Detection of Panton-Valentine Leukocidin (PVL) Genes within CA-MRSA Carriers of the Oral Roberts University Community
|
|
- Todd Mathews
- 5 years ago
- Views:
Transcription
1 96 Detection of Panton-Valentine Leukocidin (PVL) Genes within CA-MRSA Carriers of the Oral Roberts University Community Philipa Osafo-Ampadu Department of Biology and Chemistry, Oral Roberts University, Tulsa OK Joel Gaikwad Department of Biology and Chemistry, Oral Roberts University, Tulsa OK Abstract: Over the years, the misuse of antibiotics has become a significant factor in the emergence of resistant bacteria. Methicillin-resistant Staphylococcus aureus (MRSA) is staphylococci that are resistant to Beta-lactam drugs. There are two types of MRSA infections: community-acquired MRSA (CA-MRSA) and hospital-acquired MRSA (HA-MRSA). They can be differentiated by the presence of the Panton-Valentine Leukocidin (PVL) gene in the CA- MRSA strain. Studies have shown that CA-MRSA is more virulent than HA-MRSA. The aim of this study is to determine the population of students at Oral Roberts University who are carriers of CA-MRSA. This was done by obtaining nasal swabs from 50 students and performing coagulase and antibiotic susceptibility tests to identify the samples that contained MRSA. Polymerase chain reaction (PCR) was then used to detect the presence of PVL genes in the positive samples using luks-pv, hlg-1 and Sa16 primers. Results showed that 18.0% of the student nasal samples contained MRSA. Of those samples 6.0% were CA-MRSA Oklahoma Academy of Science Introduction Staphylococcus aureus (S. aureus) is a common skin bacterium that only becomes a problem when it enters the skin through a cut, open wound, or breathing tube. These bacteria occur harmlessly in the nasal passages of roughly 30% of the U.S. population, and 20% of the human population are long-term carriers (Staywell et al. 2001). Streptococcus aureus causes several diseases from minor skin infections (boils, pimples, abscesses, scalded skin syndrome) to life-threatening diseases (pneumonia, meningitis, toxic shock syndrome). A recent study by Graffunder and Venezia (2002) has shown that S. aureus is one of the most common causes of nosocomial infections, often causing postsurgical wound infections. Over the years, S. aureus has developed multiple antibiotic resistance mechanisms. The first methicillin resistant strain of S. aureus was isolated from a hospital in the UK in 1942 (Jevons et al.1961). By 1960, 80% of all S. aureus isolates were resistant to Betalactam antibiotics. These strains have gained methicillin resistance through the acquisition of the meca gene (Deurenberg et al. 2006). The meca gene is found on a genetic element known as the staphylococcal chromosomal cassette (SCCmec) and encodes low-affinity penicillin-binding protein (PBP-2a) (de Lencastre et al. 1994). This attribute causes the bacteria to be resistant to methicillin. Methicillin is a Beta-lactam antibiotic, structurally analogous to penicillin, oxacillin, and vancomycin. Under normal circumstances, the β-lactam nucleus binds to PBP-2a in the cell wall and inhibits the synthesis of peptidoglycan, thereby causing bacterial cell
2 Panton-Valentine Leukocidin Genes in MRSA Isolates 97 death (Yocum et al. 1980). However, when the meca gene is expressed, the β-lactam nucleus does not bind to PBP-2a; hence, the cell continues to synthesize peptidoglycan and is able to replicate and survive even in the presence of Beta-lactam antibiotics. Staphylococcus aureus that are resistant to methicillin are classified as Methicillinresistant Staphylococcus aureus (MRSA). MRSA constitutes 30% - 60% of Staphylococcal infections in the USA, Japan, and Europe (Davis et al. 2007). According to the Center for Disease Control, 0.8%-2% of the U.S. population is MRSA carriers; 94,000 people are infected each year, and 19,000 people die as a result (CDC Control and Prevention 2011). MRSA has consequently become a notorious lifethreatening pathogen. MRSA is commonly transmitted through physical contact. Skin-to-skin contact, cuts in the skin, sharing of personal hygiene items (towels, razors), and contact with contaminated items (door handles and athletic equipment) helps spreading this contagious disease. MRSA causes infections such as surgical wound infection, urinary tract infection, pneumonia, and skin infection. The most common signs of MRSA are cellulitis, abscess, folliculitis, and impetigo. There are two strains of MRSA: hospitalacquired MRSA (HA-MRSA) and community-acquired MRSA (CA-MRSA). In recent years, HA-MRSA (85% of MRSA) has become more abundant in hospitals and other healthcare facilities, representing a growing public health problem in the United States (Groom et al. 2008). However, in 2010, encouraging results from a CDC study stated that the invasive MRSA infections in healthcare facilities declined by 28% from 2005 through 2008 (Kallen et al. 2010). On the other hand, it has been discovered that people who have not recently been in the hospital or have had no medical procedure such as dialysis or surgery within the past year are also vulnerable to MRSA infections. This type of MRSA is often known as community-acquired MRSA. Outbreaks of CA-MRSA have been seen among athletes, prisoners, military recruits, daycare attendees, school students, and other groups of people who live in a close quarters and share contaminated items. Though both CA-MRSA and HA-MRSA cause similar infections, both strains differ in the virulence factors they express. Characteristically HA- MRSA s trains elicit staphylococcal enterotoxin A (SEA), while the CA-MRSA produces Panton Valentine Leukocidin (PVL), which is a toxin that belongs to the synergohymenotropic toxin family (Tristan et al. 2007, Dufour et al. 2002). It consists of LukS-PV, LukF-PV, and γ- hemolysin proteins. The association of PVL with five major pandemic clones of CA-MRSA led to the hypothesis that PVL is the key virulence factor for CA-MRSA (Labandeira- Rey et al. 2007, Shallcross et al. 2012, Wannet et al. 2005). The exact mechanism by which PVL toxins harm host cells is not clear. A study by Spann et al (2013) showed that PVL toxin binds to the complement receptors C5aR and C5L2, inhibiting the immune cell activation. Another study indicates that PVL binds to the ganglioside GM1 in cells and causes its cytotoxic effects (Nishiyama et al 2012). PVL has been shown to be a strong inducer of IL-1and inflammasome activation in primary human alveolar macrophages that in turn can trigger the release of chemotactic factors leading to massive neutrophil infiltration of the lung (Perret et al. 2012). Hence, PVL toxin is considered to be responsible for the high mortality rates associated with infection by CA-MRSA (Tristan et al. 2007). Gamma hemolysins (Hlg) are reported to lyse human and other mammalian erythrocytes (Kaneko et al. 2004), PMNs (Joubert et al. 2006, Malachowa et al. 2011), and to enhance the survival of S. aureus in human blood (Malachowa et al. 2011). Karauzum et al (2013) have recently shown that Hlg(B) can form heterologous oligomers with LukS-PV. A report has shown that a combination of Hlg(A) and LukF-PV is hemolytic towards rabbit red blood cells (Prevost et al. 1995). Intravitreal injection of rabbits with six different combinations of PVL and Hlg and comparing these combinations based on ability to induce inflammation and necrosis showed various degrees of symptoms with the following order of severity: Hlg(A) +
