Tatiana Baranovich Tatsuo YAMAMOTO Tomomi TAKANO Wataru HIGUCHI Akihito NISHIYAMA
|
|
- Jared Wilkins
- 5 years ago
- Views:
Transcription
1 Tatiana Baranovich Tatsuo YAMAMOTO Tomomi TAKANO Wataru HIGUCHI Akihito NISHIYAMA MRSA1961 MRSA hospital-acquired MRSA HA-MRSA MRSA MRSA MRSA The prevalence of MRSA ranges from 0.6 in The Netherlands to 66.6 in JapanDeurenberg 2007 MRSA MRSA MRSA 1 3 MRSA MRSA MRSA community-acquired MRSA CA -MRSA 2 MRSA ST CC spa agr SCC mec SE MIC ST multilocus sequence type 7 housekeeping MRSA website ST CC ST founder MRSA ST30 MRSA MRSA PFGE SCCmec meca DNA DNA methicillin-susceptible S. aureus MSSA SCCmec MRSA SCCmec I V I 39.3 kbii 58.2 kbiii kb MSSA MRSA MRSA IV kb V 28.6 kbmssa MRSA MRSA IV V MSSA SCCmec MRSA Division of Bacteriology, Department of Infectious Disease Control and International Medicine, Niigata University Graduate School of Medical and Dental Sciences (1-757 Asahimachidori, Chuo-ku, Niigata-shi)
2 MSSA MRSA ST CC eburst MRSA 4 MRSA pandemic MRSA 7 New York Japan ST5 SCCmecII Pediatric ST5 SCCmecIVBerlin ST45 SCCmecIV Iberian ST247 SCCmecIABrazilian ST239 SCCmecIII EMRSA-15 ST22 SCCmecIV EMRSA-16 ST36 SCCmecII MRSA New York Japan ST5 SCCmecII TSST-1 SEC SEL SaPI1 SEG SEI SEM SEN SEO egc MRSA 48 MRSA 50 MRSA MRSA MRSA 1 MRSA 48 MRSA MSM MRSA 2 ST1 ST8 ST ST ST8 ST1 ST8 ST80 ST59 ST30 Panton-Valentine PVL
3 EMRSA-16 clone Berlin clone ST 36 sea +, tst +, egc + ST 45 sea -, tst -, egc + EMRSA-15 clone ST 22 sea -, tst -, egc + Pediatric clone ST 5 sea -, tst -, egc + Iberian clone ST 247 sea +, tst -, egc - Hungarian clone ST 239 sea +, tst -, egc - NY/ Japan clone ST 5 sea -/+, tst +, egc + NY/ Japan clone ST 5 sea -, tst -, egc + Brazilian clone S. aureus MSSA Insertion of SCCmec MRSA MRSA ST 239 sea -, tst -, egc - Europe Africa ST : 1, 5, 8, 22, 30, 36, 37, 59, 80, 377, 766 SCCmec : IV, V Europe Resistance : FA, KM, TC, EM or others Drug resistance : EM, CLDM Oceania ST : 30, 93 SCCmec : IVa Western Samoa New Zealand ST : 1, 8 Canada SCCmec : IV, IVa Russia Alaska Resistance : Norway EM, CLDM, MU or others Scotland Finland ST : 30 The Netherlands DenmarkLatvia ST : 30 North America United Kingdom SCCmec : IVc Canada France Belgium Germany Resistance : None Switzerland North Dakota Portugal Minnesota Italy Greece Vladivostok Russia Turkey Japan California USA Algeria ST : 80 China Japan USA Egypt Asia Texas ST : 30 ST : 1, 8, 30, 59, 72 Egypt ST : 30 Taiwan Taiwan SCCmec : IVa ST : 30 ST : 59 ST : 59 SCCmec : IV Resistance : SCCmec : V EM, CLDM, TC, MU, KM, SCCmec: IV, V T Resistance : None or GM Resistance : None LVFX or others Oceania Australia Queens land South America ST : 30 Brazil SCCmec : IV Brazil Resistance : None Resistance : None, TC or others Deaths due to necrotizing or fatal pneumonia Resistance to non-ß-lactam antimicrobial agents MU : mupirocin MRSA
4 ST1 20ST8 33 PVL SSTI UTI 2 7 Waterhouse- Friderichsen PVL 75 MRSA CDC community-acquired pneumonia CAP 6 MRSA CAP CDC MRSA CAP IDSA ATS 2007 SARS H5N1 MRSA moderate recommendation level III evidence 5 PVL MRSA USA400 USA400 USA400 ST80 ST80 ST377 ST30 ST59 : SCCmecIV MRSA USA400 MW2 : ST1 : spa227 SCCmecIVa USA300T8 : SCCmecIV USA300 ST8 : spa008 SCCmecIVa USA300 ST8 : SCCmecIVa ST30 : agr3 SCCmecV USA300 ST8 : spa8 SCCmecIVa CDC 1999 CDC 1999 CDC 1999 CDC 1999 Dufour2002 Dufour2002 Garnier2006 Wannet2005 Francis2005 Peleg2004 Gilbert2006 Tseng2005 CDC 2007 Martin2006 Enany2007 Sifiri2007
5 PVL S 32 kda F 34 kda S F PVL 5 nm Bcl-2 c caspase-9 caspase nm PVL PVL -S PVL 2 1 Labandeira-Rey 2007 PVL PVL protein A Spa Spa PVL Spa TNF PVL IL -8 B 4 Voyich 8 PVL MRSA ST765, spa43, SCCmecIVx ST30, spa19, SCCmecIVc SCCmecIV ST30, spa19, SCCmecIVc ST30, spa19, SCCmecIVc ST30 ST30, spa19, SCCmecIVa ST30 GM GM GM Yamamoto2006 Yamamoto2006 Hisata2005 Takizawa2004 Takizawa2004 Okubo2007 6, 7 PVL
