Oyster viperin retains direct antiviral activity and its transcription occurs via a signalling pathway involving a heat-stable haemolymph protein
|
|
- Frederica Grant
- 5 years ago
- Views:
Transcription
1 Journl of Generl Virology (215), 96, DOI 1.199/jgv..3 Oyster viperin retins direct ntivirl ctivity nd its trnscription occurs vi signlling pthwy involving het-stble hemolymph protein Timothy J. Green, 1,2 Peter Speck, 2 Lu Geng, 3 Dvid Rftos, 1 Michel R. Berd 3 nd Krl J. Helbig 3 Correspondence Timothy J. Green tim.green@mq.edu.u 1 Deprtment of Biologicl Sciences nd Sydney Institute of Mrine Science, Mcqurie University, NSW 219, Austrli 2 School of Biologicl Sciences, Flinders University, GPO Box 21, Adelide, SA 51, Austrli 3 School of Biologicl Sciences, University of Adelide, SA 51, Austrli Received 28 July 215 Accepted 24 September 215 Little is known bout the response of non-model invertebrtes, such s oysters, to virus infection. The vertebrte innte immune system detects virus-derived nucleic cids to trigger the type I IFN pthwy, leding to the trnscription of hundreds of IFN-stimulted genes (ISGs) tht exert ntivirl functions. Invertebrtes were thought to lck the IFN pthwy bsed on the bsence of IFN or ISGs encoded in model invertebrte genomes. However, the oyster genome encodes mny ISGs, including the well-described ntivirl protein viperin. In this study, we chrcterized oyster viperin nd showed tht it loclizes to cveolin-1 nd inhibits dengue virus repliction in heterologous model. In second set of experiments, we hve provided evidence tht the hemolymph from poly(i : C)-injected oysters contins het-stble, protesesusceptible fctor tht induces hemocyte trnscription of viperin mrna in conjunction with upregultion of IFN regultory fctor. Collectively, these results support the concept tht oysters hve ntivirl systems tht re homologous to the vertebrte IFN pthwy. INTRODUCTION IFNs re clss of cytokines tht induce vertebrte cells into n ntivirl stte (Rndll & Goodbourn, 28). Typiclly, virus-infected cells secrete IFNs to lert other cells in the body to the presence of virus (Robertsen, 26). IFNs induce n ntivirl stte by binding to IFN receptors, which re present on ll nucleted cells (Biron & Sen, 21). Receptor enggement ctivtes signl trnsduction vi the Jnus kinse/signl trnsducer nd ctivtor of trnscription (JAK/STAT) pthwy, leding to the trnscription of hundreds of IFN-stimulted genes (ISGs) (Schoggins & Rice, 211). The products of these ISGs exert numerous ntivirl effector functions, mny of which re still not fully described (Schoggins & Rice, 211). Viperin (virus inhibitory protein, endoplsmic reticulum-ssocited, IFN inducible) is one of few ISGs tht hs been shown to hve direct ntivirl ctivity ginst rnge of RNA nd DNA viruses (Mttijssen & Pruijn, 212), nd is one of the erliest nd most significntly upregulted genes in response to virl infection in humns (reviewed by Helbig & Berd, 214). Viperin ws first isolted from fibroblst cells nd ws shown to be n The GenBnk/EMBL/DDBJ ccession numbers for the four oyster viperin sequences determined in this study re KT KT inducible cytoplsmic ntivirl protein tht is induced by IFNs nd humn cytomeglovirus (HCMV) (Chin & Cresswell, 21). Subsequently, viperin hs been chrcterized in vriety of vertebrte species nd shown to be highly conserved evolutionry host protein (Goossens et l., 215; Helbig et l., 211; Milic et l., 215; Wng et l., 27; Zhng et l., 214). Viperin loclizes to the endoplsmic reticulum (ER) nd lipid droplets (reviewed by Mttijssen & Pruijn, 212) nd inhibits the relese of influenz virus nd humn immunodeficiency virus by ltering the formtion of lipid rfts, which re the known sites of virus budding (Nsr et l., 212; Wng et l., 214b). Viperin lso inhibits the repliction of both heptitis C virus nd dengue virus by intercting with virl nonstructurl proteins (Helbig et l., 211, 213). The evolutionry origins nd divergence of mjor immune response pthwys hve generlly been inferred from comprisons between vertebrtes nd model invertebrte species, such s Drosophil melnogster, Anopheles gmbie, Cenorhbditis elegns nd Cion intestinlis (Roblino et l., 24). The bsence of IFN or its mjor effectors from the genomes of these model invertebrtes hs been used to imply tht the IFN pthwy is vertebrte innovtion (Loker et l., 24; Roblino et l., 25). However, non-model invertebrte species might hve 3 G 215 The Authors Printed in Gret Britin 3587
2 T. J. Green nd others ntivirl systems tht re homologous to the vertebrte type I IFN response (Green & Montgnni, 213; He et l., 215). In prticulr, trnscriptome sequencing of the Pcific oyster () infected with ostreid herpesvirus type 1 (OsHV-1) hs reveled n ncient IFN pthwy in the oyster genome with key components [Toll-like receptor (TLR), Rig-like Receptor (RLR), IFN regultory fctors (IRFs), JAK/STAT nd ISGs] conserved nd highly upregulted in response to OsHV-1 infection (He et l., 215; Renult et l., 211; Rosni et l., 214; Segrr et l., 214b). Mny of these ntivirl genes re upregulted in C. gigs tissues following injection with poly(i : C) to mimic virus infection (Green et l., 214, b), nd this inducible immune response cn inhibit OsHV-1 infection (Green & Montgnni, 213). Viperin is lso reported to be one of the erliest nd most upregulted of the C. gigs genes in response to OsHV-1 (Rosni et l., 214 nd poly(i : C) (Green et l., 214b), but it is unknown whether oyster viperin hs direct ntivirl ctivity. The concept tht non-model invertebrtes, such s oysters, hve type I IFN response is still contrry to estblished views in innte immunology. Mny comprtive immunologists re scepticl tht oysters hve n IFN response becuse bioinformtics nlysis of ll fully sequenced invertebrte genomes (including the oyster) hve filed to identify n IFN cytokine (He et l., 215; Loker et l., 24). In ddition, it is unknown whether invertebrte genes tht shre sequence homology to vertebrte ISGs hve lso retined their ntivirl functions over long evolutionry time period. Therefore, the first objective of this study ws to chrcterize oyster viperin nd determine whether it hd direct ntivirl ctivity. The second objective ws to confirm tht expression of oyster viperin is induced vi cytokine. RESULTS Sequence nlysis of oyster viperin Utilizing the oyster genome dtbse ( com), primers were designed to mplify the complete coding sequence of C. gigs viperin. The full-length coding sequence of oyster viperin ws mplified nd sequenced from four individul oysters nd confirmed to be 15 bp, encoding 35. Comprison of these four nucleotide sequences reveled single 3 bp insertion in the N terminus nd 13 single-nucleotide polymorphisms (SNPs) in the C terminus of C. gigs viperin. Only two of these SNPs were ssocited with mino cid substitutions t 25 nd 273. In the vertebrte phylum, viperin mino cid sequences re highly conserved. A comprison of C. gigs viperin with humn (; GenBnk ccession no. NP_542388), fish (; GenBnk ccession no. NP_12727), chicken (; GenBnk ccession no. ACA83729) nd lncelet ( floride; GenBnk ccession no. EEN65148) viperin reveled % mino cid identity. The C-terminl region (essentil for some of the ntivirl ctivity of this protein) of viperin ws highly conserved between vertebrtes nd C. gigs (Fig. 1). The mphipthic helix in the N-terminl region of humn viperin llows it to tether to the ER nd lipid droplets. However, n mphipthic helix could not be predicted in C. gigs viperin (Amphipseek, lthough it does retin the rdicl S-denosyl methionine (SAM) domin (Conserved Domins serch, dsrna induces oyster viperin expression Mmmlin viperin is rpidly induced (within 2 h) in response to viruses, IFN nd bcteril by-products, such s dsrna nd lipopolyscchride (LPS) (reviewed by Helbig & Berd, 214). We chose to investigte oyster viperin expression in response to poly(i : C), which is synthetic dsrna molecule. The use of synthetic dsrna in plce of replicting virus llowed full nlysis of cellulr response to dsrna in the bsence of ny interference tht my occur vi specific virl proteins. In contrst to vertebrtes, injection of poly(i : C) in the oyster s dductor muscle resulted in the delyed expression of viperin (Fig. 2). Hemocyte expression of oyster viperin remined stble t 3 nd 9 h p.i. (Pw.5, Fig. 2) nd then incresed rpidly to pek t 27 p.i. (Fig. 2, Pv.5). At 27 h p.i., viperin mrna ws lso elevted in dductor muscle, gill nd mntle tissues (Pv.5) but not in digestive glnd or gond tissues (Fig. 2b, Pw.5). Stimultion of primry hemocyte cell cultures with different concentrtions of poly(i : C) or LPS reveled dose threshold for C. gigs viperin expression (Fig. 3). Expression of hemocyte viperin ws induced by poly(i : C) t concentrtion of 24. mg ml 21 (Pv.5) but not t 2.4 nd.24 mg ml 21 (Pw.5). Stimultion of hemocytes with three different concentrtions of LPS filed to induce the expression of C. gigs viperin (Fig. 3, Pw.5). Hemolymph protein/peptide induces hemocyte viperin expression Our results demonstrted tht injection of poly(i : C) into the oyster dductor muscle resulted in elevted viperin expression in the mjority of tissue comprtments. Three possibilities exist for the systemic expression of oyster viperin: (i) cells within the dductor muscle secrete cytokine; (ii) poly(i : C) diffuses from the site of injection to other tissue comprtments; or (iii) stimulted hemocytes re migrting from the dductor muscle to other tissue comprtments. We therefore undertook series of experiments to show tht cells within the dductor muscle re secreting cytokine. First, dult C. gigs were induced into n ntivirl stte by intrmusculr injection with poly(i : C) or sewter (control). The circulting hemocytes from oysters injected with poly(i : C) hd elevted expression levels of mny genes in the IFN pthwy, including TLR, retinoic cid inducible gene I-like helicse 3588 Journl of Generl Virology 96