3 98 P. Osafa-Ampadu and J. Gaikwad LukF-PV > Hlg(AB) LukS-PV + Hlg(B) PVL > Hlg(CB), suggesting that a variety of new toxins with distinct potencies can be generated by these cross combinations (Siqueira et al. 1997). The above study has clearly demonstrated that the individual virulence factors PVL and Hlg can play a role in clinical infections. In this study, MRSA strains obtained from the Oral Roberts University student population were tested for the presence of Panton Valentine Leukocidin (pvl) and γ- hemolysin gene (hlg). Methods Study design and collection. Nasal swabs were obtained from fifty student volunteers who were recruited for this study. All samples were collected in the microbiology lab in a single day. Briefly, prepackaged sterile cotton swabs (Puritan Medical Products, Gilford, ME) were removed from the packing and soaked briefly 20 sec in sterile water. The moistened swab tip was then inserted into the volunteer student s right nostril and rotated gently for 5 seconds. The same procedure was done on the right nostril. The sample swabs were immediately placed into Tryptic Soy Broth (TSB) and incubated for 18 hours at 37 ºC. Each sample was then streaked onto Mannitol Salt Agar (MSA, Carolina Biological Supply Co, Burlington, NC) plates and incubated for 18 hours at 37 ºC to select for members of the genus Staphylococcus. Two isolated colonies of Staphylococcus were taken from each positive MSA plate, streaked onto a TSB slant, and incubated for 18 hours at 37 ºC. Coagulase test. The Staphylo Monotec Test Kit (Sigma Aldrich, St. Louis, MO) was used to confirm Staphylococcus aureus identity. As per the manufacturer instructions, a drop of control reagent was placed on an analysis card, and a small amount of the sample (Staphylococcus) was mixed with the reagent. A test reagent was then added to the mixture, and mixed for less than 20 seconds to observe agglutination on the analysis card. A coagulase positive culture of Staphylococcus aureus (Presque Isle Cultures, Erie, PA, catalog number 4651) was used as a positive control. Antibiotic resistance test. The use of methicillin has been discontinued. Oxacillin is in the same class of drugs as methicillin and was chosen as the agent of choice for testing staphylococci in the early 1990s. The acronym MRSA is still used to describe these isolates because of its historic role. Sensitivity to oxacillin (1ug), and vancomycin (30 ug) (Beckton Dickenson and Company, San Diego, CA) was performed by disk diffusion method. Coagulase-positive cultures were regrown in TSB broth for 18 hours at 37 ºC. Approximately 1 ml of culture was spread on Muller Hinton agar plate (Carolina Biological Supply Co, Burlington, NC) and allowed to dry at room temperature. The antibiotic discs were then placed on the agar plate and incubated for 18 hours at 37 ºC. The zone of inhibition was measured using a ruler to determine the sensitivity of the bacteria according to the manufacturer s instructions. Genomic DNA extraction. The extraction of genomic DNA was performed on resistant strains using the PureLink Genomic DNA Kit (Life Technologies, Grand Island, NY). TSB cell culture (1 ml) was taken from each sample and placed in a 1.5-ml micro centrifuge tube and centrifuged. The supernatant was discarded and the cell pellet was suspended in 180 μl of lysozyme solution (20 mg/ml). The solution was incubated for 30 minutes at 37 ºC, treated with 20 μl Proteinase K and 200 μl PureLink genomic lysis/binding buffer. The solution was again incubated for 30 minutes at 55 ºC, and the DNA was extracted by running the lysate through a PureLink spin column. The bound DNA in the column was eluted with Millipore water. PVL and γ-hemolysin gene analysis. Extracted genomic DNA was used as a template for amplification. Oligonucleotide primers of pvl and hlg genes were used to obtain amplification of luks-pv and hlg, respectively. The primer set sequences for the genes were as follows: For luks-pv: 5' ATCATTAGGTAAAATGTCTGGACATGAT CCA 3' and 5' GCATCAASTGTATTGGATAGCAAAAGC 3. The expected amplicon size is 533 base pairs. For hlg: 5' GCCAATCCGTTATTAGAAAATGC 3' and 5' CCATAGACGTAGCAACGGAT 3' The expected amplicon size is 937 base pairs.
4 Panton-Valentine Leukocidin Genes in MRSA Isolates 99 The 16S rrna sequence for S. aureus, Sa16, was used as an internal control. The primer set for Sa16 was: 5 GAAAGCCACGGCTAACTACG 3 and 5 CATTTCACCGCTACACATGG 3. The expected amplicon size is 203 bp. PCR primers were designed using the freeware Primer 3 (Rozen et al. 2000). In brief, the PCR protocol consisted of an initial denaturation at 94 ºC for 2 min; 30 cycles of 30 s denaturation at 94 ºC, 30 s of annealing at 55 ºC, and 1 min of extension at 72 ºC. The PCR products were resolved by electrophoresis through a 1.5% agarose gel. Results MSA plate: Staphylococcus strains were recovered from 29 out of 50 (58.0%) were staphylococcus positive as shown by the production of acid on the selective MSA agar (Fig 1) nonpathogenic Staphylococcus isolates, which are usually coagulase-negative. Coagulase test was positive for the 13 out of 29 S. aureus culture (44.0%) samples tested (Fig. 2). Figure 2. Coagulase test to identify pathogenic Staphylococcus aureus. (A) No agglutination observed on the analysis card, indicating a negative coagulase test (B) Positive coagulase test showing agglutination on the analysis card. Isolate is Staphylococcus aureus and likely pathogenic. Figure 1. MSA plate after 18 hours at 37 C inoculated with nasal swabs. (A. Upper) MSA plate showing growth of non-staphylococci; as indicated by the absence of yellow colonies. (B. Lower) MSA plate showing growth of Staphylococci, indicated by the presence of yellow colonies. Coagulase test: Coagulase test is used to differentiate the potentially pathogenic species, Staphylococcus aureus from other Antibiotic resistance: The analysis of oxacillin and vancomycin zone of inhibition was compared to the standard values provided by the manufacturer to determine the susceptibility or resistance to the antibiotics. Out of 50 samples, 9 samples (18%) were resistant to oxacillin and vancomycin antibiotics; these were considered to be MRSA. The use of methicillin has been discontinued. Oxacillin, which is in the same class of drugs as methicillin, is chosen as the agent of choice for testing Staphylococci (NCCLS). The acronym MRSA is still used to describe these isolates because of its historic role. The diameter of the zone of inhibition