6 2006 PVL MRSA PVL PVL Voyich PVL MRSA ST8 USA300 9 SCCmecIVa-ACME ACME arca δ-hemolysin hld ΦSA3usa Fibrin-specific blood-colt dissolving enzyme sak Chemotaxis inhibitory Protein chs Truncated β-hemolysin hlb mec orfx 2.16 Mbp Leukocidin ED luke-lukd γ-hemolysin hlga,c,b SCCmec a 24 kb A (S) Agr regulon agrb, D, C, A SCCmec IVa ACME SCCmec IVa MecA (PBP2 ) meca 2.9/0 Mbp ACME type I B (F) C (S) aroe arcc Arginine deiminase arca ΦSA2usa CA-MRSA USA300 (ST8) 2,872,769bp S F Protein A spa Coagulase (III) coa ACME31kb α-hemolysin hla mec complex ccr complex arc cluster opp-3 cluster glpf gmk yqil Oligopeptide permease operon opp Mbp Panton-Valentine leukocidin (PVL) luks-pv-lukf-pv pta tpi Arginine deiminase pathway (arc cluster) Oligopeptide permease system (opp-3 cluster) SET set Mbp Staphylococcal accessory regulator A sara Clumping factor clfa SEK sek SEQ seq SAPI5 IS431 meca mecr1 IS1272 ccrb2 ccra2 arcc arcb arcd arca arcr arca : arginin deiminase opp-3a opp-3b opp-3c opp-3d opp-3f DR SCCmec DR ACME DR ACME AGAAGCTTATCATAAATGATGCGGTTTTT AAAAACCGCATCATTAACTGATAAGCAGAAGCGTATCACAA AAAAACCGCATCATTAACCGATACGCAGAGGCGTATCATAA IR SCCmec IR SCCmec IR ACME MRSA ST8 USA300 9 SCCmecIVa ACME DNA GenBank accession no. CP000255
7 Opp-3 MRSA SCCmecIVa SCCmecIVa SCCmecIVa-ACME S. pyogenes streptococcal acid glycoprotein ph ph L- L- ACME L- ATP ATP arc ACME USA300 Opp-3 opp-1 opp-2 MRSA PVL MRSA PVL MRSA, MRSA bica-mrsa ST89 ST91 MRSA ST8 bica-mrsa MRSA 88 MRSA SSTI hemodynamic instability 5cm SSTI
8 PVL MRSA pusa02 pusa03 PVL MRSA ST30 ST59 ST8 USA300 ST80 B inducible tetk aph3 -IIIa aade ermb cat blaz gyra tetk erm iles iles iles iles msra, ermc tetk mupa ermc tetk aph3 -III far Takizawa2005 Takano2008 Diep2006 Tenover2006 Han2007 Tristan2007 MRSA - ST empiric therapy MRSA MRSA D-zone test MRSA 20 FDA MRSA SSTI ST MRSA Cruciani
9 Conte, 2002 ; Wunderink, 2003 MRSA Wunderink, 2003 ; Kollef, 2004 in vitro PVL PVL Dumitrescu, 2007 MRSA MRSA MRSA Daum, 2007 MRSA MRSA 1 Centers for Disease Control and Prevention.: Four pediatric deaths from community-acquired meticillin-resistant Staphylococcus aureus-minnesota and North Dakota, , Morb. Mortal. Wkly. Rep. : , Vandenesch, F., Naimi, T., Enright, M. C., Lina, G., Nimmo, G. R., Heffernan, H., Liassine, N., Bes, M., Greenland, T., Reverdy, M. E., and Etienne, J.: Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes : worldwide emergence, Emerg. Infect. Dis. : , Zetola, N., Francis, J. S., Nuermberger, E. L., and Bishai, W. R.: Community-acquired meticillin-resistant Staphylococcus aureus : an emerging threat, Lancet Infect. Dis. : , Brumfitt, W. and Hamilton-Miller, J.: Methicillin-resistant Staphylococcus aureus. N. Engl. J. Med. : , Daum, R. S.: Clinical practice. Skin and soft-tissue infections caused by methicillin-resistant Staphylococcus aureus. N. Engl. J. Med. : , Genestier, A. L., Michallet, M. C., Préost, G., Bellot, G., Chalabreysse, L., Peyrol, S., Thivolet, F., Etienne, J., Lina, G., Vallette, F. M., Vandenesch, F., and Genestier, L.: Staphylococcus aureus Panton-Valentine leukocidin directly targets mitochondria and induces Bax-independent apoptosis of human neutrophils. J. Clin. Invest. : , Labandeira-Rey, M., Couzon, F., Boisset, S., Brown, E. L., Bes, M., Benito, Y., Barbu, E. M., Vazquez, V., Höök, M., Etienne, J., Vandenesch, F., and Bowden, M. G.: Staphylococcus aureus Panton-Valentine leukocidin causes necrotizing pneumonia. Science. : , Voyich, J. M., Otto, M., Mathema, B., Braughton, K. R., Whitney, A. R., Welty, D., Long, R. D., Dorward, D. W., Gardner, D. J., Lina, G., Kreiswirth, B. N., and DeLeo, F. R.: Is Panton-Valentine leukocidin the major virulence determinant in community-associated methicillin-resistant Staphylococcus aureus disease? J. Infect. Dis. : , Diep, B. A., Gill, S. R., Chang, R. F., Phan, T. H., Chen, J. H., Davidson, M. G., Lin, F., Lin, J., Carleton, H. A., Mongodin, E. F., Sensabaugh, G. F., and Perdreau-Remington, F.: Complete genome sequence of USA300, an epidemic clone of community-acquired meticillin-resistant Staphylococcus aureus. Lancet. : , 2006.
