1. African Savannah Elephant 6. Gray, Short-tailed Opossum (Loxodonta africana) (Monodelphis domestica)
|
|
|
- Darren Charles
- 6 years ago
- Views:
Transcription
1 1. African Savannah Elephant 6. Gray, Short-tailed Opossum (Loxodonta africana) (Monodelphis domestica) 2. Chimpanzee 7. Horse (Pan troglodytes) (Equus caballus) 8. Mouse 3. Common Shrew (Mus musculus) (Sorex araneus) 4. Dog 9. Nine-banded Armadillo (Canis lupus) (Dasypus novemcinctus) 5. European Hedgehog 10. Tenrec (Erinaceus europaeus) (Echinops telfairi)
2 Bacteria Archaea Eukaryotes Time
3
4 Two ways to make phylogenetic trees: 1. Using physical characteristics 2. Using DNA sequence
5 Two ways to make phylogenetic trees:! 1. Using physical characteristics! 2. Using DNA sequence!
6 Two ways to make phylogenetic trees:! 1. Using physical characteristics!
7 Two ways to make phylogenetic trees:! 1. Using physical characteristics! rat! mouse! frog!
8 1. African Savannah Elephant 6. Gray, Short-tailed Opossum (Loxodonta africana) (Monodelphis domestica) 2. Chimpanzee 7. Horse (Pan troglodytes) (Equus caballus) 8. Mouse 3. Common Shrew (Mus musculus) (Sorex araneus) 4. Dog 9. Nine-banded Armadillo (Canis lupus) (Dasypus novemcinctus) 5. European Hedgehog 10. Tenrec (Erinaceus europaeus) (Echinops telfairi)
9 platypus! cow! macaque!
10 Two ways to make phylogenetic trees: 1. Using physical characteristics 2. Using DNA sequence
11 How to write a DNA sequence 5 3 A T T A G C C G C G G C A T T A C G G C T A T A ATGCCGATCGTT-3 3 -TACGGCTAGCAA-5 5 -ATGCCGATCGTT-3
12 Two ways to make phylogenetic trees: 1. Using physical characteristics 2. Using DNA sequence 5 -GATGACGTACG-3 5 -CAACATGGAAG-3 5 -GATTACGTACG-3
13 Two ways to make phylogenetic trees: 2. Using DNA sequence 5 -GATGACGTACG-3 5 -CAACATGGAAG-3 5 -GATTACGTACG-3 first second third
14 Two ways to make phylogenetic trees: 2. Using DNA sequence 5 -GATGACGTACG-3 5 -CAACATGGAAG-3 5 -GATTACGTACG-3 first second third
15 Two ways to make phylogenetic trees: 2. Using DNA sequence GATGACGTACG-3 first 5 -CAACATGGAAG-3 second 5 -GATTACGTACG-3 third 6
16 Two ways to make phylogenetic trees: third first 2. Using DNA sequence second GATGACGTACG-3 first 5 -CAACATGGAAG-3 second 5 -GATTACGTACG-3 third 6
17 Cow: 5 -ACCGTATTTGCCGAAG-3 Dog: 5 -AGCGTAATTGCCGTAG-3 Hedgehog: 5 -AGCGTAGTTTCCGTAC-3 Horse: 5 -AGCGTACTTGCCGTAG-3 Mouse: 5 -ATAGTAGATCGCGCAT-3 Shrew: 5 -AGCGTAGTTACCGTAC-3
18 Cow Dog Hedgehog Horse Mouse Shrew Cow Dog Hedgehog 3 Horse Mouse Shrew
19 Cow Dog Hedgehog Horse Mouse Shrew Cow Dog Hedgehog 3 Horse Mouse Shrew
20 platypus opposum tenrec elephant armadillo cow macaque chimp
21 platypus opposum tenrec elephant armadillo cow Cow Dog Hedgehog Horse Mouse Shrew Cow Dog 3 5 Hedgehog 3 macaque Horse Mouse Shrew chimp
22 platypus opposum tenrec elephant armadillo hedgehog shrew horse dog cow mouse Cow Dog Hedgehog Horse Mouse Shrew macaque chimp Cow Dog Hedgehog 3 Horse Mouse Shrew
23 Do everyone s trees based on physical characteristics look the same? Why or why not? Do everyone s DNA-based trees look the same? Why or why not?
