Modelling Aspergillus fumigatus infections in racing pigeons (Columba livia domestica)
|
|
- Kerry Perkins
- 5 years ago
- Views:
Transcription
1 Modelling Aspergillus fumigtus infections in rcing pigeons (Columb livi domestic) Lies Angèle Beernert, Frnk Psmns, Freddy Hesebrouck, An Mrtel To cite this version: Lies Angèle Beernert, Frnk Psmns, Freddy Hesebrouck, An Mrtel. Modelling Aspergillus fumigtus infections in rcing pigeons (Columb livi domestic). Avin Pthology, Tylor Frncis, 2008, 37 (05), pp < / >. <hl > HAL Id: hl Submitted on 26 Nov 2010 HAL is multi-disciplinry open ccess rchive for the deposit nd dissemintion of scientific reserch documents, whether they re published or not. The documents my come from teching nd reserch institutions in Frnce or brod, or from public or privte reserch centers. L rchive ouverte pluridisciplinire HAL, est destinée u dépôt et à l diffusion de documents scientifiques de niveu recherche, publiés ou non, émnnt des étblissements d enseignement et de recherche frnçis ou étrngers, des lbortoires publics ou privés.
2 Avin Pthology Modelling Aspergillus fumigtus infections in rcing pigeons (Columb livi domestic) Journl: Avin Pthology Mnuscript ID: CAVP R1 Mnuscript Type: Review Dte Submitted by the Author: 22-Jul-2008 Complete List of Authors: Beernert, Lies; Fculty of Veterinry Medicine, Ghent University, Deprtment of Pthology, Bcteriology nd Avin Diseses Psmns, Frnk; Fculty of Veterinry Medicine, Ghent University, Deprtment of Pthology, Bcteriology nd Avin Diseses Hesebrouck, Freddy; Fculty of Veterinry Medicine, Ghent University, Deprtment of Pthology, Bcteriology nd Avin Diseses Mrtel, An; Fculty of Veterinry Medicine, Ghent University, Deprtment of Pthology, Bcteriology nd Avin Diseses Keywords: Aspergillus fumigtus, mycology, pigeon, experimentl spergillosis E-mil: URL:
3 Pge 1 of 19 Avin Pthology Cvp R1 Modelling Aspergillus fumigtus infections in rcing pigeons (columb livi domestic) L. A. Beernert 1*, F. Psmns 1, F. Hesebrouck 1, A. Mrtel 1 1 The Deprtment of Pthology, Bcteriology nd Avin Diseses, Fculty of Veterinry Medicine, Ghent University, Slisburyln 133, 9820 Merelbeke. Short Title: Aspergillus fumigtus infections in rcing pigeons To whom correspondence should be ddressed. Tel: Fx: E- mil: lies.beernert@ugent.be Received: 16 April 2008 E-mil: cvngh@metronet.co.uk URL: 1
4 Avin Pthology Pge 2 of 19 Abstrct In vivo modelling of spergillosis in birds llows the evlution of control mesures nd the study of host-pthogen interctions. In this study the impct of the use of different inocultion routes nd immunosuppression on the course of n infection with Aspergillus fumigtus in rcing pigeons (Columb livi domestic) ws exmined. A. fumigtus conidi were inoculted in the thorcic ir sc, lung or trche in immunocompetent or immunosuppressed pigeon squbs. Immunosuppression ws induced by three dexmethsone injections before inocultion. Mortlity in the A. fumigtus inoculted groups vried between 1/4 to 4/4. The highest nd more cute mortlity ws seen in immunocompetent pigeons inoculted in the thorcic ir sc nd in pigeons inoculted in the thorcic ir sc or lung fter immunosuppression. Pigeons inoculted in the lung or inoculted intrtrchelly fter immunosuppression developed n spergillosis infection with slower course of disese nd more prominent clinicl symptoms. Using Microstellite Length Polymorphism it ws confirmed tht ll mycoses were cused by the inoculted strin except for one isolte in dexmethsone-treted pigeon. In conclusion, inocultion in the lung is selected s the preferred model for chronic spergillosis in pigeons nd inocultion in the thorcic ir sc s the one for cute spergillosis. The use of immunosuppressed birds seems to be contr-indicted due to the risk of opportunistic infections. E-mil: cvngh@metronet.co.uk URL: 2
5 Pge 3 of 19 Avin Pthology Introduction Avin spergillosis is n infectious nd noncontgious disese cused by Aspergillus spp. These fungi re ubiquitous nd cn be isolted from soil, ir nd vegettion. The most commonly isolted species is Aspergillus fumigtus but other Aspergillus spp. including A. flvus, A. niger, A. glucus nd A. nidulns cn lso ply role (Okoye nd Okeke, 1986; Brton et l., 1992; Perelmn nd Kuttin, 1992; de Wit et l., 1993; Oglesbee, 1997; Joseph, 2000). Mixed infections occsionlly occur (Perelmn nd Kuttin, 1992). A. fumigtus is n opportunistic pthogen, cusing clinicl infections t high infection pressure or in immunosuppressed hosts. Phgocytic cells nd norml respirtory microbil clernce mechnisms re the first line defense ginst inhled spores. Disese occurs when this intrpulmonry defensive mechnism becomes indequte nd doesn t succeed in eliminting the orgnism (Oglesbee, 1997). In vivo models llowing reproducing spergillosis in birds re very useful for studying host-pthogen interctions nd evluting the effect of different control mesures. Depending on the ims of such studies, more cute or chronic model is required. A rther chronic infection model would be more suitble for exmple in studies ssessing the efficcy of ntimycotic tretment. The more cute model my llow the detection of strin dependent differences of virulence. Although experimentl infections with A. fumigtus hve been crried out in quils, strlings, pigeons, turkeys nd chickens using different inocultion routes (intrvenously, intrtrchelly, in the bdominl/thorcic ir sc, intrpulmonry nd using erosol) there is n bsolute necessity to compre these routes in one bird species in order to select the pproprite model (Chute & O Mer, 1958; Wright et l., 1960; Richrd et l., 1973; Richrd et l., 1981; Richrd & Thurston, 1983; Dyr et l., 1984; Vn Cutsem et l., 1989; Julin & Goryo, 1990; E-mil: cvngh@metronet.co.uk URL: 3
6 Avin Pthology Pge 4 of 19 Elmubrk & Fdlelmul, 1991; Peden & Rhodes, 1992; Perelmn, 1993; Kunkle & Rimler, 1996; Kunkle et l., 1999; Atsever & Gümüssoy, 2004; Gümüssoy et l., 2004; Femeni et l., 2007). It ws therefore, the im of this study to select n cute nd chronic spergillosis model in pigeons. For this purpose, A. fumigtus conidi were inoculted in the thorcic ir sc, lung or trche of immunocompetent or immunosuppressed pigeons. Mterils nd methods Animls. In the first experiment eighteen cliniclly helthy dult rcing pigeons (Columb livi domestic) were divided into three groups of six pigeons. In the second experiment thirty five cliniclly helthy, 4-5-week-old pigeon squbs were divided into seven groups of four nd one group of seven pigeons. The nimls were free from Slmonell sp. nd endoprsites. During the experiment ech bird ws housed individully t C nd 31-55% reltive humidity with 12-hour photoperiod. The birds received commercil pigeon diet d libitum nd hd free ccess to fresh drinking wter. All experiments were performed with the permission of the Ethicl Committee of the Fculty of Veterinry Medicine, Merelbeke, Ghent University, Belgium (EC 2006/099). Experimentl inoculum. The Aspergillus fumigtus strin used in this study ws isolted from rcing pigeon, which ws losing weight for four weeks nd ws presented with severe dyspne. Five dy old cultures of this strin on Sbourud dextrose gr (CM0041, Oxoid Ltd., Bsingstoke, Hmpshire, Englnd) were wshed with 5 ml 0.01% Tween 80 in Hnk s blnced slt solution (HBSS) to hrvest A. fumigtus conidi. The conidi were wshed three times in E-mil: cvngh@metronet.co.uk URL: 4