5 100 P. Osafa-Ampadu and J. Gaikwad measured from these samples was within the range that was considered to be resistant as per the manufacturer (Fig. 3). Figure 3. Result of antibiotic susceptible test. (Upper left half) The sensitivity of the isolate to oxacillin with zone of inhibition of 19 mm. (Lower bottom half) The sensitivity of the isolate to vancomycin with zone of inhibition of 14 mm. PVL(pvl) and γ-hemolysin (hlg) gene analysis: PCR for pvl, hlg and Sa16 genes was carried out in separate tubes. The genomic DNA isolated from the bacterial strains was subjected to PCR to amplify genes for pvl and hlg genes. Of the 9 samples tested, 8 samples (88%) showed an amplicon size of ~ 937 bp as expected for the hlg gene; 2 out of 9 samples (22%) showed fragments for both pvl (amplicon size 533) and hlg genes, and 1 out of 9 samples (11%) showed fragment only for pvl gene (Fig. 4A). This indicated that 6.0% (pvl positive) of the samples are CA- MRSA. All PCR samples using the Sa16 primers as an internal control yielded a fragment of expected size, 203 bp, except for sample 38 (Fig. 4B) Discussion MRSA is no longer limited to the hospitalized, but also occurs among otherwise healthy communities. Such communityacquired MRSA is an emerging pathogen that primarily causes skin and soft tissue infections. A marked increase in CA-MRSA infection among people living in a closed area is demonstrated in the present study. Carriers of CA-MRSA in the Oral Roberts University student community were identified by detecting the presence of PVL genes among 50 isolates of bacteria randomly collected from students. In this study, it was found that more than half of the samples (58.0%) contained Staphylococcus. These samples produced acid by-product that reacted with the phenol in the MSA plate to convert the red color of the plate to yellow. The frequency of Staphylococcus in our samples is consistent with the known prevalence of the bacteria in humans. There are over 30 different types of staphylococci, but Staphylococcus aureus causes most staph infections. Staphylococcus aureus is part of the human flora, and its ability to clot plasma is the most widely accepted measure for identification. Coagulase test is often used to identify Staphylococcus aureus from other Staphylococcus species (Ryan 2004). From this study, it was determined that 26.0% of the student samples were positive for coagulase and were thus positive for Staphylococcus aureus. Based on previous research, 11-32% of healthy adults are carriers (Tolan 2011). Therefore, our results were consistent with previous estimates of the incidence of Staphylococcus aureus in the general population. The increasing use of antibiotics is a factor in the occurrence of MRSA. Over time, Staphylococcus aureus has developed mechanisms that impart it resistance to multiple antibiotics. Oxacillin and vancomycin (βlactams) were used during the study to determine percentage of samples that were MRSA. In this study we report that 18.0% (9/50) of the samples were resistant to the antibiotics. MRSA has been identified to be one of the leading causes of nosocomial infections. MRSA was originally isolated from patients in health care facilities; however, it has become increasingly common among healthy people who have not been living in the hospital. This change in disease distribution is illustrated in this study, which concludes that 6.0% of the students are carriers of community-acquired MRSA. CA-MRSA can be differentiated from HA-MRSA by the presence of pvl and/or hgl
6 Panton-Valentine Leukocidin Genes in MRSA Isolates 101 Figure 4. PCR for the identification of hlg and pvl genes. (A) Amplicon for pvl seen in three samples, 26, 25, and 32. All samples showed the presence of hlg amplicon, except 26. (h = hlg, p = pvl, L = DNA ladder: top arrow 1000 bp, bottom arrow 500bp,). (B) PCR results showing PCR products for Sa16 primers as an internal control genes. Vandenesch et al (2003) described CA-MRSA clones in three continents that were tested positive for pvl gene specific sequences. The clones from Oceania showed the presence of both pvl and hlg sequences. During this research, PCR was used to amplify the PVL genes to validate the study by determining the prevalence of CA-MRSA within the population. The products observed in 6.0% of the samples indicated that those samples contained PVL-producing isolates. In a study of 123 uninfected children, 59.0% carried Staphylococcus aureus, and 2% were carriers of CA-MRSA (Sdougkos 2008). Our study corroborates this prevalence of CA- MRSA among healthy people. Conclusion MRSA is a major pathogen and threat to lives worldwide. Therefore, strategies must be taken to prevent this infection. Incision and Drainage (I&D) and Oral Antimicrobial Therapy are the two clinical approaches that are most useful in treating MRSA. As the name suggests, Incision and Drainage is a minor surgical procedure to release (drain) the pus under the skin (abscess) by using a sterile instrument such as a sharp needle to puncture the skin. In the case of Oral Antimicrobial Therapy, cultures of bacteria are taken from the infected person, and several antibiotics are used to test for the susceptibility of the bacteria. Every strain of bacteria is susceptible to a specific antibiotic; hence, it is important to identify the antibiotics before prescribing to the infected person. Even though these clinical approaches can be helpful, it is advisable to take strategies such as keeping personal items uncontaminated, covering open wounds, and washing hands in order to prevent the transmission of MRSA. Acknowledgments We would like to thank the Department of Biology and Chemistry, Oral Roberts University for funding this project. We are grateful to all the student volunteers at ORU that made this project possible. The technical help provided by Leslie Davis is highly appreciated. References Centers for Disease Control and Prevention MRSA in Healthcare Settings. < tlight_2006.html> 28 Nov Davis, SL, Perri, MB, Donabedian, SM, et al Epidemiology and outcomes of community-associated methicillin-resistant Staphylococcus aureus infection. J. Clin Microbiol Dufour, P, Gillet, Y, Bes, M, Vandenesch, F, Flores, D, et al CA-MRSA infection in France: emergence of a single clone that produces PVL. Clin Infect Dis 35; Deurenberg, RH, Vink, C, Kalenic, S, Friedrich,