Significant human pathogen. SSTI Biomaterial related infections Osteomyelitis Endocarditis Toxin mediated diseases TSST Staphylococcal enterotoxins
Staphylococcus aureus Significant human pathogen. SSTI Biomaterial related infections Osteomyelitis Endocarditis Toxin mediated diseases TSST Staphylococcal enterotoxins Quintessential Pathogen? Nizet
More informationStaphylococcus aureus
Staphylococcus aureus Significant human pathogen. SSTI Biomaterial related infections Osteomyelitis Endocarditis Toxin mediated diseases TSST Staphylococcal enterotoxins Quintessential Pathogen? Nizet
More informationCommunity-acquired methicillin-resistant Staphylococcus aureus: community transmission, pathogenesis, and drug resistance
J Infect Chemother (2010) 16:225 254 DOI 10.1007/s10156-010-0045-9 REVIEW ARTICLE Community-acquired methicillin-resistant Staphylococcus aureus: community transmission, pathogenesis, and drug resistance
More informationGeoffrey Coombs 1, Graeme Nimmo 2, Julie Pearson 1, Samantha Cramer 1 and Keryn Christiansen 1
Community Onset MRSA Infections in Australia: A Tale of Two Clones Geoffrey Coombs 1, Graeme Nimmo 2, Julie Pearson 1, Samantha Cramer 1 and Keryn Christiansen 1 Community Associated MRSA First isolated
More informationEffect of Antibiotics on Staphylococcus aureus Producing Panton-Valentine Leukocidin
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 2007, p. 1515 1519 Vol. 51, No. 4 0066-4804/07/$08.00 0 doi:10.1128/aac.01201-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Effect
More informationResearch Article Genotyping of Methicillin Resistant Staphylococcus aureus Strains Isolated from Hospitalized Children
International Pediatrics, Article ID 314316, 4 pages http://dx.doi.org/10.1155/2014/314316 Research Article Genotyping of Methicillin Resistant Staphylococcus aureus Strains Isolated from Hospitalized
More informationReemergence of antibiotic-resistant Staphylococcus aureus in the genomics era
Reemergence of antibiotic-resistant Staphylococcus aureus in the genomics era Frank R. DeLeo, Henry F. Chambers J Clin Invest. 2009;119(9):2464-2474. https://doi.org/10.1172/jci38226. Review Series Staphylococcus
More informationReceived 12 July 2006/Returned for modification 17 August 2006/Accepted 4 October 2006
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Dec. 2006, p. 4077 4086 Vol. 50, No. 12 0066-4804/06/$08.00 0 doi:10.1128/aac.00847-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Molecular
More informationORIGINAL ARTICLE /j x
ORIGINAL ARTICLE 10.1111/j.1469-0691.2007.01718.x Clonal spread of SCCmec type IV methicillin-resistant Staphylococcus aureus between community and hospital Y. H. Huang 1, S. P. Tseng 1,J.M.Hu 1, J. C.
More informationEpidemiology and Outcomes of Community-Associated Methicillin-Resistant Staphylococcus aureus Infection
JOURNAL OF CLINICAL MICROBIOLOGY, June 2007, p. 1705 1711 Vol. 45, No. 6 0095-1137/07/$08.00 0 doi:10.1128/jcm.02311-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Epidemiology
More informationRoyal College of Surgeons in Ireland N H. Amir Beaumont Hospital, Dublin A S. Rossney St James's Hospital Dublin
Royal College of Surgeons in Ireland e-publications@rcsi Clinical Microbiology Articles Department of Clinical Microbiology --00 Spread of community-acquired meticillin-resistant Staphylococcus aureus
More informationCA-MRSA a new problem in Indonesia?
CA-MRSA a new problem in Indonesia? Latre Buntaran Clinical Microbiologist Consultant Indonesia Coordinator of ANSORP Study Secretary General of INASIC Community Associated MRSA Papua New Guinea Asia Europe
More informationMolecular Characterization of Staphylococcus aureus Isolates from a Contemporary (2005) ACCEPTED
AAC Accepts, published online ahead of print on 18 June 2007 Antimicrob. Agents Chemother. doi:10.1128/aac.01588-06 Copyright 2007, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationEpidemiology of MRSA in Australia
Epidemiology of MRSA in Australia Graeme R Nimmo Director, Division of Microbiology Pathology Queensland Central Laboratory, Herston QLD 429 Tel: (7) 3636 8 Fax: (7) 3636 1336 Email: Graeme_Nimmo@health.