7 Pge 5 of 19 Avin Pthology 0.01% Tween 80 in HBSS (3200 g, ten minutes t 4 C) nd the suspension ws djusted to concentrtion of 10 6 or 10 8 A. fumigtus conidi/ml in HBSS by hemcytometer count. Experimentl design. The first experiment ws crried out in order to determine n pproprite infection dose. Three groups of six pigeons were inoculted intrtrchelly either with 0.2 ml of 10 6 or 10 8 A. fumigtus conidi/ml suspension in HBSS or with 0.2 ml HBSS. The second experiment ws crried out in order to exmine the impct of the use of different inocultion routes nd immunosuppression on the course of n infection with A. fumigtus. Seven groups of four pigeons were inoculted either with 0.2 ml of 10 8 A. fumigtus conidi/ml suspension in HBSS (groups 4, 5, 6, 7 nd 8) or with 0.2 ml HBSS (control groups 1 nd 2) using one of the following inocultion routes: intrtrchel (group 8), inocultion in the right thorcic ir sc (group 1, 4 nd 6) nd inocultion in the picl prt of the right lung (groups 2, 5 nd 7). The pigeons of three groups received three dexmethsone injections (2 mg/kg IM q48h) before inocultion with A. fumigtus (group 6, 7 nd 8). One group of pigeons (n=7) only received three dexmethsone injections (control group 3). The nimls were observed t lest twice dily. The presence of ruffled fethers, dyspne, sneezing nd stridor were scored blindly. Out of ethicl considertions, pigeons with severe dyspne (open bek brething) or extreme wekness were euthnized. This ws noted s mortlity. In the first experiment t twenty two dys post inocultion (p.i.) nd in the second experiment t seven dys p.i., ll remining pigeons were euthnized by n intrvenous injection of 0.2 ml T61 (Intervet, Mechelen, Belgium) in the ven bsilic. At necropsy, mcroscopic lesions were described nd smples were collected for mycologicl nd bcteriologicl exmintion. E-mil: cvngh@metronet.co.uk URL: 5
8 Avin Pthology Pge 6 of 19 Weight. All pigeons were weighted t the time of the first dexmethsone injection, t the time of inocultion nd t necropsy. Sttisticl nlysis ws performed using Two-Smple T test (Microsoft Office Excel). Clinicl score. Every dy score for til hopping nd bdominl brething ws given to ech pigeon. These scores rnged from 0-1 (0=bsent, 0.2=brely visible, 0.4=mild, 0.6=moderte, 0.8=pronounced, 1=highly pronounced). The sum of those two scores forms the dyspne score for certin pigeon on certin dy. The presence or bsence of ruffled fethers, s generl sign of sickness ws lso noted dily for ech pigeon. Mycologicl nd bcteriologicl exmintion. In the first experiment, smples of the trche, lungs nd ir scs nd in the second experiment of the trche, lungs, ir scs, hert, pericrdium, liver, kidney, brin, pectorl muscle nd bdominl fluid were inoculted on Sbourud dextrose gr pltes nd incubted t 37 C t erobic conditions to isolte A. fumigtus. Growth of A. fumigtus ws ssessed two dys fter plte inocultion. Bcteriologicl exmintion ws performed on the livers of ll pigeons using stndrd microbiologicl isoltion techniques. Microstellite Length Polymorphism. Microstellite Length Polymorphism (MLP) ws used to confirm tht mycoses during this study originted from the inoculted strin. DNA ws extrcted by the following technique. For ech isolte piece of mycelium ws cut out from the gr plte. After melting the gr, the mycelium ws crushed mnully in order to relese DNA from the cells. After centrifugtion (16100 g; 2.5 minutes) the superntnt ws used for PCR. E-mil: cvngh@metronet.co.uk URL: 6
9 Pge 7 of 19 Avin Pthology Primers were selected for the mplifiction of microstellites A, B, C nd D (Tble 1). One primer per set ws lbeled with the fluorescent dye 6-crboxyfluorescein (6-FAM) for detection with n utomted DNA sequencer. The PCR mplifiction ws performed in 20-µl volume contining 1.5 mm MgCl 2, 100 µm dntp s, 0.1 µm for ech primer, U/µl Tq DNA polymerse nd 2 µl superntnt. Amplifiction ws done in n Eppendorf Mstercycler ep system, with denturtion for 5 min t 94 C, 35 time cycles of 30 s t 94 C, 30 s t 59 C, nd 30 s t 72 C, nd finl extension step t 72 C for 30 min. Two µl of the PCR product ws mixed with 12 µl deionized formmide nd 0.3 µl rox 500LIZ. This mixture ws denturted t 95 C during 2 min nd incubted on ice for 0.5 h. The smples were further nlyzed by cpillry electrophoresis (ABI 3100, Applied Biosystems). A reference strin (CBS , Centrl Bureu voor Schimmelculturen, Utrecht, the Netherlnds) ws included in ll nlyses s n internl control. Results Clinicl signs. Immunocompetent pigeons inoculted intrtrchelly showed no clinicl signs in the first experiment. In the second experiment significnt difference (p<0.01) between the verge weight of immunosuppressed nd immunocompetent pigeons ws observed on the dy of inocultion. After inocultion, weight loss ws detected in the groups inoculted with A. fumigtus except for group 6 (dexmethsone treted, inoculted with A. fumigtus in the ir sc) (Tble 2). Dyspne ws only seen in A. fumigtus inoculted pigeons, most pprent in group 5 (inoculted in the lung) nd group 8 (dexmethsone treted, inoculted in the trche). Dyspne ws lmost bsent in E-mil: cvngh@metronet.co.uk URL: 7
10 Avin Pthology Pge 8 of 19 group 6 (dexmethsone treted, inoculted with A. fumigtus in the ir sc) nd group 7 (dexmethsone treted, inoculted with A. fumigtus in the lung) (Tble 3). Sneezing ws seen in one pigeon in group 4 (inoculted in the thorcic ir sc) on the fourth dy p.i. nd in one pigeon in group 5 (inoculted in the lung) on the fourth nd sixth dy p.i.. Stridor ws noticed in the ltter from the fifth dy p.i. on nd in one pigeon in group 8 (dexmethsone treted, inoculted in trche) on the fifth dy p.i.. Mortlity. In the first experiment, no mortlity ws observed in ny group. In the second experiment, no mortlity ws observed in the negtive control groups, except for two out of seven pigeons in group 3 (dexmethsone treted, not inoculted), which died due to Streptococcus gllolyticus septicemi. Mortlity in the A. fumigtus inoculted groups vried between 1/4 to 4/4, the lowest mortlity occurring in groups 5 nd 8 (inoculted in the lung; dexmethsone treted, inoculted in the trche), 100% mortlity occurring in groups 4, 6 nd 7 (inoculted in the ir sc; dexmethsone treted, inoculted in the ir sc; dexmethsone treted, inoculted in the lung). Mortlity ws more cute in groups 4, 6 nd 7 (inoculted in the ir sc; dexmethsone treted, inoculted in the ir sc; dexmethsone treted, inoculted in the lung), thn in groups 5 nd 8 (inoculted in the lung; dexmethsone treted, inoculted in trche) (Tble 4). Pthologicl findings. Immunocompetent pigeons inoculted intrtrchelly showed no mcroscopic lesions t necropsy. In the second experiment, no lesions were observed in the control groups with exception of two out of seven pigeons in group 3 (dexmethsone treted, not inoculted) tht died of Strepococcus gllolyticus septicemi. In these pigeons, ple spect of the liver nd pectorl E-mil: cvngh@metronet.co.uk URL: 8
11 Pge 9 of 19 Avin Pthology muscle ws noticed. The pthologicl findings of the A. fumigtus inoculted pigeons re summrized in Tble 5. Necropsy showed lesions suggestive of spergillosis in ll A. fumigtus inoculted pigeon groups. The most pronounced lesions were noticed in the respirtory trct nd viscerl orgns. Air sc lesions included the presence of grnulomtous foci nd clouding. Lung lesions included the presence of grnulomtous nd hemorrhgic foci. Lesions on the pericrd included the presence of grnulomtous foci nd content of yellow fluid. Liver lesions included grnulomtous foci nd congestion. A ple spect of the kidneys, lrge grnulomtous focus in the brin nd the presence of ple spect nd grnulomtous foci on the pectorl muscles were lso noticed occsionlly. Mycologicl findings. In the first experiment A. fumigtus could not be isolted from trche, lungs nd ir scs of ny of the pigeons. In the second experiment A. fumigtus ws isolted from different orgns of ll inoculted pigeons nd could not be isolted from orgns of non-a. fumigtus-inoculted pigeons (Tble 5). Microstellite Length Polymorphism. All isolted strins hd the sme MLP chrcteristics s the inoculted strin (A 123 B 102 C 167 D 112 ) except for one strin (A 127 B 161 C 165 D 78 ). This strin ws isolted from ple kidneys of one pigeon in group 7 (dexmethsone treted, inoculted in the picl prt of the right lung). The strin isolted from the trche of the sme pigeon hd the sme MLP chrcteristics s the inoculted strin. Discussion E-mil: cvngh@metronet.co.uk URL: 9
