment of Tetracapsuloides n. gen. for Tetracapsula bryosalmonae. J Eukaryot Microbiol 49: Collins MAJ: 1976, The lumpfish (Cyclopterus lumpus L.) in Newfoundland waters. Canadian Field-Naturalist 90: Diamant A: 1997, Fish-to-fish transmission of a marine myxosporean. Dis Aquat Organ 30: Dohle A, Schmahl G, Raether W, et al.: 2002, Effects of orally administered chemotherapeutics (quinine, salinomycin) against Henneguya sp. Thelohán, 1892 (Myxozoa: Myxobolidae), a gill parasite in the tapir fish Gnathonemus petersii Günther, 1862 (Teleostei). Parasitol Res 88: el-matbouli M, Hoffmann R: 1989, Experimental transmission of two Myxobolus spp. developing bisporogeny via tubificid worms. Parasitol Res 75: Fiala I: 2006, The phylogeny of Myxosporea (Myxozoa) based on small subunit ribosomal RNA gene analysis. Int J Parasitol 36: Fiala I, Bartošová P: 2010, History of myxozoan character evolution on the basis of rdna and EF-2 data. BMC Evol Biol 10: Gilbert MA, Granath WO Jr: 2003, Whirling disease of salmonid fish: life cycle, biology and disease. J Parasitol 89: Griffin BR, Davis EM: 1978, Myxosoma cerebralis: detection of circulating antibodies in infected rainbow trout (Salmo gairdneri). J Fish Res Board Can 35: Hallett SL, Diamant A: 2001, Ultrastructure and small-subunit ribosomal DNA sequence of Henneguya lesteri n. sp. (Myxosporea), a parasite of sand whiting Sillago analis (Sillaginidae) from the coast of Queensland, Australia. Dis Aquat Organ 46: Hedrick RP, Groff JM, Foley P, McDowell T: 1988, Oral administration of fumagillin DCH protects Chinook salmon Oncorhynchus tshawytscha from experimentally-induced proliferative kidney disease. Dis Aquat Organ 4: Hedrick RP, McDowell TS, Marty GD, et al.: 2000, Ultraviolet irradiation inactivates the waterborne infective stages of Myxobolus cerebralis: a treatment for hatchery water supplies. Dis Aquat Organ 42: Hogge CI, Campbell MR, Johnson KA: 2008, Redescription and molecular characterization of Myxobolus kisutchi Yasutake & Wood, J Fish Dis 31: Jirků M, Bolek MG, Whipps CM, et al.: 2006, A new species of Myxidium (Myxosporea: Myxidiidae), from the Western chorus frog, Pseudacris triseriata triseriata, and Blanchard s cricket frog, Acris crepitans blanchardi (Hylidae), from eastern Nebraska: morphology, phylogeny, and critical comments on amphibian Myxidium taxonomy. J Parasitol 92: Karagouni E, Athanassopoulou F, Lytra A, et al.: 2005, Antiparasitic and immunomodulatory effect of innovative treatments against Myxolobus sp. infection in Diplodus puntazzo. Vet Parasitol 134: Kent ML, Andree KB, Bartholomew JL, et al.: 2001, Recent advances in our knowledge of the Myxozoa. J Eukaryot Microbiol 48: Kent ML, Khattra J, Hedrick RP, Devlin RH: 2000, Tetracapsula renicola n. sp. (Myxozoa: Saccosporidae); the PKX myxozoan: the cause of proliferative kidney disease of salmonid fishes. J Parasitol 86: Lom J, Dyková I: 1988, Sporogenesis and spore structure in Kudoa lunata (Myxosporea, Multivalvulida). Parasitol Res 74: Lom J, Dyková I: 1992, Protozoan parasites of fishes. In: Developments in aquaculture and fisheries science, vol. 26, pp Elsevier, New York, NY. 26. Lom J, Dyková I: 2006, Myxozoan genera: definition and notes on taxonomy, life-cycle terminology and pathogenic species. Folia Parasitol (Praha) 53: Murcia S, Kerans BL, MacConnell E, Koel TM: 2006, Myxobolus cerebralis infection patterns in Yellowstone cutthroat trout after natural exposure. Dis Aquat Organ 71: Nielsen CV, Køie M, Székely C, Buchmann K: 2002, Comparative analysis of 18S rrna genes from Myxobolus aeglefini Auerbach, 1906 isolated from cod (Gadus morhua), plaice (Pleuronectes platessa) and dab (Limanda