Supporting information
|
|
- Randall Harris
- 5 years ago
- Views:
Transcription
1 Supporting information Reassortment and distinct evolutionary dynamics of Rift Valley Fever virus genomic segments Caio C. M. Freire 1, Atila Iamarino 1, Peinda O. Ly Soumaré 2, Ousmane Faye 2, Amadou A. Sall 2, Paolo M. A. Zanotto 1 * 1. Laboratory of Molecular Evolution and Bioinformatics, Department of Microbiology, Biomedical Sciences Institute, University of Sao Paulo, Sao Paulo, Brazil. 2. Institut Pasteur de Dakar, Dakar, Senegal. *Corresponding author: Paolo M. A. Zanotto. Laboratory of Molecular Evolution and Bioinformatics, Department of Microbiology, Biomedical Sciences Institute ICBII, University of São Paulo, Av. Prof. Lineu Prestes, 1734 São Paulo - SP - Brazil pzanotto@usp.br. Phone: Fax:
2
3 Figure S1. Paired phylogenetic trees for RVFV segments showing phylogenetic discrepancies among reassortant lineages. A Phylogenetic trees for L and M. B Phylogenetic trees for M and S. Posterior probability support values are shown close to the nodes. Pairs of reassortants are colored accordingly.
4
5
6 Figure S2. Time- scaled MCC trees, showing times of reassortment. A MCC tree for L segment. B - MCC tree for M segment. C- MCC tree for S segment. Labels of reassortants are colored in red. TMRCAs are shown close to the nodes.
7 Table S1. Significant detected codon sites under purifying selection in RVFV. Aa position dn-ds p-value Gene Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase
8 Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Polymerase Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein
9 Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Glycoprotein Nucleocapsid Nucleocapsid Nucleocapsid Nucleocapsid Nucleocapsid Nucleocapsid Nucleocapsid Nucleocapsid Nucleocapsid Nucleocapsid Nucleocapsid Non-structural Non-structural Non-structural
10 Non-structural Non-structural Non-structural Non-structural Non-structural Non-structural
11 Table S2. Akaike s information estimated by Markov chain Monte Carlo (AICM) and path-sampling tests for different prior propositions to explain evolution of RVFV strains. Segment AICM S.E. Diference between AICM marginal log(l) from PS Mean rate (m) HPD Long E-04 (1.88E-4 to 2.72E-4) Long E-04 (2.56E-4 to 3.98E-4) Medium E-04 (2.53E-4 to 5.05E-4) Medium E-04 (1.52E-4 to 2.4E-4) Small E-04 (2.42E-4 to 4.26E-4) Small E-04 (1.66E-4 to 2.47e-4)
12 Table S3. RVFV strains used in this study. Strain name Locality of isolation Collection date Accession number Host Segment ARD38388 BurkinaFaso 1983 DQ mosquito Long 73HB1230 CentralAfricanRepublic 1973 DQ human Long 73HB1449 CentralAfricanRepublic 1974 DQ human Long 74HB59 CentralAfricanRepublic 1974 DQ human Long Zinga CentralAfricanRepublic 1969 DQ human Long CARR1622 CentralAfricanRepublic$Bangui 1985 DQ human Long HvB375 CentralAfricanRepublic$Mbaki 1985 DQ human Long ZC3349 Egypt$Asyut 1978 DQ bovine Long ZH1776 Egypt$Gharbiya 1978 DQ human Long ZS6365 Egypt$Gharbiya 1979 DQ ovine Long T Egypt$Sharqiya 1977 DQ mosquito Long T1 Egypt$Sharqiya 1977 DQ mosquito Long ZH501 Egypt$Sharqiya 1977 DQ human Long ZH548 Egypt$Sharqiya 1977 DQ human Long ZM657 Egypt$Sharqiya 1978 DQ mosquito Long ZH Egypt$Sharqiya 1977 DQ plaque pick of RVFV ZH-501 Long ANK3837 Guinea 1981 DQ bat Long ANK6087 Guinea 1984 DQ bat Long Kenya 2007 JF human Long KEN/Bar032/07 Kenya 3-Feb-07 HM human Long KEN/Bar035/07 Kenya 30-Jan-07 HM human Long KEN/Gar004/06 Kenya 21-Dec-06 HM human Long KEN/Gar008/06 Kenya 21-Dec-06 HM human Long KEN/Kil006/07 Kenya 5-Jan-07 HM human Long KEN/Mal032/07 Kenya 15-Jan-07 HM human Long Kenya Kenya 1998 DQ human Long Kenya57Rintoul Kenya 1951 DQ ovine Long Kenya$Baringodistrict 7-Feb-07 EU ovine Long Kenya$Garissadisrict 1-Dec-06 EU caprine Long Kenya$Garissadistrict 12-Jan-07 EU bovine Long Kenya$Garissadistrict 1-Dec-06 EU caprine Long Kenya$Kajaidodistrict 26-Jan-07 EU ovine Long Kenya$Kiambudistrict 14-May-07 EU bovine Long Kenya$Maraguadistrict 12-Jan-07 EU bovine Long Kenya$Maraguadistrict 16-Jan-07 EU bovine Long Kenya$Maraguadistrict 16-Jan-07 EU bovine Long Kenya$Maraguadistrict 16-Jan-07 EU bovine Long Kenya$Maraguadistrict 16-Jan-07 EU bovine Long Kenya$Mbeeredistrict 27-Feb-07 EU bovine Long Kenya$MeruCentraldistrict 5-Feb-07 EU bovine Long Kenya$MeruCentraldistrict 5-Feb-07 EU bovine Long Kenya$MeruSouthdistrict 29-Jan-07 EU bovine Long Kenya$MeruSouthdistrict 29-Jan-07 EU bovine Long Kenya$MeruSouthdistrict 29-Jan-07 EU bovine Long Kenya$MeruSouthdistrict 31-Jan-07 EU bovine Long Kenya$Mombassadistrict 30-Jan-07 EU bovine Long Kenya$Murangadistrict 29-Jan-07 EU bovine Long Kenya$Nairobidistrict 31-Jan-07 EU bovine Long Kenya$Nairobidistrict 23-Apr-07 EU bovine Long Kenya$Nakurudistrict 31-Jan-07 EU bovine Long Kenya$Nakurudistrict 21-Feb-07 EU bovine Long Kenya Kenya$Ruiru 1983 DQ mosquito Long Kenya$Thikadistrict 25-Jan-07 EU bovine Long Kenya$Thikadistrict 21-Feb-07 EU bovine Long Madagascar 20-Feb-08 GQ bovine Long Madagascar 20-Feb-08 GQ bovine Long Madagascar 24-Mar-08 GQ bovine Long Madagascar 18-Apr-08 GQ bovine Long Madagascar 25-Apr-08 GQ bovine Long Madagascar 13-Apr-08 GQ caprine Long Madagascar 30-Jan-08 GQ human Long Madagascar 22-Feb-08 GQ human Long Madagascar 15-Feb-08 GQ human Long Madagascar 26-Feb-08 GQ human Long Madagascar 9-Mar-08 GQ human Long Madagascar 12-Mar-08 GQ human Long Madagascar 12-Mar-08 GQ human Long Madagascar 12-Mar-08 GQ human Long Madagascar 11-Mar-08 GQ human Long Madagascar 14-Mar-08 GQ human Long Madagascar 23-Mar-08 GQ human Long Madagascar 23-Mar-08 GQ human Long Madagascar 23-Mar-08 GQ human Long Madagascar 23-Mar-08 GQ human Long Madagascar 23-Mar-08 GQ human Long Madagascar 23-Mar-08 GQ human Long Madagascar 23-Mar-08 GQ human Long Madagascar 23-Mar-08 GQ human Long Madagascar 23-Mar-08 GQ human Long Madagascar 25-Mar-08 GQ human Long