12 Avin Pthology Pge 10 of 19 Immunocompetent dult pigeons inoculted intrtrchelly showed no clinicl signs, mortlity or lesions t necropsy. A. fumigtus could not be isolted from the trches or other orgns of these nimls. Apprently, the pigeons were cpble of clering the infection even t very high infection doses. This finding suggests tht cliniclly helthy pigeons re not prone to develop spergillosis. This low susceptibility might be species (Chudhry & Sdn, 1988; Femeni et l., 2007) nd ge dependent (O Mer & Chute, 1959; Femeni et l., 2007). Therefore, pigeon squbs (4-5-week-old) were used in the second experiment. In the second experiment A. fumigtus inoculted pigeons developed mycosis. Becuse of the risk of contmintion by irborne conidi, especilly in the dexmethsone pretreted groups, we used MLP nlysis to ensure tht the mycosis ws cused by the inoculted strin. Hereby, it ws confirmed tht ll isolted A. fumigtus strins hd the sme MLP chrcteristics s the inoculted strin except for one isolte of dexmethsone treted pigeon. Probbly due to the dexmethsone injections, environmentl, irborne A. fumigtus conidi cused co-infection. This finding emphsizes the role of immunosuppression in the development of vin spergillosis. Clinicl symptoms were present in ll inoculted pigeons. However, the most obvious symptoms were noticed in pigeons inoculted in the lung or inoculted intrtrchelly fter immunosuppression. This coincides with delyed mortlity in nimls from both groups. Hence, the more severe symptoms cn probbly be merely ttributed to the slower course of infection. Both experimentl designs cn thus be used s model for chronic spergillosis. Due to the more cute mortlity in pigeons inoculted in the thorcic ir sc nd in pigeons inoculted in the thorcic ir sc or lung fter immunosuppression, these designs re more suitble s model for cute spergillosis. In this experiment mortlity ws observed from the second dy nd within five dys p.i.. In the models for cute spergillosis four out of four pigeons died within five dys p.i. while in the models for chronic spergillosis only one out of four pigeons died on the fifth E-mil: cvngh@metronet.co.uk URL: 10
13 Pge 11 of 19 Avin Pthology dy p.i.. These findings re in contrst with A. fumigtus experimentl infections in other vin species. In turkeys inoculted with A. fumigtus spores in the thorcic ir sc no mortlity ws seen the first four dys p.i. while quils nd strlings inoculted with A. fumigtus spores intrtrchelly demonstrted mortlity s soon s two-three dys p.i. (Peden & Rhodes, 1992; Kunkle & Rimler, 1996; Atsever & Gümüssoy, 2004; Gümüssoy et l., 2004; Femeni et l., 2007). On the other hnd, pigeons inoculted with A. fumigtus spores intrvenously showed similr results s the models for cute spergillosis in this study (Vn Cutsem et l., 1989; Elmubrk & Fdlelmul, 1991). Discrepncy with literture cn be cused by species dependent susceptibility for A. fumigtus infections nd/or vribility of pthogenicity of the A. fumigtus isoltes used in the different studies (Peden & Rhodes, 1992). Lesions suggestive of spergillosis were present in ll A. fumigtus inoculted pigeons. In this study s well s in generl (prt from the used inocultion route nd vin species), cute mortlity is consistent with disseminted mycosis while reduced nd delyed mortlity is consistent with mycotic lesions restricted to the respirtory trct (Chudry & Sdn, 1988; Peden & Rhodes, 1992; Kunkle & Rimler, 1996; Atsever & Gümüssoy, 2004; Gümüssoy et l.,2004; Femeni et l., 2007). Dexmethsone tretment clerly enhnced the risk of opportunistic infections, such s streptococcosis or interference with environmentl A. fumigtus strins. The use of immunocompetent pigeons thus seems preferble in spergillosis models. Bsed on our results, we propose inocultion of A. fumigtus in the picl prt of the right lung using immunocompetent pigeon squbs s the preferred chronic spergillosis model. Inoculting A. fumigtus in the right thorcic ir sc of immunocompetent pigeon squbs ppers to be the best model for cute spergillosis. E-mil: cvngh@metronet.co.uk URL: 11
14 Avin Pthology Pge 12 of 19 Acknowledgements This work ws supported by the Institute for the Promotion of Innovtion by Science nd Technology in Flnders (IWT Vlnderen), Brussels, Belgium. References Atsever, A. & Gümüssoy K.S. (2004). Pthologicl, clinicl nd mycologicl findings in experimentl spergillosis infections of strlings. Journl of Veterinry Medicine A, 51, Brt-Delbesse, E., Humbert, J.-F., Delbesse, E. & Bretgne, S. (1998). Microstellite mrkers for typing Aspergillus fumigtus isoltes. Journl of Clinicl Microbiology, 36, Brton, J.T., Dft, B.M., Red, D.H., Kinde, H. & Bickford, A.A. (1992). Trchel spergillosis in 6 1/2 -week-old chickens cused by Aspergillus flvus. Avin Diseses, 36, Chudhry, S.K. & Sdn, S.R. (1988). Experimentl spergillosis in Jpnese quils (Coturnix coturnix jponic), clinicl signs nd hemtologicl chnges. Mycopthologi, 102, Chute, H.L. & O Mer, D.C. (1958). Experimentl fungous infections in chickens. Avin Diseses, 2, de Wit, J.J., vn Cutsem, J., Schoenmker, G.J.W., Brunius, W.W. & vn den Bergh, J.P.A.M. (1993). Een ernstige Aspergillus flvus-infectie bij slchtkuikens en het effect vn desinfectie met enilconzole: een cse study. Tijdschrift voor diergeneeskunde, 118, E-mil: cvngh@metronet.co.uk URL: 12
15 Pge 13 of 19 Avin Pthology Dyr, P.M., Fletcher, O.J. & Pge, R.K. (1984). Aspergillosis in turkeys ssocited with use of contminted litter. Avin Diseses, 28, Elmubrk, A.K. & Fdlelmul, A. (1991). Pthogenesis of Aspergillus fumigtus infection in pigeons in the Sudn. Revue d Elevge et de Medicine Vétérinire des Pys Tropicux, 44, Femeni, F., Fontine, J., Lir-Fulleringer, S., Berkov, N., Huet, D., Townou, N., Rkotovo, F., Grnet, O.-I., Le Loc h, G., Arné, P. & Guillot, J. (2007). Clinicl, mycologicl nd pthologicl findings in turkeys experimentlly infected by Aspergillus fumigtus. Avin Pthology, 36, Gümüssoy, K.S., Uynik, F., Atsever, A. & Cm, Y. (2004). Experimentl Aspergillus fumigtus infection in quils nd results of tretment with itrconzole. Journl of Veterinry Medicine B, 51, Joseph V. (2000). Aspergillosis in rptors. Seminrs in Avin nd Exotic Pet Medicine, 9(2), Julin, R.J. & Goryo, M. (1990). Pulmonry spergillosis cusing right ventriculr filure nd scites in met-type chickens. Avin Pthology, 19, Kunkle R.A. & Rimler R.B. (1996). Pthology of cute spergillosis in turkeys. Avin Diseses, 40, Kunkle, R.A., Rimler, R.B. & Stedhm, E.M. (1999). Absence of protection ginst chllenge with Aspergillus fumigtus by doptive trnsfer of splenocytes from convlescent turkeys. Avin Diseses, 43, Oglesbee, B.L. (1997). Mycotic diseses. In R.B. Altmn (1997), Avin medicine nd surgery 1st edn (pp ). Phildelphi: W.B. Sunders Compny. E-mil: cvngh@metronet.co.uk URL: 13