3 Oyster viperin hs direct ntivirl ctivity Fig. 1. Viperin hs remrkbly high evolutionry conservtion in nimls. C. gigs viperin (GenBnk ccession no. KT334231) hs 68 % mino cid identity to viperin sequences isolted from humn (; GenBnk ccession no. NP_542388), fish (; GenBnk ccession no. NP_12727), chicken (; GenBnk ccession no. ACA83729) nd lncelet ( floride; GenBnk ccession no. EEN65148). The viperin mino cid sequences were ligned by CLUSTAL W using the phylogenetic softwre pckge MEGA v.6.6. The rdicl SAM domin is underlined. Asterisks indicte conserved mino cids. (RLH), IRF, JAK, STAT5A, STAT6, suppressor of cytokine signlling (SOC), protein kinse R (PKR) nd viperin (Fig. 4, Pv.5). The cellulr frction of the hemolymph ws retined from C. gigs injected with poly(i : C) [stimulted cell-free hemolymph (CFH)] or sewter (non-stimulted CFH) s culture medium for primry hemocyte cultures. The second group of experiments using primry hemocyte cultures reveled tht component of
4 T. J. Green nd others () 2 ΔΔC T viperin Sewter Poly(l : C) b b c bc (b) 2 ΔΔC T viperin Hemocytes (H) Brnchi (B) Mntle (M) Adductor (Ad) Digestive glnd (DG) Gond (G) Time (h) H B M Ad DG G Tissue (27 h) Fig. 2. Normlized expression of C. gigs viperin in response to poly(i : C) injection. () Viperin ws significntly upregulted in hemocytes t 27 nd 54 h post-injection. Different lower-cse letters denote significnt chnges in viperin expression compred with the sewter control (P,.5). (b) At 27 h post-injection, viperin ws significntly upregulted in hemocytes (H), brnchi (B), mntle (M) nd dductor tissue (Ad) (P,.5) but ws not induced in digestive glnd (DG) nd gond (G) tissue (P..5). Asterisks denote significnt differences compred with controls (*P,.5). stimulted CFH ctivted expression of IRF, JAK, STAT6 nd viperin (Fig. 4b, Pv.5). The upregultion of RLH in Fig. 4(b) is n nomly: RLH ws only upregulted in one experiment, wheres IRF, JAK, STAT6 nd viperin were consistently upregulted in three independent experiments. Fig. 4(c) demonstrtes tht the hemolymph compound tht induces viperin expression must be potent becuse diluting stimulted CFH (2 %, v/v) did not reduce viperin expression in primry hemocytes (Pw.5). Furthermore, this hemolymph component ppered to be het-stble, protese-susceptible fctor becuse the bility of the stimulted CFH to induce viperin expression ws retined fter digestion with RNse A or het inctivtion (Fig. 4c, Pw.5), but ws eliminted by proteinse K digestion (Fig. 4c, Pw.5). Oyster viperin loclizes to cveolin-1 but not to lipid droplets Mny viperin molecules to dte hve been shown to loclize to lipid droplets nd/or the ER, including murine, humn, crocodile nd fish viperin (Helbig et l., 211; Hinson & Cresswell, 29b; Milic et l., 215; Wng et l., 214), nd in most cses this hs been ttributed to the mphipthic helix of the N terminus of viperin (reviewed by Helbig & Berd, 214). Oyster viperin hs considerbly shorter N terminus thn humn viperin, nd our nlysis of oyster viperin suggested tht it is unlikely to form n mphipthic helix in its N terminus (see bove). To determine the locliztion of oyster viperin, we performed number of expression studies using the Huh-7 cell line, which is known to hve prominent lipid droplet formtion, mking viperin s potentil locliztion to this orgnelle esier to observe. To ssess the bility of both oyster nd humn viperin to loclize to lipid droplets, we co-trnsfected FLAG-tgged oyster nd humn viperin into Huh-7 cells in conjunction with MCherry conjugted to dipocyte differentition-relted protein (MCherry ADRP), which is resident lipid droplet mrker. As cn be seen in Fig. 5(), humn viperin co-loclized extensively with the lipid droplet; however, oyster viperin expression ppered more cytoplsmiclly punctte in nture nd did not co-loclize with ADRP. Due to the punctte nture of oyster viperin, we nlysed its potentil co-locliztion with number of orgnelle mrkers displying similr locliztion pttern, including those for lysosome (LAMP1), erly 2 ΔΔC T viperin b Sewter Poly(I : C) 24. μg ml 1 Poly(I : C) 2.4 μg ml 1 b Poly(I : C).24 μg ml 1 LPS 24. μg ml 1 LPS 2.4 μg ml 1 LPS.24 μg ml 1 Fig. 3. Poly(I : C) but not LPS is responsible for inducing hemocyte expression of C. gigs viperin. Primry cell cultures of C. gigs hemocytes were estblished from individul oysters nd exposed to three different concentrtions of poly(i : C) nd LPS. Different lower-cse letters denote significnt chnges in viperin expression compred with sewter control (P,.5). 359 Journl of Generl Virology 96
5 Oyster viperin hs direct ntivirl ctivity () 8 Poly(l : C) (b) Stim. CFH (c) In vivo 5 In vitro Sewter NS CFH ΔΔC T TLR RLH STING IRF JAK STAT5A STAT6 SOC PKR Viperin 2 ΔΔC T TLR RLH STING IRF JAK STAT5A STAT6 SOC PKR Viperin 2 ΔΔC T viperin In vitro b b b Stim. CFH 2 % CFH NS CFH 85 C RNAse Prot. K Fig. 4. Evidence tht hemolymph from oysters injected with poly(i : C) induces the expression of viperin nd IRF in hemocytes from nïve oysters. () In vivo injection with poly(i : C) results in the upregultion of IFN-relted genes in C. gigs hemocytes. The cell-free hemolymph (CFH) ws retined nd used s culture medium for primry hemocyte cell cultures. (b) Viperin, JAK, STAT6 nd IRF re upregulted in nïve hemocytes cultured using poly(i : C)-stimulted hemolymph (Stim. CFH). NS, Not stimulted. (c) Viperin induction ws retined when hemolymph ws treted with RNse A or het treted t 85 8C, but ws eliminted when digested with proteinse K (Prot. K). Poly(I : C)-stimulted hemolymph retined ctivity when diluted (2 %, v/v). Asterisks in (, b) nd different lower-cse letters (c) denote significnt differences compred with controls (*P,.5). b nd lte endosoml comprtments (Rb5 nd -7), mitochondri (Cox IV) nd the peroxisome (pex19); however, no colocliztion ws observed (dt not shown). Interestingly, oyster viperin ws observed to co-loclize with cveolin-1 in Huh-7 cells (Fig. 5b). Cveolin-1 is mrker of cveole, specilized form of lipid rft (Prton & Simons, 27). To exmine the divergent locliztions of humn nd oyster viperin in vitro, we co-expressed humn viperin GFP in conjunction with FLAG-tgged oyster viperin in Huh-7 cells. Fig. 5(c) shows tht the two viperin molecules displyed extensive co-locliztion to puttive lipid droplets, s well s to punctte cytoplsmic loci. Humn viperin hs been shown to dimerize previously (Hinson & Cresswell, 29b), independent of its N terminus, nd, given the inbility of oyster viperin to loclize to lipid droplets in the bsence of humn viperin expression (Fig. 5), we cn presume tht oyster viperin mintins the bility to dimerize, nd is ble to do so with humn viperin, reloclizing to lipid droplets in vitro. Oyster viperin inhibits dengue virus repliction Cell lines for mrine bivlves do not exist (Yoshino et l., 213), nd the methodology to culture OsHV-1 in primry cells isolted from C. gigs hs not yet been developed. Therefore, we utilized heterologous model to investigte whether oyster viperin directs ntivirl ctivity. Humn viperin restricts the repliction of number of humn virl pthogens, including dengue virus (DENV-2; Helbig et l., 213). We compred the bility of oyster nd humn viperin to restrict DENV-2 repliction in Huh-7 cells. Cells were trnsiently trnsfected with either FLAG expression control vector, FLAG-tgged oyster viperin or FLAG-tgged humn viperin expression plsmid, nd then infected with DENV-2 t 24 h post-trnsfection. Both oyster nd humn viperin were ble to restrict DENV-2 repliction t 24 h post-infection (p.i.) by 6 nd 54 % respectively (Fig. 6, Pv.5). No significnt difference ws observed between the bility of oyster nd humn viperin to restrict DENV-2 repliction in vitro. The bility of oyster viperin to restrict DENV-2 repliction demonstrted tht the lck of n mphipthic helix in the N terminus of this protein did not inhibit its nti-denv ctivity. DISCUSSION A growing body of evidence supports the concept tht some invertebrtes my hve n ncient ntivirl pthwy tht is homologous to the vertebrte type I IFN response (reviewed by Wng et l., 215). Despite numerous studies describing C. gigs genes tht re homologous to vertebrte ISGs (Green & Montgnni, 213; He et l., 215; Renult et l., 211; Rosni et l., 214), there re outstnding questions regrding whether these invertebrte genes hve similr biologicl function nd whether C. gigs type I IFN cytokine exists. In the current study, we showed oyster viperin hs direct ntivirl ctivity (Fig. 6) nd provided evidence tht intrmusculr poly(i : C) injection induces hemolymph protein/peptide (cytokine) tht induces hemocyte expression of viperin in conjunction with upregultion of IRF nd JAK/STAT (Fig. 4b). As herpesviruses pose the biggest thret to the globl production of Pcific oysters (Renult et l., 214; Segrr et l., 21) nd other mrine molluscs (reviewed by Green et l., 215), these results re of considerble interest in progressing novel therpeutics for the quculture industry
6 T. J. Green nd others () Viperin ADRP Merge Oyster Humn (b) O. viperin Cveolin-1 Merge (c) O. viperin H. Viperin Merge Fig. 5. C. gigs viperin co-loclizes to cveolin-1 but not to lipid droplets. () Huh-7 cells were trnsfected with either FLAG-tgged oyster viperin (O. viperin) or FLAG-tgged humn viperin (H. viperin) in conjunction with MCherry ADRP. ADRP is resident lipid droplet mrker. No co-locliztion ws observed between oyster viperin nd ADRP. (b) FLAG-tgged oyster viperin hs considerble co-locliztion to cveolin-1-gfp. (c) Co-expression of FLAG-tgged oyster viperin nd GFP-tgged humn viperin in Huh-7 cells reveling tht humn viperin molecules dimerize with oyster viperin loclizing to lipid droplets. Viperin hs been chrcterized from mny different nimls within the subphylums of Vertebrt (Goossens et l., 215; Helbig et l., 213; Milic et l., 215; Wng et l., 214b; Zhong et l., 215) nd Cephlochordt (Lei et l., 215). To the best of our knowledge, this is the first study to chrcterize viperin isolted from n niml without notochord (non-chordtes). The mino cid sequence of C. gigs viperin hs high homology to humn nd teleost viperin (Fig. 1) nd hs similr domin rrngement with the conserved motif of CxxxCxxC tht exists in rdicl SAM enzymes nd conserved C-terminl domin. However, we were unble to predict n mphipthic helix in the N-terminl region. Vertebrte viperin requires the mphipthic helix for its ssocition with the ER nd its bility to loclize to lipid droplets (Hinson & Cresswell, 29, b). The mphipthetic helix of humn viperin is importnt for its direct ntivirl ctivity ginst heptitis C virus (Helbig et l., 3592 Journl of Generl Virology 96