13 87808 Madagascar 26-Mar-08 GQ human Long Madagascar 26-Mar-08 GQ human Long Madagascar 26-Mar-08 GQ human Long Madagascar 26-Mar-08 GQ human Long Madagascar 26-Mar-08 GQ human Long Madagascar 28-Mar-08 GQ human Long Madagascar 15-Apr-08 GQ human Long Madagascar 25-May-08 GQ human Long Madagascar 29-Apr-08 GQ human Long Madagascar 23-Apr-08 GQ human Long MgH824 Madagascar 1979 DQ human Long Madagascar 20-Apr-08 GQ ovine Long Madagascar$Anjozorobe Feb-08 JF human Long Madagascar$Ankazobe Mar-08 JF human Long Madagascar$Antananarivo Feb-91 JF bovine Long Madagascar$Antananarivo Feb-91 JF human Long Madagascar$Antsirabe Feb-08 JF bovine Long Madagascar$Manjakandriana Mar-08 JF bovine Long Madagascar$Manjakandriana Mar-08 JF human Long Madagascar$Miarinarivo Feb-08 JF bovine Long Madagascar$Taolagnaro Jan-08 JF human Long OS1 Mauritania 1987 DQ human Long OS3 Mauritania 1987 DQ human Long OS8 Mauritania 1987 DQ human Long OS9 Mauritania 1987 DQ human Long 2008/00099 Mayotte 21-Feb-08 HE human Long 2008/00101 Mayotte 20-Mar-08 HE human Long Saudi SaudiArabia 2000 DQ human Long 35/74 SouthAfrica 1974 JF sheep Long Kakamas SouthAfrica Oct-09 JQ sheep Long SA51VanWyck SouthAfrica$Boshof 1951 DQ ovine Long SA75 SouthAfrica$Randfontein 1975 DQ human Long Sudan Sudan$GeziraState Oct-10 JQ human Long Sudan Sudan$GeziraState Oct-10 JQ human Long Sudan Sudan$GeziraState Oct-10 JQ human Long Sudan2V2007 Sudan$WhiteNileState 2007 JQ human Long Tanzania Feb-07 JF human Long Tanzania Feb-07 JF human Long TAN/Dod002/07 Tanzania 14-Mar-07 HM human Long TAN/Tan001/07 Tanzania 8-Feb-07 HM human Long Entebbe Uganda 1944 DQ mosquito Long 2250/74 Zimbabwe$Beatrice 1974 DQ bovine Long 1260/78 Zimbabwe$Salisbury 1978 DQ bovine Long 2373/74 Zimbabwe$Salisbury 1974 DQ bovine Long 763/70 Zimbabwe$Salisbury 1970 DQ bovine Long 1853/78 Zimbabwe$Sinoia 1978 DQ bovine Long 2269/74 Zimbabwe$Sinoia 1974 DQ bovine Long ARD38388 BurkinaFaso 1983 DQ mosquito Medium 73HB1230 CentralAfricanRepublic 1973 DQ human Medium 73HB1449 CentralAfricanRepublic 1973 DQ human Medium 74HB59 CentralAfricanRepublic 1974 HM human Medium Zinga CentralAfricanRepublic 1969 DQ mosquito Medium HvB375 CentralAfricanRepublic$Abaki 7-Jun-05 DQ human Medium CARR1622 CentralAfricanRepublic$Bangui 7-Jun-05 DQ human Medium T1 Egypt 1977 DQ mosquito Medium T Egypt 1977 DQ mosquito Medium ZH Egypt 1977 DQ plaque pick of ZH-501 Medium ZC3349 Egypt$Asyut 31-May-05 DQ bovine Medium ZH1776 Egypt$Gharbiya 31-May-05 DQ human Medium ZS6365 Egypt$Gharbiya 1-Jun-05 DQ ovine Medium ZH501 Egypt$Sharqiya 30-May-05 DQ human Medium ZH548 Egypt$Sharqiya 30-May-05 DQ human Medium ZM657 Egypt$Sharqiya 31-May-05 DQ mosquito Medium ANK3837 Guinea 3-Jun-05 DQ bat Medium ANK6087 Guinea 6-Jun-05 DQ bat Medium Kenya 29-Jun-05 JF human Medium Kenya 29-Dec-06 JF mosquito Medium KEN/Bar032/07 Kenya 3-Feb-07 HM Unknown Medium KEN/Bar035/07 Kenya 30-Jan-07 HM Unknown Medium KEN/Gar004/06 Kenya 21-Dec-06 HM Unknown Medium KEN/Gar008/06 Kenya 21-Dec-06 HM Unknown Medium KEN/Kil006/07 Kenya 5-Jan-07 HM Unknown Medium KEN/Mal032/07 Kenya 15-Jan-07 HM Unknown Medium Kenya Kenya 1998 DQ human Medium Kenya$Baringodistrict 7-Feb-07 EU ovine Medium Kenya$Garissadisrict 1-Dec-06 EU caprine Medium Kenya$Garissadistrict 12-Jan-07 EU bovine Medium Kenya$Garissadistrict 1-Dec-06 EU caprine Medium Kenya$Kajaidodistrict 26-Jan-07 EU ovine Medium Kenya$Kiambudistrict 14-May-07 EU bovine Medium Kenya57Rintoul Kenya$Kitale 1951 DQ ovine Medium
14 Kenya$Maraguadistrict 12-Jan-07 EU bovine Medium Kenya$Maraguadistrict 16-Jan-07 EU bovine Medium Kenya$Maraguadistrict 16-Jan-07 EU bovine Medium Kenya$Maraguadistrict 16-Jan-07 EU bovine Medium Kenya$Maraguadistrict 16-Jan-07 EU bovine Medium Kenya$Mbeeredistrict 27-Feb-07 EU bovine Medium Kenya$MeruCentraldistrict 5-Feb-07 EU bovine Medium Kenya$MeruCentraldistrict 5-Feb-07 EU bovine Medium Kenya$MeruSouthdistrict 29-Jan-07 EU bovine Medium Kenya$MeruSouthdistrict 29-Jan-07 EU bovine Medium Kenya$MeruSouthdistrict 29-Jan-07 EU bovine Medium Kenya$MeruSouthdistrict 31-Jan-07 EU bovine Medium Kenya$Mombassadistrict 30-Jan-07 EU bovine Medium Kenya$Murangadistrict 29-Jan-07 EU bovine Medium Kenya$Nairobidistrict 31-Jan-07 EU bovine Medium Kenya$Nairobidistrict 23-Apr-07 EU bovine Medium Kenya$Nakurudistrict 31-Jan-07 EU bovine Medium Kenya$Nakurudistrict 21-Feb-07 EU bovine Medium Kenya Kenya$Ruiru 1983 DQ mosquito Medium Kenya$Thikadistrict 25-Jan-07 EU bovine Medium Kenya$Thikadistrict 21-Feb-07 EU bovine Medium Madagascar 30-Jan-08 GQ human Medium Madagascar Feb-08 GQ bovine Medium Madagascar Feb-08 GQ bovine Medium Madagascar 22-Feb-08 GQ human Medium Madagascar 15-Feb-08 GQ human Medium Madagascar 26-Feb-08 GQ human Medium Madagascar Mar-08 GQ human Medium Madagascar 12-Mar-08 GQ human Medium Madagascar 12-Mar-08 GQ human Medium Madagascar 12-Mar-08 GQ human Medium Madagascar Mar-08 GQ human Medium Madagascar 14-Mar-08 GQ human Medium Madagascar 23-Mar-08 GQ human Medium Madagascar 23-Mar-08 GQ human Medium Madagascar 23-Mar-08 GQ human Medium Madagascar 23-Mar-08 GQ human Medium Madagascar 23-Mar-08 GQ human Medium Madagascar Mar-08 GQ human Medium Madagascar 23-Mar-08 GQ human Medium Madagascar 23-Mar-08 GQ human Medium Madagascar 23-Mar-08 GQ human Medium Madagascar 23-Mar-08 GQ human Medium Madagascar 24-Mar-08 GQ bovine Medium Madagascar 25-Mar-08 GQ human Medium Madagascar 26-Mar-08 GQ human Medium Madagascar 26-Mar-08 GQ human Medium Madagascar 26-Mar-08 GQ human Medium Madagascar 26-Mar-08 GQ human Medium Madagascar 26-Mar-08 GQ human Medium Madagascar 26-Mar-08 GQ human Medium Madagascar Mar-08 GQ human Medium Madagascar Apr-08 GQ caprine Medium Madagascar 15-Apr-08 GQ human Medium Madagascar 18-Apr-08 GQ bovine Medium Madagascar 20-Apr-08 GQ ovine Medium Madagascar Apr-08 GQ bovine Medium Madagascar May-08 GQ human Medium Madagascar 29-Apr-08 GQ human Medium Madagascar 23-Apr-08 GQ human Medium MgH824 Madagascar 1-Jun-05 HM human Medium FI28 Madagascar$AmpandrambatoSahambavy 19-Dec-08 GU mosquito Medium Madagascar$Anjozorobe Feb-08 JF human Medium Madagascar$Ankazobe 1-Mar-08 JF human Medium Madagascar$Antananarivo Feb-91 JF human Medium Madagascar$Antananarivo Feb-91 JF bovine Medium FI148 Madagascar$AntanifotsyFianarantsoaI 19-Dec-08 GU mosquito Medium Madagascar$Antsirabe 1-Feb-08 JF bovine Medium Madagascar$Manjakandriana Mar-08 JF human Medium Madagascar$Manjakandriana Mar-08 JF bovine Medium Madagascar$Miarinarivo 1-Feb-08 JF bovine Medium Madagascar$Taolagnaro 1-Jan-08 JF human Medium Mauritania 5-Dec-10 KF human Medium Mauritania 2-Nov-12 KF human Medium Mauritania 2-Nov-12 KF human Medium Mauritania 2-Nov-12 KF human Medium Mauritania 2-Nov-12 KF human Medium Mauritania 2-Nov-12 KF human Medium Mauritania 2-Nov-12 KF human Medium OS1 Mauritania 1987 DQ human Medium OS3 Mauritania 1987 DQ human Medium