16 Avin Pthology Pge 14 of 19 Okoye, J.O.A. & Okeke, C.N. (1986). Pthogenicity of n isolte of Aspergillus flvus in chickens. Avin Pthology, 15, O Mer, D.C. & Chute, H.L. (1959). Aspergillosis experimentlly produced in htching chicks. Avin Diseses, 3, Peden, W.M. & Rhodes, K.R. (1992). Pthogenicity differences of multiple isoltes of Aspergillus fumigtus in turkeys. Avin Diseses, 36, Perelmn, B. (1993). Evlution of zole nti-mycotic gents using n experimentl model of spergillosis in turkey poults. Proceedings of the Europen Conference on Avin Medicine nd Surgery (p. 120) Utrecht, The Netherlnds. Perelmn, B. & Kuttin, E.S. (1992). Aspergillosis in ostriches. Avin Pthology, 21, Richrd, J.L., Cutlip, R.C., Thurston, J.R. & Songer, J. (1981). Response of turkey poults to erosolized spores of Aspergillus fumigtus nd fltoxigenic nd nonfltoxigenic strins of Aspergillus flvus. Avin Diseses, 25, Richrd, J.L. & Thurston, J.R. (1983). Rpid hemtogenous dissemintion of Aspergillus fumigtus nd A. flvus spores in turkey poults following erosol exposure. Avin Diseses, 27, Richrd, J.L., Pier, A.C., Cysewski, S.J. & Grhm, C.K. (1973). Effect of fltoxin nd spergillosis on turkey poults. Avin Diseses, 17, Vn Cutsem, J., Vn Gerven, F. & Jnssen, P.A.J. (1989). Orl nd prenterl therpy with sperconzole (R 66905) of invsive spergillosis in norml nd immunocompromised nimls. Antimicrobil Agents nd Chemotherpy, 33, Wright, M.L., Anderson, G.W. & Epps, N.A. (1960). Htchery snittion s control mesure for spergillosis in fowl. Avin Diseses, 4, E-mil: cvngh@metronet.co.uk URL: 14
17 Pge 15 of 19 Avin Pthology Tble 1: Primer sequences (5 to 3 ) for multipliction of microstellites A, B, C nd D (Brt- Delbesse et l., 1998). Microstellite Primer sequences (5 to 3 ) A GCCTACGATGACCGAAATGA CTGTTTTGAGAAGCGGATGG TTGCCATCGCTTGTCATAGA GCAGGTGGTTCAATAGGACAG CGAAGCTCTCCCCTGCAAATC GATGCCGCTGGTGGTGTTGT AGGGATACGGCTACGGACAA AAAGCGTCTGTCAGCGTGTCT B C D E-mil: cvngh@metronet.co.uk URL: 15
18 Avin Pthology Pge 16 of 19 Tble 2. Averge totl weight loss s percentge of the initil weight in pigeons, either inoculted with A. fumigtus or shm inoculted, t seven dys p.i.(or t euthnsi). Group % weight loss HBSS in right thorcic ir sc (n=4) HBSS in right lung (n=4) Dexmethsone (n=7) 1.4 A. fumigtus in right thorcic ir sc (n=4) 8.1 A. fumigtus in right lung (n=4) 6.6 A. fumigtus in right thorcic ir sc fter dexmethsone injections (n=4) A. fumigtus in right lung fter dexmethsone injections (n=4) 8.9 A. fumigtus in trche fter dexmethsone injections (n=4) 12.4 x% weight loss = weight gin E-mil: cvngh@metronet.co.uk URL: 16
19 Pge 17 of 19 Avin Pthology Tble 3. Averge dily clinicl scores for dyspne nd the presence or bsence of ruffled fethers per dy in pigeons, either inoculted with A. fumigtus or shm inoculted. DYSPNEA SCORE Dy Group p.i FRACTION OF PIGEONS WITH RUFFLED FEATHERS Dy Group p.i /4 0/4 0/7 1/4 1/4 1/4 2/ /4 0/4 2/7 3/4 1/4 3 0/4 0/4 0/5 1/2 0/4 4 0/4 0/4 0/5 1/2 2/4 5 0/4 0/4 0/5 1/2 1/3 6 0/4 0/4 0/5 7 0/4 0/4 0/5 All pigeons died 0/3 1/ /4 2/4 1/1 2/4 3/4 3/4 1/3 1/3 Group 1: HBSS in right thorcic ir sc, Group 2: HBSS in right lung, Group 3: dexmethsone, Group 4: A. fumigtus in right thorcic ir sc, Group 5: A. fumigtus in right lung, Group 6: A. fumigtus in right thorcic ir sc fter dexmethsone injections, Group 7: A. fumigtus in right lung fter dexmethsone injections, Group 8: A. fumigtus in trche fter dexmethsone injections E-mil: cvngh@metronet.co.uk URL: 17
20 Avin Pthology Pge 18 of 19 Tble 4. Dily mortlity in pigeons, either inoculted with A. fumigtus or shm inoculted. Dy Group p.i Dy 1 Dy Dy Dy Dy Dy 6 Dy 7 Totl 0 0 2/7 4/4 1/4 4/4 4/4 1/4 Group 1: HBSS in right thorcic ir sc, Group 2: HBSS in right lung, Group 3: dexmethsone, Group 4: A. fumigtus in right thorcic ir sc, Group 5: A. fumigtus in right lung, Group 6: A. fumigtus in right thorcic ir sc fter dexmethsone injections, Group 7: A. fumigtus in right lung fter dexmethsone injections, Group 8: A. fumigtus in trche fter dexmethsone injections E-mil: cvngh@metronet.co.uk URL: 18
21 Pge 19 of 19 Avin Pthology Tble 5. Pthologicl nd mycologicl findings in pigeons inoculted with A. fumigtus. Orgns Number of nimls showing lesions (L) nd number of nimls from which A. fumigtus ws isolted (I) in the different groups L I L I L I L I L I Trche swb Left bdominl ir sc Right bdominl ir sc Left thorcic ir sc Right thorcic ir sc Left lung Right lung Pericrd Hert Liver Spleen 4 b 4 b 0 b 1 b 0 b Kidney Brin Ascites b 0 b Pectorl muscle Ech group consisted of four nimls. Group 4: A. fumigtus in right thorcic ir sc, Group 5: A. fumigtus in right lung, Group 6: A. fumigtus in right thorcic ir sc fter dexmethsone injections, Group 7: A. fumigtus in right lung fter dexmethsone injections, Group 8: A. fumigtus in trche fter dexmethsone injections b Not determined E-mil: cvngh@metronet.co.uk URL: 19
High Frequency of Antimicrobial Resistance in Human Fecal Flora
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Dec. 1988, p. 181-186 66-484188112181-6$2./ Copyright 1988, Americn Society for Microbiology Vol. 32, No. 12 High Frequency of Antimicrobil Resistnce in Humn Fecl
More informationImmune Responses and Efficacy After Administration of a Commercial Brucella abortus Strain RB51 Vaccine to Cattle*
Immune Responses nd Efficcy After Administrtion of Commercil Brucell bortus Strin RB51 Vccine to Cttle* Steven C. Olsen, DVM, PhD United Sttes Deprtment of Agriculture Bcteril Diseses of Livestock Reserch
More informationEffect of Rumensin on Health and Reproduction of Lactating Dairy Cows
Scientific Updte From Elnco Animl Helth Effect of Rumensin on Helth nd Reproduction of Lctting Diry Cows NADA 095-735 Dvid G. McClry, DVM, MS; Howrd B. Green, MS; Gerld D. Mechor, DVM; nd John I. D. Wilkinson,
More informationEfficacy of Clarithromycin for Treatment of Experimental
ANTIMICROBLAL AGENTS AND CHEMOTHERAPY, June 1993, p. 1329-1333 0066-4804/93/061329-05$02.00/0 Copyright X) 1993, Americn Society for Microbiology Vol. 37, No. 6 Efficcy of for Tretment of Experimentl Lyme
More informationAIR SAC PARASITES OF THE GENUS Serratospiculum IN FALCONS
AIR SA PARASITES OF THE GENUS Serrtospiculum IN FALONS Authors: F. PRESOTT WARD, nd DAVID G. FAIRHILD Source: Journl of Wildlife Diseses, 8(2) : 165-168 Published By: Wildlife Disese Assocition URL: https://doi.org/1.7589/9-3558-8.2.165
More informationRobert H. Six 1*, William R. Everett 2, Melanie R. Myers 1 and Sean P. Mahabir 1
Six et l. Prsites & Vectors (2016) 9:93 DOI 10.1186/s13071-016-1374-z RESEARCH Comprtive speed of kill of srolner (Simpric ) nd spinosd plus milbemycin oxime (Trifexis ) ginst induced infesttions of Ctenocephlides
More informationShell Thickness of Turkey Eggs Affects Cardiac Physiology and Embryo Survival 1
Interntionl Journl of Poultry Science 5 (8): 796-80, 2006 ISSN 682-856 Asin Network for Scientific Informtion, 2006 Shell Thickness of Turkey Eggs Affects Crdic Physiology nd Emryo Survivl 2 2 4 2 V.L.
More informationIntroduction: Definition of Palatability
Mesurement of pltility of common ingredients used in feed mixes for lms nd ewes A. Mereu,, G. Molle, V. Giovnetti, M. Acciro, M. Decndi, A. Cnns Diprtimento di Scienze Zootecniche, Università di Sssri,
More informationMycobacterium paratuberculosis Cultured from Milk and
JOURNAL OF CLINICAL MICROBIOLOGY, Jn. 1992, p. 6-171 95-1137/92/16-6$2./ Copyright C 1992, Americn Society for Microbiology Vol. 3, No. 1 Mycobcterium prtuberculosis Cultured from Milk nd Suprmmmry Lymph
More informationHereditary ataxia in the Jack Russell Terrier (JRT) is a
J Vet Intern Med 2004;1:1 21 Hereditry Atxi in the Jck Russell Terrier Clinicl nd Genetic Investigtions Annette Wessmnn, Thoms Goedde, Andre Fischer, Peter Wohlsein, Henning Hmnn, Ottmr Distl, nd Andre
More informationComparative Study on Some Productive Traits of Muscovy and Sudani Ducks in Egypt
Interntionl Journl of Poultry Science 11 (4): 264-268, 2012 ISSN 1682-8356 Asin Network for Scientific Informtion, 2012 Comprtive Study on Some Productive Trits of Muscovy nd Sudni Ducks in Egypt Lil D.