limanda), using PCR-RFLP. Bull Eur Assoc Fish Pathol 22: Nolan MW, Roberts HE, Zimmerman KL, Smith SA: 2010, Pathology in practice: severe, chronic, focal, granulomatous, nodular and ulcerative stomatitis with myxosporidia (Myxobolus sp.). J Am Vet Med Assoc 236: Picon-Camacho SM, Holzer AS, Freeman MA, et al.: 2009, Myxobolus albi n. sp. (Myxozoa) from the gills of the common goby Pomatoschistus microps Krφyer (Teleostei: Gobiidae). J Eukaryot Microbiol 56: Swearer SE, Robertson DR: 1999, Life history, pathology, and description of Kudoa ovivora n. sp. (Myxozoa, Myxosporea):
9 524 Cavin et al. an ovarian parasite of Caribbean labroid fishes. J Parasitol 85: Wagner EJ, Smith M, Arndt R, Roberts DW: 2003, Physical and chemical effects on viability of the Myxobolus cerebralis triactinomyxon. Dis Aquat Organ 53: Wise DJ, Griffin MJ, Terhune JS, et al.: 2008, Induction and evaluation of proliferative gill disease in channel catfish fingerlings. J Aquat Anim Health 20: Wolf K, Markiw ME, Hiltunen JK: 1986, Salmonid whirling disease: Tubifex tubifex (Müller) identified as the essential oligochaete in the protozoan life cycle. J Fish Dis 9: Yokoyama H, Freeman MA, Yoshinaga T, Ogawa K: 2004, Myxobolus buri, the myxosporean parasite causing scoliosis of yellowtail, is synonymous with Myxobolus acanthogobii infecting the brain of the yellowfin goby. Fish Sci 70:
A Lymphosarcoma in an Atlantic Salmon (Salmo salar)
A Lymphosarcoma in an Atlantic Salmon (Salmo salar) Authors: Paul R. Bowser, Marilyn J. Wolfe, and Timothy Wallbridge Source: Journal of Wildlife Diseases, 23(4) : 698-701 Published By: Wildlife Disease
More informationPrevention of experimentally induced whirling disease in rainbow trout Oncorhynchus mykiss by Fumagillin
Vol. 10: 109-113, 1991 DISEASES OF AQUATIC ORGANISMS Dis. aquat. Org. Published April 4 Prevention of experimentally induced whirling disease in rainbow trout Oncorhynchus mykiss by Fumagillin M. El-Matbouli,
More informationThe Israeli Journal of Aquaculture Bamidgeh 58(3), 2006,
The Israeli Journal of Aquaculture Bamidgeh 58(3), 26, 157-169. 157 Efficacy and Toxicity of Orally Administrated Anti-Coccidial Drug Treatment on Enteromyxum leei Infections in Sharpsnout Seabream (Diplodus
More informationBORKHANUDDIN Hafiz, CECH Gábor, OSTOROS Györgyi, MOLNÁR Kálmán, SZÉKELY Csaba
BORKHANUDDIN Hafiz, CECH Gábor, OSTOROS Györgyi, MOLNÁR Kálmán, SZÉKELY Csaba Veterinary Medical Research Institute of the Hungarian Academy of Sciences, 1143. Budapest. Hungária krt. 21. Introduction
More informationThe life cycle of Myxobolus lentisuturalis (Myxozoa: Myxobolidae), from goldfish (Carassius auratus auratus), involves a Raabeia-type actinospore
FOLIA PARASITOLOGICA 56[1]: 6 12, 2009 ISSN 0015-5683 (print), ISSN 1803-6465 (online) Institute of Parasitology, Biology Centre ASCR http://www.paru.cas.cz/folia/ The life cycle of Myxobolus lentisuturalis
More informationMyxosporeans and myxosporidiosis of common carp and gibel carp in China
Myxosporeans and myxosporidiosis of common carp and gibel carp in China Zhang Jinyong, Liu Xinhua, Xi Bingwen, Kálmán Molnár zhangjy@ihb.ac.cn Hungary 2015 June.3 Laboratory of Fish Diseases; Institute
More informationMyxosporeans and myxosporidiosis of allogynogenetic gibel carp (Carassius auratus gibelio Bloch) in China
Myxosporeans and myxosporidiosis of allogynogenetic gibel carp (Carassius auratus gibelio Bloch) in China Zhang Jinyong zhangjy@ihb.ac.cn Laboratory of Fish Diseases; Institute of Hydrobiology (IHB), Chinese
More information4-year-old neutered male American domestic shorthair cat with a locally extensive area of swelling ulceration and crusting over the nasal planum.