15 OS8 Mauritania 1987 DQ human Medium OS9 Mauritania 1987 DQ human Medium M30ARMcxMRAA1999 Mauritania$AyounElAtross 1999 JN mosquito Medium M214HMMRGA1987 Mauritania$Garack 1987 JN human Medium M298ARMcxMRGI2003 Mauritania$Guimi 2003 JN mosquito Medium M303ARMcxMRGI2003 Mauritania$Guimi 2003 JN mosquito Medium M347ARMcxMRGI2003 Mauritania$Guimi 2003 JN mosquito Medium M356ARMcxMRGI2003 Mauritania$Guimi 2003 JN mosquito Medium M11ANMMRHG1998 Mauritania$HodhElGarbi 1998 JN sheep Medium M16ANMMRHG1998 Mauritania$HodhElGarbi 1998 JN Unknown Medium M22ANMMRHG1998 Mauritania$HodhElGarbi 1998 JN Unknown Medium M24ANMMRHG1998 Mauritania$HodhElGarbi 1998 JN sheep Medium M25ANMMRHG1998 Mauritania$HodhElGarbi 1998 JN sheep Medium M292HMMRHG1998 Mauritania$HodhElGarbi 1998 JN human Medium M208HMMRKM1987 Mauritania$KeurMacene 1987 JN human Medium M226HMMRNK1987 Mauritania$Nkick 1987 JN human Medium M211HMMRRO1987 Mauritania$Rosso 1987 JN human Medium M232HMMRRO1987 Mauritania$Rosso 1987 JN human Medium M209HMMRTG1987 Mauritania$Tegmaline 1987 JN human Medium M223HMMRTE1987 Mauritania$Terg 1987 JN human Medium 2008/00099 Mayotte 21-Feb-08 HE human Medium 2008/00101 Mayotte 20-Mar-08 HE human Medium Saudi SaudiArabia 2000 DQ human Medium M18ANBkSNBA1993 Senegal$Barkedji 1993 JN sheep Medium M31ARBkcxSNBA2002 Senegal$Barkedji 2002 JN mosquito Medium M32ARBkcxSNBA2002 Senegal$Barkedji Jun-05 JN mosquito Medium M33ARBkcxSNBA2002 Senegal$Barkedji Jun-05 JN mosquito Medium M35ARBkcxSNBA2003 Senegal$Barkedji 2003 JN mosquito Medium M36ARBkcxSNBA2003 Senegal$Barkedji 2003 JN mosquito Medium M10ARDwcxSNDI1998 Senegal$Diawara 1998 JN mosquito Medium M27ARDwcxSNDI1998 Senegal$Diawara 1998 JN mosquito Medium M28ARDwcxSNDI1998 Senegal$Diawara 1998 JN mosquito Medium M9ARDwcxSNDI1998 Senegal$Diawara 1998 JN mosquito Medium M233HMMRRO1987 Senegal$Rosso 1987 JN human Medium 35/74 SouthAfrica 1974 JF sheep Medium Kakamas SouthAfrica Oct-09 JQ sheep Medium SA51VanWyck SouthAfrica$Boshof 1951 DQ ovine Medium SA75 SouthAfrica$Randfontein 1975 DQ human Medium Sudan Sudan$GeziraState 1-Oct-10 JQ human Medium Sudan72010 Sudan$GeziraState 1-Oct-10 JQ human Medium Sudan Sudan$GeziraState Oct-10 JQ human Medium Sudan Sudan$GeziraState Oct-10 JQ human Medium Sudan2V2007 Sudan$WhiteNileState 29-Jun-05 JQ human Medium Tanzania 1-Feb-07 JF human Medium Tanzania Feb-07 JF human Medium TAN/Dod002/07 Tanzania 14-Mar-07 HM Unknown Medium TAN/Tan001/07 Tanzania 8-Feb-07 HM Unknown Medium Entebbe Uganda 1944 DQ mosquito Medium 2250/74 Zimbabwe$Beatrice 27-May-05 DQ bovine Medium 1260/78 Zimbabwe$Salisbury 1978 DQ bovine Medium 2373/74 Zimbabwe$Salisbury 1974 DQ bovine Medium 763/70 Zimbabwe$Salisbury 1970 DQ bovine Medium 1853/78 Zimbabwe$Sinoia 31-May-05 DQ bovine Medium 2269/74 Zimbabwe$Sinoia 27-May-05 DQ bovine Medium ANK3837 Guinea 3-Jun-05 DQ bat Small ANK6087 Guinea 6-Jun-05 DQ bat Small Madagascar Feb-08 GQ bovine Small Madagascar Feb-08 GQ bovine Small Madagascar 22-Feb-08 GQ bovine Small Madagascar 24-Mar-08 GQ bovine Small Madagascar 24-Mar-08 GQ bovine Small Madagascar 24-Mar-08 GQ bovine Small Madagascar 18-Apr-08 GQ bovine Small Madagascar Apr-08 GQ bovine Small Madagascar$Antananarivo Feb-91 JF bovine Small Madagascar$Miarinarivo 1-Feb-08 JF bovine Small Madagascar$Antsirabe 1-Feb-08 JF bovine Small Kenya$Maraguadistrict 12-Jan-07 EU bovine Small Kenya$Garissadistrict 12-Jan-07 EU bovine Small Kenya$Maraguadistrict 16-Jan-07 EU bovine Small Kenya$Maraguadistrict 16-Jan-07 EU bovine Small Kenya$Maraguadistrict 16-Jan-07 EU bovine Small Kenya$Maraguadistrict 16-Jan-07 EU bovine Small Kenya$MeruSouthdistrict 29-Jan-07 EU bovine Small Kenya$MeruSouthdistrict 29-Jan-07 EU bovine Small Kenya$MeruSouthdistrict 29-Jan-07 EU bovine Small Kenya$Thikadistrict 25-Jan-07 EU bovine Small Kenya$MeruSouthdistrict 31-Jan-07 EU bovine Small Kenya$Nakurudistrict 31-Jan-07 EU bovine Small Kenya$Murangadistrict 29-Jan-07 EU bovine Small Kenya$Mombassadistrict 30-Jan-07 EU bovine Small
16 Kenya$Nairobidistrict 31-Jan-07 EU bovine Small Kenya$MeruCentraldistrict 5-Feb-07 EU bovine Small Kenya$MeruCentraldistrict 5-Feb-07 EU bovine Small Kenya$Nakurudistrict 21-Feb-07 EU bovine Small Kenya$Thikadistrict 21-Feb-07 EU bovine Small Kenya$Mbeeredistrict 27-Feb-07 EU bovine Small Kenya$Nairobidistrict 23-Apr-07 EU bovine Small Kenya$Kiambudistrict 14-May-07 EU bovine Small 1260/78 Zimbabwe$Salisbury 1978 DQ bovine Small 1853/78 Zimbabwe$Sinoia 31-May-05 DQ bovine Small 2250/74 Zimbabwe$Beatrice 27-May-05 DQ bovine Small 2269/74 Zimbabwe$Sinoia 27-May-05 DQ bovine Small 2373/74 Zimbabwe$Salisbury 1974 DQ bovine Small 763/70 Zimbabwe$Salisbury 1970 DQ bovine Small ZC3349 Egypt$Asyut 31-May-05 DQ bovine Small Madagascar Apr-08 GQ caprine Small Kenya$Garissadisrict 1-Dec-06 EU caprine Small Kenya$Garissadistrict 1-Dec-06 EU caprine Small Madagascar 30-Jan-08 GQ human Small Madagascar Feb-08 GQ human Small Madagascar 15-Feb-08 GQ human Small Madagascar 26-Feb-08 GQ human Small Madagascar 26-Feb-08 GQ human Small Madagascar Mar-08 GQ human Small Madagascar 12-Mar-08 GQ human Small Madagascar 12-Mar-08 