7 Oyster viperin hs direct ntivirl ctivity Reltive fold chnge in DENV RNA Control O. viperin H. viperin Fig. 6. C. gigs viperin hs direct ntivirl ctivity ginst DENV- 2 in heterologous model. Huh-7 cells were trnsfected with either oyster viperin (O. viperin), humn viperin (H. viperin) or n empty control vector, 24 h prior to infection with DENV-2 (m.o.i.51). Cells were hrvested for RNA t 24 h p.i. nd reverse trnscriptse PCR ws performed to detect virl RNA levels in comprison with the controls. C. gigs viperin hd the sme level of ntivirl ctivity s humn viperin ginst DENV-2. Asterisks denote significnt difference compred with control (*P,.5). 25) nd chikunguny virus (Teng et l., 212) but not ginst DENV-2 (Helbig et l., 213). The bsence of predictble mphipthic helix in the N terminus of C. gigs viperin is the most likely explntion for its filure to loclize with lipid droplets in Huh-7 cells (Fig. 5). Insted, C. gigs viperin co-loclized to cveolin-1 (Fig. 5b), which is mrker for cveole. Cveole re flsk-shped indenttions of the plsm membrne enriched in cholesterol, cveolin nd signlling fctors (Prton & Simons, 27), nd re exploited by some niml viruses s direct portl for endocytic entry to host cells (Smith & Helenius, 24). The mechnism for virus entry into molluscn cells is unknown, but other mrine invertebrte viruses, such s white spot syndrome virus, rely on cveole-medited endocytosis to enter crustcen cells (Dun et l., 214; Hung et l., 213). Cveole re lso involved in ntivirl signlling by llowing signlling molecules to cluster within the cveole domin, thus fcilitting protein interctions mong signlling components nd enhncing signl trnsduction (Gbor et l., 213). Cveolin-1 serves s the scffolding protein tht recruits signlling molecules, such n IFN receptors, to cveole (Tkok et l., 2). The role of cveolin nd cveole in molluscn ntivirl signlling nd recruitment of ntivirl proteins is lso unknown, but cveolin nd viperin trnscripts re both highly expressed in C. gigs infected with OsHV-1 (He et l., 215; Rosni et l., 214). We confirmed tht C. gigs viperin hs the sme level of ntivirl ctivity s humn viperin ginst DENV-2 (Fig. 6), lthough C. gigs viperin did not loclize to the sme cellulr comprtment s vertebrte viperin. Helbig et l. (213) confirmed tht the nti-denv effect of humn viperin is medited within the C-terminl 17. The C-terminl region of humn viperin ws shown to restrict erly DENV-2 RNA production/ccumultion by intercting with DENV-2 cpsid, non-structurl protein (NS3) nd virl RNA (Helbig et l., 213). Phylogenetic nlysis reveled tht humn nd C. gigs viperin shre 88 % mino cid identity within the C-terminl region. Herpesviruses re renowned for their bility to modulte the host s immune response nd co-opt host ntivirl proteins to fcilitte the infectious process (Aresté & Blckbourn, 29; White et l., 212). Both HCMV (humn herpesvirus-5) nd humn herpesvirus-1 [herpes simplex virus type 1 (HSV-1)] hve been shown to counterct viperin s ntivirl ctivities (Seo et l., 211; Shen et l., 214). The HCMV vmia protein hs been demonstrted to interct with viperin, resulting in the relocliztion of viperin from the ER to the mitochondri, where it reduces cellulr ATP genertion, resulting in ctin cytoskeleton disruption nd enhncement of HCMV infection (Seo et l., 211). HSV-1 does not co-opt viperin; rther, the endoribonuclese ctivity of its UL41 protein hs been shown to restrict viperin mrna ccumultion nd to bolish its bility to limit HSV-1 infection (Shen et l., 214). It is presumed tht OsHV-1 cn lso modulte the immune response of C. gigs, s the virl genome encodes four inhibitors of poptosis tht re highly expressed during the erly stges of infection (Green et l., 215b; Segrr et l., 214, b). There re fewer dt vilble regrding the bility of OsHV-1 to modulte the other evolutionrily conserved ntivirl proteins, such s viperin. Interestingly, younger developmentl stges of C. gigs induce viperin to higher expression levels when infected with OsHV-1 (unpublished dt) nd these erlier developmentl stges lso hppen to be more susceptible to OsHV-1 infection (Pul-Pont et l., 214; Peeler et l., 212). Further reserch is therefore wrrnted to determine whether OsHV- 1 diverts viperin from its ntivirl role nd co-opts it to fcilitte the infection process. In vertebrtes, viperin is highly inducible gene nd its expression rpidly increses following virl infections nd tretment with poly(i : C) nd LPS (reviewed by Helbig & Berd, 214; Mttijssen & Pruijn, 212). We conducted severl in vitro experiments to determine which pthogenssocited lignds nd sensors re responsible for inducing C. gigs viperin. In contrst to vertebrtes, C. gigs viperin ws induced by poly(i : C) but not by LPS (Fig. 3). These results suggest tht virl repliction products, such s dsrna, re responsible for inducing viperin expression in C. gigs hemocytes vi TLR or retinoic cid inducible gene I-like helicse (RLH) sensor. In vivo experiments reveled viperin expression is delyed in C. gigs hemocytes following poly(i : C)-injection when compred with other nimls from the vertebrte phylum. Vertebrte cells usully express viperin within 2 h following stimulus, nd its expression typiclly peks between 4 nd6hfollowingstimultionwithpoly(i:c)(goossens et l., 215; Zhng et l., 214), wheres hemocyte expression of C. gigs viperin remined stble for the
8 T. J. Green nd others first 9 h fter poly(i : C)-injection nd did not pek until 27 h post-injection (Fig. 2). Poly(I : C)-injection in the dductor muscle lso resulted in the upregultion of C. gigs viperin in the mjority of tissue comprtments (Fig. 2b). Severl plusible explntions for the delyed but systemic expression of C. gigs viperin re tht: (i) stimulted hemocytes migrte from the site of poly(i : C) injection to other tissue comprtments; (ii) poly(i : C) diffuses from the site of injection to other tissue comprtments; or (iii) poly(i : C) induces the cells within the dductor muscle to secrete type I IFN cytokine. We therefore devised severl experiments to indirectly test whether C. gigs hs type I IFN response. Genes with cler homology to type I IFNs hve been identified in tetrpods (mphibins, reptiles, birds nd mmmls) nd fishes but not in non-vertebrte chordtes (tunictes or lncelets). This hs previously been tken to suggest tht IFNs first evolved in erly vertebrtes (Lngevin et l., 213). However, nother interprettion is tht functionlly ctive IFNs from other niml groups simply lck sufficient sequence conservtion with their vertebrte counterprts to be identified by homology serches. Comprisons of mmmlin nd teleost IFNs revel low overll mino cid similrity (v25 %) nd dissimilr gene domin rchitecture of type I IFNs even within the vertebrte phylum (Robertsen, 26). Our results showed tht C. gigs injected with poly(i : C) produced hemolymph compound tht ctivted viperin expression in primry hemocyte cell cultures in conjunction with upregultion of IRF nd JAK/STAT (Fig. 4b). Furthermore, this compound(s) is likely to be het-stble protein/peptide (cytokine) becuse its ctivity ws retined fter digestion with RNse A nd het inctivtion (Fig. 4c) but ws eliminted by proteinse K digestion. Previous reserch hs shown tht ll type I IFNs from vertebrtes re het stble (Oritni et l., 23). Conclusion In summry, our results provide further support to the concept of n ncient type I IFN response existing in the common metzon ncestor. We demonstrted tht C. gigs viperin hs direct ntivirl ctivity nd provided evidence tht viperin expression is induced by non-specific dsrna vi hemolymph protein/peptide (cytokine). Reserch is currently underwy to purify this hemolymph protein/peptide(s) tht ctivtes viperin expression. The existence of type I IFN response in the oyster cretes exciting new possibilities for future reserch into novel therpeutic tretments for virl diseses tht re thretening globl quculture production. METHODS Oyster chllenge experiments. Juvenile oysters (C. gigs) hd notch filed in their shell djcent to their dductor muscle to llow delivery of poly(i : C) (5 mg ml 21 in sewter; Sigm) ccording to previous published procedures (Green & Brnes, 29; Green et l., 214b). At h, oysters were injected with 5 ml poly(i : C) or sewter (control) nd plced in replicted quriums (slinity 35 p.p.t., 19 uc, erted). Six oysters per tretment were smpled t, 3, 9, 27 nd 54 h post-injection. Smpling consisted of excising oyster tissues, snp freezing in liquid nitrogen nd storge t 28 uc for RNA extrction. The oysters were not fed for the durtion of the experiment. Primry cell culture nd pthogen-ssocited moleculr ptterns (PAMP) stimultion. Experiments investigting the effects of PAMPs on nïve hemocytes were crried out using primry hemocyte cell cultures tht were estblished from individul oysters. Six primry cell cultures were estblished from individul C. gigs ccording to previously published procedures (Morg et l., 211; Renult et l., 211). Briefly, hemolymph ws withdrwn from the pericrdil cvity using sterile 21-guge needle nd syringe. Hemolymph from individul oysters ws kept seprte nd divided into seven replicte wells of 24-well tissue culture plte (.4 ml per well). Hemocytes were llowed to dhere to the tissue culture wells for 3 min t 22 uc before the cellulr frction of the hemolymph ws removed