7 102 P. Osafa-Ampadu and J. Gaikwad AW, Bruggeman, CA, Stobberingh, E E The Molecular Evolution of Methicillin-Resistant Staphylococcus aureus. Clin Microbio Infect. 13: De Lencastre, H, de Jonge, BL, Matthews, PR, Tomasz, A Molecular aspects of methicillin resistance in Staphylococcus aureus. J Antimicrob Chemother 33(1):7-24. Graffunder, EM, Venezia, RA Risk factors associated with nosocomial methicillin-resistant Staphylococcus aureus (MRSA) infection including previous use of antimicrobials. J Antimicrob Chemother. 49: Groom, VA, Wolsey, HD, Naimi, ST, Smith, K, Johnson, S, Boxrud, D, Moore AK, Cheek, EJ Community-Acquired Methicillin- Resistant Staphylococcus aureus in a Rural American Indian Community. J of Amer Med Assoc. 286: Huang, H, Flynn, NM, King, JH, Monchaud, C, Morita, M, Cohen, SH Comparisons of Community-Associated Methicillin- Resistant Staphylococcus aureus (MRSA) and Hospital-Associated MRSA Infections in Sacramento, California. J Clinic Microbio. 44: Joubert, O, Viero, G, Keller, D, Martinez, E, Colin, DA, Monteil, H, Mourey, L, Dalla, M, Prevost, G Engineered covalent leucotoxin heterodimers form functional pores: Insights into S-F interactions. Biochem. J. 396: Jevons, MP Cel-benin resistant Staphylococci. Br. Med. J. 1, Lina, G, Piemont, Y, Godail-Gamot, F, Bes, M, Peter, MO, Gauduchon, V, Vandenesch, F, Etienne, J Involvement of Panton- Valentine Leukocidin Prodicing Staphylococcus aureus In Primary Skin. Clin Infect Diseases 29(5):1128. Kallen, AJ1, Mu, Y, Bulens, S, Reingold, A, Petit, S, Gershman, K, Ray, SM, Harrison, LH, Lynfield, R, Dumyati, G, Townes, JM, Schaffner, W, Patel, PR, Fridkin, SK Health care-associated invasive MRSA infections, JAMA 304(6): Kaneko, J, Kamio, Y Bacterial twocomponent and hetero-heptameric poreforming cytolytic toxins: structures, poreforming mechanism, and organization of the genes. Biosci. Biotechnol. Biochem. 68: Karauzum, H, Adhikari, RP, Sarwar, J, Devi, VS, Abaandou, L, Haudenschild, C, Mahmoudieh, M, Boroun, AR, Vu, H, Nguyen, T., et al Structurally designed attenuated subunit vaccines for S. Aureus Luks-PV and Lukf-PV confer protection in a mouse bacteremia model. PLoS ONE 8, e Kluytmans-VandenBergh, M FQ, Kluytmans, JA Community-Acquired Methicillin-Resistant Staphylococcus aureus: Current Perspectives. Clinic Microbio and Infec. 12:9-15. Labandeira-Rey, M, Couzon, F, Boisset, S, Brown, EL, Bes, M, Benito, Y, Barbu, EM, Vazquez, V, Hook, M., et al Staphylococcus aureus panton-valentine leukocidin causes necrotizing pneumonia. Science 315, Malachowa, N, Whitney, AR, Kobayashi, SD, Sturdevant, DE, Kennedy, AD, Braughton K.R., Shabb D.W., Diep B.A., Chambers H.F., Otto M., et al. Global changes in staphylococcus aureus gene expression in human blood. PLoS ONE 2011, 6, e Nathwani, D, Morgan, M, Masterton, RG, Dryden, M, Cookson, B D, French, G, Lewis, D Guidelines for OK practice for the diagnosis and management of methicillin-resistant Staphylococcus aureus (MRSA) infections presenting in the community. J Antimicrob Chemother. 61: National Foundation for Infectious Diseases. Diagnosis and Treatment of Serious Antimicrobial-Resistant Staphylococcus aureus Infection. Nov < e/staph.html> 28 Nov The National Committee for Clinical Laboratory Standards. M100-S13. Performance Standards for Antimicrobial Susceptibility Testing. Thirteenth Informational Supplement. Nishiyama, A, Isobe, H, Iwao, Y, Takano, T, Hung, WC, Taneike, I, Nakagawa, S, Dohmae, S, Iwakura, N and Yamamoto, T. Accumulatio of staphylococcal PVL in the detergent-resistant membrane microdomains on the target cells is essential for its cytotoxicity FEMS Immunol Med Microbiol 66(3): Perret, M, Badiou, C, Lina, G, Burbaud, S, Benito, Y, Bes, M, Cottin, V, Couzon, F,
8 Panton-Valentine Leukocidin Genes in MRSA Isolates 103 Juruj, C, Dauwalder, O., et al. 2012, Cross- Talk between staphylococcus aureus leukocidins-intoxicated macrophages and lung epithelial cells triggers chemokine secretion in an inflammasome-dependent manner. Cell. Microbiol. 14, Prevost, G, Cribier, B, Couppie, P, Petiau, P, Supersac, G, Finck-Barbancon, V, Monteil, H, Piemont, Y Panton-Valentine leucocidin and gamma-hemolysin from staphylococcus aureus Atcc are encoded by distinct genetic loci and have different biological activities. Infect. Immun. 63, Ryan, KJ, Ray, C (ed) Sherris Medical Microbiology, McGraw Hill. Siqueira, JA, Speeg-Schatz, C, Freitas, FI, Sahel, J, Monteil, H, Prevost G Channel-Forming leucotoxins from staphylococcus aureus cause severe inflammatory reactions in a rabbit eye model. J. Med. Microbiol. 46, Shallcross, LJ, Fragaszy, E, Johnson, AM, Hayward, AC The role of the pantonvalentine leucocidin toxin in staphylococcal disease: A systematic review and metaanalysis. Lancet Infect. Dis. 13, Staywell, Krames. "MRSA Infections on the Rise." Health Information. Brigham and Women's Hospital, 21 Feb < g/library/wellness/1,4139> 28 Nov Sdougkos, G Clinical Microbiology and Infection Issue 11 Spann, AN, Henry, T, van Rooijen, WJ, Perret, M, Badiou, C, Aerts PC, Kemmink, J, de Hass, CJ, van Kessei, KP, Vandenesch, F, Lina, G, van Strijp, J The Staphylococcal toxin PVL targets human C5a receptors. Cell Host Microbe. 13(5): Rozen, S and Skaletsky H Primer 3 on the WWW for general users and for biologist programmers. In: Krawetz S,Misener S(eds) Bioinformatics Methods and Protocols: Methods in Mole Biology. Humana Press, Totowa, NJ. Pp The Medical News, Latest Medical News and Research from Around the World. What is Staphylococcus aureus? < medical.net/health/what-is-staphylococcus- Aureus.aspx > 28 Nov Tolan, RW. "Staphylococcus aureus Infection." Medscape Reference. WebMD Professional, 22 Nov < 358-overview> 7 Dec Tristan, A, Ferry, T, Durand, G, Dauwalder, O, Bes, M, Lina, G, Vandenesch, F, Etiene, J Virulence determinants in Community and hospital methicillin resistant Staphylococcus aureus. J Hosp Infection 65(52): Vandenesch, F, Naimi, T, Enright, M, Lina G, et al CA-MRSA carrying PVL genes: Worldwide emergence. Emerging Infectious Diseases 9(8): Wannet, WJ, Spalburg, E, Heck, ME, Pluister, GN, Tiemersma, E, Willems, RJ, Huijsdens, XW, de Neeling, AJ, Etienne, J Emergence of virulent methicillin-resistant staphylococcus aureus strains carrying panton-valentine leucocidin genes in the Netherlands. J. Clin. Microbiol. 43, Yocum, RR, Rasmussen, JR, Strominger, JL The mechanism of action of penicillin. Penicillin acrylates the active site of B. steaorothermophilus D-ala carboxypeptidase.. J Biol Chem. 255(9): Received August 15, 2014 Accepted November 5, 2014
Methicillin-Resistant Staphylococcus aureus
Methicillin-Resistant Staphylococcus aureus By Karla Givens Means of Transmission and Usual Reservoirs Staphylococcus aureus is part of normal flora and can be found on the skin and in the noses of one
More informationInt.J.Curr.Microbiol.App.Sci (2018) 7(8):
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 08 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.708.378
More informationCa-MRSA Update- Hand Infections. Washington Hand Society September 19, 2007
Ca-MRSA Update- Hand Infections Washington Hand Society September 19, 2007 Resistant Staph. Aureus Late 1940 s -50% S.Aureus resistant to PCN 1957-80/81 strain- of S.A. highly virulent and easily transmissible
More informationEDUCATIONAL COMMENTARY - Methicillin-Resistant Staphylococcus aureus: An Update
EDUCATIONAL COMMENTARY - Methicillin-Resistant Staphylococcus aureus: An Update Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain
More informationAntimicrobial Resistance and Molecular Epidemiology of Staphylococcus aureus in Ghana
Antimicrobial Resistance and Molecular Epidemiology of Staphylococcus aureus in Ghana Beverly Egyir, PhD Noguchi Memorial Institute for Medical Research Bacteriology Department, University of Ghana Background
More informationOne issue associated with Staphylococcus aureus is the development of drug resistance.