More informationClinical Microbiology Newsletter
Clinical Microbiology Newsletter $95 Vol. 31, No. 20 www.cmnewsletter.com October 15, 2009 Epidemiology and Virulence of Community-Associated MRSA Adam D. Kennedy, Ph.D. and Frank R. DeLeo, Ph.D., Laboratory
More informationORIGINAL ARTICLE /j x
ORIGINAL ARTICLE 10.1111/j.1469-0691.2008.02064.x Community-associated Staphylococcus aureus infections and nasal carriage among children: molecular microbial data and clinical characteristics G. Sdougkos
More informationPresence and Molecular Epidemiology of Virulence Factors in Methicillin-Resistant Staphylococcus aureus Strains Colonizing and Infecting Soldiers
JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2009, p. 940 945 Vol. 47, No. 4 0095-1137/09/$08.00 0 doi:10.1128/jcm.02352-08 Copyright 2009, American Society for Microbiology. All Rights Reserved. Presence and
More informationMethicillin resistant Staphylococcus aureus (MRSA) in pigs, the Spanish experience
Methicillin resistant Staphylococcus aureus (MRSA) in pigs, the Spanish experience M. Concepción Porrero, José-Francisco Fernández- Garayzabal, Ana Mateos and Lucas Domínguez cporrero@visavet.ucm.es Food-borne
More informationClindamycin suppresses virulence expression in inducible clindamycin resistant Staphylococcus aureus strains
https://doi.org/10.1186/s12941-018-0291-8 Annals of Clinical Microbiology and Antimicrobials SHORT REPORT Open Access Clindamycin suppresses virulence expression in inducible clindamycin resistant Staphylococcus
More informationHong-Kai Wang 1, Chun-Yen Huang 1 and Yhu-Chering Huang 1,2*
Wang et al. BMC Infectious Diseases (2017) 17:470 DOI 10.1186/s12879-017-2560-0 RESEARCH ARTICLE Open Access Clinical features and molecular characteristics of childhood communityassociated methicillin-resistant
More informationMICROBIOLOGICAL SURVEY FOR METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS IN VETERINARY PATIENTS AND GENOTYPIC CHARACTERIZATION OF THE ISOLATES
MICROBIOLOGICAL SURVEY FOR METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS IN VETERINARY PATIENTS AND GENOTYPIC CHARACTERIZATION OF THE ISOLATES By KATHERINE LYNN MALDONADO A THESIS PRESENTED TO THE GRADUATE
More informationJ M e d A l l i e d S c i ; 6 ( 2 ) : w w w. j m a s. i n. P r i n t I S S N : O n l i n e I S S N : X
J M e d A l l i e d S c i 2 0 1 6 ; 6 ( 2 ) : 5 6-6 0 w w w. j m a s. i n P r i n t I S S N : 2 2 3 1 1 6 9 6 O n l i n e I S S N : 2 2 3 1 1 7 0 X Journal of M e d i cal & Allied Sciences Original article
More informationPrevalence and Molecular Characteristics of Methicillin-resistant Staphylococcus aureus Isolates in a Neonatal Intensive Care Unit
Journal of Bacteriology and Virology 2016. Vol. 46, No. 2 p.99 103 http://dx.doi.org/10.4167/jbv.2016.46.2.99 Communication Prevalence and Molecular Characteristics of Methicillin-resistant Staphylococcus
More informationCommunity-Associated Methicillin-Resistant Staphylococcus aureus: Epidemiology and Clinical Consequences of an Emerging Epidemic
CLINICAL MICROBIOLOGY REVIEWS, July 2010, p. 616 687 Vol. 23, No. 3 0893-8512/10/$12.00 doi:10.1128/cmr.00081-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Community-Associated
More informationCommunity-associated methicillin-resistant Staphylococcus aureus infections
British Medical Bulletin Advance Access published April 1, 2010 Community-associated methicillin-resistant Staphylococcus aureus infections Fiona J. Cooke and Nicholas M. Brown * Clinical Microbiology
More informationMRSA. ( Staphylococcus aureus; S. aureus ) ( community-associated )
005 16 190-194 ( Staphylococcus aureus; S. aureus ) ( community-associated ) ( -susceptible Staphylococcus auerus; MSSA ) ( -resistant Staphylococcus auerus; ) ( ) ( -lactam ) ( glycopeptide ) ( Staphylococcus
More informationCommunity-Associated Methicillin-Resistant Staphylococcus aureus Case Studies
Chapter 2 Community-Associated Methicillin-Resistant Staphylococcus aureus Case Studies Madeleine G. Sowash and Anne-Catrin Uhlemann Abstract Over the past decade, the emergence of community-associated
More informationOne issue associated with Staphylococcus aureus is the development of drug resistance.
Abstract One issue associated with Staphylococcus aureus is the development of drug resistance. A recently emerged strain of MRSA, ST398, has been identified as livestock-associated and transmission has
More informationAntimicrobial Resistance and Molecular Epidemiology of Staphylococcus aureus in Ghana
Antimicrobial Resistance and Molecular Epidemiology of Staphylococcus aureus in Ghana Beverly Egyir, PhD Noguchi Memorial Institute for Medical Research Bacteriology Department, University of Ghana Background
More informationFifteen-Year Study of the Changing Epidemiology of Methicillin-Resistant Staphylococcus aureus
The American Journal of Medicine (2006) 119, 943-951 CLINICAL RESEARCH STUDY AJM Theme Issue: Infectious Disease Fifteen-Year Study of the Changing Epidemiology of Methicillin-Resistant Staphylococcus
More informationCommunity-onset Staphylococcus aureus infections presenting to general practices in South-eastern Australia
Epidemiol. Infect. (2014), 142, 501 511. Cambridge University Press 2013 doi:10.1017/s0950268813001581 Community-onset Staphylococcus aureus infections presenting to general practices in South-eastern
More informationACCEPTED. Association between staphylococcal PVL gene and a lower inhospital. survival in Pulmonary Patients. Spain. Científicas (CSIC), Madrid, Spain
JCM Accepts, published online ahead of print on 8 November 006 J. Clin. Microbiol. doi:10.118/jcm.003-06 Copyright 006, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationAnnual survey of methicillin-resistant Staphylococcus aureus (MRSA), 2014
Annual survey of methicillin-resistant Staphylococcus aureus (MRSA), 2014 Helen Heffernan, Sarah Bakker, Kristin Dyet, Deborah Williamson Nosocomial Infections Laboratory, Institute of Environmental Science
More informationLarge screening of CA-MRSA among Staphylococcus aureus colonizing healthy young children living in two areas (urban and rural) of Portugal
RESEARCH ARTICLE Open Access Research article Large screening of CA-MRSA among Staphylococcus aureus colonizing healthy young children living in two areas (urban and rural) of Portugal Débora A Tavares
More informationGlobal distribution of Panton-Valentine leukocidin positive methicillin-resistant Staphylococcus aureus, 2006.