from ech well, filtered (.2 mm) nd retined on ice. Adhered hemocytes were wshed three times with sterile sewter before.4 ml cellulr hemolymph with 2 % (v/v) penicillin/streptomycin ws replced s the culture medium. Three concentrtions of the PAMPs poly(i : C) nd LPS (5.,.5 nd.5 mg.ml 21 ) were prepred in sewter nd 2 ml PAMP suspension (control5sewter) ws dded to ech well. Hemocytes from ech individul oyster were therefore exposed to three concentrtions of poly(i : C) nd LPS. Hemocytes were incubted for 6 h t 22 uc in humid incubtor nd then used for RNA extrction. This set of experiments ws repeted on two seprte occsions. Stimultion of nïve hemocytes with hemolymph collected from oysters injected with poly(i : C). Six dult oysters were injected with either 1 ml poly(i : C) or with sewter s bove. Hemolymph from poly(i : C)-injected nd control oysters ws collected t 27 h post-injection using 21-guge needle nd syringe, pooled nd filtered (.2 mm), nd the cellulr frction of the hemolymph ws retined on ice. Primry hemocyte cultures were estblished from individul oysters (n56) s described bove. Pooled hemolymph from poly(i : C)- nd sewter-injected dult oysters ws used s the culture medium to determine whether hemolymph component induced viperin expression (Fig. 7). Additionl tretments included digestion of the hemolymph from poly(i : C)-injected oysters with RNse A (3.3 mg ml 21,37uC, 1.5 h), proteinse K (.1 mg ml 21,37uC, 1.5 h) nd het inctivtion (85 uc for 15 min) before using s culture medium. Hemolymph from poly(i : C)-injected oysters ws lso diluted with hemolymph from control oysters (2 %, v/v) before being used s culture medium. Hemocytes were incubted for 6 h t 22 uc in humid incubtor nd then used for RNA extrction. This set of experiments ws repeted on two seprte occsions. RNA extrction nd quntittive reverse trnscription PCR (RTqPCR). Totl RNA ws purified from oyster smples using TriSure (Bioline) nd reverse trnscribed using Tetro cdna synthesis kit (Bioline). Quntittive rel-time PCR ws performed in ViiA7 thermocycler (Applied Biosystems), s described previously, using the primers in Tble 1, which included the internl reference gene eef1 (Green et l., 214b). Oyster viperin coding sequence nd synthesis. The complete coding sequence of oyster viperin ws mplified from cdna smples of oysters injected with poly(i : C) (n54, 27 h p.i.), using the primers 59-ACATGGCTATTACGCSGTAC-39 nd 59-CCAGGATTACAAATC- GAC-39. PCR mplicons were DNA sequenced t the Austrlin Genome Reserch Fcility. The N-terminl FLAG-tgged oyster viperin ws generted in two steps. The consensus nucleotide sequence of oyster viperin ws directly synthesized (GenScript USA) 3594 Journl of Generl Virology 96
9 Oyster viperin hs direct ntivirl ctivity (i) Oysters stimulted with dsrna [poly(i : C)] or sewter (control). (n = 6 oysters per tretment) for 24 h in erted quri. (ii) Hemolymph collected, pooled nd.2 µm filtered. Cell-free hemolymph used s culture medium. (iii) Hemocytes collected from unstimulted oysters (n = 6 oysters). (iv) Hemocytes from individul oysters split into individul wells nd exposed to both poly(i : C)-stimulted nd control hemolymph. (v) Hemocytes cultured t 22 C for 6 h. RNA purified using TriSure. Poly(I : C), positive control; sewter, negtive control. Fig. 7. Methodology used to evlute the effect of hemolymph from oysters treted with poly(i : C) or sewter (control) on viperin expression in hemocytes from nïve oysters. The cellulr frction of the hemolymph ws collected from C. gigs stimulted with poly(i : C) or sewter (control). The cellulr frction of the hemolymph ws then used s culture medium to determine whether hemolymph component induced hemocyte expression of viperin. into the puc57 vector. puc57-viperin ws PCR mplified using the primers 59-TTATGCTAGCATGGACTACAAGGATGACGACGATA- AGATGGCTATTACGCAGTACGTCAGC-39 nd 59-TTATCTCGAG- TTACCAATCGAGCTTCATATCGGC-39. The resulting PCR mplicon ws double digested with Nhe I nd Xho I nd subcloned into the pci-neo expression vector (Promeg). Vector sequences were verified by DNA sequencing. Immunostining nd co-locliztion studies. The humn heptocellulr crcinom cell linehuh-7 were cultured on geltin-coted glss coverslips nd trnsiently trnsfected with plsmids expressing humn or oyster viperin tht were FLAG tgged t their N terminus in the vector pci-neo. Co-trnsfection ws performed with vectors expressing either MCherry ADRP or cveolin-1 GFP. Cells were fixed in 4 % prformldehyde t 24 h post-trnsfection (Eyre et l., Tble 1. Primer pirs used in RT-qPCR expression nlysis The GenBnk ccession number is provided for ech gene. STING, Stimultor of IFN genes; viperin, virus inhibitory protein, ER-ssocited, IFN inducible. Gene nme Accession no. Sense primer (59R39) Antisense primer (59R39) EFU ABI2266 GAGCGTGAACGTGGTATCAC ACAGCACAGTCAGCCTGTGA TLR GCAGGACTCCACTTTCTCAC GTTGGCACCCAGGTAAAGG RLH EKC3834 CAACAACATGGGAAGTATGGTG TCGGTCTGTTAACTGCGGAC STING EKC29965 CTGCTATTGTCCGCCATC GAATGGGCGTGGCATACTC IRF EKC43155 CGAAACGCAGAAACTGTTC ATTTGCCTTCCATCTTTTGG SOC EKC24772 CAAGAGAGAATCTGTGGGAAC GCATCTTAGCACTAATTCTCTC JAK EKC41693 AGAACACCTACCTTCCTGTG TGAGCCACGTCACTTATCATC STAT5A EKC3789 AGCTCAGAGTCCTCTGTG ACACTGTTAGTCTGGATACTC STAT6 EKC39332 AGCAGCAGACAGGCAACAC ACTGGGCTCATTTGCTGGTC PKR EKC3487 GAGCATCAGCAAAGTGTTGAG GTAGCACCAGGAGATGGTTC Viperin EKC2825 GCTTTGACCCGGAAACCAAC TGACACCAATCCCGAACTCG
10 T. J. Green nd others 27, 214), wshed in PBS nd permebilized in 1 % NP-4, before blocking in 5 % (w/v) BSA in PBS. FLAG-tgged viperin ws visulized using n nti-flag mouse ntibody (Sigm) nd either got nti-mouse IgG Alex Fluor 488 or got nti-mouse IgG Alex Fluor 555 (Moleculr Probes) nd counterstined with DAPI. Florescence ws visulized using Nikon TiE inverted microscope where seril Z-sections were cquired nd deconvoluted using the 3D AutoQunt Blind Deconvolution plug-in of NIS Elements AR v Imges re single representtive Z-sections. DENV ssy. Huh-7 cells were seeded in 12-well dish nd infected 24 h fter seeding t n m.o.i. of 1 for 9 min t 37 uc with DENV-2 in volume of 3 ml per well s described previously (Milic et l., 215). Cells were then wshed with PBS three times before being reincubted in culture medium. At 24 h p.i., the cells were hrvested for RNA purifiction s described bove, nd rel-time PCR ws performed utilizing the DENV-2-specific primers 59-ATCCTCCTA- TGGTACGCACAAA-39 nd 59-CTCCAGTATTATTGAAGCTGCT- ATCC-39 in combintion with primers for the internl RPLPO (lrge ribosoml protein) reference gene: 59-AGATGCAGCAGATCC- GCAT-39 nd 59-GGATGGCCTTGCGCA-39. ACKNOWLEDGEMENTS The uthors cknowledge the funding provided by Mcqurie University postdoctorl reserch scheme (MQ grnt ), Austrlin Sefood Coopertive Reserch Centre (CRC project no. 211/ 758) nd the Austrlin Ntionl Helth nd Medicl Reserch Council (NHMRC progrmme grnt APP15326). The uthors lso cknowledge Gry Zippel, Kevin McAsh nd Ewn McAsh for providing oysters for reserch. REFERENCES Aresté, C. & Blckbourn, D. J. (29). Modultion of the immune system by Kposi s srcom-ssocited herpesvirus. Trends Microbiol 17, Biron, C. A. & Sen, G. C. (21). Interferons nd other cytokines. In Fields Virology, 4th edn, pp Edited by D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lmb, M. A. Mrtin, B. Roizmn & S. E. Strus. Phildelphi, PA: Lippincott Willims & Wilkins. Chin, K.-C. & Cresswell, P. (21). Viperin (cig5), n IFN-inducible ntivirl protein directly induced by humn cytomeglovirus. Proc Ntl Acd Sci U S A 98, Dun, H., Jin, S., Zhng, Y., Li, F. & Xing, J. (214). Grnulocytes of the red clw cryfish Cherx qudricrintus cn endocytose beds, E. coli nd WSSV, but in different wys. Dev Comp Immunol 46, Eyre, N. S., Clelnd, L. G., Tndon, N. N. & Myrhofer, G. (27). Importnce of the crboxyl terminus of FAT/CD36 for plsm membrne locliztion nd function in long-chin ftty cid uptke. J Lipid Res 48, Eyre, N. S., Fiches, G. N., Aloi, A. L., Helbig, K. J., McCrtney, E. M., McErlen, C. S. P., Li, K., Aggrwl, A., Turville, S. G. & Berd, M. R. (214). Dynmic imging of the heptitis C virus NS5A protein during productive infection. J Virol 88, Gbor, K. A., Stevens, C. R., Pietrszewski, M. J., Gould, T. J., Shim, J., Yoder, J. A., Lm, S. H., Gong, Z., Hess, S. T. & Kim, C. H. (213). Super resolution microscopy revels tht cveolin-1 is required for sptil orgniztion of CRFB1 nd subsequent ntivirl signling in zebrfish. PLoS One 8, e Goossens, K. E., Krpl, A. J., Rohringer, A., Wrd, A. & Ben, A. G. D. (215). Chrcteristion of chicken viperin. Mol Immunol 63, Green, T. J. & Brnes, A. C. (29). Inhibitor of REL/NF-KB is regulted in Sydney rock oysters in response to specific doublestrnded RNA nd Vibrio lginolyticus, but the mjor immune ntioxidnts EcSOD nd Prx6 re non-inducible. Fish Shellfish Immunol 27, Green, T. J. & Montgnni, C. (213). Poly I:C induces protective ntivirl immune response in the Pcific oyster () ginst subsequent chllenge with Ostreid herpesvirus (OsHV-1 mvr). Fish Shellfish Immunol 35, Green, T. J., Benkendorff, K., Robinson, N., Rftos, D. & Speck, P. (214). Anti-virl gene induction is bsent upon secondry chllenge with double-strnded RNA in the Pcific oyster, Crssostre gigs. Fish Shellfish Immunol 39, Green, T. J., Montgnni, C., Benkendorff, K., Robinson, N. & Speck, P. (214b). Ontogeny nd wter temperture influences the ntivirl response of the Pcific oyster,. Fish Shellfish Immunol 36, Green, T. J., Rftos, D., Speck, P. & Montgnni, C. (215). Antivirl immunity in mrine molluscs. J Gen Virol 96, Green, T. J., Rollnd, J.