Abstract One issue associated with Staphylococcus aureus is the development of drug resistance. A recently emerged strain of MRSA, ST398, has been identified as livestock-associated and transmission has
More information*Corresponding Author:
Original Research Article DOI: 10.18231/2394-5478.2017.0098 Prevalence and factors associated with the nasal colonization of Staphylococcus aureus and Methicillin-Resistant Staphylococcus aureus among
More informationStaphylococcus aureus
Staphylococcus aureus Significant human pathogen. SSTI Biomaterial related infections Osteomyelitis Endocarditis Toxin mediated diseases TSST Staphylococcal enterotoxins Quintessential Pathogen? Nizet
More informationToday s Agenda: 9/30/14
Today s Agenda: 9/30/14 1. Students will take C List Medical Abbreviation Quiz. 2. TO: Discuss MRSA. MRSA MRSA Methicillin Resistant Staphylococcus Aureus Methicillin Resistant Staphylococcus Aureus What
More informationSignificant human pathogen. SSTI Biomaterial related infections Osteomyelitis Endocarditis Toxin mediated diseases TSST Staphylococcal enterotoxins
Staphylococcus aureus Significant human pathogen. SSTI Biomaterial related infections Osteomyelitis Endocarditis Toxin mediated diseases TSST Staphylococcal enterotoxins Quintessential Pathogen? Nizet
More informationDetection of inducible clindamycin resistance among clinical isolates of Staphylococcus aureus in a tertiary care hospital
ISSN: 2319-7706 Volume 3 Number 9 (2014) pp. 689-694 http://www.ijcmas.com Original Research Article Detection of inducible clindamycin resistance among clinical isolates of Staphylococcus aureus in a
More informationImpact of a Standardized Protocol to Address Outbreak of Methicillin-resistant
Impact of a Standardized Protocol to Address Outbreak of Methicillin-resistant Staphylococcus Aureus Skin Infections at a large, urban County Jail System Earl J. Goldstein, MD* Gladys Hradecky, RN* Gary
More informationMRSA Outbreak in Firefighters
MRSA Outbreak in Firefighters Angie Carranza Munger, MD Resident, Occupational and Environmental Medicine The University of Colorado, Denver and National Jewish Health Candidate, Masters of Public Health
More informationIsolation of MRSA from the Oral Cavity of Companion Dogs
InfectionControl.tips Join. Contribute. Make A Difference. https://infectioncontrol.tips Isolation of MRSA from the Oral Cavity of Companion Dogs By: Thomas L. Patterson, Alberto Lopez, Pham B Reviewed
More informationGeoffrey Coombs 1, Graeme Nimmo 2, Julie Pearson 1, Samantha Cramer 1 and Keryn Christiansen 1
Community Onset MRSA Infections in Australia: A Tale of Two Clones Geoffrey Coombs 1, Graeme Nimmo 2, Julie Pearson 1, Samantha Cramer 1 and Keryn Christiansen 1 Community Associated MRSA First isolated
More informationConsequences of Antimicrobial Resistant Bacteria. Antimicrobial Resistance. Molecular Genetics of Antimicrobial Resistance. Topics to be Covered
Antimicrobial Resistance Consequences of Antimicrobial Resistant Bacteria Change in the approach to the administration of empiric antimicrobial therapy Increased number of hospitalizations Increased length
More informationAntimicrobial Resistance
Antimicrobial Resistance Consequences of Antimicrobial Resistant Bacteria Change in the approach to the administration of empiric antimicrobial therapy Increased number of hospitalizations Increased length
More informationAntimicrobial Resistance Acquisition of Foreign DNA
Antimicrobial Resistance Acquisition of Foreign DNA Levy, Scientific American Horizontal gene transfer is common, even between Gram positive and negative bacteria Plasmid - transfer of single or multiple
More informationMID 23. Antimicrobial Resistance. Consequences of Antimicrobial Resistant Bacteria. Molecular Genetics of Antimicrobial Resistance
Antimicrobial Resistance Molecular Genetics of Antimicrobial Resistance Micro evolutionary change - point mutations Beta-lactamase mutation extends spectrum of the enzyme rpob gene (RNA polymerase) mutation
More informationDetection of Methicillin Resistant Strains of Staphylococcus aureus Using Phenotypic and Genotypic Methods in a Tertiary Care Hospital
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 7 (2017) pp. 4008-4014 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.607.415
More informationPCR detection of Leptospira in. stray cat and
PCR detection of Leptospira in 1 Department of Pathology, School of Veterinary Medicine, Islamic Azad University, Shahrekord Branch, Shahrekord, Iran 2 Department of Microbiology, School of Veterinary
More informationTACKLING THE MRSA EPIDEMIC
TACKLING THE MRSA EPIDEMIC Paul D. Holtom, MD Associate Professor of Medicine and Orthopaedics USC Keck School of Medicine MRSA Trend (HA + CA) in US TSN Database USA (1993-2003) % of MRSA among S. aureus
More informationGeNei TM. Antibiotic Sensitivity. Teaching Kit Manual KT Revision No.: Bangalore Genei, 2007 Bangalore Genei, 2007
GeNei Bacterial Antibiotic Sensitivity Teaching Kit Manual Cat No. New Cat No. KT68 106333 Revision No.: 00180705 CONTENTS Page No. Objective 3 Principle 3 Kit Description 4 Materials Provided 5 Procedure
More informationResearch Article Genotyping of Methicillin Resistant Staphylococcus aureus Strains Isolated from Hospitalized Children
International Pediatrics, Article ID 314316, 4 pages http://dx.doi.org/10.1155/2014/314316 Research Article Genotyping of Methicillin Resistant Staphylococcus aureus Strains Isolated from Hospitalized
More informationMRSA surveillance 2014: Poultry
Vicky Jasson MRSA surveillance 2014: Poultry 1. Introduction In the framework of the FASFC surveillance, a surveillance of MRSA in poultry has been executed in order to determine the prevalence and diversity
More informationM R S A. Methicillin-Resistant Staphylococcus aureus. The Facts
M R S A Methicillin-Resistant Staphylococcus aureus The Facts Michael Parry, M.D. Director of Infectious Diseases and Microbiology Stamford Hospital January 24, 2008 Introduction to Staph aureus Staphylococcus
More informationSummary Report Relating to a Pilot Program to Require Reporting of Methicillin-resistant Staphylococcus aureus
Summary Report Relating to a Pilot Program to Require Reporting of Methicillin-resistant Staphylococcus aureus Prepared by the Texas Department of State Health Services as required by House Bill 1082,
More informationMrsa abscess and cellulitis
Search Mrsa abscess and cellulitis An abscess is a collection of pus that has built up within the tissue of the body. Signs and symptoms of abscesses include redness, pain, warmth, and swelling. The. Staph
More informationPrevalence & Risk Factors For MRSA. For Vets
For Vets General Information Staphylococcus aureus is a Gram-positive, aerobic commensal bacterium of humans that is carried in the anterior nares of approximately 30% of the general population. It is
More informationJ M e d A l l i e d S c i ; 6 ( 2 ) : w w w. j m a s. i n. P r i n t I S S N : O n l i n e I S S N : X
J M e d A l l i e d S c i 2 0 1 6 ; 6 ( 2 ) : 5 6-6 0 w w w. j m a s. i n P r i n t I S S N : 2 2 3 1 1 6 9 6 O n l i n e I S S N : 2 2 3 1 1 7 0 X Journal of M e d i cal & Allied Sciences Original article
More informationCHAPTER 18 THE COCCI OF MEDICAL IMPORTANCE. Learning Objectives
CHAPTER 18 THE COCCI OF MEDICAL IMPORTANCE Gram-positive and gram-negative cocci that cause infection are presented. The difference between commensal and pathogenic strains is explained, because many of
More informationMolecular identification of methicillin resistance and virulence marker in staphylococcus aureus
Research Article Molecular identification of methicillin resistance and virulence marker in staphylococcus aureus N.D Gunawardena 1, V. Thevanesam 2, N Kanakaratne 1, D.Abeysekera 1, A Ekanayake 2, N Perera
More informationRebekah A. Shepherd and Jennifer T. Thomas, Ph.D.