4-year-old neutered male American domestic shorthair cat with a locally extensive area of swelling ulceration and crusting over the nasal planum. Which of the following is the most likely disease? 1. Squamous
More informationThomas G. Rosser. Wes A. Baumgartner. Michael A. Barger. Matt J. Griffin
DOI 10.1007/s10-017-9719-3 Myxobolus lepomis n. sp. (Cnidaria: Myxobolidae), a gill myxozoan infecting Lepomis marginatus Holbrook and Lepomis miniatus Jordan (Perciformes: Centrarchidae), in the Big Thicket
More informationPCR detection of Leptospira in. stray cat and
PCR detection of Leptospira in 1 Department of Pathology, School of Veterinary Medicine, Islamic Azad University, Shahrekord Branch, Shahrekord, Iran 2 Department of Microbiology, School of Veterinary
More informationAhead of print online version
FOLIA PARASITOLOGICA 61 [6]: 505 511, 2014 ISSN 0015-5683 (print), ISSN 1803-6465 (online) doi: 10.14411/fp.2014.052 Institute of Parasitology, Biology Centre ASCR http://folia.paru.cas.cz/ Myxobolus oralis
More informationASVCP quality assurance guidelines: veterinary immunocytochemistry (ICC)
ASVCP quality assurance guidelines: veterinary immunocytochemistry (ICC) Version 1.0 (Approved 11/2017) Developed by the American Society for Veterinary Clinical Pathology (ASVCP) Quality Assurance and
More informationF1 IN THE NAME OF GOD
F1 IN THE NAME OF GOD Slide 1 F1 FEIKO.IR.SOFT; 2011/07/06 Lid Laceration Conjunctival Hemorrhage a) No therapy is necessary b) Usually resolve in 7-12 days. Subconjunctival Hemorrhage Corneal Abrasion
More informationEfficacy and toxicity of orally administrated anti-coccidial drugs for innovative treatments of Myxobolus sp. infection in Puntazzo puntazzo
DISEASES OF AQUATIC ORGANISMS Vol. 62: 217 226, 2004 Published December 13 Dis Aquat Org Efficacy and toxicity of orally administrated anti-coccidial drugs for innovative treatments of Myxobolus sp. infection
More informationMy fish appear to be itchy... they re jumping about, scraping and flicking
Vet Times The website for the veterinary profession https://www.vettimes.co.uk My fish appear to be itchy... they re jumping about, scraping and flicking Author : FIONA MACDONALD Categories : Vets Date
More informationThere is no one correct way to describe a slide. Macroscopic Veterinary Pathology. Be concise. Look at the center of the slide.
Macroscopic Veterinary Pathology There is no one correct way to describe a slide. Bruce Williams, DVM, DACVP Senior Pathologist, JPC Email: williams@cldavis.org Tissue from a sheep Tissue from a foal Be
More informationChapter 1 COPYRIGHTED MATERIAL. Introduction to Veterinary Pathology. What is pathology? Who does pathology?
What is pathology? Who does pathology? Chapter 1 Introduction to Veterinary Pathology Anatomic pathology Clinical pathology Microbiology Parasitology Immunology Toxicology Veterinary forensic pathology
More informationAhead of print online version
Folia Parasitologica 58[2]: 157 163, 2011 ISSN 0015-5683 (print), ISSN 1803-6465 (online) Institute of Parasitology, Biology Centre ASCR http://www.paru.cas.cz/folia/ The development of Myxobolus pavlovskii
More informationFish Farms. DATCP Fish Health 4/21/2009. Myron Kebus, MS, DVM. State Aquaculture Veterinary Epidemiologist
Fish Farms Myron Kebus, MS, DVM State Aquaculture Veterinary Epidemiologist DATCP Fish Health National model for fish health programs Requirements: Import permits Health certificates Record-keeping Reportable
More informationA novel myxozoan parasite of terrestrial mammals: description of Soricimyxum minuti sp. n. (Myxosporea) in pygmy shrew Sorex minutus from Hungary
Institute of Parasitology, Biology Centre CAS Folia Parasitologica 2015, 62: 045 http://folia.paru.cas.cz Research Article A novel myxozoan parasite of terrestrial mammals: description of Soricimyxum minuti
More informationConsequences of Antimicrobial Resistant Bacteria. Antimicrobial Resistance. Molecular Genetics of Antimicrobial Resistance. Topics to be Covered
Antimicrobial Resistance Consequences of Antimicrobial Resistant Bacteria Change in the approach to the administration of empiric antimicrobial therapy Increased number of hospitalizations Increased length
More informationMID 23. Antimicrobial Resistance. Consequences of Antimicrobial Resistant Bacteria. Molecular Genetics of Antimicrobial Resistance
Antimicrobial Resistance Molecular Genetics of Antimicrobial Resistance Micro evolutionary change - point mutations Beta-lactamase mutation extends spectrum of the enzyme rpob gene (RNA polymerase) mutation
More informationAntimicrobial Resistance
Antimicrobial Resistance Consequences of Antimicrobial Resistant Bacteria Change in the approach to the administration of empiric antimicrobial therapy Increased number of hospitalizations Increased length
More informationAntimicrobial Resistance Acquisition of Foreign DNA
Antimicrobial Resistance Acquisition of Foreign DNA Levy, Scientific American Horizontal gene transfer is common, even between Gram positive and negative bacteria Plasmid - transfer of single or multiple