GQ human Small Madagascar 12-Mar-08 GQ human Small Madagascar Mar-08 GQ human Small Madagascar 14-Mar-08 GQ human Small Madagascar 16-Mar-08 GQ human Small Madagascar 23-Mar-08 GQ human Small Madagascar 23-Mar-08 GQ human Small Madagascar 23-Mar-08 GQ human Small Madagascar 23-Mar-08 GQ human Small Madagascar 23-Mar-08 GQ human Small Madagascar Mar-08 GQ human Small Madagascar 23-Mar-08 GQ human Small Madagascar 23-Mar-08 GQ human Small Madagascar 23-Mar-08 GQ human Small Madagascar 23-Mar-08 GQ human Small Madagascar 25-Mar-08 GQ human Small Madagascar 26-Mar-08 GQ human Small Madagascar 26-Mar-08 GQ human Small Madagascar 26-Mar-08 GQ human Small Madagascar 26-Mar-08 GQ human Small Madagascar 26-Mar-08 GQ human Small Madagascar 26-Mar-08 GQ human Small Madagascar Mar-08 GQ human Small Madagascar Apr-08 GQ human Small Madagascar 25-Apr-08 GQ human Small Madagascar 29-Apr-08 GQ human Small Madagascar 23-Apr-08 GQ human Small Mauritania 5-Dec-10 KF human Small Mauritania 2-Nov-12 KF human Small Mauritania 2-Nov-12 KF human Small Mauritania 2-Nov-12 KF human Small Mauritania 2-Nov-12 KF human Small Mauritania 2-Nov-12 KF human Small Mauritania 2-Nov-12 KF human Small Madagascar$Taolagnaro 1-Jan-08 JF human Small Madagascar$Ankazobe 1-Mar-08 JF human Small Madagascar$Antananarivo Feb-91 JF human Small Kenya 29-Jun-05 JF human Small Tanzania 1-Feb-07 JF human Small 2008/00099 Mayotte 21-Feb-08 HE human Small 2008/00101 Mayotte 20-Mar-08 HE human Small 73HB1230 CentralAfricanRepublic 1973 DQ human Small 73HB1449 CentralAfricanRepublic 1973 DQ human Small 74HB59 CentralAfricanRepublic 1974 DQ human Small CARR1622 CentralAfricanRepublic 7-Jun-05 DQ human Small HvB375 CentralAfricanRepublic 7-Jun-05 DQ human Small Kenya Kenya 1998 DQ human Small MgH824 Madagascar 1-Jun-05 DQ human Small OS1 Mauritania 1987 DQ human Small OS3 Mauritania 1987 DQ human Small OS8 Mauritania 1987 DQ human Small OS9 Mauritania 1987 DQ human Small S208HMMRKM1987 Mauritania$KeurMacene 1987 JN human Small S209HMMRTG1987 Mauritania$Tegmaline 1987 JN human Small S211HMMRRO1987 Mauritania$Rosso 1987 JN human Small S214HMMRGA1987 Mauritania$Garack 1987 JN human Small
17 S223HMMRTE1987 Mauritania$Terg 1987 JN human Small S226HMMRNK1987 Mauritania$Nkick 1987 JN human Small S232HMMRRO1987 Mauritania$Rosso 1987 JN human Small S233HMMRRO1987 Mauritania$Rosso 1987 JN human Small S292HMMRHG1998 Mauritania$HodhElGarbi 1998 JN human Small SA75 SouthAfrica$Randfontein 1975 DQ human Small Saudi SaudiArabia 2000 DQ human Small Sudan Sudan$GeziraState 1-Oct-10 JQ human Small Sudan2V2007 Sudan$WhiteNileState 29-Jun-05 JQ human Small Sudan72010 Sudan$GeziraState 1-Oct-10 JQ human Small Sudan Sudan$GeziraState 1-Oct-10 JQ human Small Sudan Sudan$GeziraState Oct-10 JQ human Small ZH1776 Egypt$Gharbiya 31-May-05 DQ human Small ZH501 Egypt 30-May-05 GU human Small ZH548 Egypt$Sharqiya 30-May-05 DQ human Small Kenya 29-Dec-06 JF mosquito Small ARD38388 BurkinaFaso 1983 DQ mosquito Small Entebbe Uganda 1944 DQ mosquito Small FI148 Madagascar$AntanifotsyFianarantsoaI Dec-08 GU mosquito Small FI28 Madagascar$AmpandrambatoSahambavy Dec-08 GU mosquito Small Kenya Kenya 1983 DQ mosquito Small S10ARDwcxSNDI1998 Senegal$Diawara 1998 JN mosquito Small S27ARDwcxSNDI1998 Senegal$Diawara 1998 JN mosquito Small S28ARDwcxSNDI1998 Senegal$Diawara 1998 JN mosquito Small S298ARMcxMRGI2003 Mauritania$Guimi 2003 JN mosquito Small S303ARMcxMRGI2003 Mauritania$Guimi 2003 JN mosquito Small S30ARMcxMRAA1999 Mauritania$AyounElAtrouss 1999 JN mosquito Small S31ARBkcxSNBA2002 Senegal$Barkedji Jun-05 JN mosquito Small S32ARBkcxSNBA2002 Senegal$Barkedji 2002 JN mosquito Small S33ARBkcxSNBA2002 Senegal$Barkedji Jun-05 JN mosquito Small S347ARMcxMRGI2003 Mauritania$Guimi 2003 JN mosquito Small S356ARMcxMRGI2003 Mauritania$Guimi 2003 JN mosquito Small S35ARBkcxSNBA2003 Senegal$Barkedji 2003 JN mosquito Small S36ARBkcxSNBA2003 Senegal$Barkedji 2003 JN mosquito Small S9ARDwcxSNDI1998 Senegal$Diawara 1998 JN mosquito Small Zinga CentralAfricanRepublic 1969 DQ mosquito Small ZM657 Egypt$Sharqiya 31-May-05 DQ mosquito Small Madagascar Apr-08 GQ ovine Small Kenya$Kajaidodistrict 26-Jan-07 EU ovine Small Kenya$Baringodistrict 7-Feb-07 EU ovine Small Kenya57Rintoul Kenya 1951 DQ ovine Small SA51VanWyck SouthAfrica$Boshof 1951 DQ ovine Small 35/74 SouthAfrica 1974 JF sheep Small Kakamas SouthAfrica Oct-09 JQ sheep Small S11ANMMRHG1998 Mauritania$HodhElGarbi 1998 JN sheep Small S18ANBkSNBA1993 Senegal$Barkedji 1993 JN sheep Small S24ANMMRHG1998 Mauritania$HodhElGarbi 1998 JN sheep Small S25ANMMRHG1998 Mauritania$HodhElGarbi 1998 JN sheep Small ZS6365 Egypt$Gharbiya 1-Jun-05 DQ sheep Small KEN/Bar032/07 Kenya 3-Feb-07 HM Unknown Small KEN/Bar035/07 Kenya 30-Jan-07 HM Unknown Small KEN/Gar004/06 Kenya 21-Dec-06 HM Unknown Small KEN/Gar008/06 Kenya 21-Dec-06 HM Unknown Small KEN/Kil006/07 Kenya 5-Jan-07 HM Unknown Small KEN/Mal032/07 Kenya 15-Jan-07 HM Unknown Small MP12 Egypt 1977 DQ Unknown Small S16ANMMRHG1998 Mauritania$HodhElGarbi 1998 JN Unknown Small S22ANMMRHG1998 Mauritania$HodhElGarbi 1998 JN Unknown Small Smithburn Uganda 1944 DQ Unknown Small TAN/Dod002/07 Tanzania 14-Mar-07 HM Unknown Small TAN/Tan001/07 Tanzania 8-Feb-07 HM Unknown Small
EU Market Situation for Poultry. Committee for the Common Organisation of the Agricultural Markets 23 July 2015
EU Market Situation for Poultry Committee for the Common Organisation of the Agricultural Markets 23 July 2015 uro Exchange rate 3,5 3,0 1 Euro =... US$ / BRZ Real/ BRZ Real USA $ 2,5 2,0 1,5 1,0 I 2008
More informationEU Market Situation for Poultry. Committee for the Common Organisation of the Agricultural Markets 23 October 2014
EU Market Situation for Poultry Committee for the Common Organisation of the Agricultural Markets 23 October 214 Results of the Forecast Group 29 September 214 Thousand Tons 11.592 11.476 11.384 11.838
More informationSupplementary Table 1. Primers used in the study.