Global distribution of Panton-Valentine leukocidin positive methicillin-resistant Staphylococcus aureus, 2006. Anne Tristan, Michèle Bes, Hélène Meugnier, Gérard Lina, Bülent Bozdogan, Patrice Courvalin,
More informationStaphylococcus aureus
The National Reference Centre (NRC) for S. aureus of Université Libre de Bruxelles (ULB) provides the following tasks: - Identification and antimicrobial susceptibility testing of Staphylococcus sp. strains
More informationAnnual survey of methicillin-resistant Staphylococcus aureus (MRSA), 2015
Annual survey of methicillin-resistant Staphylococcus aureus (MRSA), 2015 Helen Heffernan and Sarah Bakker Nosocomial Infections Laboratory, Institute of Environmental Science and Research Limited (ESR);
More informationAbstract. Introduction. Editor: G. Lina
ORIGINAL ARTICLE BACTERIOLOGY Impact of psm-mec in the mobile genetic element on the clinical characteristics and outcome of SCCmec-II methicillin-resistant Staphylococcus aureus bacteraemia in Japan T.
More informationMethicillin resistant Staphylococcus aureus (MRSA) Lina Cavaco
Methicillin resistant Staphylococcus aureus (MRSA) Lina Cavaco licav@food.dtu.dk 1 DTU Food, Technical University of Denmark Staphylococcus aureus Gram positive cocci Catalase positive Coagulase postive
More informationHelen Heffernan and Sarah Bakker Nosocomial Infections Laboratory, Institute of Environmental Science and Research Limited (ESR); October 2018
2017 survey of methicillin-resistant Staphylococcus aureus (MRSA) Helen Heffernan and Sarah Bakker Nosocomial Infections Laboratory, Institute of Environmental Science and Research Limited (ESR); October
More informationSpread of a methicillin-resistant Staphylococcus aureus ST80 strain in the community of the northern Netherlands
Eur J Clin Microbiol Infect Dis (2007) 26:723 727 DOI 10.1007/s10096-007-0352-y CONCISE ARTICLE Spread of a methicillin-resistant Staphylococcus aureus ST80 strain in the community of the northern Netherlands
More informationCommunity2acquired methicill in2resistant St a p hyl ococcus a ureus
376 : ; ; ; :R978. 11 :A :100927708 (2005) 0620376205 Community2acquired methicill in2resistant St a p hyl ococcus a ureus W A N G Fu. ( I nstit ute of A ntibiotics, H uashan Hos pit al, S hang hai 200040,
More information2016 Sabaheta Bektas, Amina Obradovic, Mufida Aljicevic, Fatima Numanovic, Dunja Hodzic, Lutvo Sporisevic
DOI: 10.5455/msm.2016.28.61-65 Received: 05 December 2015; Accepted: 11 January 2016 2016 Sabaheta Bektas, Amina Obradovic, Mufida Aljicevic, Fatima Numanovic, Dunja Hodzic, Lutvo Sporisevic This is an
More informationStaphylococcus aureus Programme 2007 (SAP 2007) Hospital Survey MRSA Epidemiology and Typing Report
AGAR The Australian Group on Antimicrobial Resistance http://antimicrobial-resistance.com Staphylococcus aureus Programme 2007 (SAP 2007) Hospital Survey MRSA Epidemiology and Typing Report PREPARED BY:
More informationEpidemiology of community MRSA obtained from the UK West Midlands region.
Epidemiology of community MRSA obtained from the UK West Midlands region. J. Rollason a, L. Bastin b, A. C. Hilton a, D. G. Pillay c, T. Worthington a, C. Mckeon c, P. De c, K. Burrows c and P. A. Lambert
More informationCommunity-acquired methicillin-resistant Staphylococcus aureus in Taiwan
CA-MRSA J Microbiol in Immunol TaiwanInfect 2005;38:376-382 Community-acquired methicillin-resistant Staphylococcus aureus in Taiwan Chih-Jung Chen, Yhu-Chering Huang Division of Pediatric Infectious Diseases,
More informationSolmaz Ohadian Moghadam 1, Mohammad Reza Pourmand 1,, Mahmood Mahmoudi 2 and Hooman Sadighian 3. RESEARCH LETTER Taxonomy & Systematics ABSTRACT
FEMS Microbiology Letters, 362, 2015, fnv043 doi: 10.1093/femsle/fnv043 Advance Access Publication Date: 20 March 2015 Research Letter RESEARCH LETTER Taxonomy & Systematics Molecular characterization
More informationEpidemiological Characteristics of Methicillin-Resistant Staphylococcus aureus Isolates from Children with Eczematous Atopic Dermatitis Lesions
JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 2008, p. 991 995 Vol. 46, No. 3 0095-1137/08/$08.00 0 doi:10.1128/jcm.00698-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Epidemiological
More informationTrends in Prescribing -Lactam Antibiotics for Treatment of Community-Associated Methicillin-Resistant Staphylococcus aureus Infections
JOURNAL OF CLINICAL MICROBIOLOGY, Dec. 2007, p. 3930 3934 Vol. 45, No. 12 0095-1137/07/$08.00 0 doi:10.1128/jcm.01510-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Trends in
More informationPrevalence of Panton-Valentine leukocidin-positive methicillinsusceptible Staphylococcus aureus infections in a Saudi Arabian hospital
Journal of Infection and Public Health (2015) 8, 364 368 Prevalence of Panton-Valentine leukocidin-positive methicillinsusceptible Staphylococcus aureus infections in a Saudi Arabian hospital Ali M. Bazzi
More informationA 12-year survey of methicillin-resistant Staphylococcus aureus infections in Greece: ST80-IV epidemic?