More informationCHARACTERISTICS ASSOCIATED WITH OUT CROSSING IN A SHORT DURATION IMPROVED RICE (Oryza sativa L) VARIETY AT307
CHARACTERISTICS ASSOCIATED WITH OUT CROSSING IN A SHORT DURATION IMPROVED RICE (Oryz stiv L) VARIETY AT307 Kumr APA 1, Dhnyke Nilnthi 1 *, Phthinyke BD 2 nd Sennyke SGJN 1 1 Deprtment of Agriculturl Biology,
More informationJ. Wat. Treat. Biol. Vol.37 No.2
Direct Observtion biilm's surfce bcteril prt pcked n clerly seen B), ct section s spheres rods (Fig., frequently 10μm size. smooth boundries clumps where ded s process. A polymer drk-light res All structure
More informationComparative Study on Production Efficiency of Two Strains of Brown and White Egg Laying Hens in Kuwait
Interntionl Journl of Poultry Science 12 (7): 383-389, 2013 ISSN 1682-8356 Asin Network for Scientific Informtion, 2013 Comprtive Study on Production Efficiency of Two Strins of Brown nd White Egg Lying
More informationISSN: Isolation of High Antibiotic Resistant Fecal Bacteria Indicators, Salmonella and Vibrio Species from Raw
ISSN: 2276-7762 Isoltion of High Antibiotic Resistnt Fecl Bcteri Indictors, Slmonell nd Vibrio Species from Rw Abttoirs Sewge in Peri- Urbn Loctions of Nirobi, Keny By Nymboy Rosemry Atieno Okemo Pul Owuor
More informationX-RAY Contents lists available at
ISSN 1115-7976 X-RAY Contents lists vilble t Journl of Assocition of Rdiogrphers of Nigeri Journl homepge: www.jrn-xry.org Vol. 26 X-ry Equipments nd Accessories s possible Vectors of Nosocomil Bcteri
More informationHepatitis C virus entry and cell-cell transmission : implication for viral life cycle and antiviral treatment
Hepatitis C virus entry and cell-cell transmission : implication for viral life cycle and antiviral treatment Fei Xiao To cite this version: Fei Xiao. Hepatitis C virus entry and cell-cell transmission
More informationEffect of Rearing Program, Body Conformation and Protein Level of Breeder Feed on Broiler Breeder Hen Reproductive Performance
Interntionl Journl of Poultry Science (): 670-679, 0 ISSN 68-856 Asin Network for Scientific Informtion, 0 Effect of Rering Progrm, Body Conformtion nd Protein Level of Breeder Feed on Broiler Breeder
More informationPLASMA CORTISOL LEVEL AND MAIN METABOLISM EVOLUTION IN PREGNANT EWE
PLASMA CORTISOL LEVEL AND MAIN METABOLISM EVOLUTION IN PREGNANT EWE N. Dojnă, Iulin Codrenu, Costin Budică Fculty of veterinry medicine Buchrest, Romni, dojn2001@yhoo.com. Abstrct The purpose of this reserch
More informationTECHNICAL SUMMARY October 2013
TECHNICAL SUMMARY October 2013 GeneSTAR MVPs Moleculr Vlue Predictions for beef feed efficiency, 1 mrbling 2 nd tenderness Key Points GeneSTAR is DNA-mrker test for importnt production trits in ll breeds
More informationHaematological and Biochemical Changes in Japanese Quails Coturnix coturnix Japonica and Chickens Due to Ascaridia galli Infection
Interntionl Journl of Poultry Science 7 (7): 704-70, 2008 ISSN 682-8356 Asin Network for Scientific Informtion, 2008 Hemtologicl nd Biochemicl Chnges in Jpnese Quils Coturnix coturnix Jponic nd Chickens
More informationAppropriateness of antimicrobial therapy: a multicentre prevalence survey in the Netherlands,
Surveillnce nd outbrek reports Appropriteness of ntimicrobil therpy: multicentre prevlence survey in the Netherlnds, 28 29 I Willemsen 1, T vn der Kooij 2, B vn Benthem 2, J Wille 3, J Kluytmns (jnkluytmns@gmil.com)
More informationEvaluation of the Hologic Gen-Probe PANTHER, APTIMA Combo 2 Assay in a Tertiary Care Teaching Hospital
AJCP / Originl Article Evlution of the Hologic Gen-Probe PANTHER, APTIMA Combo 2 Assy in Tertiry Cre Teching Hospitl Annie Cheng, MT, nd Jmes E. Kirby, MD From the Deprtment of Pthology, Beth Isrel Deconess
More informationIncreasing survival of wild macaw chicks using foster parents
Gbriel Vigo Truco,b,c nd Donld J. Brightsmithbb,c Deprtment of Wildlife nd Fisheries, Texs A&M University,b Schubot Exotic Bird Helth Center, Texs A&M University, c Tmbopt Mcw Project, Mdre de Dios, Perú
More informationLuteolysis and pregnancy outcomes after change in dose delivery of prostaglandin F2α in a 5-day timed artificial insemination program in dairy cows
Knss Agriculturl Experiment ttion Reserch Reports Volume Issue 2 Diry Reserch (94-24) Article 9 24 Luteolysis nd pregnncy outcomes fter chnge in dose delivery of prostglndin F2α in -dy timed rtificil insemintion
More informationBIOLOGICAL CONTROL OF HAEMONCHUS CONTORTUS BY FUNGAL ANTAGONISTS IN SMALL RUMINANTS
Khttk et l.: Biologicl control of Hemonchus contortus by fungl ntgonists in smll ruminnts - 5825 - BIOLOGICAL CONTROL OF HAEMONCHUS CONTORTUS BY FUNGAL ANTAGONISTS IN SMALL RUMINANTS KHATTAK, B. 1* SAFI,
More informationInfluence of 2-hydroxy-4-(Methylthio)butanoic Acid on Early Egg and Chick Weights of Broiler Breeders
Interntionl Journl of Poultry Science 2 (6): 430-437, 2003 Asin Network for Scientific Informtion 2003 Influence of 2-hydroxy-4-(Methylthio)utnoic Acid on Erly Egg nd Chick Weights of Broiler Breeders
More informationFeasibility of Miscanthus as alternative bedding for dairy cows
Veterinrni Medicin,, 1 (3): 11 13 Originl Pper doi: 1.171/9-VETMED Fesibility of Miscnthus s lterntive bedding for diry cows S. Vn Weyenberg, T. Ulens, K. De Reu, I. Zwertvegher, P. Demeyer, L. Pluym Institute
More informationA retrospective study of the causes of morbidity and mortality in farmed elk (Cervus elaphus) Murray R. Woodbury, John Berezowski, Jerry Haigh
A retrospective study of the cuses of morbidity nd mortlity in frmed elk (Cervus elphus) Murry R. Woodbury, John Berezowski, Jerry High Abstrct A survey of North Americn frmed elk (Cervus elphus) producers
More informationEFFECT OF DEXAMETHASONE ON THE CHANGES OF SEMEN QUALITY INDUCED BY ENDOTOXIN IN STALLION
Bull Vet Inst Pulwy 5, 581-589, 8 FFCT OF DXAMTHASON ON TH CHANGS OF SMN QUALITY INDUCD BY NDOTOXIN IN STALLION JANUSZ DANK Deprtment of Animl Reproduction nd Animl Helth Protection, University of Technology
More informationBVD = Bovine Viral Diarrhea
George Perry, South Dkot Stte University 11/2/17 Influence of Modified Live Vccines on Reproductive Performnce in Beef Cttle George A. Perry, Russell F. Dly, nd Christopher C. Chse Deprtment of Animl Science
More informationA Model for Promoting Poultry Industry Development in Togo: Part 1. Management Practices and Incubation Conditions
Interntionl Journl of Poultry Science 13 (3): 176-184, 2014 ISSN 1682-8356 Asin Network for Scientific Informtion, 2014 A Model for Promoting Poultry Industry Development in Togo: Prt 1. Mngement Prctices