Supplementary Table 1. Primers used in the study. Primer Position (bp) Upstream primer (5 3 ) Downstream primer (5 3 ) Expected (bp) size 1 1 278 ACCAAACAGAGAATCTGTGAG CAGCAATCCGAAGGCAGAATAC 299 2 48 946
More informationRegional research activities and state of the art of Vmerge Project: Emerging viralvector
Regional research activities and state of the art of Vmerge Project: Emerging viralvector borne diseases Joint permanent committee 4th November 2014 Cirad Key features of Vmerge Cirad - F Borne Objectives
More informationMonthly Economic Review November 2017
Monthly Economic Review November 2017 Contents Contents... 2 Cattle Prices... 3 Average NI Clean Cattle Price... 3 Average NI Cow Price... 3 Cattle Slaughterings... 4 NI Clean Cattle Slaughterings Cumulative...
More informationBeef Calving Statistics (01/07/ /06/2016)
LoCall (1/7/1 --- /6/16) IE167 1() 1. Summary Data Report is based on beef cows with a calving record in the cattle breeding database and where the calving date is between (Embryo births excluded) Total
More informationAnimal Care, Control and Adoption
Wake County Animal Care, Control and Adoption December 213 Monthly Report Definitions Intake: Animals admitted to the Animal Center. These include animals surrendered by the general public, picked up by
More informationAnimal Care, Control and Adoption
Wake County Animal Care, Control and Adoption January 214 Monthly Report Definitions Intake: Animals admitted to the Animal Center. These include animals surrendered by the general public, picked up by
More informationAnimal Care, Control and Adoption
Wake County Animal Care, Control and Adoption June 214 Monthly Report Definitions Intake: Animals admitted to the Animal Center. These include animals surrendered by the general public, picked up by Animal
More informationSituation update of dengue in the SEA Region, 2010
Situation update of dengue in the SEA Region, 21 The global situation of Dengue It is estimated that nearly 5 million dengue infections occur annually in the world. Although dengue has a global distribution,
More informationAPPENDICES APPENDIX 1: TERRITORIALITY AND AGE AT FIRST BREEDING FOR O.N.E KIWI Age of first breeding (years)
APPENDICES APPENDIX 1: TERRITORIALITY AND AGE AT FIRST BREEDING FOR O.N.E KIWI 2002-2012 Gender Age of territoriality (years) Age of first breeding (years) Cohort Outcome or Current age (years) male (pair
More informationEU Market Situation for Eggs. Civil Dialogue Group. 17 February 2017
EU Market Situation for Eggs Civil Dialogue Group 17 February 217 Thousand Tons F O R E C A S T 8 7 Experts EU production forecast on Eggs (Missing or incomplete data (BE-EL-LT-AT-SE) - No expert (BG-EE-LV-MT-SK)
More information4-H LIVESTOCK RECORD BOOK
4-H LIVESTOCK RECORD BOOK NON-MARKET OTSEGO COUNTY Beef [ ] Swine [ ] Sheep [ ] Meat Goat [ ] Poultry/Waterfowl [ ] Rabbit [ ] For Intermediate (2nd & 3rd Year) Members Name Address 4-H Club Age as of
More informationImplementation of Bovine and Small Ruminant s Brucellosis Eradication Programmes in Portugal PAFF Standing Committee Brussels, 8 June 2017
Implementation of Bovine and Small Ruminant s Brucellosis Eradication Programmes in Portugal 2016 PAFF Standing Committee Brussels, 8 June 2017 Bovine Brucellosis Eradication Programme 2016 Bovine brucellosis
More informationGlobal Monthly October 2016
Jan- Feb- Mar- Apr- May- Jun- Jul- Aug- Sep- Global Monthly Index, >5 = expansion 5 Output Export orders 5 9 http://www.worldbank.org/en/research/brief/economic-monitoring Sept ' Dec '5 Sept ' Sept ' Dec
More informationPresentation Outline. Commercial RVF vaccines. RVF Clone 13 performance in the field. Candidate RVF vaccines in the pipeline
Presentation Outline Commercial RVF vaccines Old Smithburn, inactivated New Clone 13 RVF Clone 13 performance in the field Candidate RVF vaccines in the pipeline 2 Onderstepoort Biological Products November
More informationAnimal Care, Control and Adoption
Wake County Animal Care, Control and Adoption September 21 Monthly Report Wake County 1/1/21 Definitions Intake: Animals admitted to the Animal Center. These include animals surrendered by the general
More informationA Project of Peaceful Kingdom, a 501(c)3 organization
2014 A Project of Peaceful Kingdom, a 501(c)3 organization The GoNorth Transport Collaborative is a group of overcrowded animal shelters in east Tennessee that works together to transport puppies and
More informationrange of RA s accessible during the night.
***** 2008 Night-time Astronomical Calendar for Kitt Peak ***** By John Thorstensen, Dartmouth College This calendar is designed to provide information useful for the planning of nighttime observations.
More informationrange of RA s accessible during the night.
***** 2010 Night-time Astronomical Calendar for Kitt Peak ***** By John Thorstensen, Dartmouth College This calendar is designed to provide information useful for the planning of nighttime observations.
More informationFreedom of Information
ND ref. FOI/16/244 Freedom of Information Thank you for your 01/08/16 request for the following information: Under the Freedom of Information Act, please could you provide me with an extract from the hospital
More informationNATURAL BVD VACCINATION THE WAY TO GO?
NATURAL BVD VACCINATION THE WAY TO GO? Using identified BVD PI (persistently infected) animals as vaccinators has been an accepted way of exposing young stock to BVD infection before their first pregnancy.