More informationLesions of Neonatally Induced Toxoplasmosis in Cats
Vet Pathol33:290-295 (1 996) Lesions of Neonatally Induced Toxoplasmosis in Cats J. P. DUBEY, M. E. MATTIX, AND T. P. LIPSCOMB Parasite Biology and Epidemiology Laboratory, Livestock and Poultry Sciences
More informationThe detection of Cytauxzoon felis in apparently healthy free-roaming cats in the USA
Veterinary Parasitology 146 (2007) 316 320 www.elsevier.com/locate/vetpar The detection of Cytauxzoon felis in apparently healthy free-roaming cats in the USA Marion D. Haber a, Melissa D. Tucker a, Henry
More informationVeterinary Surgical Pathology and Necropsy Services
Veterinary Surgical Pathology and Necropsy Services 61 Biopolis Drive, Proteos Building Level 6 Singapore 138673 Telephone: (65) 6586 9629 http://www.imcb.a-star.edu.sg/php/ittd-i-histo.php Advanced Molecular
More informationCopyright is owned by the Author of the thesis. Permission is given for a copy to be downloaded by an individual for the purpose of research and
Copyright is owned by the Author of the thesis. Permission is given for a copy to be downloaded by an individual for the purpose of research and private study only. The thesis may not be reproduced elsewhere
More information"Incremento del riesgo de Necrosis Aguda del
"Incremento del riesgo de Necrosis Aguda del Hepatopáncreas (AHPND) y Necrosis Séptica del Hepátopacreas (SHPN) en Penaeus vannamei infectados con Enterocytozoon hepatopenaei (EHP) Luis Fernando Aranguren
More informationHISTOPATHOLOGY. Introduction:
Introduction: HISTOPATHOLOGY Goats and sheep are the major domestic animal species in India. Much of the economy of the country has been depend upon the domestication of these animals. Especially economy
More informationVOTS Meeting Nov Puerto Rico. Billie Beckwith-Cohen, DVM, MBA Comparative Ocular Pathology Fellow UW-Madison School of Veterinary Medicine
VOTS Meeting Nov. 2013 Puerto Rico Billie Beckwith-Cohen, DVM, MBA Comparative Ocular Pathology Fellow UW-Madison School of Veterinary Medicine What is COPLOW? Founded in 1983 by Dr. Richard R. Dubielzig
More informationEYE CONDITIONS IN THE DOMESTIC FERRET
EYE CONDITIONS IN THE DOMESTIC FERRET Several conditions can impact the eyes of domestic ferrets. The following conditions are the most common: cataracts, glaucoma, uveitis, infections, nutritional or
More informationPractical management of bacterial diseases in finfish aquaculture to minimize AMR
FMM/RAS/298: Strengthening capacities, policies and national action plans on prudent and responsible use of antimicrobials in fisheries Final Workshop in cooperation with AVA Singapore and INFOFISH 12-14
More informationPLASMODIUM MODULE 39.1 INTRODUCTION OBJECTIVES 39.2 MALARIAL PARASITE. Notes
Plasmodium MODULE 39 PLASMODIUM 39.1 INTRODUCTION Malaria is characterized by intermittent fever associated with chills and rigors in the patient. There may be enlargement of the liver and spleen in the
More informationPoints to consider before embarking on certification
DISEASE FREE CERTIFICATION OF LIVE KOI AND TROUT OVA FOR EXPORT TO THE EUROPEAN UNION David Huchzermeyer Sterkspruit Veterinary Clinic Points to consider before embarking on certification The prospective
More informationVeterinary Surgical Pathology and Necropsy Services
Veterinary Surgical Pathology and Necropsy Services 61 Biopolis Drive, Proteos Building Level 6 Singapore 138673 Telephone: (65) 6586 9629 http://www.imcb.a star.edu.sg/php/ittd i histo.php Advanced Molecular
More informationTHE STRUCTURE OF ECHINOCOCCAL CYSTS AND HISTOPATHOLOGICAL CHANGES IN LIVER
THE STRUCTURE OF ECHINOCOCCAL CYSTS AND HISTOPATHOLOGICAL CHANGES IN LIVER Michal Juszynski Helena Palenga, Danuta Cielecka PhD Department of General Biology and Parasitology Medical University of Warsaw
More informationMechanisms and Pathways of AMR in the environment
FMM/RAS/298: Strengthening capacities, policies and national action plans on prudent and responsible use of antimicrobials in fisheries Final Workshop in cooperation with AVA Singapore and INFOFISH 12-14
More informationDISEASE SAMPLING. Readings. What to wear, what to wear 3/9/2009. Required. Supplemental. Rubber boots or waders Disposable gloves
DISEASE SAMPLING Readings Required Standard operating procedures SEPARC collecting and shipping specimens for diagnostic testing Green et al. Disease Monitoring and Biosafety Section 26.3 and 26.4 Supplemental
More informationAn introduction to ear cytology in small animal patients
Vet Times The website for the veterinary profession https://www.vettimes.co.uk An introduction to ear cytology in small animal patients Author : Ariane Neuber Categories : RVNs Date : November 1, 2009
More informationUpper Respiratory Pathogens of Chelonians: A Snotty Turtle
Upper Respiratory Pathogens of Chelonians: A Snotty Turtle Matt Allender, DVM, MS, PhD, Dipl. ACZM University of Illinois Illinois Fall Conference 2015 Pathogens o o o Ranavirus Herpes Mycoplasma General