Community-Associated Methicillin-Resistant Staphylococcus aureus Isolate on Belmont University s Campus is Negative for PBP2a as the Mechanism of Resistance Rebekah A. Shepherd and Jennifer T. Thomas,
More informationGram-positive cocci Staphylococci and Streptococcia
Medical microbiology Laboratory Lab 8 Gram-positive cocci Staphylococci and Streptococcia Lecturer Maysam A Mezher Gram positive cocci 1-Staphylococcus. 2-Streptococcus. 3-Micrococcus The medically important
More informationCan you treat mrsa with amoxicillin
Can you treat mrsa with amoxicillin 15-8-2017 Community-associated MRSA You can pick up MRSA outside the hospital, especially if you :. (a related drug developed to treat these germs). Amoxicillin and
More informationIntroduction to Chemotherapeutic Agents. Munir Gharaibeh MD, PhD, MHPE School of Medicine, The university of Jordan November 2018
Introduction to Chemotherapeutic Agents Munir Gharaibeh MD, PhD, MHPE School of Medicine, The university of Jordan November 2018 Antimicrobial Agents Substances that kill bacteria without harming the host.
More informationInternational Journal of Pharma and Bio Sciences SCREENING OF METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS (MRSA) FROM SPUTUM SAMPLES ABSTRACT
Research Article Microbiology International Journal of Pharma and Bio Sciences ISSN 0975-6299 SCREENING OF METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS (MRSA) FROM SPUTUM SAMPLES PRIYANKA SHARMA * Dr. K.
More informationStaphylococcus 8/30/2011. The Genus Staphylococcus. Cell wall. S. aureus. + - Bunch of grapes + berry. Gram-positive aerobic cocci
The Genus Staphylococcus Gram-positive aerobic cocci Staphylococcus Staphylococcus: Micrococcus Peptidococcus Pediococcus Catalase (2H2O2 2H2O + O2) + - Bunch of grapes + berry You will learn soon S. aureus
More informationAntimicrobial Resistance
Antimicrobial Resistance Consequences of Antimicrobial Resistant Bacteria Change in the approach to the administration of Change in the approach to the administration of empiric antimicrobial therapy Increased
More informationCHAPTER 1 INTRODUCTION
1 CHAPTER 1 INTRODUCTION The Staphylococci are a group of Gram-positive bacteria, 14 species are known to cause human infections but the vast majority of infections are caused by only three of them. They
More informationMethicillin Resistant Staphylococcus aureus:
Methicillin Resistant Staphylococcus aureus: Action-Oriented Guidance for Community-Based Prevention Jackie Dawson, PhD Public Health Epidemiologist Chelan, Douglas, Grant, Kittitas, & Okanogan Counties
More informationMulti-Drug Resistant Organisms (MDRO)
Multi-Drug Resistant Organisms (MDRO) 2016 What are MDROs? Multi-drug resistant organisms, or MDROs, are bacteria resistant to current antibiotic therapy and therefore difficult to treat. MDROs can cause
More informationSource: Portland State University Population Research Center (
Methicillin Resistant Staphylococcus aureus (MRSA) Surveillance Report 2010 Oregon Active Bacterial Core Surveillance (ABCs) Office of Disease Prevention & Epidemiology Oregon Health Authority Updated:
More informationMolecular Characterization of Staphylococcus aureus of Camel (Camelus dromedarius) Skin Origin
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 01 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.701.410
More informationTel: Fax:
CONCISE COMMUNICATION Bactericidal activity and synergy studies of BAL,a novel pyrrolidinone--ylidenemethyl cephem,tested against streptococci, enterococci and methicillin-resistant staphylococci L. M.
More informationNasal Carriage Rates of Methicillin Resistant Staphylococcus aureus in Healthy Individuals from a Rural Community in Southeastern United States
World Journal of Medical Sciences 4 (2): 65-69, 2009 ISSN 1817-3055 IDOSI Publications, 2009 Nasal Carriage Rates of Methicillin Resistant Staphylococcus aureus in Healthy Individuals from a Rural Community
More informationSafe Patient Care Keeping our Residents Safe Use Standard Precautions for ALL Residents at ALL times
Safe Patient Care Keeping our Residents Safe 2016 Use Standard Precautions for ALL Residents at ALL times #safepatientcare Do bugs need drugs? Dr Deirdre O Brien Consultant Microbiologist Mercy University
More informationName(s): Period: Date:
Evolution in Action: Antibiotic Resistance HASPI Medical Biology Lab 21 Background/Introduction Evolution and Natural Selection Evolution is one of the driving factors in biology. It is simply the concept
More informationIn-Service Training Program. Managing Drug-Resistant Organisms in Long-Term Care
In-Service Training Program Managing Drug-Resistant Organisms in Long-Term Care OBJECTIVES 1. Define the term antibiotic resistance. 2. Explain the difference between colonization and infection. 3. Identify
More informationBMR Microbiology. Research Article
www.advancejournals.org Open Access Scientific Publisher Research Article A STUDY OF METICILLIN RESISTANT PATTERN ON CLINICAL ISOLATES OF Staphylococcus aureus IN TERTIARY CARE HOSPITALS OF POKHARA Suresh
More informationQ1. (a) Clostridium difficile is a bacterium that is present in the gut of up to 3% of healthy adults and 66% of healthy infants.
Q1. (a) Clostridium difficile is a bacterium that is present in the gut of up to 3% of healthy adults and 66% of healthy infants. C. difficile rarely causes problems, either in healthy adults or in infants.