ORIGINAL ARTICLE BACTERIOLOGY A 12-year survey of methicillin-resistant Staphylococcus aureus infections in Greece: ST80-IV epidemic? E. Drougka 1,2, A. Foka 1,2, A. Liakopoulos 3, A. Doudoulakakis 4,
More informationCommunity-Associated Methicillin-Resistant Staphylococcus aureus: A Review
Complete Table of Contents for Pharmacotherapy Subscription Information for Pharmacotherapy Community-Associated Methicillin-Resistant Staphylococcus aureus: A Review Michael J. Rybak, Pharm.D., and Kerry
More informationPopulation genetic structures of Staphylococcus aureus isolates from cats and dogs in Japan.
JCM Accepts, published online ahead of print on 21 March 2012 J. Clin. Microbiol. doi:10.1128/jcm.06739-11 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Population genetic
More informationThe molecular epidemiology of methicillin-resistant Staphylococcus aureus (MRSA) in the major countries of East Asia
Boston University OpenBU Theses & Dissertations http://open.bu.edu Boston University Theses & Dissertations 2017 The molecular epidemiology of methicillin-resistant Staphylococcus aureus (MRSA) in the
More informationVirulence and Resistance Determinants of German Staphylococcus aureus ST398 Isolates from Nonhuman Sources
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, May 2011, p. 3052 3060 Vol. 77, No. 9 0099-2240/11/$12.00 doi:10.1128/aem.02260-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Virulence
More informationACCEPTED. Division of pediatric infectious diseases, Chang Gung Children s Hospital and Chang
JCM Accepts, published online ahead of print on 1 October 00 J. Clin. Microbiol. doi:./jcm.0-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationInt.J.Curr.Microbiol.App.Sci (2018) 7(8):
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 08 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.708.378
More informationStaphylococcus aureus ST121: a globally disseminated hypervirulent clone
Journal of Medical Microbiology (2015), 64, 1462 1473 DOI 10.1099/jmm.0.000185 Review Staphylococcus aureus ST121: a globally disseminated hypervirulent clone Qing Rao, Weilong Shang, Xiaomei Hu and Xiancai
More informationAbstract. Background. Editor: G. Lina
ORIGINAL ARTICLE BACTERIOLOGY Evidence of transmission of a Panton Valentine leukocidin-positive community-acquired methicillin-resistant Staphylococcus aureus clone: a family affair P. Cocchi 1, G. Taccetti
More informationINTRODUCTION Horinouchi, Hachioji, Tokyo , Japan , Japan. Japan
Journal of Medical Microbiology (2008), 57, 1251 1258 DOI 10.1099/jmm.0.2008/002824-0 Molecular epidemiology and antimicrobial susceptibilities of 273 exfoliative toxin-encodinggene-positive Staphylococcus
More informationRyuta Yonezawa, 1 Tsukasa Kuwana, 2 Kengo Kawamura, 1 and Yasuji Inamo Introduction. 2. Case Presentation
Hindawi Publishing Corporation Case Reports in Pediatrics Volume 2015, Article ID 291025, 6 pages http://dx.doi.org/10.1155/2015/291025 Case Report Invasive Community-Acquired Methicillin-Resistant Staphylococcus
More informationKey words. blaz. Staphylococcus aureus
Key words I II blaz Staphylococcus aureus Macrococcus caseolyticus S. aureus group S. haemolyticus group S. rosti group S. delphini group 300 S. fleurettii 20 200 Dinosaur meca 0 Extinct 0 S. auricularis
More informationEmergence and Characterization of Community-Associated Methicillin-Resistant Staphyloccocus aureus Infections in Denmark, 1999 to 2006
JOURNAL OF CLINICAL MICROBIOLOGY, Jan. 2009, p. 73 78 Vol. 47, No. 1 0095-1137/09/$08.00 0 doi:10.1128/jcm.01557-08 Copyright 2009, American Society for Microbiology. All Rights Reserved. Emergence and
More informationSignificado y Manejo de Infecciones Causadas por Stafilococo aureus Meticilino Resistente
Significado y Manejo de Infecciones Causadas por Stafilococo aureus Meticilino Resistente Jose G. Montoya, MD Associate Professor of Medicine Associate Chief for Clinical Affairs Division of Infectious
More informationK. M. Campbell A. F. Vaughn K. L. Russell B. Smith D. L. Jimenez C. P. Barrozo J. R. Minarcik N. F.Crum M. A. K. Ryan. Reportt No.
NAVAL HEALTH RESEARCH CENTER RISK FACTORS FOR COMMUNITY-ACQUIRED METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS (CAMRSA) INFECTIONS IN MILITARY TRAINEES: REVIEW OF AN OUTBREAK IN SAN DIEGO, CALIFORNIA, 2002
More informationThis is an author version of the contribution published on: Corcione S,Motta I,Fossati L,Campanile F,Stefani S,Cavallo R,Di Perri G,Ranieri VM,De Rosa FG Molecular epidemiology of methicillin-resistant
More informationMethicillin/Oxacillin-resistant Staphylococcus aureus as a hospital and public health threat in Brazil
Methicillin/Oxacillin-resistant Staphylococcus aureus as a hospital and public health threat in Brazil OrIGINAl ArTIClE ABSTRACT Methicillin-resistant Staphylococcus aureus is an established nosocomial
More informationSCOTTISH MRSA REFERENCE LABORATORY
Title SCOTTISH MRSA REFERENCE LABORATORY LABORATORY PROCEDURE NUMBER / VERSION User Manual DATE OF ISSUE 17/05/2014 REVIEW INTERVAL AUTHORISED BY AUTHOR 2 Years Dr. B. Jones B. Cosgrove COPY 1 of 1 Master
More informationDeborah A. Williamson 1,2,3 *, Sally A. Roberts 2, Stephen R. Ritchie 1, Geoffrey W. Coombs 4,5, John D. Fraser 1, Helen Heffernan 3.