-L., Vergnes, A., Rftos, D. & Montgnni, C. (215b). OsHV-1 countermesures to the Pcific oyster s nti-virl response. Fish Shellfish Immunol 47, He, Y., Jouux, A., Ford, S. E., Lelong, C., Sourdine, P., Mthieu, M. & Guo, X. (215). Trnscriptome nlysis revels strong nd complex ntivirl response in mollusc. Fish Shellfish Immunol 46, Helbig, K. J. & Berd, M. R. (214). The role of viperin in the innte ntivirl response. J Mol Biol 426, Helbig, K. J., Lu, D. T., Semendric, L., Hrley, H. A. & Berd, M. R. (25). Anlysis of ISG expression in chronic heptitis C identifies viperin s potentil ntivirl effector. Heptology 42, Helbig, K. J., Eyre, N. S., Yip, E., Nryn, S., Li, K., Fiches, G., McCrtney, E. M., Jngr, R. K., Lemon, S. M. & Berd, M. R. (211). The ntivirl protein viperin inhibits heptitis C virus repliction vi interction with nonstructurl protein 5A. Heptology 54, Helbig, K. J., Crr, J. M., Clvert, J. K., Wti, S., Clrke, J. N., Eyre, N. S., Nryn, S. K., Fiches, G. N., McCrtney, E. M. & Berd, M. R. (213). Viperin is induced following dengue virus type-2 (DENV-2) infection nd hs nti-virl ctions requiring the C-terminl end of viperin. PLoS Negl Trop Dis 7, e2178. Hinson, E. R. & Cresswell, P. (29). The ntivirl protein, viperin, loclizes to lipid droplets vi its N-terminl mphipthic -helix. Proc Ntl Acd Sci U S A 16, Hinson, E. R. & Cresswell, P. (29b). The N-terminl mphipthic -helix of viperin medites locliztion to the cytosolic fce of the endoplsmic reticulum nd inhibits protein secretion. J Biol Chem 284, Hung, Z.-J., Kng, S.-T., Leu, J.-H. & Chen, L.-L. (213). Endocytic pthwy is indicted for white spot syndrome virus (WSSV) entry in shrimp. Fish Shellfish Immunol 35, Lngevin, C., Aleksejev, E., Pssoni, G., Plh, N., Levrud, J.-P. & Boudinot, P. (213). The ntivirl innte immune response in fish: evolution nd conservtion of the IFN system. J Mol Biol 425, Lei, M., Liu, H., Liu, S., Zhng, Y. & Zhng, S. (215). Identifiction nd functionl chrcteriztion of viperin of mphioxus jponicum: implictions for ncient origin of viperin-medited ntivirl response. Dev Comp Immunol 53, Journl of Generl Virology 96
11 Oyster viperin hs direct ntivirl ctivity Loker, E. S., Adem, C. M., Zhng, S.-M. & Kepler, T. B. (24). Invertebrte immune systems not homogeneous, not simple, not well understood. Immunol Rev 198, Mttijssen, S. & Pruijn, G. J. M. (212). Viperin, key plyer in the ntivirl response. Microbes Infect 14, Milic, N. L., Dvis, S., Crr, J. M., Isberg, S., Berd, M. R. & Helbig, K. J. (215). Sequence nlysis nd chrcteristion of virlly induced viperin in the sltwter crocodile (Crocodylus porosus). Dev Comp Immunol 51, Morg, B., Arzul, I., Fury, N., Segrr, A., Chollet, B. & Renult, T. (211). Moleculr responses of Ostre edulis hemocytes to n in vitro infection with Bonmi ostree. Dev Comp Immunol 35, Nsr, N., Mddocks, S., Turville, S. G., Hrmn, A. N., Woolger, N., Helbig, K. J., Wilkinson, J., Bye, C. R., Wright, T. K. & other uthors (212). HIV-1 infection of humn mcrophges directly induces viperin which inhibits virl production. Blood 12, Oritni, K., Hirot, S., Nkgw, T., Tkhshi, I., Kwmoto, S., Ymd, M., Ishid, N., Kdoy, T., Tomiym, Y. & other uthors (23). T lymphocytes constitutively produce n interferonlike cytokine limitin chrcterized s het- nd cid-stble nd heprin-binding glycoprotein. Blood 11, Prton, R. G. & Simons, K. (27). The multiple fces of cveole. Nt Rev Mol Cell Biol 8, Pul-Pont, I., Evns, O., Dhnd, N. K., Rubio, A., Cod, P. & Whittington, R. (214). Descriptive epidemiology of mss mortlity due to Ostreid herpesvirus-1 (OsHV-1) in commercilly frmed Pcific oysters () in the Hwkesbury River estury. Aust Aqucult , Peeler, E. J., Reese, R. A., Cheslett, D. L., Geoghegn, F., Power, A. & Thrush, M. A. (212). Investigtion of mortlity in Pcific oysters ssocited with Ostreid herpesvirus-1 mvr in the Republic of Irelnd in 29. Prev Vet Med 15, Rndll, R. E. & Goodbourn, S. (28). Interferons nd viruses: n interply between induction, signlling, ntivirl responses nd virus countermesures. J Gen Virol 89, Renult, T., Fury, N., Brbos-Solomieu, V. & Moreu, K. (211). Suppression substrctive hybridistion (SSH) nd rel time PCR revel differentil gene expression in the Pcific cupped oyster,, chllenged with Ostreid herpesvirus 1. Dev Comp Immunol 35, Renult, T., Tchleu, G., Fury, N., Moreu, P., Segrr, A., Brbos- Solomieu, V. & Lpegue, S. (214). Genotyping of microstellite locus to differentite clinicl Ostreid herpesvirus 1 specimens. Vet Res 45, 3. Roblino, J., Browdy, C. L., Prior, S., Metz, A., Prnell, P., Gross, P. & Wrr, G. (24). Induction of ntivirl immunity by double-strnded RNA in mrine invertebrte. J Virol 78, Roblino, J., Brtlett, T., Sheprd, E., Prior, S., Jrmillo, G., Scur, E., Chpmn, R. W., Gross, P. S., Browdy, C. L. & Wrr, G. W. (25). Double-strnded RNA induces sequence-specific ntivirl silencing in ddition to nonspecific immunity in mrine shrimp: convergence of RNA interference nd innte immunity in the invertebrte ntivirl response? J Virol 79, Robertsen, B. (26). The interferon system of teleost fish. Fish Shellfish Immunol 2, Rosni, U., Vrotto, L., Domeneghetti, S., Arcngeli, G., Pllvicini, A. & Venier, P. (214). Dul nlysis of host nd pthogen trnscriptomes in ostreid herpesvirus 1-positive. Environ Microbiol, [Epub hed of print]. Schoggins, J. W. & Rice, C. M. (211). Interferon-stimulted genes nd their ntivirl effector functions. Curr Opin Virol 1, Segrr, A., Pépin, J. F., Arzul, I., Morg, B., Fury, N. & Renult, T. (21). Detection nd description of prticulr Ostreid herpesvirus 1 genotype ssocited with mssive mortlity outbreks of Pcific oysters,, in Frnce in 28. Virus Res 153, Segrr, A., Fury, N., Pépin, J.-F. & Renult, T. (214). Trnscriptomic study of 39 ostreid herpesvirus 1 genes during n experimentl infection. J Invertebr Pthol 119, Segrr, A., Muduit, F., Fury, N., Trncrt, S., Dégremont, L., Tourbiez, D., Hffner, P., Brbos-Solomieu, V., Pépin, J.-F. & other uthors (214b). Dul trnscriptomics of virus-host interctions: compring two Pcific oyster fmilies presenting contrsted susceptibility to ostreid herpesvirus 1. BMC Genomics 15, Seo, J.-Y., Ynev, R., Hinson, E. R. & Cresswell, P. (211). Humn cytomeglovirus directly induces the ntivirl protein viperin to enhnce infectivity. Science 332, Shen, G., Wng, K., Wng, S., Ci, M., Li, M.-L. & Zheng, C. (214). Herpes simplex virus 1 countercts viperin vi its virion host shutoff protein UL41. J Virol 88, Smith, A. E. & Helenius, A. (24). How viruses enter niml cells. Science 34, Tkok, A., Mitni, Y., Suemori, H., Sto, M., Yokochi, T., Noguchi, S., Tnk, N. & Tniguchi, T. (2). Cross tlk between interferon-c nd -/b signling components in cveolr membrne domins. Science 288, Teng, T. S., Foo, S. S., Simmrt, D., Lum, F. M., Teo, T. H., Lull, A., Yeo, N. K., Koh, E. G., Chow, A. & other uthors (212). Viperin restricts chikunguny virus repliction nd pthology. J Clin Invest 122, Wng, X., Hinson, E. R. & Cresswell, P. (27). The interferoninducible protein viperin inhibits influenz virus relese by perturbing lipid rfts. Cell Host Microbe 2, Wng, B., Zhng, Y.-B., Liu, T.-K. & Gui, J.-F. (214). Sequence nlysis nd subcellulr locliztion of crucin crp Crssius urtus viperin. Fish Shellfish Immunol 39, Wng, B., Zhng, Y.-B., Liu, T.-K., Shi, J., Sun, F. & Gui, J.-F. (214b). Fish viperin exerts conserved ntivirl function through RLRtriggered IFN signling pthwy. Dev Comp Immunol 47, Wng, P.-H., Weng, S.-P. & He, J.-G. (215). Nucleic cid-induced ntivirl immunity in invertebrtes: n evolutionry perspective. Dev Comp Immunol 48, White, D. W., Suznne Berd, R. & Brton, E. S. (212). Immune modultion during ltent herpesvirus infection. Immunol Rev 245, Yoshino, T. P., Bickhm, U. & Byne, C. J. (213). Molluscn cells in culture: primry cell cultures nd cell lines. Cn J Zool 91, Zhng, B.-C., Zhng, J., Xio, Z.-Z. & Sun, L. (214). Rock brem (Oplegnthus fscitus) viperin is virus-responsive protein tht modultes innte immunity nd promotes resistnce ginst meglocytivirus infection. Dev Comp Immunol 45, Zhong, Z., Ji, Y., Fu, Y., Liu, B. & Zhu, Q. (215). Moleculr chrcteriztion nd expression nlysis of the duck viperin gene. Gene 57,
High Frequency of Antimicrobial Resistance in Human Fecal Flora
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Dec. 1988, p. 181-186 66-484188112181-6$2./ Copyright 1988, Americn Society for Microbiology Vol. 32, No. 12 High Frequency of Antimicrobil Resistnce in Humn Fecl
More informationLuteolysis and pregnancy outcomes after change in dose delivery of prostaglandin F2α in a 5-day timed artificial insemination program in dairy cows
Knss Agriculturl Experiment ttion Reserch Reports Volume Issue 2 Diry Reserch (94-24) Article 9 24 Luteolysis nd pregnncy outcomes fter chnge in dose delivery of prostglndin F2α in -dy timed rtificil insemintion
More informationASPECTS OF THE BREEDING BIOLOGY OF THE GENTOO PENGUIN PYGOSCELIS PAPUA AT VOLUNTEER BEACH, FALKLAND ISLANDS, 2001/02
ASPECTS OF THE BREEDING BIOLOGY OF THE GENTOO PENGUIN PYGOSCELIS PAPUA AT VOLUNTEER BEACH, FALKLAND ISLANDS, 2001/02 HELEN M. OTLEY, 1 ANDREA P. CLAUSEN, 1 DARREN J. CHRISTIE 1 & KLEMENS PÜTZ 2 1 Flklnds
More informationDragon genetics, pt. II: Monohybrid crosses
Lesson 6.4 Drgon genetics, pt. II: Monohybrid crosses Nme Dte Period Key Terms Monohybrid cross Dominnt trit Recessive trit Engge BCKGROUND: long time go, in world fr, fr wy, gret rce of beings lived on
More informationImmunostimulation Assays in Bovine Brucellosis
INFECTION AND IMMUNITY, Nov. 1978, p. 486-491 0019-9567/78/0022-0486$02.00/0 Copyright i 1978 Americn Society for Microbiology Vol. 22, No. 2 Printed in U.S.A. Brucell Antigen Preprtions for In Vitro Lymphocyte
More informationCHARACTERISTICS ASSOCIATED WITH OUT CROSSING IN A SHORT DURATION IMPROVED RICE (Oryza sativa L) VARIETY AT307
CHARACTERISTICS ASSOCIATED WITH OUT CROSSING IN A SHORT DURATION IMPROVED RICE (Oryz stiv L) VARIETY AT307 Kumr APA 1, Dhnyke Nilnthi 1 *, Phthinyke BD 2 nd Sennyke SGJN 1 1 Deprtment of Agriculturl Biology,
More informationfact sheet Stage 1: Puppy breeding & raising Puppy Breeding
fct sheet Stge 1: Puppy breeding & rising It tkes two yers nd costs more thn $35,000 to trnsform plyful puppy into responsible Guide Dog. Not ll pups re suitble for guiding people who re vision impired.