More informationDOGS NSW AGILITY CALENDAR
1st 2nd 3rd 4th 5th 6-Jan 5-Jan 7-Jan 6-Jan 13-Jan 12-Jan 14-Jan 13-Jan 20-Jan 19-Jan 21-Jan 20-Jan 27-Jan 26-Jan 28-Jan 27-Jan 3-Feb 2-Feb 4-Feb 3-Feb 10-Feb 9-Feb 6th 11-Feb 10-Feb 7th 8th 17-Feb 16-Feb
More informationMICROBIOLOGICAL AND EPIDEMIOLOGICAL INVESTIGATIONS AT THE VLA
CAMPYLOBACTER IN BROILERS IN UK: MICROBIOLOGICAL AND EPIDEMIOLOGICAL INVESTIGATIONS AT THE VLA J. Rodgers 1, L. Powell 2, F. Clifton-Hadley 1 and A. Vidal 1 1 Dept of Food and Environmental Safety 2 Centre
More informationSTATUS OF THE DUCK INDUSTRY IN 2012 AND PROSPECTS FOR 2013
STATUS OF THE DUCK INDUSTRY IN 2012 AND PROSPECTS FOR 2013 SUMMARY There were 9 meat duck breeding companies with a total of 20 farms in operation in Peninsular Malaysia in 2012. The breeds used were Cherry
More informationAnimal Care, Control and Adoption
Wake County Animal Care, Control and Adoption February 21 Monthly Report Wake County 3/9/21 Definitions Intake: Animals admitted to the Animal Center. These include animals surrendered by the general public,
More informationName of Member. Address. Grade in School. County. Leader
Name of Member Address Age Grade in School County Leader INSTRUCTIONS This record book was developed to aid 4-H ers in keeping more accurate records in their poultry project. To determine the financial
More informationPoultry Pocketbook 2018
Poultry Pocketbook 2018 Produced for you by: AHDB Stoneleigh Park Kenilworth Warwickshire CV8 2TL T 024 7669 2051 E comms@ahdb.org.uk W ahdb.org.uk @TheAHDB If you no longer wish to receive this information,
More informationA Case Study of the Effectiveness of TNR on a Feral Cat Colony
Compiled and Written By: Triple R Pets PO Box 86, Western Springs, IL 60558 708.738.1438 phone 630.214.3603 fax www.triplerpets.org QUESTION Does a TNR trap/neuter/return program stabilize or reduce the
More informationThe Right Lamb Every Time
AN INITIATIVE OF The Right Lamb Every Time Rob Davidson WAMMCO International Dave Pethick & Kelly Pearce Murdoch Uni & Sheep CRC EVENT PARTNERS: EVENT SUPPORTERS: The Right Lamb Definition?? Store lamb
More informationDISEASE MONITORING AND EXTENSION SYSTEM FOR THE SOUTH AFRICAN DAIRY INDUSTRY
DISEASE MONITORING AND EXTENSION SYSTEM FOR THE SOUTH AFRICAN DAIRY INDUSTRY Disease Trend Report: July 2014 IN THIS ISSUE: 1. Preface Importance of disease monitoring. 2. Get the vaccination plan in place
More informationFREEDOM OF INFORMATION ACT
FOI REF: 16/401 29 th September 2016 FREEDOM OF INFORMATION ACT I am responding to your request for information under the Freedom of Information Act. The answers to your specific questions are as follows:
More informationFigure 1: Comparison of District Monthly Rainfall
Table 1. Estimated Rainfall Totals Last June Change Mont County June-2007 Jun-2006 12 Months Average 10 F001 Alachua 6.18 7.27 35.42 6.57 F003 Baker 5.45 5.32 36.61 6.29 F007 Bradford 4.97 6.81 29.89 6.11
More informationFigure 1: Comparison of District Monthly Rainfall
Table 1. Estimated Rainfall Totals Last July Change Mont County July-2007 Jul-2006 12 Months Average 10 F001 Alachua 6.38 5.24 36.68 7.01 F003 Baker 5.66 5.49 36.85 7.06 F007 Bradford 7.57 4.99 32.56 6.92
More informationFigure 1: Comparison of District Monthly Rainfall
Table 1. Estimated Rainfall Totals Last August Change Mont County August-2007 Aug-2006 12 Months Average 10 F001 Alachua 5.49 5.39 36.74 7.10 F003 Baker 5.99 4.15 38.62 6.59 F007 Bradford 3.60 3.63 32.47
More informationNational Polecat Survey Update
National Polecat Survey Update January - December 2014 Polecat Richard Bowler The National Polecat Survey The Vincent Wildlife Trust s national polecat survey began in January 2014 with the aim of gathering
More informationRisk-based surveillance of PPR
Risk-based surveillance of PPR featuring spatial qualitative risk analysis R. Lancelot, C. Coste, C. Squarzoni-Diaw CIRAD, Unit ASTRE June 2018 1 Outline 1 Qualitative risk analysis and risk mapping Overview
More informationStaphylococcus aureus Blood Stream Infection (Bacteraemia) Surveillance. Ceredigion and Mid Wales Trust Data per Bed Days
Staphylococcus aureus Blood Stream Infection (Bacteraemia) Surveillance Ceredigion and Mid Wales Trust Data per 100 000 Bed Days Commentary: Staphylococcus aureus is a bacterium that a proportion (up to
More informationFigure 1: Comparison of District Monthly Rainfall
Table 1. Estimated Rainfall Totals Last April Change Mont County April-2007 Apr-2006 12 Months Average 10 F001 Alachua 1.13 2.00 38.00 3.35 F003 Baker 0.86 1.55 37.75 3.07 F007 Bradford 0.70 1.37 33.50
More informationBIORISK: AFRICAN EXPERIENCE
BIORISK: AFRICAN EXPERIENCE Mehdi EL HARRAK OIE BIOLOGICAL STANDARD COMMISION MEMBER Elharrak_m@hotmail.com 12 th OIE/WAVLD Seminar 9 June 2017, Sorrento Italy Africa : a major source of animal proteins
More informationProficiency Testing Schemes 1 April 2018 to 31 March 2019
Proficiency Testing Schemes 1 April 2018 to 31 March 2019 Scheme Code Proficiency Testing Scheme Name Antibody Detection Test Method Method PT0001 African Horse Sickness (AHS) ELISA - serum C 15 May, 13
More informationANIMAL HEALTH PLAN TEMPLATE QMS CATTLE & SHEEP ASSURANCE SCHEME
ANIMAL HEALTH PLAN TEMPLATE QMS CATTLE & SHEEP ASSURANCE SCHEME This template can be used to document the key procedures and policies undertaken to maintain herd and flock health and welfare on your holding.