More informationEfficacy of Some Trypanocidal Drug Against Trypanosoma equiperdum OVI in Experimentally Infected Mice in Debre Zeit, Ethiopia
Europen Journl of Biologicl Sciences 7 (1): 7-13, 215 ISSN 279-285 IDOSI Publictions, 215 DOI: 1.5829/idosi.ejbs.215.7.1.91173 Efficcy of Some Trypnocidl Drug Aginst Trypnosom equiperdum OVI in Experimentlly
More informationDistribution and dissemination of antimicrobial-resistant Salmonella in broiler farms with or without enrofloxacin use
Shng et l. BMC Veterinry Reserch (2018) 14:257 https://doi.org/10.1186/s12917-018-1590-1 RESEARCH ARTICLE Open Access Distribution nd dissemintion of ntimicrobil-resistnt Slmonell in broiler frms with
More informationThe ARESC study: an international survey on the antimicrobial resistance of pathogens involved in uncomplicated urinary tract infections
The ARESC study: n interntionl survey on the ntimicrobil resistnce of pthogens involved in uncomplicted urinry trct infections Gin Crlo Schito, Kurt G. Nber, Henry Botto, Jun Plou, Teresit Mzzei, Lur Gulco,
More informationImmunostimulation Assays in Bovine Brucellosis
INFECTION AND IMMUNITY, Nov. 1978, p. 486-491 0019-9567/78/0022-0486$02.00/0 Copyright i 1978 Americn Society for Microbiology Vol. 22, No. 2 Printed in U.S.A. Brucell Antigen Preprtions for In Vitro Lymphocyte
More informationEffects of mercury exposure on the reproductive success of tree swallows (Tachycineta bicolor)
Ecotoxicology (2008) 17:133 141 DOI 10.1007/s10646-007-0163-z Effects of mercury exposure on the reproductive success of tree swllows (Tchycinet bicolor) Rebeck L. Brsso Æ Dniel A. Cristol Accepted: 20
More informationIsolation of Legionella longbeachae Serogroup 1 from Potting Mixes
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jn. 1990, p. 49-53 0099-2240/90/010049-05$02.00/0 Copyright C) 1990, Americn Society for Microbiology Vol. 56, No. 1 Isoltion of Legionell longbeche Serogroup 1
More informationReal Life Problems involving Area
Rel Life Prolems involving Are Prolems occur often in everydy life. Exmple :- A edroom wll is to e wllppered. (300 cm) The wll hs een mesured nd is 6 metres y etres, s shown. The rolls of wllpper to e
More informationThe Japanese Quail: A Review
Interntionl Journl of Poultry Science 7 (9): 95-9, 008 ISSN 68-856 Asin Network for Scientific Informtion, 008 The Jpnese Quil: A Review Nsrollh Vli Deprtment of Animl Sciences, Fculty of Agriculture,
More informationESTIMATION OF BREEDING VALUES AND THEIR ACCURACIES USING MULTIVARIATES ANIMAL MODEL ANALYSIS FOR GROWTH TRAITS IN THREE LOCAL STRAINS OF CHICKENS
Egypt. Poult. Sci. Vol. 0 (IV) Dec. 000 (98-00) ESTIMATION OF BREEDING VALUES AND THEIR ACCURACIES USING MULTIVARIATES ANIMAL MODEL ANALYSIS FOR GROWTH TRAITS IN THREE LOCAL STRAINS OF CHICKENS M. M. IRAQI,
More informationDifferences in peripartal plasma parameters related to calcium homeostasis of dairy sheep and goats in comparison with cows
Zurich Open Repository nd Archive University of Zurich Min Lirry Strickhofstrsse 39 CH-8057 Zurich www.zor.uzh.ch Yer: 2014 Differences in periprtl plsm prmeters relted to clcium homeostsis of diry sheep
More informationAgreed by the Antimicrobial Advice ad hoc Expert Group (AMEG) 2 May Adopted by the CVMP for release for consultation 19 May 2016
27 July 2016 EMA/CVMP/CHMP/231573/2016 Committee for Medicinl Products for Veterinry use (CVMP) Committee for Medicinl Products for Humn Use (CHMP) Updted dvice on the use of colistin products in nimls
More informationRelationship Between Some Serum Enzyme Activities, Liver Functions and Body Weight in Growing Local Chickens
Interntionl Journl of Poultry Science 8 (7): 700-705, 2009 ISSN 1682-856 Asin Network for Scientific Informtion, 2009 Reltionship Between Some Serum Enzyme Activities, Liver Functions nd Body Weight in
More informationThe preventive effects of two nutraceuticals on experimentally induced acute synovitis
Equine Veterinry Journl ISSN 0425-1644 DOI: 10.1111/evj.12629 The preventive effects of two nutrceuticls on experimentlly induced cute synovitis E. VAN DE WATER *, M. OOSTERLINCK, M. DUMOULIN, N. M. KORTHAGEN,P.R.VAN
More informationEvaluation of New Biological Product Saltose for Controlling Coccidia and Clostridia in Broiler Chickens
Glol Veterinri 1 (): 57-, 01 ISSN 199-197 IDOSI Pulictions, 01 DOI: 10.589/idosi.gv.01.1.0.81 Evlution of New Biologicl Product Sltose for Controlling Coccidi nd Clostridi in Broiler Chickens 1 K.G. El
More informationMaterials and method Animals and blood samples
Originl Reserch 1 / 12 Veterinri OA México Publicción Digitl de l Fcultd de Medicin Veterinri y Zootecni o http://www.revists.unm.mx/index.php/veterinri-mexico Effect of prostglndin F2α dministrtion during
More informationThe following Supplemental Tables represent the data upon which Figures 3 and 4, respectively, are based.
The following Supplementl Tbles represent the dt upon which Figures 3 nd 4, respectively, re bsed. Tble S1: Existence of incidents of unconfined dogs, cts, ferrets: impct on wildlife Effects on Wildlife
More informationContinuous Subcutaneous Infusion of Morphine vs. Hydromorphone: A Controlled Trial
Vol. 18 No. 1 July 1999 Journl of Pin nd Symptom Mngement 9 Originl Article Continuous Subcutneous Infusion of Morphine vs. Hydromorphone: A Controlled Tril Mry G. Miller, MB, MRCP (Irelnd), Noel McCrthy,
More informationCurrent Canine Guidelines for the. Prevention, Diagnosis, and Management of Heartworm (Dirofilaria immitis) Infection in Dogs
Current Cnine Guidelines for the Prevention, Dignosis, nd Mngement of Hertworm (Dirofilri immitis) Infection in Dogs Thnk You to Our Generous Sponsors: Printed with n Eduction Grnt from IDEXX Lbortories.
More informationSources of contamination, prevalence, and antimicrobial resistance of thermophilic Campylobacter isolated from turkeys
Veterinry World, EISSN: 2231-0916 RESEARCH ARTICLE Open Access Sources of contmintion, prevlence, nd ntimicrobil resistnce of thermophilic Cmpylobcter isolted from turkeys Rdi Bouhmed 1, Leil Bouyd 1,
More informationMERCURY EXPOSURE AFFECTS THE REPRODUCTIVE SUCCESS OF A FREE-LIVING TERRESTRIAL SONGBIRD, THE CAROLINA WREN (THRYOTHORUS LUDOVICIANUS)
The Auk 128(4):759 769, 2011 The Americn Ornithologists Union, 2011. Printed in USA. MERCURY EXPOSURE AFFECTS THE REPRODUCTIVE SUCCESS OF A FREE-LIVING TERRESTRIAL SONGBIRD, THE CAROLINA WREN (THRYOTHORUS
More informationOriginal research. Meloxicam as adjunctive therapy in treatment and control of porcine respiratory disease complex in growing pigs.