More informationBVD = Bovine Viral Diarrhea
George Perry, South Dkot Stte University 11/2/17 Influence of Modified Live Vccines on Reproductive Performnce in Beef Cttle George A. Perry, Russell F. Dly, nd Christopher C. Chse Deprtment of Animl Science
More informationImmune Responses and Efficacy After Administration of a Commercial Brucella abortus Strain RB51 Vaccine to Cattle*
Immune Responses nd Efficcy After Administrtion of Commercil Brucell bortus Strin RB51 Vccine to Cttle* Steven C. Olsen, DVM, PhD United Sttes Deprtment of Agriculture Bcteril Diseses of Livestock Reserch
More informationEfficacy of Clarithromycin for Treatment of Experimental
ANTIMICROBLAL AGENTS AND CHEMOTHERAPY, June 1993, p. 1329-1333 0066-4804/93/061329-05$02.00/0 Copyright X) 1993, Americn Society for Microbiology Vol. 37, No. 6 Efficcy of for Tretment of Experimentl Lyme
More informationAntibiotic prescribing for sore throat: a cross-sectional analysis of the ReCEnT study exploring the habits of early-career doctors in family practice
Fmily Prctice, 2016, Vol. 33, No. 3, 302 308 doi:10.1093/fmpr/cmw014 Advnce Access publiction 18 Mrch 2016 Helth Service Reserch Antibiotic prescribing for sore throt: cross-sectionl nlysis of the ReCEnT
More informationEffects of mercury exposure on the reproductive success of tree swallows (Tachycineta bicolor)
Ecotoxicology (2008) 17:133 141 DOI 10.1007/s10646-007-0163-z Effects of mercury exposure on the reproductive success of tree swllows (Tchycinet bicolor) Rebeck L. Brsso Æ Dniel A. Cristol Accepted: 20
More informationIncreasing survival of wild macaw chicks using foster parents
Gbriel Vigo Truco,b,c nd Donld J. Brightsmithbb,c Deprtment of Wildlife nd Fisheries, Texs A&M University,b Schubot Exotic Bird Helth Center, Texs A&M University, c Tmbopt Mcw Project, Mdre de Dios, Perú
More informationPLASMA CORTISOL LEVEL AND MAIN METABOLISM EVOLUTION IN PREGNANT EWE
PLASMA CORTISOL LEVEL AND MAIN METABOLISM EVOLUTION IN PREGNANT EWE N. Dojnă, Iulin Codrenu, Costin Budică Fculty of veterinry medicine Buchrest, Romni, dojn2001@yhoo.com. Abstrct The purpose of this reserch
More informationEffect of Rumensin on Health and Reproduction of Lactating Dairy Cows
Scientific Updte From Elnco Animl Helth Effect of Rumensin on Helth nd Reproduction of Lctting Diry Cows NADA 095-735 Dvid G. McClry, DVM, MS; Howrd B. Green, MS; Gerld D. Mechor, DVM; nd John I. D. Wilkinson,
More informationIsolation of Legionella longbeachae Serogroup 1 from Potting Mixes
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jn. 1990, p. 49-53 0099-2240/90/010049-05$02.00/0 Copyright C) 1990, Americn Society for Microbiology Vol. 56, No. 1 Isoltion of Legionell longbeche Serogroup 1
More informationTECHNICAL SUMMARY October 2013
TECHNICAL SUMMARY October 2013 GeneSTAR MVPs Moleculr Vlue Predictions for beef feed efficiency, 1 mrbling 2 nd tenderness Key Points GeneSTAR is DNA-mrker test for importnt production trits in ll breeds
More informationEVALUATION OF S FOR FLY (DIPTERA: MUSCIDAE) CONTROL AS A FEED-THROUGH COMPOUND FOR POULTRY, CATTLE, AND SWINE'
EVALUATION OF S-31183 FOR FLY (DIPTERA: MUSCIDAE) CONTROL AS A FEED-THROUGH COMPOUND FOR POULTRY, CATTLE, AND SWINE' R. W. Miller Livestock Insects Lbortory, LPS! ARS, USDA Beltsville, MD 275 (Accepted
More informationComparative Study on Production Efficiency of Two Strains of Brown and White Egg Laying Hens in Kuwait
Interntionl Journl of Poultry Science 12 (7): 383-389, 2013 ISSN 1682-8356 Asin Network for Scientific Informtion, 2013 Comprtive Study on Production Efficiency of Two Strins of Brown nd White Egg Lying
More informationمؤتمر الجمعية العربية لتربية النحل األول 6-5 فبراير 2018 م مركز أبوظبي الوطني للمعارض - دوله اإلمارات العربية المتحدة
The Project Objective: To develop productive, gentle honeybees with tolernce to mites nd brood diseses By: Albert J. Robertson The Ssktchewn Honeybee Breeding nd Selection Progrm 1 2 Current Honeybee Helth
More informationDifferences in peripartal plasma parameters related to calcium homeostasis of dairy sheep and goats in comparison with cows
Zurich Open Repository nd Archive University of Zurich Min Lirry Strickhofstrsse 39 CH-8057 Zurich www.zor.uzh.ch Yer: 2014 Differences in periprtl plsm prmeters relted to clcium homeostsis of diry sheep
More informationInfluence of 2-hydroxy-4-(Methylthio)butanoic Acid on Early Egg and Chick Weights of Broiler Breeders
Interntionl Journl of Poultry Science 2 (6): 430-437, 2003 Asin Network for Scientific Informtion 2003 Influence of 2-hydroxy-4-(Methylthio)utnoic Acid on Erly Egg nd Chick Weights of Broiler Breeders
More informationHow do cuckoos find their hosts? The role of habitat imprinting
ANIMAL BEHAVIOUR, 1998, 56, 1425 1433 Article No. r980931 How do cuckoos find their hosts? The role of hbitt imprinting YVONNE TEUSCHL, BARBARA TABORSKY & MICHAEL TABORSKY Konrd Lorenz-Institut für Vergleichende
More informationShell Thickness of Turkey Eggs Affects Cardiac Physiology and Embryo Survival 1
Interntionl Journl of Poultry Science 5 (8): 796-80, 2006 ISSN 682-856 Asin Network for Scientific Informtion, 2006 Shell Thickness of Turkey Eggs Affects Crdic Physiology nd Emryo Survivl 2 2 4 2 V.L.
More informationDepolarized GABAergic Signaling in Subicular Microcircuits Mediates Generalized Seizure in Temporal Lobe Epilepsy
orrections epolrized ergic Signling in Suiculr Microcircuits Medites enerlized Seizure in Temporl Loe pilepsy Yi Wng, englin Xu, Zhengho Xu, ihong Ji, Jio Ling, Ying Wng, in hen, Xiohu Wu, eng o, Shung
More informationJ. Wat. Treat. Biol. Vol.37 No.2
Direct Observtion biilm's surfce bcteril prt pcked n clerly seen B), ct section s spheres rods (Fig., frequently 10μm size. smooth boundries clumps where ded s process. A polymer drk-light res All structure
More informationAppropriateness of antimicrobial therapy: a multicentre prevalence survey in the Netherlands,
Surveillnce nd outbrek reports Appropriteness of ntimicrobil therpy: multicentre prevlence survey in the Netherlnds, 28 29 I Willemsen 1, T vn der Kooij 2, B vn Benthem 2, J Wille 3, J Kluytmns (jnkluytmns@gmil.com)
More informationA retrospective study of the causes of morbidity and mortality in farmed elk (Cervus elaphus) Murray R. Woodbury, John Berezowski, Jerry Haigh
A retrospective study of the cuses of morbidity nd mortlity in frmed elk (Cervus elphus) Murry R. Woodbury, John Berezowski, Jerry High Abstrct A survey of North Americn frmed elk (Cervus elphus) producers
More informationKNOWLEDGE, ATTITUDES AND PRACTICES ABOUT ANTIBIOTIC USE AMONG THE GENERAL PUBLIC IN MALAYSIA
KNOWLEDGE, ATTITUDES AND PRACTICES ABOUT ANTIBIOTIC USE AMONG THE GENERAL PUBLIC IN MALAYSIA Frid Islhudin, Aly Mdihh Ahmd Tmezi nd Norid Mohmed Shh Fculty of Phrmcy, Universiti Kebngsn Mlysi, Kul Lumpur,
More informationGenetic divergence of early song discrimination between two young songbird species
In the formt provided y the uthors nd unedited. Genetic divergence of erly song discrimintion etween two young songird species Dvid Whetcroft* nd Ann Qvrnström SUPPLEMENTARY INFORMATION VOLUME: 1 ARTICLE
More informationDistribution and dissemination of antimicrobial-resistant Salmonella in broiler farms with or without enrofloxacin use
Shng et l. BMC Veterinry Reserch (2018) 14:257 https://doi.org/10.1186/s12917-018-1590-1 RESEARCH ARTICLE Open Access Distribution nd dissemintion of ntimicrobil-resistnt Slmonell in broiler frms with
More informationEvaluation of the Hologic Gen-Probe PANTHER, APTIMA Combo 2 Assay in a Tertiary Care Teaching Hospital
AJCP / Originl Article Evlution of the Hologic Gen-Probe PANTHER, APTIMA Combo 2 Assy in Tertiry Cre Teching Hospitl Annie Cheng, MT, nd Jmes E. Kirby, MD From the Deprtment of Pthology, Beth Isrel Deconess
More informationTRANSMISSION. at a frequency of 0.1 Hz with rectangular pulses of 0.2 ms duration and of strength greater than that
Br. J. Phrmc. (1979), 67, 199-25 EFFECTS OF THE VENOM OF THE GREEN ngusticeps ON SKELETAL MUSCLE AND TRANSMISSION J.C. BARRETT1 & A.L. HARVEY Deprtment of Physiology nd Phrmcology, University of Strthclyde,
More informationOriginal Article. E Oz 1, *H Cetin 1, J E Cilek 2, O Deveci 3, A Yanikoglu 1
Irnin J Pul Helth, Vol. 39, No.3, 2010, Irnin pp. 102-108 J Pul Helth, Vol. 39, No.3, 2010, pp. 102-108 Originl Article Effects of Two Temperture Storge Regimes on the Efficcy of 3 Commercil Gel Bits ginst
More informationThe physiology of hibernation in common map turtles ž / Graptemys geographica
Ž. Comprtive Biochemistry nd Physiology Prt A 130 001 331340 The physiology of hierntion in common mp turtles ž / Grptemys geogrphic Scott A. Reese, Crlos E. Crocker,,c, Mry E. Crwile, Donld C. Jckson
More informationEffects of certain anthelmintics on the survival and reproduction of Euoniticellus intermedius (Reiche) (Coleoptera: Scarabaeidae)
Effects of certin nthelmintics on the survivl nd reproduction of Euoniticellus intermedius (Reiche) (Coleopter: Scrbeide) By Crmen Tin Jcobs Submitted in prtil fulfilment of the requirements for the degree
More informationA Next-generation Genetically Attenuated Plasmodium falciparum Parasite Created by Triple Gene Deletion
vccine technology originl rticle A Next-genertion Geneticlly Attenuted Plsmodium flciprum Prsite Creted by Triple Gene Deletion Sebstin A Mikoljczk 1, Viswnthn Lkshmnn 1, Mtthew Fishbugher 1, Nelly Cmrgo
More informationX-RAY Contents lists available at
ISSN 1115-7976 X-RAY Contents lists vilble t Journl of Assocition of Rdiogrphers of Nigeri Journl homepge: www.jrn-xry.org Vol. 26 X-ry Equipments nd Accessories s possible Vectors of Nosocomil Bcteri
More informationA Model for Promoting Poultry Industry Development in Togo: Part 1. Management Practices and Incubation Conditions
Interntionl Journl of Poultry Science 13 (3): 176-184, 2014 ISSN 1682-8356 Asin Network for Scientific Informtion, 2014 A Model for Promoting Poultry Industry Development in Togo: Prt 1. Mngement Prctices
More informationA comparison of the effects of midazolam, propofol and dexmedetomidine on the antioxidant system: A randomized trial
EXPERIMENTAL AND THERAPEUTIC MEDICINE 9: 2293-2298, 2015 A comprison of the effects of midzolm, propofol nd dexmedetomidine on the ntioxidnt system: A rndomized tril CHAO HAN 1*, WEILIANG DING 2*, WENJIE