More informationStaphylococcus aureus nasal carriage in diabetic patients in a tertiary care hospital
Available online at www.scholarsresearchlibrary.com Scholars Research Library Der Pharmacia Lettre, 15, 7 (7):23-28 (http://scholarsresearchlibrary.com/archive.html) ISSN 0975-5071 USA CODEN: DPLEB4 Staphylococcus
More informationVolume-7, Issue-2, April-June-2016 Coden IJABFP-CAS-USA Received: 5 th Mar 2016 Revised: 11 th April 2016 Accepted: 13 th April 2016 Research article
Volume-7, Issue-2, April-June-2016 Coden IJABFP-CAS-USA Copyrights@2016 Received: 5 th Mar 2016 Revised: 11 th April 2016 Accepted: 13 th April 2016 Research article A STUDY ON ANTIBIOTIC SUSCEPTIBILITY
More informationAntimicrobial Activity of Ceftaroline and ME1036 Tested against Clinical Strains of Community-Acquired ACCEPTED. Helio S Sader 1,2 *,
AAC Accepts, published online ahead of print on 7 January 2008 Antimicrob. Agents Chemother. doi:10.1128/aac.01351-07 Copyright 2008, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationORIGINAL ARTICLE /j x
ORIGINAL ARTICLE 10.1111/j.1469-0691.2008.02064.x Community-associated Staphylococcus aureus infections and nasal carriage among children: molecular microbial data and clinical characteristics G. Sdougkos
More informationNational MRSA Reference Laboratory
Author: Gráinne Brennan Date: 23/02/2017 Date of Issue: 23/02/2017 National MRSA Reference Laboratory User s Manual NMRSARL Users Manual Page 1 of 12 Table of Contents Page 1. Location... 3 2. Contact
More informationMethicillin and Clindamycin resistance in biofilm producing staphylococcus aureus isolated from clinical specimens
Original article Methicillin and Clindamycin resistance in biofilm producing staphylococcus aureus isolated from clinical specimens Pankaj A. Joshi, Dhruv K.Mamtora,. Neeta PJangale., Meena N.Ramteerthakar,
More informationSelective toxicity. Antimicrobial Drugs. Alexander Fleming 10/17/2016
Selective toxicity Antimicrobial Drugs Chapter 20 BIO 220 Drugs must work inside the host and harm the infective pathogens, but not the host Antibiotics are compounds produced by fungi or bacteria that
More informationMRSA. ( Staphylococcus aureus; S. aureus ) ( community-associated )
005 16 190-194 ( Staphylococcus aureus; S. aureus ) ( community-associated ) ( -susceptible Staphylococcus auerus; MSSA ) ( -resistant Staphylococcus auerus; ) ( ) ( -lactam ) ( glycopeptide ) ( Staphylococcus
More informationSaxena Sonal*, Singh Trishla* and Dutta Renu* (Received for publication January 2012)
J. Commun. Dis. 44(2) 2012 : 97-102 Practical disk diffusion method for detection of inducible clindamycin resistance in Staphylococcus aureus at a tertiary care hospital: Implications for clinical therapy
More informationMethicillin Resistant Staphylococcus Aureus (MRSA) The drug resistant `Superbug that won t die
Methicillin Resistant Staphylococcus Aureus (MRSA) The drug resistant `Superbug that won t die Michael A. Miller, MD Assistant Professor of Pediatrics -Jacksonville OBJECTIVES 1. Understand the basic microbiology
More informationRESEARCH NOTE COMMUNITY-ACQUIRED METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS IN A MALAYSIAN TERTIARY CENTRE
RESEARCH NOTE COMMUNITY-ACQUIRED METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS IN A MALAYSIAN TERTIARY CENTRE Zetti Zainol Rashid 1, Norazlah Bahari 1, Amizah Othman 1, Roslinda Jaafar 1, Nurul Azmawati
More informationInfections caused by Methicillin-Resistant Staphylococcus
MRSA infections are no longer limited to hospitals. An infectious disease specialist offers insight on what this means for dermatologists. By Robert S. Jones, DO, Reading, PA Infections caused by Methicillin-Resistant
More informationASSIST. PROF. Dr. Abdulameer Abdullah University of Basra, College of Nursing
ASSIST. PROF. Dr. Abdulameer Abdullah University of Basra, College of Nursing 2017-2108 Gram Positive Cocci Pyogenic Opportunists (normal flora) Staphylococcus, Streptococcus, Enterococcus Contagious Pathogens
More informationOverview. There are commonly found arrangements of bacteria based on their division. Spheres, Rods, Spirals
Bacteria Overview Bacteria live almost everywhere. Most are microscopic ranging from 0.5 5 m in size, and unicellular. They have a variety of shapes when viewed under a microscope, most commonly: Spheres,
More informationFrequency of MecA, Van A and Van B Genes in Staphylococcus aureus isolates among pediatric clinical specimens in Khartoum Hospitals 2017
EUROPEAN ACADEMIC RESEARCH Vol. VI, Issue 3/ June 2018 ISSN 2286-4822 www.euacademic.org Impact Factor: 3.4546 (UIF) DRJI Value: 5.9 (B+) Frequency of MecA, Van A and Van B Genes in Staphylococcus aureus
More informationWhy Don t These Drugs Work Anymore? Biosciences in the 21 st Century Dr. Amber Rice October 28, 2013
Why Don t These Drugs Work Anymore? Biosciences in the 21 st Century Dr. Amber Rice October 28, 2013 Outline Drug resistance: a case study Evolution: the basics How does resistance evolve? Examples of
More informationEvolution of antibiotic resistance. October 10, 2005
Evolution of antibiotic resistance October 10, 2005 Causes of death, 2001: USA 6. Population: 6,122,210,000 Deaths: 56,554,000 1. Infectious and parasitic diseases: 14.9 million 1. 2. 3. 4. 5. 2. Heart
More informationBurton's Microbiology for the Health Sciences. Chapter 9. Controlling Microbial Growth in Vivo Using Antimicrobial Agents
Burton's Microbiology for the Health Sciences Chapter 9. Controlling Microbial Growth in Vivo Using Antimicrobial Agents Chapter 9 Outline Introduction Characteristics of an Ideal Antimicrobial Agent How
More informationHong-Kai Wang 1, Chun-Yen Huang 1 and Yhu-Chering Huang 1,2*
Wang et al. BMC Infectious Diseases (2017) 17:470 DOI 10.1186/s12879-017-2560-0 RESEARCH ARTICLE Open Access Clinical features and molecular characteristics of childhood communityassociated methicillin-resistant
More informationNosocomial Antibiotic Resistant Organisms
Nosocomial Antibiotic Resistant Organisms Course Medical Microbiology Unit II Laboratory Safety and Infection Control Essential Question Does improved hand hygiene really reduce the spread of bacteria
More informationAbsence of LA-MRSA CC398 as nasal colonizer of pigs raised
AEM Accepts, published online ahead of print on 9 December 2011 Appl. Environ. Microbiol. doi:10.1128/aem.07260-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationANTIMICROBIAL STEWARDSHIP: THE ROLE OF THE CLINICIAN SAM GUREVITZ PHARM D, CGP BUTLER UNIVERSITY COLLEGE OF PHARMACY AND HEALTH SCIENCES
ANTIMICROBIAL STEWARDSHIP: THE ROLE OF THE CLINICIAN SAM GUREVITZ PHARM D, CGP BUTLER UNIVERSITY COLLEGE OF PHARMACY AND HEALTH SCIENCES 1 Crisis: Antibiotic Resistance Success Strategy 2 OBJECTIVES Discuss
More informationMRSA Control : Belgian policy
MRSA Control : Belgian policy PEN ERY CLI DOT GEN KAN SXT CIP MIN RIF FUC MUP OXA Marc Struelens Service de microbiologie & unité d épidémiologie des maladies infectieuses Université Libre de Bruxelles
More informationPrevalence of genes encoding Exfoliatin toxin A and Panton-Valentine Leukocidin among Methicillin resistant Staphylococcus aureus in Baghdad
ISSN: 2319-7706 Volume 3 Number 6 (2014) pp. 595-600 http://www.ijcmas.com Original Research Article Prevalence of genes encoding Exfoliatin toxin A and Panton-Valentine Leukocidin among Methicillin resistant
More informationMethicillin-resistant Staphylococcus aureus isolates in a hospital of Shanghai
/, 2017, Vol. 8, (No. 4), pp: 6079-6084 Methicillin-resistant Staphylococcus aureus isolates in a hospital of Shanghai Xiaoguang Wang 1, Lin Ouyang 1, Lingfei Luo 1, Jiqian Liu 1, Chiping Song 1, Cuizhen
More informationrunning head: SUPERBUGS Humphreys 1
running head: SUPERBUGS Humphreys 1 Superbugs GCH 360 Term Paper Assignment Kelly Humphreys April 30, 2014 SUPERBUGS Humphreys 2 Introduction The World Health Organization (WHO) recognizes antibiotic resistance
More informationChallenges Emerging resistance Fewer new drugs MRSA and other resistant pathogens are major problems
Micro 301 Antimicrobial Drugs 11/7/12 Significance of antimicrobial drugs Challenges Emerging resistance Fewer new drugs MRSA and other resistant pathogens are major problems Definitions Antibiotic Selective
More informationFlorida Health Care Association District 2 January 13, 2015 A.C. Burke, MA, CIC
Florida Health Care Association District 2 January 13, 2015 A.C. Burke, MA, CIC 11/20/2014 1 To describe carbapenem-resistant Enterobacteriaceae. To identify laboratory detection standards for carbapenem-resistant
More informationEvaluation of a computerized antimicrobial susceptibility system with bacteria isolated from animals
J Vet Diagn Invest :164 168 (1998) Evaluation of a computerized antimicrobial susceptibility system with bacteria isolated from animals Susannah K. Hubert, Phouc Dinh Nguyen, Robert D. Walker Abstract.