Clinical and Molecular Epidemiology of Methicillin- Resistant Staphylococcus aureus in New Zealand: Rapid Emergence of Sequence Type 5 (ST5)-SCCmec-IV as the Dominant Community-Associated MRSA Clone Deborah
More informationAnnual survey of methicillin-resistant Staphylococcus aureus (MRSA), 2008
Annual survey of methicillin-resistant Staphylococcus aureus (MRSA), 2008 Each year ESR conducts a one-month survey of methicillin-resistant Staphylococcus aureus (MRSA) to provide ongoing information
More informationDetection of Panton-Valentine Leukocidin (PVL) Genes within CA-MRSA Carriers of the Oral Roberts University Community
96 Detection of Panton-Valentine Leukocidin (PVL) Genes within CA-MRSA Carriers of the Oral Roberts University Community Philipa Osafo-Ampadu Department of Biology and Chemistry, Oral Roberts University,
More informationSCOTTISH MRSA REFERENCE LABORATORY
Title SCOTTISH MRSA REFERENCE LABORATORY LABORATORY PROCEDURE NUMBER / VERSION User Manual DATE OF ISSUE 20/01/2017 REVIEW INTERVAL AUTHORISED BY AUTHOR 1 Year Dr. B. Jones Dr E. Dickson COPY 1 of 1 Master
More informationAntimicrobial Resistance Strains
Antimicrobial Resistance Strains Microbiologics offers a wide range of strains with characterized antimicrobial resistance mechanisms including: Extended-Spectrum β-lactamases (ESBLs) Carbapenamases Vancomycin-Resistant
More informationAntimicrobial Activity of Ceftaroline and ME1036 Tested against Clinical Strains of Community-Acquired ACCEPTED. Helio S Sader 1,2 *,
AAC Accepts, published online ahead of print on 7 January 2008 Antimicrob. Agents Chemother. doi:10.1128/aac.01351-07 Copyright 2008, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationMethicillin-Resistant Staphylococcus aureus
Methicillin-Resistant Staphylococcus aureus By Karla Givens Means of Transmission and Usual Reservoirs Staphylococcus aureus is part of normal flora and can be found on the skin and in the noses of one
More informationMethicillin-resistant Staphylococcus aureus isolates in a hospital of Shanghai
/, 2017, Vol. 8, (No. 4), pp: 6079-6084 Methicillin-resistant Staphylococcus aureus isolates in a hospital of Shanghai Xiaoguang Wang 1, Lin Ouyang 1, Lingfei Luo 1, Jiqian Liu 1, Chiping Song 1, Cuizhen
More informationMRSA as a cause of lung infection including airway infection, communityacquired pneumonia and hospital-acquired pneumonia
Eur Respir J 2009; 34: 1470 1476 DOI: 10.1183/09031936.00122309 CopyrightßERS Journals Ltd 2009 SERIES MRSA AND THE PULMONOLOGIST Edited by M. Woodhead and A. Torres Number 2 in this Series MRSA as a cause
More informationMicrobiological Surveillance of Methicillin Resistant Staphylococcus aureus (MRSA) in Belgian Hospitals in 2003
Microbiological Surveillance of Methicillin Resistant Staphylococcus aureus (MRSA) in Belgian Hospitals in 3 Final report Olivier Denis and Marc J. Struelens Reference Laboratory for Staphylococci Department
More informationCommunity Associated MRSA Dr. Rachel Gorwitz, CDC A Webber Training Teleclass
Community-Associated MRSA: What s Up and What s Next? Rachel Gorwitz, MD, MPH Division of Healthcare Quality Promotion Centers for Disease Control and Prevention Learning Objectives Describe the changing
More informationCommunity-Associated Methicillin-Resistant Staphylococcus aureus: Review of an Emerging Public Health Concern
Community-Associated Methicillin-Resistant Staphylococcus aureus: Review of an Emerging Public Health Concern Timothy D. Drews, MD; Jonathan L. Temte, MD, PhD; Barry C. Fox, MD ABSTRACT Methicillin-resistant
More informationFinalized Article. Shahana Khanam 1, Mohammad Jobayer 2, SM Shamsuzzaman 2, Jalaluddin Ashraful Haq 3, Md Motlabur Rahman 4, Kazi Zulfiquer Mamun 5.
Bangladesh J Med Microbiol 2014; 08 (02): 08-13 Bangladesh Society of Medical Microbiologists Finalized Article Nasal colonization of Methicillin resistant Staphylococcus aureusamong patients during hospital
More informationStaphylococcal Cassette Chromosome mec Types and Staphylococcus aureus Isolates from Maharaj Nakorn Chiang Mai Hospital
Staphylococcal Cassette Chromosome mec Types and Antibiogram of Methicillin-Resistant Staphylococcus aureus Isolates from Maharaj Nakorn Chiang Mai Hospital ชน ดของสแตฟฟ ลโลคอคคอล คาสเซทโครโมโซมเมค เมค
More informationNational MRSA Reference Laboratory
Author: Gráinne Brennan Date: 23/02/2017 Date of Issue: 23/02/2017 National MRSA Reference Laboratory User s Manual NMRSARL Users Manual Page 1 of 12 Table of Contents Page 1. Location... 3 2. Contact
More informationCM&R Rapid Release. Published online ahead of print August 25, 2010 as doi: /cmr
CM&R Rapid Release. Published online ahead of print August 25, 2010 as Original Research Evidence of Multiple Virulence Subtypes in Nosocomial and Community-Associated MRSA Genotypes in Companion Animals
More informationChart showing the average height of males and females in various world countries.