More informationTowards a better understanding of the respective effects of milk yield and body condition dynamics on reproduction in Holstein dairy cows
Animl (2012), 6:3, pp 476 487 & The Animl Consortium 2011 doi:10.1017/s175173111100173x niml Towrds etter understnding of the respective effects of milk yield nd ody condition dynmics on reproduction in
More informationIntroduction: Definition of Palatability
Mesurement of pltility of common ingredients used in feed mixes for lms nd ewes A. Mereu,, G. Molle, V. Giovnetti, M. Acciro, M. Decndi, A. Cnns Diprtimento di Scienze Zootecniche, Università di Sssri,
More informationEffects of Management of Domestic Dogs and Recreation on Carnivores in Protected Areas in Northern California
Contriuted Pper Effects of Mngement of Domestic Dogs nd Recretion on Crnivores in Protected Ares in Northern Cliforni SARAH E. REED AND ADINA M. MERENLENDER Deprtment of Environmentl Science, Policy &
More informationPROVISIONAL INSTITUTIONS OF SELF GOVERNMENT THE VETERINARY LAW
UNITED NATIONS United Ntions Interim Administrtion Mission in Kosovo UNMIK NATIONS UNIES Mission d Administrtion Intérimire des Ntions Unies u Kosovo PROVISIONAL INSTITUTIONS OF SELF GOVERNMENT Lw No.2004/21
More informationExperimental examination of behavioural interactions between free-ranging wild and domestic canids
Behv Ecol Sociobiol (2009) 64:279 287 DOI 10.1007/s00265-009-0845-z ORIGINAL PAPER Experimentl exmintion of behviourl interctions between free-rnging wild nd domestic cnids Abi Tmim Vnk & Mri Thker & Mtthew
More informationMaterials and method Animals and blood samples
Originl Reserch 1 / 12 Veterinri OA México Publicción Digitl de l Fcultd de Medicin Veterinri y Zootecni o http://www.revists.unm.mx/index.php/veterinri-mexico Effect of prostglndin F2α dministrtion during
More informationGROWTH PERFORMANCE, CARCASS TRAITS AND ECONOMIC VALUES OF PEKIN, MUSCOVY, AND MULARD DUCKS
Slov Vet Res 2018; 55 (Suppl 20): 357 65 DOI 10.26873/SVR-663-2018 Originl Reserch Article GROWTH PERFORMANCE, CARCASS TRAITS AND ECONOMIC VALUES OF PEKIN, MUSCOVY, AND MULARD DUCKS Frdos A.M. Hssn, Elshim
More informationKnowledge, attitude and practice of antibiotics prescribing among medical officers of public health care facilities in the state of Kedah, Malaysia
ORIGINAL ARTICLE Knowledge, ttitude nd prctice of ntibiotics prescribing mong medicl officers of public helth cre fcilities in the stte of Kedh, Mlysi Tn Wei Leong, MD*, Siti Rhmh@Noor Syhireen Mohmmed,
More informationBand-tailed Pigeon Population Status, 2010
University of Nebrsk - Lincoln DigitlCommons@University of Nebrsk - Lincoln US Fish & Wildlife Publictions US Fish & Wildlife Service 2010 Bnd-tiled Pigeon Popultion Sttus, 2010 Todd A. Snders U.S. Fish
More informationAn Integrated Population Pharmacokinetic Meta-Analysis of Propofol in Morbidly Obese and Nonobese Adults, Adolescents, and Children
Originl Article Cittion: CPT: Phrmcometrics & Systems Phrmcology (13), e73; doi:1.138/psp.13.7 13 ASCPT All rights reserved 163-836/1 www.nture.com/psp An Integrted Popultion Phrmcokinetic Met-Anlysis
More informationIndications for penetrating keratoplasty in the Philippines
VOL. 30 NO. 4 PHILIPPINE JOURNAL OF Ophthlmology OCTOBER ORIGINAL ARTICLE - DECEMBER 2005 M. Doming B. Pdill, MD Mrie Antonette T. Eltnl-Pscul, MD Snt Luci Interntionl Eye Bnk of Mnil Sentro Oftlmologico
More informationGenetic Variability of mtdna Sequences in Chinese Native Chicken Breeds
903 Genetic Vribility of mtdna Sequences in Chinese Ntive Chicken Breeds Z. G. Liu*, C. Z. Lei 1, J. Luo 1, C. Ding, G. H. Chen 2, H. Chng 2, K. H. Wng, X. X. Liu, X. Y. Zhng X. J. Xio 2 nd S. L. Wu 2
More informationEfficacy of noviflumuron gel bait for control of the German cockroach, Blattella germanica (Dictyoptera: Blattellidae) laboratory studies
Pest Mngement Science Pest Mng Sci 62:434 439 (2006) Efficcy of noviflumuron gel it for control of the Germn cockroch, Blttell germnic (Dictyopter: Blttellide) lortory studies Chnglu Wng nd Gry W Bennett
More informationSilent tidbitting in male fowl, Gallus gallus: a referential visual signal with multiple functions
835 The Journl of Experimentl Biology 212, 835-842 Published by The Compny of Biologists 2009 doi:10.1242/jeb.023572 Silent tidbitting in mle fowl, Gllus gllus: referentil visul signl with multiple functions
More informationCHARACTERISTICS ASSOCIATED WITH OUT CROSSING IN A SHORT DURATION IMPROVED RICE (Oryza sativa L) VARIETY AT307
CHARACTERISTICS ASSOCIATED WITH OUT CROSSING IN A SHORT DURATION IMPROVED RICE (Oryz stiv L) VARIETY AT37 Kumr APA 1, Dhnyke Nilnthi 1 *, Phthinyke BD 2 n Sennyke SGJN 1 1 Deprtment of Agriculturl Biology,
More informationSedation in the PICU is vital for patient comfort and to
Long-Term Dexmedetomidine Use nd Sfety Profile Among Criticlly Ill Children nd Neontes* Lest D. Whlen, MD; Jne L. Di Gennro, MD; Gretchen A. Irby, PhrmD; Ofer Yny, MD; Jerry J. Zimmermn, MD, PhD, FCCM
More informationEFFECT OF DEXAMETHASONE ON THE CHANGES OF SEMEN QUALITY INDUCED BY ENDOTOXIN IN STALLION
Bull Vet Inst Pulwy 5, 581-589, 8 FFCT OF DXAMTHASON ON TH CHANGS OF SMN QUALITY INDUCD BY NDOTOXIN IN STALLION JANUSZ DANK Deprtment of Animl Reproduction nd Animl Helth Protection, University of Technology
More informationResearch Article Neuroprotective Effects of Meloxicam and Selegiline in Scopolamine-Induced Cognitive Impairment and Oxidative Stress
Hindwi Publishing Corportion Interntionl Journl of Alzheimer s Disese Volume 212, Article ID 97413, 8 pges doi:1.1155/212/97413 Reserch Article Neuroprotective Effects of Meloxicm nd in Scopolmine-Induced
More informationThe Anatomy of Sea Turtles
Close this window to return to the previous pge or go to www.ivis.org The Antomy of Se Turtles Jenette Wyneken, Ph.D. Illustrted y Dwn Witherington Close this window to return to the previous pge or go
More informationSynergistic effect of rhein in combination with ampicillin or oxacillin against methicillin-resistant Staphylococcus aureus
608 Synergistic effect of rhein in combintion with mpicillin or oxcillin ginst methicillin-resistnt Stphylococcus ureus DAE-KI JOUNG 1, HEE JOUNG 1, DA-WUN YANG 1, DONG-YEUL KWON 2, JANG-GI CHOI 2, SEO
More informationHaematological and Biochemical Changes in Japanese Quails Coturnix coturnix Japonica and Chickens Due to Ascaridia galli Infection
Interntionl Journl of Poultry Science 7 (7): 704-70, 2008 ISSN 682-8356 Asin Network for Scientific Informtion, 2008 Hemtologicl nd Biochemicl Chnges in Jpnese Quils Coturnix coturnix Jponic nd Chickens
More informationContinuous Subcutaneous Infusion of Morphine vs. Hydromorphone: A Controlled Trial
Vol. 18 No. 1 July 1999 Journl of Pin nd Symptom Mngement 9 Originl Article Continuous Subcutneous Infusion of Morphine vs. Hydromorphone: A Controlled Tril Mry G. Miller, MB, MRCP (Irelnd), Noel McCrthy,
More informationCurrent Canine Guidelines for the. Prevention, Diagnosis, and Management of Heartworm (Dirofilaria immitis) Infection in Dogs
Current Cnine Guidelines for the Prevention, Dignosis, nd Mngement of Hertworm (Dirofilri immitis) Infection in Dogs Thnk You to Our Generous Sponsors: Printed with n Eduction Grnt from IDEXX Lbortories.
More informationToxicity interaction of fipronil and imidacloprid against Coptotermes formasanus
Louisin Stte University LSU Digitl Commons LSU Mster's Theses Grdute School 2010 Toxicity interction of fipronil nd imidcloprid ginst Coptotermes formsnus Pn Luo Louisin Stte University nd Agriculturl
More informationThere are important differences between blood transfusions
Revised My 2012 1 CE Credit Idiosyncrsies in Feline Blood Trnsfusions DeeDee Schumcher, CVT, VTS (ECC), MEd Des Moines Are Community College Ankeny, Iow There re importnt differences between blood trnsfusions
More informationDevelopment of an Assay for Besylate in Amlodipine Besylate by IC and a Second Assay to Simultaneously Determine Amlodipine and Besylate by HPLC
Development of n Assy for in Amlodipine y IC nd Second Assy to Simultneously Determine Amlodipine nd y HPLC Brin De Bor nd Jeffrey Rohrer, Thermo Fisher Scientific, Sunnyvle, CA, USA Overview Purpose:
More informationMycobacterium paratuberculosis Cultured from Milk and
JOURNAL OF CLINICAL MICROBIOLOGY, Jn. 1992, p. 6-171 95-1137/92/16-6$2./ Copyright C 1992, Americn Society for Microbiology Vol. 3, No. 1 Mycobcterium prtuberculosis Cultured from Milk nd Suprmmmry Lymph
More informationARTICLE IN PRESS. Ecological Indicators xxx (2011) xxx xxx. Contents lists available at ScienceDirect. Ecological Indicators
ECOIND-918; No. of Pges 1 Ecologicl Indictors xxx (211) xxx xxx Contents lists ville t ScienceDirect Ecologicl Indictors jo ur nl homep ge: www.elsevier.com/locte/ecolind Opertionl performnce indictors
More informationSo much more than friendship
So much more thn friendship How to include Assistnce Dogs Austrli in your Will, nd build brighter future filled with love, friendship nd greter freedom for people with disbilities. By leving gift in your
More informationESTIMATION OF (CO) VARIANCE COMPONENTS OF EWE PRODUCTIVITY TRAITS IN KERMANI SHEEP
Slovk J. Anim. Sci., 46, 2013 (2): 45-51 2013 CVŽV ISSN 1337-9984 ESTIMATION OF (CO) VARIANCE COMPONENTS OF EWE PRODUCTIVITY TRAITS IN KERMANI SHEEP M. R. MOHAMMADABADI*, R. SATTAYIMOKHTARI Deprtment of
More informationResearch Article Interspecific Variation in Temperature Effects on Embryonic Metabolism and Development in Turtles
Interntionl Scholrly Reserch Network ISRN Zoology Volume 212, Article ID 846136, 13 pges doi:1.542/212/846136 Reserch Article Interspecific Vrition in Temperture Effects on Emryonic Metolism nd Development
More informationIMPACT OF OIL-SANDS BASED WETLANDS ON THE GROWTH OF MALLARD (ANAS PLATYRHYNCHOS) DUCKLINGS
Environmentl Toxicology nd Chemistry, Vol. 2, No. 2, pp. 7 3, 200 200 SETAC Printed in the USA 0730-728/0 $12.00.00 IMPACT OF OIL-SANDS BASED WETLANDS ON THE GROWTH OF MALLARD (ANAS PLATYRHYNCHOS) DUCKLINGS
More informationFilmArray Blood Culture Identification Panel Quick Guide
FilmArry Pnel FilmArry Blood Culture Identifiction Pnel Quick Guide Testing on the FilmArry should be performed within 8 hours of the positive reding from continuously monitoring blood culture instrument.