More informationHEMATOPOETIC LAB. Heather Fenton/S. Martinson VPM 222 March, 2013
HEMATOPOETIC LAB Heather Fenton/S. Martinson VPM 222 March, 2013 Diffuse Splenomegaly: Bloody vs Meaty Photos: Pathologic basis of veterinary disease Bloody Spleen: Swollen margins Dark red Oozes blood
More informationVeterinary Ophthalmology
Veterinary Ophthalmology Eyelids Protect the eye Provides part of and spreads the tear film Regulates the amount of light that enters the eye Clears foreign material Third Eyelid Protects the cornea by
More informationCanine and Feline Distemper. Description. The following chart indicates the animals which are susceptible to infection by canine and feline distemp
Canine and Feline Distemper Description Canine and feline distemper are diseases affecting many wild and domestic carnivo The following chart indicates the animals which are susceptible to infection by
More informationStudy of Bacteriological Profile of Corneal Ulcers in Patients Attending VIMS, Ballari, India
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 5 Number 7 (2016) pp. 200-205 Journal homepage: http://www.ijcmas.com Original Research Article http://dx.doi.org/10.20546/ijcmas.2016.507.020
More informationIndex. Note: Page numbers of article titles are in boldface type.
Index Note: Page numbers of article titles are in boldface type. A Adnexal pain, in farm animals, ocular squamous cell carcinoma and, 431 432 Age, as factor in OSCC, 518 Akinesia, in eye examination in
More informationFirst Record of Myxobolus Species (Myxosporea: Myxobolidae) in Grey Mullet Mugil cephalus (Teleostei, Mugilidae) from Syria
First Record of Myxobolus Species (Myxosporea: Myxobolidae) in Grey Mullet Mugil cephalus (Teleostei, Mugilidae) from Syria Hassan M Salman*,Amal I Dayoub**, Paolo Merella***,Nasreen M Kurhaily* *Department
More informationWashington State University Institutional Animal Care and Use Committee Management of Ulcerative Dermatitis in Mice Approved: 06/27/2018
1.0 Purpose: This SOP authorizes and outlines objective scoring and various treatment options of mice with ulcerative dermatitis by veterinary staff, investigative personnel and animal care technicians
More informationUpdate on diagnosis of feline infectious peritonitis (FIP)
Update on diagnosis of feline infectious peritonitis (FIP) Séverine Tasker RCVS Specialist in Feline Medicine The Feline Centre Langford Veterinary Services University of Bristol http://www.felinecentre.co.uk/
More informationInternationalJournalofAgricultural
www.ijasvm.com IJASVM InternationalJournalofAgricultural SciencesandVeterinaryMedicine ISSN:2320-3730 Vol.5,No.1,February2017 E-Mail:editorijasvm@gmail.com oreditor@ijasvm.comm@gmail.com Int. J. Agric.Sc
More informationFish Pathology. presentation for. CA DFG Fish Hatcheries
Fish Pathology presentation for CA DFG Fish Hatcheries Outline 1. Fish Lab (who we are, what we do) 2. Fish Health at Hatcheries 3. Some Common Pathogens 4. Treating Fish Diseases CA DFG Fish Health Laboratory
More informationEXOSTOSIS OF THE MANDIBLE OF THE CHICKEN
EXOSTOSIS OF THE MANDIBLE OF THE CHICKEN COMPLICATING EDEMA OF THE WATTLES GEORGE MILTON SMITH, M.D.1 (AnutomioaZ Laboratory, Yale School of Medicine, New Haven, Connecticut) During the past year opportunity
More informationMedical Genetics and Diagnosis Lab #3. Gel electrophoresis
Medical Genetics and Diagnosis Lab #3 Gel electrophoresis Background Information Gel electrophoresis is the standard lab procedure for separating DNA by size (e.g. length in base pairs) for visualization
More informationThe surveillance programme for bovine tuberculosis in Norway 2017
Annual Report The surveillance programme for bovine tuberculosis in Norway 2017 Norwegian Veterinary Institute The surveillance programme for bovine tuberculosis in Norway in 2017 Content Summary... 3
More informationHow to stop the snotty noses: Preventing feline upper respiratory infections. Staci Cannon, DVM, MPH, DACVPM, DABVP (Shelter Medicine Practice)
How to stop the snotty noses: Preventing feline upper respiratory infections Staci Cannon, DVM, MPH, DACVPM, DABVP (Shelter Medicine Practice) Why is URI so hard to control? Multiple pathogens Chronic
More informationZoology Department, College of Science, King Saud University, Riyadh, Saudi Arabia 3
Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 106(5): 557-561, August 2011 557 Myxidium volitans sp. nov., a parasite of the gallbladder of the fish, Dactylopterus volitans (Teleostei: Triglidae) from the
More informationIntroduction to Fish Health Management 1
CIR921 Introduction to Fish Health Management 1 Ruth Francis-Floyd 2 What Is Fish Health Management? Fish health management is a term used in aquaculture to describe management practices which are designed
More informationA comparison of placental tissue in the skinks Eulamprus tympanum and E. quoyii. Yates, Lauren A.