More informationSCOTTISH MRSA REFERENCE LABORATORY
Title SCOTTISH MRSA REFERENCE LABORATORY LABORATORY PROCEDURE NUMBER / VERSION User Manual DATE OF ISSUE 20/01/2017 REVIEW INTERVAL AUTHORISED BY AUTHOR 1 Year Dr. B. Jones Dr E. Dickson COPY 1 of 1 Master
More informationMRSA. by Melissa Ochs
MRSA by Melissa Ochs MRSA (methicillin-resistant Staphylococcus aureus) is caused by the bacterium Staphylococcus aureus that is resistant to beta-lactams class of antibiotics (3, 4). MRSA can be classified
More informationCommunity-Associated Methicillin-Resistant Staphylococcus aureus: Review of an Emerging Public Health Concern
Community-Associated Methicillin-Resistant Staphylococcus aureus: Review of an Emerging Public Health Concern Timothy D. Drews, MD; Jonathan L. Temte, MD, PhD; Barry C. Fox, MD ABSTRACT Methicillin-resistant
More informationINDUCIBLE CLINDAMYCIN RESISTANCE AMONG CLINICAL ISOLATES OF METHICILLIN RESISTANT STAPHYLOCOCCUS AUREUS
IJCRR Vol 05 issue 01 Section: Healthcare Category: Research Received on: 29/10/12 Revised on: 18/11/12 Accepted on: 03/12/12 INDUCIBLE CLINDAMYCIN RESISTANCE AMONG CLINICAL ISOLATES OF METHICILLIN RESISTANT
More informationFinnzymes Oy. PathoProof Mastitis PCR Assay. Real time PCR based mastitis testing in milk monitoring programs
PathoProof TM Mastitis PCR Assay Mikko Koskinen, Ph.D. Director, Diagnostics, Finnzymes Oy Real time PCR based mastitis testing in milk monitoring programs PathoProof Mastitis PCR Assay Comparison of the
More informationAn Approach to Linezolid and Vancomycin against Methicillin Resistant Staphylococcus Aureus
Article ID: WMC00590 ISSN 2046-1690 An Approach to Linezolid and Vancomycin against Methicillin Resistant Staphylococcus Aureus Author(s):Dr. K P Ranjan, Dr. D R Arora, Dr. Neelima Ranjan Corresponding
More informationHealthcare-associated infections surveillance report
Healthcare-associated infections surveillance report Methicillin-resistant Staphylococcus aureus (MRSA) Update, Q3 of 2017/18 Summary Table Q3 2017/18 Previous quarter (Q2 2017/18) Same quarter of previous
More information5/17/2012 DISCLOSURES OBJECTIVES CONTEMPORARY PEDIATRICS
CONTEMPORARY PEDIATRICS Surgical Management of MRSA Soft Tissue Infections John M. Draus, Jr., M.D. Assistant Professor of Surgery and Pediatrics Kentucky Children s Hospital University of Kentucky DISCLOSURES
More informationIsolation of antibiotic producing Actinomycetes from soil of Kathmandu valley and assessment of their antimicrobial activities
International Journal of Microbiology and Allied Sciences (IJOMAS) ISSN: 2382-5537 May 2016, 2(4):22-26 IJOMAS, 2016 Research Article Page: 22-26 Isolation of antibiotic producing Actinomycetes from soil
More informationMethicillin resistant Staphylococcus aureus (MRSA) Lina Cavaco
Methicillin resistant Staphylococcus aureus (MRSA) Lina Cavaco licav@food.dtu.dk 1 DTU Food, Technical University of Denmark Staphylococcus aureus Gram positive cocci Catalase positive Coagulase postive
More informationAntibacterial Agents & Conditions. Stijn van der Veen
Antibacterial Agents & Conditions Stijn van der Veen Antibacterial agents & conditions Antibacterial agents Disinfectants: Non-selective antimicrobial substances that kill a wide range of bacteria. Only
More informationMethicillin-Resistant Staphylococcus aureus Nasal Swabs as a Tool in Antimicrobial Stewardship
Methicillin-Resistant Staphylococcus aureus Nasal Swabs as a Tool in Antimicrobial Stewardship Natalie R. Tucker, PharmD Antimicrobial Stewardship Pharmacist Tyson E. Dietrich, PharmD PGY2 Infectious Diseases
More informationBovine Mastitis Products for Microbiological Analysis
Bovine Mastitis Products for Microbiological Analysis 121917ss Hardy Diagnostics has everything for your laboratory! SAVE MONEY Now you have a choice for obtaining your supplies for mastitis testing. Hardy
More informationInt.J.Curr.Microbiol.App.Sci (2016) 5(12):
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 5 Number 12 (2016) pp. 644-649 Journal homepage: http://www.ijcmas.com Original Research Article http://dx.doi.org/10.20546/ijcmas.2016.512.071
More informationControlling Bacterial Growth
Pre- Lab Discussion: Controlling Bacterial Growth Most bacteria (and other microorganisms) are harmless. In fact, many bacteria are beneficial. Cheesemaking, decay, and soil building are a few of the important
More informationThere are two international organisations that set up guidelines and interpretive breakpoints for bacteriology and susceptibility
ANTIMICROBIAL SUSCEPTIBILITY TESTING ON MILK SAMPLES Method and guidelines There are two international organisations that set up guidelines and interpretive breakpoints for bacteriology and susceptibility
More informationHOSPITAL-ACQUIRED INFECTION/MRSA EYERUSALEM KIFLE AND GIFT IMUETINYAN OMOBOGBE PNURSS15
HOSPITAL-ACQUIRED INFECTION/MRSA EYERUSALEM KIFLE AND GIFT IMUETINYAN OMOBOGBE PNURSS15 INTRODUCTION DEFINITIONS SIGNS AND SYMPTOMS RISK FACTORS DIAGNOSIS COMPLICATIONS PREVENTIONS TREATMENT PATIENT EDUCATION
More informationEXPERIMENT. Antibiotic Sensitivity-Kirby Bauer Diffusion Test
EXPERIMENT Antibiotic Sensitivity-Kirby Bauer Diffusion Test Author Name Version 42-0238-00-02 Review the safety materials and wear goggles when working with chemicals. Read the entire exercise before
More informationScholars Research Library
Journal of Microbiology and Biotechnology Research Scholars Research Library J. Microbiol. Biotech. Res., 2012, 2 (2):258-264 (http://scholarsresearchlibrary.com/archive.html) ISSN : 2231 3168 CODEN (USA)
More information