More informationMERCURY EXPOSURE AFFECTS THE REPRODUCTIVE SUCCESS OF A FREE-LIVING TERRESTRIAL SONGBIRD, THE CAROLINA WREN (THRYOTHORUS LUDOVICIANUS)
The Auk 128(4):759 769, 2011 The Americn Ornithologists Union, 2011. Printed in USA. MERCURY EXPOSURE AFFECTS THE REPRODUCTIVE SUCCESS OF A FREE-LIVING TERRESTRIAL SONGBIRD, THE CAROLINA WREN (THRYOTHORUS
More informationA Study on Morbidity Management among Lymphatic Filariasis Patients in Udupi district, Karnataka, India
Int J Med. Public Helth. 2017; 7(2):91-95 A Multifceted Peer Reviewed Journl in the field of Medicine nd Public Helth www.ijmedph.org www.journlonweb.com/ijmedph Originl Article A Study on Morbidity Mngement
More informationPrevalence and Antimicrobial Resistance of Enterococcus Species Isolated from Retail Meats
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2003, p. 7153 7160 Vol. 69, No. 12 0099-2240/03/$08.00 0 DOI: 10.1128/AEM.69.12.7153 7160.2003 Prevlence nd Antimicrobil Resistnce of Enterococcus Species Isolted
More informationSELECTED LIFE HISTORY ASPECTS AND HABITAT USE BY MERRIAM'S WILD TURKEYS IN OREGON
SELECTED LIFE HISTORY ASPECTS AND HABITAT USE BY MERRIAM'S WILD TURKEYS IN OREGON by Robert Scott Lutz A THESIS submitted to Oregon Stte University in prtil fulfillment of the requirements for the degree
More informationRobert H. Six 1*, William R. Everett 2, Melanie R. Myers 1 and Sean P. Mahabir 1
Six et l. Prsites & Vectors (2016) 9:93 DOI 10.1186/s13071-016-1374-z RESEARCH Comprtive speed of kill of srolner (Simpric ) nd spinosd plus milbemycin oxime (Trifexis ) ginst induced infesttions of Ctenocephlides
More informationEffect of Rearing Program, Body Conformation and Protein Level of Breeder Feed on Broiler Breeder Hen Reproductive Performance
Interntionl Journl of Poultry Science (): 670-679, 0 ISSN 68-856 Asin Network for Scientific Informtion, 0 Effect of Rering Progrm, Body Conformtion nd Protein Level of Breeder Feed on Broiler Breeder
More informationComparative Studies on the Prevalence of Ixodid Ticks on Some Selected Sedentary Farms and Trade Cattle in Adamawa State, Nigeria
Interntionl Journl of Scientific nd Reserch Publictions, Volume 7, Issue 9, September 2017 505 Comprtive Studies on the Prevlence of Ixodid Ticks on Some Selected Sedentry Frms nd Trde Cttle in Admw Stte,
More informationPostantibiotic Sub-MIC Effects of Vancomycin, Roxithromycin, Sparfloxacin, and Amikacin
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Sept. 1992, p. 1852-1858 0066-4804/92/091852-07$02.00/0 Copyright X) 1992, Americn Society for Microiology Vol. 36, No. 9 Postntiiotic Su-MIC Effects of Vncomycin,
More informationINCUBATION BEHAVIOR AND BODY MASS OF FEMALE GREATER SNOW GEESE
The Condor 97:993-1001 0 The Cooper Ornithologicl Society 1995 INCUBATION BEHAVIOR AND BODY MASS OF FEMALE GREATER SNOW GEESE AUSTIN REED Cndin Wildlife Service, 1141 Route de I Eglise, Ste-Foy, Quebec,
More informationResurgence of leptospirosis in dogs in Ontario: recent findings
ARTICLE Resurgence of leptospirosis in dogs in Ontrio: recent findings John F. Prescott, Beverly McEwen, Judith Tylor, J. Pul Woods, Anthony Abrms-Ogg, Brin Wilcock Abstrct A mrked increse in leptospirosis
More informationBIOLOGICAL CONTROL OF HAEMONCHUS CONTORTUS BY FUNGAL ANTAGONISTS IN SMALL RUMINANTS
Khttk et l.: Biologicl control of Hemonchus contortus by fungl ntgonists in smll ruminnts - 5825 - BIOLOGICAL CONTROL OF HAEMONCHUS CONTORTUS BY FUNGAL ANTAGONISTS IN SMALL RUMINANTS KHATTAK, B. 1* SAFI,
More informationUse of episcleral cyclosporine implants in dogs with keratoconjunctivitis sicca: pilot study
Veterinry Ophthlmology (2015) 18, 3, 234 241 DOI:10.1111/vop.12173 Use of episclerl cyclosporine implnts in dogs with kertoconjunctivitis sicc: pilot study Lur rchetti,* ntonell Rmpzzo, Crlo M. Mortellro,*
More informationGrzegorz GOSIEWSKI, Miroslawa SOKOLOWSKA-MIKOLAJCZYK, Jaroslaw CHYB, and Magdalena SOCHA
PL-ISSN 0015-5497 (print), ISSN 1734-9168 (online) Foli iologic (Krków), vol. 63 (2015), No 1 Institute of Systemtics nd Evolution of nimls, PS, Krków, 2015 doi:10.3409/f63_1.25 Preliminry Results Concerning
More informationComputer literature searches on dengue
Computer literture serches on dengue G. Kuno1 Mny reserch workers, to sve time, rely entirely on either on-line or off-line dtbses offered by n incresing number of informtion services. The chrcteristics
More informationEffects of season on plasma progesterone profiles in repeat breeding cows
Veterinrni Medicin, 60, 2015 (5): 227 234 Originl Pper Effects of seson on plsm progesterone profiles in repet reeding cows M.E. Ghnem 1, M. Nishiori 2 1 Fculty of Veterinry Medicine, Suez Cnl University,
More informationEFFECTS OF SODIUM AND MAGNESIUM SULFATE IN DRINKING WATER ON MALLARD DUCKLINGS
EFFETS OF SODIUM AND MAGNESIUM SULFATE IN DRINKING WATER ON MALLARD DUKLINGS Authors: S. A. Mitchm, nd G. Wobeser Source: Journl of Wildlife Diseses, 24(1) : 3044 Published By: Wildlife Disese Assocition
More informationEffects of litter quality and climate change along an elevation gradient on litter mass loss in an alpine meadow ecosystem on the Tibetan plateau
Plnt Ecol (21) 29:257 268 DOI 1.17/s11258-9-9714- Effects of litter qulity nd climte chnge long n elevtion grdient on litter mss loss in n lpine medow ecosystem on the Tietn plteu Gungping Xu Yigng Hu
More informationSources of contamination, prevalence, and antimicrobial resistance of thermophilic Campylobacter isolated from turkeys
Veterinry World, EISSN: 2231-0916 RESEARCH ARTICLE Open Access Sources of contmintion, prevlence, nd ntimicrobil resistnce of thermophilic Cmpylobcter isolted from turkeys Rdi Bouhmed 1, Leil Bouyd 1,
More informationSubcellular Vaccine Containing the Major Outer Membrane Protein
INFECTION AND IMMUNITY, Sept. 1990, p. 3101-3108 0019-9567/90/093101-08$02.00/0 Copyright X) 1990, Americn Society for Microbiology Vol. 58, No. 9 Protection of Sheep ginst Chlmydi psittci Infection with
More informationStudy of antibiotic prescribing among dental practitioners in Shiraz, Islamic Republic of Iran
Study of ntibiotic prescribing mong dentl prctitioners in Shirz, Islmic Republic of Irn G. Vessl, 1 A. Khbiri, 2 H. Mirkhni, 3 B.D. Cookson 4 nd M. Askrin 2 دراسة حول وصف املضادات احليوية بني أطباء األسنان
More informationFungi participate in driving home-field advantage of litter decomposition in a subtropical forest
https://doi.org/1.17/s1114-18-3865-5 REGULAR ARTICLE Fungi prticipte in driving home-field dvntge of litter decomposition in subtropicl forest Dunmei Lin & Mei Png & Nicols Fnin & Hongjun Wng & Shenhu
More informationCause-specific temporal and spatial trends in green sea turtle strandings in the Hawaiian Archipelago ( )
Mr Biol (2008) 154:887 898 DOI 10.1007/s00227-008-0981-4 ORIGINAL PAPER Cuse-specific temporl nd sptil trends in green se turtle strndings in the Hwiin Archipelgo (1982 2003) Milni Chloupk Æ Thierry M.
More informationISSN: Isolation of High Antibiotic Resistant Fecal Bacteria Indicators, Salmonella and Vibrio Species from Raw
ISSN: 2276-7762 Isoltion of High Antibiotic Resistnt Fecl Bcteri Indictors, Slmonell nd Vibrio Species from Rw Abttoirs Sewge in Peri- Urbn Loctions of Nirobi, Keny By Nymboy Rosemry Atieno Okemo Pul Owuor
More informationAre stray dogs confined in animal shelters at increased risk of seropositivity to Leishmania infantum? A case control study
12 SARIDOMICHELAKIS (M.N.) AND COLLABORATORS Are stry dogs confined in niml shelters t incresed risk of seropositivity to Leishmni infntum? A cse control study M.N. SARIDOMICHELAKIS 1 *, K.N. APOSTOLIDIS
More informationAgreed by the Antimicrobial Advice ad hoc Expert Group (AMEG) 2 May Adopted by the CVMP for release for consultation 19 May 2016
27 July 2016 EMA/CVMP/CHMP/231573/2016 Committee for Medicinl Products for Veterinry use (CVMP) Committee for Medicinl Products for Humn Use (CHMP) Updted dvice on the use of colistin products in nimls
More informationComparisons of antifeedancy and spatial repellency of three natural product repellents agains horn flies
United Sttes Deprtment of Agriculture From the SelectedWorks of Dvid B Tylor 14 Comprisons of ntifeedncy nd sptil repellency of three nturl product repellents gins horn flies Junwei J. Zhu, USDA-ARS Agroecosystem
More informationet.al.2002;sartori et.al.2001 Finisher Gonzales et.al.(2000) adlibitum Dry matter
5 6 Suget et.l. Sleh et.l,6 Leeson Zuir Gonzles et.l.(000) Tumov et.l.00;srtori et.l.00 Finisher Brto 6 Dgs& Bustri, Bene et.l. 00 Hood C : P 6 6 C : P 5 6 6 dliitum 6 5 6 Dry mtter 5 Orgnic mtter A.O.A.C
More information