Peer reviewed Originl reserch Meloxicm s djunctive therpy in tretment nd control of porcine respirtory disese complex in growing pigs Ionnis E. Georgoulkis, DVM, PhD; Evnthi Petridou, DVM, Dr Med Vet;
More informationThe Anatomy of Sea Turtles
Close this window to return to the previous pge or go to www.ivis.org The Antomy of Se Turtles Jenette Wyneken, Ph.D. Illustrted y Dwn Witherington Close this window to return to the previous pge or go
More informationEffects of Genotype and Housing System on the Laying Performance of Chickens in Different Seasons in the Semi-Humid Tropics
Interntionl Journl of Poultry Science 6 (6): 434-439, 2007 ISSN 1682-8356 Asin Network for Scientific Informtion, 2007 Effects of Genotype nd Housing System on the Lying Performnce of Chickens in Different
More informationOriginal Article. E Oz 1, *H Cetin 1, J E Cilek 2, O Deveci 3, A Yanikoglu 1
Irnin J Pul Helth, Vol. 39, No.3, 2010, Irnin pp. 102-108 J Pul Helth, Vol. 39, No.3, 2010, pp. 102-108 Originl Article Effects of Two Temperture Storge Regimes on the Efficcy of 3 Commercil Gel Bits ginst
More informationFaculty of Veterinary Medicine, USAMV Cluj-Napoca, 3-6 Calea Mănăştur, Cluj-Napoca, România,
Bulletin UASMV, Veterinry Medicine, 69(1-2)/2012 Print ISSN 1843-5262; Electronic ISSN 1843-5378 Comprtive study of the internl conformtion of the posdiphrgmtic digestive trct in the dog (Cnis lupus fmiliris)
More informationSo much more than friendship
So much more thn friendship How to include Assistnce Dogs Austrli in your Will, nd build brighter future filled with love, friendship nd greter freedom for people with disbilities. By leving gift in your
More informationCHARACTERISTICS ASSOCIATED WITH OUT CROSSING IN A SHORT DURATION IMPROVED RICE (Oryza sativa L) VARIETY AT307
CHARACTERISTICS ASSOCIATED WITH OUT CROSSING IN A SHORT DURATION IMPROVED RICE (Oryz stiv L) VARIETY AT37 Kumr APA 1, Dhnyke Nilnthi 1 *, Phthinyke BD 2 n Sennyke SGJN 1 1 Deprtment of Agriculturl Biology,
More informationGROWTH PERFORMANCE, CARCASS TRAITS AND ECONOMIC VALUES OF PEKIN, MUSCOVY, AND MULARD DUCKS
Slov Vet Res 2018; 55 (Suppl 20): 357 65 DOI 10.26873/SVR-663-2018 Originl Reserch Article GROWTH PERFORMANCE, CARCASS TRAITS AND ECONOMIC VALUES OF PEKIN, MUSCOVY, AND MULARD DUCKS Frdos A.M. Hssn, Elshim
More informationResearch Article Neuroprotective Effects of Meloxicam and Selegiline in Scopolamine-Induced Cognitive Impairment and Oxidative Stress
Hindwi Publishing Corportion Interntionl Journl of Alzheimer s Disese Volume 212, Article ID 97413, 8 pges doi:1.1155/212/97413 Reserch Article Neuroprotective Effects of Meloxicm nd in Scopolmine-Induced
More informationSynergistic effect of rhein in combination with ampicillin or oxacillin against methicillin-resistant Staphylococcus aureus
608 Synergistic effect of rhein in combintion with mpicillin or oxcillin ginst methicillin-resistnt Stphylococcus ureus DAE-KI JOUNG 1, HEE JOUNG 1, DA-WUN YANG 1, DONG-YEUL KWON 2, JANG-GI CHOI 2, SEO
More informationESTIMATION OF (CO) VARIANCE COMPONENTS OF EWE PRODUCTIVITY TRAITS IN KERMANI SHEEP
Slovk J. Anim. Sci., 46, 2013 (2): 45-51 2013 CVŽV ISSN 1337-9984 ESTIMATION OF (CO) VARIANCE COMPONENTS OF EWE PRODUCTIVITY TRAITS IN KERMANI SHEEP M. R. MOHAMMADABADI*, R. SATTAYIMOKHTARI Deprtment of
More informationComparative Studies on the Prevalence of Ixodid Ticks on Some Selected Sedentary Farms and Trade Cattle in Adamawa State, Nigeria
Interntionl Journl of Scientific nd Reserch Publictions, Volume 7, Issue 9, September 2017 505 Comprtive Studies on the Prevlence of Ixodid Ticks on Some Selected Sedentry Frms nd Trde Cttle in Admw Stte,
More informationEffects of Fusaric Acid in Broiler Chicks and Turkey Poults
Interntionl Journl of Poultry Science 4 (6): 356-359, 2005 ISSN 682-8356 Asin Network for Scientific Informtion, 2005 Effects of Fusric Acid in Broiler nd Turkey Poults S.O. Oguno, D.R. Ledoux, J.N. Broomhed,
More informationClinical, mycological and pathological findings in turkeys experimentally infected by Aspergillus fumigatus
Clinical, mycological and pathological findings in turkeys experimentally infected by Aspergillus fumigatus Francoise Femenia, Jean-Jacques Fontaine, Sybille Lair-Fulleringer, Nadia Berkova, Dominique
More informationLUNGWORMS IN WHITE-TAILED DEER OF THE SOUTHEASTERN UNITED STATES*
Journl of Wildlife Diseses Vol. 7, July, 1971 149 LNGWORMS IN WHITETAILED DEER OF THE SOTHEASTERN NITED STATES* ANNIE K. PRESTWOOD, T JAMES F. SMITH, [i nd JOHN 8RWN Southestern oopertive Wildlife Disese
More informationEfficacy of noviflumuron gel bait for control of the German cockroach, Blattella germanica (Dictyoptera: Blattellidae) laboratory studies
Pest Mngement Science Pest Mng Sci 62:434 439 (2006) Efficcy of noviflumuron gel it for control of the Germn cockroch, Blttell germnic (Dictyopter: Blttellide) lortory studies Chnglu Wng nd Gry W Bennett
More informationKnowledge, attitude and practice of antibiotics prescribing among medical officers of public health care facilities in the state of Kedah, Malaysia
ORIGINAL ARTICLE Knowledge, ttitude nd prctice of ntibiotics prescribing mong medicl officers of public helth cre fcilities in the stte of Kedh, Mlysi Tn Wei Leong, MD*, Siti Rhmh@Noor Syhireen Mohmmed,
More informationAn Integrated Population Pharmacokinetic Meta-Analysis of Propofol in Morbidly Obese and Nonobese Adults, Adolescents, and Children
Originl Article Cittion: CPT: Phrmcometrics & Systems Phrmcology (13), e73; doi:1.138/psp.13.7 13 ASCPT All rights reserved 163-836/1 www.nture.com/psp An Integrted Popultion Phrmcokinetic Met-Anlysis
More informationSedation in the PICU is vital for patient comfort and to
Long-Term Dexmedetomidine Use nd Sfety Profile Among Criticlly Ill Children nd Neontes* Lest D. Whlen, MD; Jne L. Di Gennro, MD; Gretchen A. Irby, PhrmD; Ofer Yny, MD; Jerry J. Zimmermn, MD, PhD, FCCM
More informationResearch with Finnsheep
I j, I Agriculture Cnd Reserch Brnch Direction generte de l recherche Technicl Bulletin 1991-2E Reserch with Finnsheep in Cnd * ' - * Cnd Digitized by the Internet Archive in 2011 with funding from Agriculture
More informationPostantibiotic Sub-MIC Effects of Vancomycin, Roxithromycin, Sparfloxacin, and Amikacin
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Sept. 1992, p. 1852-1858 0066-4804/92/091852-07$02.00/0 Copyright X) 1992, Americn Society for Microiology Vol. 36, No. 9 Postntiiotic Su-MIC Effects of Vncomycin,
More informationPrevalence and Antimicrobial Resistance of Enterococcus Species Isolated from Retail Meats
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Dec. 2003, p. 7153 7160 Vol. 69, No. 12 0099-2240/03/$08.00 0 DOI: 10.1128/AEM.69.12.7153 7160.2003 Prevlence nd Antimicrobil Resistnce of Enterococcus Species Isolted
More informationGenetic divergence of early song discrimination between two young songbird species
In the formt provided y the uthors nd unedited. Genetic divergence of erly song discrimintion etween two young songird species Dvid Whetcroft* nd Ann Qvrnström SUPPLEMENTARY INFORMATION VOLUME: 1 ARTICLE
More informationHow do cuckoos find their hosts? The role of habitat imprinting
ANIMAL BEHAVIOUR, 1998, 56, 1425 1433 Article No. r980931 How do cuckoos find their hosts? The role of hbitt imprinting YVONNE TEUSCHL, BARBARA TABORSKY & MICHAEL TABORSKY Konrd Lorenz-Institut für Vergleichende
More informationfact sheet Stage 1: Puppy breeding & raising Puppy Breeding
fct sheet Stge 1: Puppy breeding & rising It tkes two yers nd costs more thn $35,000 to trnsform plyful puppy into responsible Guide Dog. Not ll pups re suitble for guiding people who re vision impired.