A comparison of placental tissue in the skinks Eulamprus tympanum and E. quoyii Yates, Lauren A. Abstract: The species Eulamprus tympanum and Eulamprus quoyii are viviparous skinks that are said to have
More informationCercetări bacteriologice, epidemiologice şi serologice în bruceloza ovină ABSTRACT
ABSTRACT Thesis entitled BACTERIOLOGICAL, EPIDEMIOLOGICAL AND SEROLOGICAL RESEARCHES IN BRUCELLOSIS OVINE is scientific and practical reasons the following: - Infectious epididymitis in Romania, described
More informationSarcocystis heydorni, n. sp. (Apicomplexa: Protozoa) with cattle (Bos taurus) and human
1 Sarcocystis heydorni, n. sp. (Apicomplexa: Protozoa) with cattle (Bos taurus) and human (Homo sapiens) cycle Jitender P. Dubey 1, Erna van Wilpe 2, Rafael Calero-Bernal 1, Shiv Kumar Verma 1, Ronald
More informationVeterinary Diagnostics Portfolio Overview. Complete solutions for veterinary testing and pathogen research
Veterinary Diagnostics Portfolio Overview Complete solutions for veterinary testing and pathogen research Sample preparation products Cat. no. (number of preps) Target analyte Product Short description
More informationMyxozoans Exploiting Homeotherms
Myxozoans Exploiting Homeotherms Sascha L. Hallett, Stephen D. Atkinson, Jerri L. Bartholomew, and Csaba Székely 7 Abstract Discoveries published in 2007 and 2008 expanded the known host range of myxozoans
More informationVETERINARY BIOMEDICAL SCIENCES (VBSC)
Veterinary Biomedical Sciences (VBSC) 1 VETERINARY BIOMEDICAL SCIENCES (VBSC) VBSC 5000 Master s Research and Thesis Prerequisites: Graduate standing. Description: Research problem for meeting requirements
More informationAquarium Department Celebrate, Connect, Care
Aquarium Department Celebrate, Connect, Care Introduction Gary Violetta Curator of Fishes at SeaWorld Orlando Graduated from Bowling Green State University Major : Marine Science Minor: Chemistry SeaWorld
More informationProtein Synthesis Inhibitors
Protein Synthesis Inhibitors Assistant Professor Dr. Naza M. Ali 11 Nov 2018 Lec 7 Aminoglycosides Are structurally related two amino sugars attached by glycosidic linkages. They are bactericidal Inhibitors
More informationDr. Norman Ackerman served the University of Florida, College of Veterinary Medicine with distinction as Professor of Radiology from 1979 to 1994.
Dr. Norman Ackerman served the University of Florida, College of Veterinary Medicine with distinction as Professor of Radiology from 1979 to 1994. A concerned teacher of veterinary students and residents
More informationTreatment of septic peritonitis
Vet Times The website for the veterinary profession https://www.vettimes.co.uk Treatment of septic peritonitis Author : Andrew Linklater Categories : Companion animal, Vets Date : November 2, 2016 Septic
More informationThis is the smallest tapeworm that can affect human being but it s not really proper human tapeworm (the human is not the primary host).
Echinococcus Granulosus Small Tapeworm (1 cm), Cestode. This is the smallest tapeworm that can affect human being but it s not really proper human tapeworm (the human is not the primary host). The primary
More informationCOMMON CLINICAL CONDITIONS IN RATS AND MICE
COMMON CLINICAL CONDITIONS IN RATS AND MICE Megan H. Nowland, DVM, Diplomate ACLAM Assistant Professor Unit for Laboratory Animal Medicine University of Michigan NCRC Building 10, Suite G90 2800 Plymouth
More informationEar drops suspension. A smooth, uniform, white to off-white viscous suspension.