More informationAn Evaluation of Environmental Windows on Dredging Projects in Florida, USA
An Evaluation of Environmental Windows on Dredging Projects in Florida, USA Terri Jordan-Sellers and Aubree Hershorin, Ph.D. Coastal Section, Environmental Branch Florida Shore and Beach Technical Meeting
More informationGULF COAST AGRICULTURE & NATURAL RESOURCE YOUTH ORGANIZATION GCA & NRYO SPRING 2018 SHOW RECORD BOOK
GULF COAST AGRICULTURE & NATURAL RESOURCE YOUTH ORGANIZATION GCA & NRYO SPRING 2018 SHOW RECORD BOOK Name: Age: (As of September 1, 2017) Date of Birth: Address: Phone: Cell Home 4S H Club or FFA Chapter:
More informationThe impact on the routine laboratory of the introduction of an automated ELISA for the detection of Cryptosporidium and Giardia in stool samples
The impact on the routine laboratory of the introduction of an automated ELISA for the detection of Cryptosporidium and Giardia in stool samples Nigel Stephenson BMS 3 Department of Medical Microbiology
More informationLactational and reproductive effects of melatonin in lactating dairy ewes mated during spring
59 th Meeting EAAP, 24-27 August 2008, Vilnius, Lithuania Session 24: Free communications on Sheep and Goat Production Lactational and reproductive effects of melatonin in lactating dairy ewes mated during
More informationDon Bell s Table Egg Layer Flock Projections and Economic Commentary
August 30, 2005 No. 53 Don Bell s Table Egg Layer Flock Projections and Economic Commentary - 2005 (This report was written by Don Bell, University of California Poultry Specialist, emeritus, under the
More informationDredging Impacts on Sea Turtles in the Southeastern USA Background Southeastern USA Sea Turtles Endangered Species Act Effects of Dredging on Sea Turt
An Update on Dredging Impacts on Sea Turtles in the Southeastern t USA A Historical Review of Protection and An Introduction to the USACE Sea Turtle Data Warehouse D. Dickerson U.S. Army Corps of Engineers
More informationPlacer SPCA open admission shelter Annual total intake = ~4000 Annual cat intake = ~2400 For 2012: Total cat intake = 2411, adoptions = 1558 Average
Placer SPCA open admission shelter Annual total intake = ~4000 Annual cat intake = ~2400 For 2012: Total cat intake = 2411, adoptions = 1558 Average cat LOS: 2012 = 26.4 days Overall live release = 81%
More information4-H Laying Flock. Signature _ Date. _ Signature Date. Signature Date. Submit Project Books to County Agent
4-H Laying Flock Project Book By signing I am stating that I have completed as much of the work in this project book myself as possible to the best of my the information included in it is Signature _ Date
More informationDiclofenac in Europe an update
Diclofenac in Europe an update Diclofenac: non-steroidal anti-inflammatory substance Vet diclofenac caused 95-99% decline in Indian Gyps vultures in 20 years Vet diclofenac in Europe Safe alternative exists
More informationMonitoring of marine turtle reproductive activity in Juan de Nova using daily track counting
Monitoring of marine turtle reproductive activity in Juan de Nova using daily track counting Marie Lauret-Stepler 1, Stéphane Ciccione 1, Jérôme Bourjea 2 1 CEDTM Kélonia, 46 rue du Général de Gaulle,
More informationTHE BROILER CHICKEN INDUSTRY IN PENINSULAR MALAYSIA STATUS OF THE INDUSTRY IN 2013 AND PROSPECTS FOR 2014
THE BROILER CHICKEN INDUSTRY IN PENINSULAR MALAYSIA STATUS OF THE INDUSTRY IN 2013 AND PROSPECTS FOR 2014 SUMMARY stock accounted for 97.41% of the total In 2013, a production of 695.92 million day-old
More informationEcography. Supplementary material
Ecography ECOG-2343 Lin, L.-H. and Wiens, J. J. 216. Comparing macroecological patterns across continents: evolution of climatic niche breadth in varanid lizards. Ecography doi: 1.1111/ecog.2343 Supplementary
More informationZimbabwe Poultry Association
Zimbabwe Poultry Association Old Show Office, Exhibition Park, Samora Machel Ave, Harare P O Box BE 209, Belvedere, Harare Ph 756 600 / 772 915 / 777 391 E-mail admin@lit.co.zw Contents Production News
More informationEU Market Situation for Eggs. Committee for the Common Organisation of the Agricultural Markets 21 May 2015
EU Market Situation for Eggs Committee for the Common Organisation of the Agricultural Markets 21 May 215 1. p. Placings of Laying chicks (1 pieces) compared to the baseline trend (baseline= monthly avg
More informationLandfill Dogs by Shannon Johnstone
Wake County Animal Center May 216 Monthly Report Landfill Dogs by Shannon Johnstone WCAC Monthly Report Page 1 The Wake County Animal Center serves approximately 13, - 15, animals each year. Through the
More informationMy 4-H Animal Project
My 4-H Animal Project Complete this form for ALL animal projects. If you are enrolled in both the BREEDING and MARKET project for a species, you may choose to do separate records for each or put both projects
More informationPromoting Appropriate Antimicrobial Prescribing in Secondary Care
Promoting Appropriate Antimicrobial Prescribing in Secondary Care Stuart Brown Healthcare Acquired Infection and Antimicrobial Resistance Project Lead NHS England March 2015 Introduction Background ESPAUR
More informationRECENT BREEDING RECORDS OF STORKS IN EASTERN AFRICA M. P. KAHL CONTENTS
PaB 67 RECENT BREEDING RECORDS OF STORKS IN EASTERN AFRICA By M. P. KAHL CONTENTS I. Introduction II. Recent breeding records of storks in eastern Africa III. Resume of breeding distribution and seasons
More informationEJEMPLARES DE VETERINARIA RECIBIDOS EN EL MES DE JULIO DE Acta veterinaria, Brno. VETERINARIA Vol.74, No.1 (Mar. 2005)
EJEMPLARES DE RECIBIDOS EN EL MES DE JULIO DE 2005 1. Acta veterinaria, Brno. Vol.74, No.1 (Mar. 2005) 2. Agricultura técnica. Vol.64, No.3 (Sept. 2004) Vol.64, No.4 (Dec. 2004) 3. Agricultural research
More informationAppendix C: Religious restrictions index scores by region
51 Appendix C: Religious restrictions index scores by region Scores in the table below express the levels of religious restrictions according to Pew Research Center s Government Restrictions Index (GRI)
More informationDryland Pastoral Research at Ashley Dene
Dryland Pastoral Research at Ashley Dene Prof. Derrick Moot (Derrick.Moot@lincoln.ac.nz) Dr Annamaria Mills Mr Malcolm Smith Website: www.lincoln.ac.nz/dryland Blog: http://www.lincoln.ac.nz/conversation/drylandpastures/
More informationBoard Meeting Agenda Item: 7.2 Paper No: Purpose: For Information. Healthcare Associated Infection Report
Board Meeting 9.. Agenda Item: 7. Paper No: 6- Purpose: For Information Healthcare Associated Infection Report August/September Board Meeting 9.. Agenda Item: 7. Paper No: 6- Purpose: For Information August/September
More informationEconomically important trait. Increased demand: Decreased supply. Sheep milk cheese. 2007: $2.9 million for milk production (Shiflett, 2008)
Genetic Markers for Milk Production Raluca Mateescu, OklahomaStateUniversity Michael Thonney, Cornell University Milk production & Sheep Industry Economically important trait 2007: $2.9 million for milk
More informationAntibiotic usage in the British sheep industry. Dr Peers Davies
Antibiotic usage in the British sheep industry Dr Peers Davies 40% of all livestock biomass in the UK (ESVAC report 2016) Current Estimates and Data Sources No published, quantitative estimates of antimicrobial
More informationLandfill Dogs by Shannon Johnstone
Wake County Animal Center September 216 Monthly Report Landfill Dogs by Shannon Johnstone WCAC Monthly Report Page 1 The Wake County Animal Center serves approximately 13, - 15, animals each year. Through
More information(TSAP) - Antimicrobial pre-treatment and blood culture positivity rates for S. Typhi, ints and other invasive bacterial pathogens
(TSAP) - Antimicrobial pre-treatment and blood culture positivity rates for S. Typhi, ints and other invasive bacterial pathogens Gi Deok Pak, Presented by (Ondari D. Mogeni) Coalition against Typhoid
More informationPeople, Animals, Plants, Pests and Pathogens: Connections Matter
People, Animals, Plants, Pests and Pathogens: Connections Matter William B. Karesh, DVM Executive Vice President for Health and Policy, EcoHealth Alliance President, OIE Working Group on Wildlife Co-Chair,
More informationLandfill Dogs by Shannon Johnstone
Wake County Animal Center December 217 Monthly Report Landfill Dogs by Shannon Johnstone WCAC Monthly Report Page 1 The Wake County Animal Center serves approximately 13, - 15, animals each year. Through
More informationRabbits and hares (Lagomorpha)
Rabbits and hares (Lagomorpha) Rabbits and hares are part of a small order of mammals called lagomorphs. They are herbivores (feeding only on vegetation) with enlarged front teeth (anterior incisors) which
More informationNewsletter October 2015
Contents Production News Inputs and Raw Materials ket Watch Imports Veterinary Report Zimbabwe Poultry Association Old Show Office, Exhibition Park, Samora Machel Ave, Harare P O Box BE 209, Belvedere,
More informationLandfill Dogs by Shannon Johnstone
Wake County Animal Center August 217 Monthly Report Landfill Dogs by Shannon Johnstone WCAC Monthly Report Page 1 The Wake County Animal Center serves approximately 13, - 15, animals each year. Through
More informationCOMMISSION (2003/708/EC)
10.10.2003 L 258/11 COMMISSION COMMISSION DECISION of 7 October 2003 amending Annex E to Council Directive 91/68/EEC and Annexes I and II to Decision 93/198/EEC as regards the updating of the model health
More informationAntimicrobial Resistance Surveillance from sentinel public hospitals, South Africa, 2013
Antimicrobial Resistance Surveillance from sentinel public s, South Africa, 213 Authors: Olga Perovic 1,2, Melony Fortuin-de Smidt 1, and Verushka Chetty 1 1 National Institute for Communicable Diseases
More informationWhat I learned from Limpus, Carter. Quantifying a Nesting Season. and Hamann (2001) and. Sussing out. Identifying
What I learned from Limpus, Carter and Hamann (2001) and Quantifying a Nesting Season Identifying Sussing out Michael Guinea School of Environment Charles Darwin University Darwin 0909 Whole of season
More informationAn audit of the quality of antimicrobial prescribing
An audit of the quality of antimicrobial prescribing Rakhee Patel, Antimicrobial Pharmacist Alison Williams, Antimicrobial Technician & Dr Armando Gonzalez-Ruiz May 2011 ICE Score 2 Introduction & Aims
More informationCould I please be provided details of all reports of dog thefts in the force area over the last two years from January 2013 to the present date.