More informationEFFECTS OF SODIUM AND MAGNESIUM SULFATE IN DRINKING WATER ON MALLARD DUCKLINGS
EFFETS OF SODIUM AND MAGNESIUM SULFATE IN DRINKING WATER ON MALLARD DUKLINGS Authors: S. A. Mitchm, nd G. Wobeser Source: Journl of Wildlife Diseses, 24(1) : 3044 Published By: Wildlife Disese Assocition
More informationEVALUATION OF S FOR FLY (DIPTERA: MUSCIDAE) CONTROL AS A FEED-THROUGH COMPOUND FOR POULTRY, CATTLE, AND SWINE'
EVALUATION OF S-31183 FOR FLY (DIPTERA: MUSCIDAE) CONTROL AS A FEED-THROUGH COMPOUND FOR POULTRY, CATTLE, AND SWINE' R. W. Miller Livestock Insects Lbortory, LPS! ARS, USDA Beltsville, MD 275 (Accepted
More informationThere are important differences between blood transfusions
Revised My 2012 1 CE Credit Idiosyncrsies in Feline Blood Trnsfusions DeeDee Schumcher, CVT, VTS (ECC), MEd Des Moines Are Community College Ankeny, Iow There re importnt differences between blood trnsfusions
More informationRomain Béraud, Louis Huneault, Dave Bernier, Francis Beaudry, Ann Letellier, Jérôme R.E. del Castillo. Abstract. Résumé
Article Comprison of the selection of ntimicroil resistnce in fecl Escherichi coli during enrofloxcin dministrtion with locl drug delivery system or with intrmusculr injections in swine model Romin Bérud,
More informationA.S. Fairchild, J.L. Grimes, J.K. Porter, W.J. Croom, Jr., L.R. Daniel and W.M. Hagler, Jr. 1
Interntionl Journl of Poultry Science 4 (6): 350-355, 005 ISSN 68-8356 sin Network for Scientific Informtion, 005 Effects of Dicetoxyscirpenol nd Fusric cid on Poults: Individul nd Comined Effects of Dietry
More informationInsecticide Resistance of the Green Rice Leafhopper, Nephotettix cincticeps, to the Systemic Insecticides Used for Seedling-Box Application
ScienceAsi 31 (25): 151-158 Insecticide Resistnce of the Green Rice Lefhopper, Nephotettix cincticeps, to the Systemic Insecticides Used for Seedling-Box Appliction Jirpong Jirin,* Nouki Kojim nd Toru
More informationet.al.2002;sartori et.al.2001 Finisher Gonzales et.al.(2000) adlibitum Dry matter
5 6 Suget et.l. Sleh et.l,6 Leeson Zuir Gonzles et.l.(000) Tumov et.l.00;srtori et.l.00 Finisher Brto 6 Dgs& Bustri, Bene et.l. 00 Hood C : P 6 6 C : P 5 6 6 dliitum 6 5 6 Dry mtter 5 Orgnic mtter A.O.A.C
More informationIMMOBILIZATION OF POLAR BEARS (Ursus maritimus, PHIPPS) WITH KETAMINE HYDROCHLORIDE AND XYLAZINE HYDROCHLORIDE
IMMOBILIZATION OF POLAR BEAR (rsus mritimus, PHIPP) WITH KETAMINE HYDROCHLORIDE AND XYLAZINE HYDROCHLORIDE Author(s): J. LEE, R CHWEINBRG, FAYE KERNAN nd J. HAIGH ource: Journl of Wildlife Diseses, 17(3):331-336.
More informationTowards a better understanding of the respective effects of milk yield and body condition dynamics on reproduction in Holstein dairy cows
Animl (2012), 6:3, pp 476 487 & The Animl Consortium 2011 doi:10.1017/s175173111100173x niml Towrds etter understnding of the respective effects of milk yield nd ody condition dynmics on reproduction in
More informationResearch Archive. DOI: Document Version: This is the Published Version. Copyright and Reuse: 2014 The Author(s).
10.1073/pns.1303053111 10.1073/pns.1303053111 10.1073/pns.1303053111 Reserch Archive Cittion for published version: M. K. Rust, et l, Susceptibility of Ct Fles (Siphonpter: Pulicide) to Fipronil nd Imidcloprid
More informationAre stray dogs confined in animal shelters at increased risk of seropositivity to Leishmania infantum? A case control study
12 SARIDOMICHELAKIS (M.N.) AND COLLABORATORS Are stry dogs confined in niml shelters t incresed risk of seropositivity to Leishmni infntum? A cse control study M.N. SARIDOMICHELAKIS 1 *, K.N. APOSTOLIDIS
More informationEffects of certain anthelmintics on the survival and reproduction of Euoniticellus intermedius (Reiche) (Coleoptera: Scarabaeidae)
Effects of certin nthelmintics on the survivl nd reproduction of Euoniticellus intermedius (Reiche) (Coleopter: Scrbeide) By Crmen Tin Jcobs Submitted in prtil fulfilment of the requirements for the degree
More informationMetabolizable Energy Requirements for Broiler Breeder in Different Environmental Temperatures
Interntionl Journl of Poultry Science 11 (7): 453-461, 2012 ISSN 1682-8356 Asin Network for Scientific Informtion, 2012 Metolizle Energy Requirements for Broiler Breeder in Different Environmentl Tempertures
More informationAntibiotic prescribing for sore throat: a cross-sectional analysis of the ReCEnT study exploring the habits of early-career doctors in family practice
Fmily Prctice, 2016, Vol. 33, No. 3, 302 308 doi:10.1093/fmpr/cmw014 Advnce Access publiction 18 Mrch 2016 Helth Service Reserch Antibiotic prescribing for sore throt: cross-sectionl nlysis of the ReCEnT
More informationPrevalence of Darkling Beetles (Alphitobius diaperinus) and Bacterial Load in Broiler Litters
Interntionl Journl of Poultry Science 6 (6): 440-444, 007 ISSN 168-8356 Asin Network for Scientific Informtion, 007 Prevlence of Drkling Beetles (Alphitoius diperinus) nd Bcteril Lod in Broiler Litters
More informationEffects of Management of Domestic Dogs and Recreation on Carnivores in Protected Areas in Northern California
Contriuted Pper Effects of Mngement of Domestic Dogs nd Recretion on Crnivores in Protected Ares in Northern Cliforni SARAH E. REED AND ADINA M. MERENLENDER Deprtment of Environmentl Science, Policy &
More informationWool causing injuries to legs and feet of Oystercatchers
Wool cusing injuries to legs nd feet of Oysterctchers By P. J. Dre nd A. J. Mercer Fisheries Experiment Sttion, Conwy, Cernrvonshire (Plte 38) INTRODUCTION Although mny diseses nd deformities of the legs
More informationDo stallions recognize the estrous state by smelling the odor of mares?
EAAP 213 Nntes Frnce Horse Commission Session Do stllions recognize the estrous stte by smelling the odor of mres? C Brint (1), A Boukkz (2), Y Gudé (3), I Couty (4), D Guillume (4), JM Yvon (3), Y Murin
More informationBand-tailed Pigeon Population Status, 2010
University of Nebrsk - Lincoln DigitlCommons@University of Nebrsk - Lincoln US Fish & Wildlife Publictions US Fish & Wildlife Service 2010 Bnd-tiled Pigeon Popultion Sttus, 2010 Todd A. Snders U.S. Fish
More informationPatch choice of avian herbivores along a migration trajectory From Temperate to Arctic
Bsic nd Applied Ecology 8 (2007) 354 363 www.elsevier.de/be Ptch choice of vin herbivores long migrtion trjectory From Temperte to Arctic A.J. vn der Grf,, J. Sthl b, G.F. Veen c, R.M. Hving, R.H. Drent
More informationASPECTS OF THE BREEDING BIOLOGY OF THE GENTOO PENGUIN PYGOSCELIS PAPUA AT VOLUNTEER BEACH, FALKLAND ISLANDS, 2001/02
ASPECTS OF THE BREEDING BIOLOGY OF THE GENTOO PENGUIN PYGOSCELIS PAPUA AT VOLUNTEER BEACH, FALKLAND ISLANDS, 2001/02 HELEN M. OTLEY, 1 ANDREA P. CLAUSEN, 1 DARREN J. CHRISTIE 1 & KLEMENS PÜTZ 2 1 Flklnds
More informationToxicity interaction of fipronil and imidacloprid against Coptotermes formasanus
Louisin Stte University LSU Digitl Commons LSU Mster's Theses Grdute School 2010 Toxicity interction of fipronil nd imidcloprid ginst Coptotermes formsnus Pn Luo Louisin Stte University nd Agriculturl
More informationUse of episcleral cyclosporine implants in dogs with keratoconjunctivitis sicca: pilot study
Veterinry Ophthlmology (2015) 18, 3, 234 241 DOI:10.1111/vop.12173 Use of episclerl cyclosporine implnts in dogs with kertoconjunctivitis sicc: pilot study Lur rchetti,* ntonell Rmpzzo, Crlo M. Mortellro,*
More information