SUMMARY OF PRODUCT CHARACTERISTICS 1. NAME OF THE VETERINARY MEDICINAL PRODUCT OTOMAX EAR DROPS SUSPENSION 2. QUALITATIVE AND QUANTITATIVE COMPOSITION Each ml of the veterinary medicinal product contains:
More informationHYDATID CYST DISEASE
HYDATID CYST DISEASE Hydatid disease, also called hydatidosis or echinococcosis, is a cystforming disease resulting from an infection with the metacestode, or larval form, of parasitic dog tapeworms from
More informationAnaesthesia and Analgesia of fish
Anaesthesia and Analgesia of fish Dr Stewart Fielder Port Stephens Fisheries Institute Marine fish production and enhancement Plan of talk Who uses anaesthetics for fish Why anaesthetics are used When
More informationTitle. CitationJapanese Journal of Veterinary Research, 52(2): 101- Issue Date Doc URL. Type. File Information
Title INFORMATION: Thesis for the Doctor of Veterinary Med CitationJapanese Journal of Veterinary Research, 52(2): 101- Issue Date 2004-08 Doc URL http://hdl.handle.net/2115/10515 Type bulletin File Information
More informationAntimicrobial Resistance
Antimicrobial Resistance Consequences of Antimicrobial Resistant Bacteria Change in the approach to the administration of Change in the approach to the administration of empiric antimicrobial therapy Increased
More informationInternational Journal of Science, Environment and Technology, Vol. 6, No 1, 2017,
International Journal of Science, Environment and Technology, Vol. 6, No 1, 2017, 872 876 ISSN 2278-3687 (O) 2277-663X (P) Case report SURGICAL MANAGEMENT OF BILATERAL HYPERMATURE CATARACT BY EXTRACAPSULAR
More informationVertebrates. Vertebrate Characteristics. 444 Chapter 14
4 Vertebrates Key Concept All vertebrates have a backbone, which supports other specialized body structures and functions. What You Will Learn Vertebrates have an endoskeleton that provides support and
More informationGood aquaculture and biosecurity practices to minimize AMR
FMM/RAS/298: Strengthening capacities, policies and national action plans on prudent and responsible use of antimicrobials in fisheries Good aquaculture and biosecurity practices to minimize AMR Larry
More informationNECROPSY FORM STRAND LOCATION: FLOATING IN VAQUITA REFUGE BY MX TIME: 10 AM
NECROPSY FORM FIELD #: Ps 9 NECROPSY DATE: April 4 2018 SPECIES: PHOCOENA SINUS STRAND DATE: March 28 2018 AGE CLASS: ADULT STRAND LOCATION: FLOATING IN VAQUITA REFUGE BY MX NAVY, BAJA CALIFORNIA, MX SEX:
More informationAKC Canine Health Foundation Grant Updates: Research Currently Being Sponsored By The Vizsla Club of America Welfare Foundation
AKC Canine Health Foundation Grant Updates: Research Currently Being Sponsored By The Vizsla Club of America Welfare Foundation GRANT PROGRESS REPORT REVIEW Grant: 00748: SNP Association Mapping for Canine
More informationCoccidia and Giardia Diagnosis, Prevention and Treatment
Coccidia and Giardia Diagnosis, Prevention and Treatment Coccidia and Giardia are both intestinal protozoan parasites that are common in young puppies and kittens and older or debilitated adults. Their
More informationThe Friends of Nachusa Grasslands 2016 Scientific Research Project Grant Report Due June 30, 2017
The Friends of Nachusa Grasslands 2016 Scientific Research Project Grant Report Due June 30, 2017 Name: Laura Adamovicz Address: 2001 S Lincoln Ave, Urbana, IL 61802 Phone: 217-333-8056 2016 grant amount:
More informationVETERINARY SCIENCE CURRICULUM. Unit 1: Safety and Sanitation
Chariho Regional School District - Science Curriculum September, 2016 VETERINARY SCIENCE CURRICULUM Unit 1: Safety and Sanitation Students will gain an understanding of the types of hazards common in veterinary
More informationManual of Diagnostic Tests for Aquatic Animals. Aquatic Manual
Workshop for OIE National Focal Points for Aquatic Animals Dubai, UAE, 27-29 September 2010 Manual of Diagnostic Tests for Aquatic Animals Aquatic Manual OIE international standards Terrestrial Animal
More informationDrd. OBADĂ MIHAI DORU. PhD THESIS ABSTRACT
UNIVERSITY OF AGRICULTURAL SCIENCES AND VETERINARY MEDICINE ION IONESCU DE LA BRAD IAŞI FACULTY OF VETERINARY MEDICINE SPECIALIZATION MICROBIOLOGY- IMUNOLOGY Drd. OBADĂ MIHAI DORU PhD THESIS ABSTRACT RESEARCHES
More informationDiabetic Foot Infection. Dr David Orr Consultant Microbiologist Lancashire Teaching Hospitals