Our ref: 000170/15 Could I please be provided details of all reports of dog thefts in the force area over the last two years from January 2013 to the present date. Can details of each incident include
More informationMOON PHASES FOR 2018, at Kitt Peak Times and dates are given in local time, zone = 7 hr West. They are generally better than +- 2 minutes.
Nighttime astronomical calendar program. Select a site: *SELECT SITE* - Enter single-character code: n.. new site (enter all parameters). x.. exit without change (current: Kitt Peak) k.. Kitt Peak s..
More informationMOON PHASES FOR 2019, at Kitt Peak Times and dates are given in local time, zone = 7 hr West. They are generally better than +- 2 minutes.
Nighttime astronomical calendar program. Select a site: *SELECT SITE* - Enter single-character code: n.. new site (enter all parameters). x.. exit without change (current: Kitt Peak) k.. Kitt Peak s..
More informationMyxosporeans and myxosporidiosis of common carp and gibel carp in China
Myxosporeans and myxosporidiosis of common carp and gibel carp in China Zhang Jinyong, Liu Xinhua, Xi Bingwen, Kálmán Molnár zhangjy@ihb.ac.cn Hungary 2015 June.3 Laboratory of Fish Diseases; Institute
More informationUse of monthly collected milk yields for the early detection of vector-borne emerging diseases.
Use of monthly collected milk yields for the early of vector-borne emerging diseases. A. Madouasse A. Lehébel A. Marceau H. Brouwer-Middelesch C. Fourichon August 29, 2013 1 / 14 Plan 1 2 3 4 5 2 / 14
More informationPublic Health Impact of Leptospirosis in New Zealand
Collaborating Centre for Veterinary Epidemiology and Public Health Public Health Impact of Leptospirosis in New Zealand Cord Heuer A. Dreyfus, J. Sanhueza, J. Benschop, F.Fang, J. Collins-Emerson, P.R.
More informationPublic Wishing to Address the Board. Legislative Regular Agenda
Notice of Meeting for the of the City of Georgetown at 6:00 PM at Georgetown Animal Shelter, 110 W. L. Walden Dr., Georgetown, TX 78627 The City of Georgetown is committed to compliance with the Americans
More informationLandfill Dogs by Shannon Johnstone
Wake County Animal Center May 217 Monthly Report Landfill Dogs by Shannon Johnstone WCAC Monthly Report Page 1 The Wake County Animal Center serves approximately 13, - 15, animals each year. Through the
More informationANIMAL RABIES IN NEPAL AND RACCOON RABIES IN ALBANY COUNTY, NEW YORK
ANIMAL RABIES IN NEPAL AND RACCOON RABIES IN ALBANY COUNTY, NEW YORK SHANKAR YADAV MPH Report/Capstone Project Presentation 07/19/2012 CHAPTER 1: FIELD EXPERIENCE AT KANSAS STATE UNIVERSITY RABIES LABORATORY
More informationNewaygo County Swine Record Book 2018
Newaygo County Swine Record Book 2018 Beginning Photo of Project and Member Ending Photo of Project and Member Name Street City Fair Age Club Zip Age Group 9-12 Year 13-15 Year 16-19 Year Member s Signature
More informationUrgent Product Correction Notice FSCA This is to inform you of an Urgent Product Correction Notice involving:
20 April 2017 Urgent Product Correction Notice FSCA 3445 Dear This is to inform you of an Urgent Product Correction Notice involving: VITEK 2 Identification / Antimicrobial Susceptibility Test Cards referenced
More informationThis document is available on the English-language website of the Banque de France
JANUARY 7 This document is available on the English-language website of the www.banque-france.fr Countries ISO code Date of entry into the euro area Fixed euro conversion rates France FR //999.97 Germany
More informationEffects of Heat Stress on Reproduction in Lactating Dairy Cows
Effects of Heat Stress on Reproduction in Lactating Dairy Cows Paul M. Fricke, Ph.D. Professor of Dairy Science University of Wisconsin - Madison Maintenance of Body Temperature in Dairy Cattle Homeothermy:
More informationAcinetobacter Outbreaks: Experience from a Neurosurgery Critical Care Unit. Jumoke Sule Consultant Microbiologist 19 May 2010
Acinetobacter Outbreaks: Experience from a Neurosurgery Critical Care Unit Jumoke Sule Consultant Microbiologist 19 May 2010 Epidemiology of Acinetobacter spp At least 32 different species Recovered from
More informationMyxosporeans and myxosporidiosis of allogynogenetic gibel carp (Carassius auratus gibelio Bloch) in China
Myxosporeans and myxosporidiosis of allogynogenetic gibel carp (Carassius auratus gibelio Bloch) in China Zhang Jinyong zhangjy@ihb.ac.cn Laboratory of Fish Diseases; Institute of Hydrobiology (IHB), Chinese
More informationOIE Collaborating Centres Reports Activities
OIE Collaborating Centres Reports Activities Activities in 2016 This report has been submitted : 2017-01-12 14:46:21 Title of collaborating centre: Quality Control of Veterinary Vaccines Address of Collaborating
More informationTHE BROILER CHICKEN INDUSTRY IN PENINSULAR MALAYSIA STATUS OF THE INDUSTRY IN 2012 AND PROSPECTS FOR 2013
THE BROILER CHICKEN INDUSTRY IN PENINSULAR MALAYSIA STATUS OF THE INDUSTRY IN 2012 AND PROSPECTS FOR 2013 SUMMARY produced parent stock accounted for In 2012, a production of 673.87 million day-old chicks
More informationPew forum on religion & public life
90 Religious Restriction Index Scores by Region Scores in the table below express the levels of religious restrictions according to the Pew Forum s Government Restrictions Index (GRI) and Social Hostilities
More informationLandfill Dogs by Shannon Johnstone
Wake County Animal Center July 217 Monthly Report Landfill Dogs by Shannon Johnstone WCAC Monthly Report Page 1 The Wake County Animal Center serves approximately 13, - 15, animals each year. Through the
More information9/27/2007 March/April 2007 US Egg Statistics 1
9/27/2007 March/April 2007 US Egg Statistics 1 8/30/07 UEPMEMO# 65 Don Bell s Table Egg Layer Flock Projections and Economic Commentary - 2007 (This report was written by Don Bell, University of California
More information-2SD +2SD -3SD -2SD -3SD -2SD
National 1971-75 0. -5.99 5603 1.0 8.4 0.4 24.0 55.3 12.7 49.9 00318 0. -0.24 150 2.7 3.4 2.7 2.0 13.3 2.7 7.3 0.25-0.49 315 0.9 4.8 1.9 3.8 19.7 3.8 13.3 0.50-0.74 338 0.3 4.7 1.5 7.1 29.3 7.1 32.0 0.75-0.99
More informationLandfill Dogs by Shannon Johnstone
Wake County Animal Center March 218 Monthly Report Landfill Dogs by Shannon Johnstone WCAC Monthly Report Page 1 The Wake County Animal Center serves approximately 13, - 15, animals each year. Through
More informationENHANCING SKILLED DELIVERIES THROUGH MATERNAL SHELTER
From Relief to Self- Reliance ENHANCING SKILLED DELIVERIES THROUGH MATERNAL SHELTER Nachola dispensary, Samburu county, Kenya Fridah Mutea - Na.onal Nutri.on Program Manager - KENYA Background The problem
More information