Chart showing the average height of males and females in various world countries. Country/Region Average male height Average female height Sampled Age Range Albania 174.0 cm (5 ft 8 1/2 in) 161.8 cm (5
More informationEuropean poultry industry trends
European poultry industry trends November 5 th 2014, County Monaghan Dr. Aline Veauthier & Prof. Dr. H.-W. Windhorst (WING, University of Vechta) 1 Agenda The European Chicken Meat Market - The global
More informationA web-based interactive tool to explore antibiotic resistance and consumption via maps and charts
http://resistancemap.cddep.org A web-based interactive tool to explore antibiotic resistance and consumption via maps and charts CDDEP first developed ResistanceMap in 21. The new ResistanceMap now includes
More informationTACKLING THE MRSA EPIDEMIC
TACKLING THE MRSA EPIDEMIC Paul D. Holtom, MD Associate Professor of Medicine and Orthopaedics USC Keck School of Medicine MRSA Trend (HA + CA) in US TSN Database USA (1993-2003) % of MRSA among S. aureus
More informationCARRIAGE OF ANTIBIOTIC-RESISTANT STAPHYLOCOCCUS AUREUS BY LIVESTOCK WORKERS AND HOUSEHOLD MEMBERS IN NORTH CAROLINA.
CARRIAGE OF ANTIBIOTIC-RESISTANT STAPHYLOCOCCUS AUREUS BY LIVESTOCK WORKERS AND HOUSEHOLD MEMBERS IN NORTH CAROLINA Maya Nadimpalli A thesis submitted to the faculty of the University of North Carolina
More informationCharacteristics of community- and hospitalacquired meticillin-resistant Staphylococcus aureus strains carrying SCCmec type IV isolated in Malaysia
Journal of Medical Microbiology (2009), 58, 1213 1218 DOI 10.1099/jmm.0.011353-0 Characteristics of community- and hospitalacquired meticillin-resistant Staphylococcus aureus strains carrying SCCmec type
More informationMethicillin-resistant Staphylococcus aureus carriage among veterinary staff and dogs in private veterinary clinics in Hokkaido, Japan
Microbiol Immunol 2014; 58: 149 154 doi: 10.1111/1348-0421.12128 ORIGINAL ARTICLE Methicillin-resistant Staphylococcus aureus carriage among veterinary staff and dogs in private veterinary clinics in Hokkaido,
More informationThe population structure of Staphylococcus aureus among general practice patients from The Netherlands
Postprint Version 1.0 Journal website http://www3.interscience.wiley.com/journal/121668164/abstract Pubmed link http://www.ncbi.nlm.nih.gov/pubmed/19178545 DOI 10.1111/J.1469-0691.2008.02662.X The population
More informationCommunity-Onset Methicillin-Resistant Staphylococcus aureus Skin and Soft-Tissue Infections: Impact of Antimicrobial Therapy on Outcome
MAJOR ARTICLE Community-Onset Methicillin-Resistant Staphylococcus aureus Skin and Soft-Tissue Infections: Impact of Antimicrobial Therapy on Outcome Jörg J. Ruhe, 1,2 Nathaniel Smith, 1,3 Robert W. Bradsher,
More informationRESEARCH NOTE COMMUNITY-ACQUIRED METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS IN A MALAYSIAN TERTIARY CENTRE
RESEARCH NOTE COMMUNITY-ACQUIRED METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS IN A MALAYSIAN TERTIARY CENTRE Zetti Zainol Rashid 1, Norazlah Bahari 1, Amizah Othman 1, Roslinda Jaafar 1, Nurul Azmawati
More informationAntimicrobial Cycling. Donald E Low University of Toronto
Antimicrobial Cycling Donald E Low University of Toronto Bad Bugs, No Drugs 1 The Antimicrobial Availability Task Force of the IDSA 1 identified as particularly problematic pathogens A. baumannii and
More informationEpidemiology of Methicillin-Resistant Staphylococcus aureus
SUPPLEMENT ARTICLE Epidemiology of Methicillin-Resistant Staphylococcus aureus Helen W. Boucher 1 and G. Ralph Corey 2 1 Division of Infectious Diseases, Tufts University Medical School and New England
More informationTreatment and Outcomes of Infections by Methicillin-Resistant Staphylococcus aureus at an Ambulatory Clinic
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Feb. 2007, p. 423 428 Vol. 51, No. 2 0066-4804/07/$08.00 0 doi:10.1128/aac.01244-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Treatment
More informationReceived 19 June 2012; returned 12 July 2012; revised 19 July 2012; accepted 22 July 2012
J Antimicrob Chemother 2012; 67: 2809 2813 doi:10.1093/jac/dks329 Advance Access publication 31 August 2012 The newly described meca homologue, meca LGA251, is present in methicillin-resistant Staphylococcus
More informationMethicillin-Resistant Staphylococcus aureus (MRSA) in Food. Production Animals
Methicillin-Resistant Staphylococcus aureus (MRSA) in Food Production Animals W. VANDERHAEGHEN 1,2 K. HERMANS 2 F. HAESEBROUCK 2 P. BUTAYE 1,2 1 Operational Directorate of Bacterial Diseases, Veterinary
More information