Diabetic Foot Infection Dr David Orr Consultant Microbiologist Lancashire Teaching Hospitals History of previous amputation [odds ratio (OR)=19.9, P=.01], Peripheral vascular disease (OR=5.5, P=.007)
More informationLens luxation when the lens gets wobbly
Lens luxation when the lens gets wobbly Introduction The lens what is it there for? The lens - anatomy Lens luxation What does that mean? Lens luxation - what to look out for? Lens luxation How can it
More informationPost malachite green: Alternative strategies for fungal infections and white spot disease
Bull. Eur. Ass. Fish Pathol., 22(2) 2002, 152 Post malachite green: Alternative strategies for fungal infections and white spot disease R. Rahkonen 1 and P. Koski 2 1 Finnish Game and Fisheries Research
More informationTaking the Guess Out of Fungus: Dermatophytosis
Taking the Guess Out of Fungus: Dermatophytosis Aleisha Swartz, DVM Hawaiian Humane Society, HSUS University of Wisconsin Fellow Jyothi V. Robertson, DVM JVR Shelter Strategies & UC-Davis KSMP Resident
More informationTHE MICROSCOPE PATHOGEN IDENTIFICATION
CONTENTS 5 ABOUT THE AUTHOR 5 ACKNOWLEDGEMENTS 6 OVERVIEW 6 What is the Purpose of this Book? 6 What are the Limitations of Light Microscopy as a Diagnostic Tool? 7 When Should I Contact a Veterinarian?
More information1. Examine the specimens of sponges on the lab table. Which of these are true sponges? Explain your answers.
Station #1 - Porifera 1. Examine the specimens of sponges on the lab table. Which of these are true sponges? Explain your answers. 2. Sponges are said to have an internal special skeleton. Examine the
More informationPPPA Health and Research Committee Report to the Club April 1, 2017
PPPA Health and Research Committee Report to the Club April 1, 2017 We have had a very busy last 8 months with the discovery of several Genetic Markers in the breed. This was an unexpected benefit of the
More informationCommonly asked questions about dermatomyositis (DM or FCD) in dogs
Commonly asked questions about dermatomyositis (DM or FCD) in dogs 1) What is dermatomyositis? Dermatomyositis (DM) is a devastating inherited inflammatory disease of the skin and/or muscle which most
More informationANNEX I SUMMARY OF PRODUCT CHARACTERISTICS
ANNEX I SUMMARY OF PRODUCT CHARACTERISTICS 1 1. NAME OF THE VETERINARY MEDICINAL PRODUCT CLYNAV solution for injection for Atlantic salmon 2. QUALITATIVE AND QUANTITATIVE COMPOSITION Each 0.05 ml dose
More informationAmerican Association of Feline Practitioners American Animal Hospital Association
American Association of Feline Practitioners American Animal Hospital Association Basic Guidelines of Judicious Therapeutic Use of Antimicrobials August 1, 2006 Introduction The Basic Guidelines to Judicious
More informationPesky Ectoparasites. Insecta fleas, lice and flies. Acari- ticks and mites
Pesky Ectoparasites Parasite control should be at the forefront of every pet owner s life as all animals have the propensity to contract numerous ones at one stage or another. They are a challenge to the
More informationProceedings of the Southern European Veterinary Conference - SEVC -
www.ivis.org Proceedings of the Southern European Veterinary Conference - SEVC - Sep. 29-Oct. 2, 2011, Barcelona, Spain Next SEVC Conference: Oct. 18-21, 2012 - Barcelona, Spain Reprinted in the IVIS website
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11046 Supplementary Figure 1: Images of PB-positive cells in the subepidermal region (a-i) Representative images of PB positive cells in the subepidermis of the upper beak of the pigeon.
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/319/5870/1679/dc1 Supporting Online Material for Drosophila Egg-Laying Site Selection as a System to Study Simple Decision-Making Processes Chung-hui Yang, Priyanka
More informationChanging Trends and Issues in Canine and Feline Heartworm Infections
Changing Trends and Issues in Canine and Feline Heartworm Infections Byron L. Blagburn College of Veterinary Medicine Auburn University Canine and feline heartworm diagnostic, treatment and prevention
More informationSurgical Removal of Retrobulbar Hemangioma in a Goldfish (Carassius auratus)
Vet Clin Exot Anim 9 (2006) 729 733 Surgical Removal of Retrobulbar Hemangioma in a Goldfish (Carassius auratus) Bradley J. O Hagan, BVSc, MACVSc a, *, Shane R. Raidal, BVSc, PhD, FACVSc b a Research and
More information