24 Which method do you think is used to generate current, scientifically accepted phylogenetic trees?
25 ATGCCGATCGTACGACACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGATC TACTGACTGCATCGTACTGACTGCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTTTA CATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGC CATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCC ACTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATAC TCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTT ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACA GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGC TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATA CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGCATCGTACTGACTGTCTAGTCTAAACACATCCCACA ATCGTACTGACTGTCTAGTCTAAACACATCCCAGCATCCATCCATATCGTCATCGTACTGACTGTCTAGTCTAAACAC GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGC TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATA CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACA TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATACATATCGTCATCGTACTGACTGTCTAGTCTAAACAC GCCGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGC TGACTGCATCGTACTGACTGCACATATCGTCATACATAGACTTCGTACTGACTGTCTAGTCTAAACACATCCCACATA CGTACTGACTGTCTAGTCTAAACACATCCCACTTTACCCATGATATCGTCATCGTACTGACTGTCTAGTCTAAACACA TATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATAGCCGATCGTACGACACATATCGTCATCGTACTGCCC CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGCCGATCGTACGACACATATCGTCATCGTACTGCCC CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACTGACTGCATCGTACTGACTGCACATATCGTCATACA CGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTA ATCGTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCAGCA ATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCTATGCCGATCGTACGACACATATCGTCATCGTACTGCCC CTGTCTAGTCTAAACACATCCATCGTACTGACTGCATCGTACGACTGCATCGTACTGACTGCACATATCGTCATACAT GTACTGACTGTCTAGTCTAAACACATCCCACATATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACTTTAC ATCGTCATCGTACTGACTGTCTAGTCTAAACACATCCCACACTGTCTAGTCTAAACACATCCATCGTACTGACTGCAT CGATCGTACGACACATATCGTCATCGTACTGCCCTACGGGACTGTCTAGTCTAAACACATCCATCGTACTGACTGCAT
26 Which animal s placement on the DNA-based tree surprised you the most, and why?
27 1. African Savannah Elephant 6. Gray, Short-tailed Opossum (Loxodonta africana) (Monodelphis domestica) 2. Chimpanzee 7. Horse (Pan troglodytes) (Equus caballus) 8. Mouse 3. Common Shrew (Mus musculus) (Sorex araneus) 4. Dog 9. Nine-banded Armadillo (Canis lupus) (Dasypus novemcinctus) 5. European Hedgehog 10. Tenrec (Erinaceus europaeus) (Echinops telfairi)
28 platypus opposum tenrec elephant armadillo hedgehog shrew horse dog cow mouse macaque chimp
Comparing DNA Sequences Cladogram Practice
Name Period Assignment # See lecture questions 75, 122-123, 127, 137 Comparing DNA Sequences Cladogram Practice BACKGROUND Between 1990 2003, scientists working on an international research project known
Fig Phylogeny & Systematics
Fig. 26- Phylogeny & Systematics Tree of Life phylogenetic relationship for 3 clades (http://evolution.berkeley.edu Fig. 26-2 Phylogenetic tree Figure 26.3 Taxonomy Taxon Carolus Linnaeus Species: Panthera
AP Lab Three: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST
AP Biology Name AP Lab Three: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST In the 1990 s when scientists began to compile a list of genes and DNA sequences in the human genome
Cumbria Biodiversity Data Centre Cumbria Mammal Group
Cumbria Biodiversity Data Centre Cumbria Mammal Group Cumbria Mammal Atlas Cumbria Biodiversity Data Centre and Cumbria Mammal Group November 17 Copyright Notice Maps are copyright Cumbria Biodiversity
Classification Write the name of Each animal below and then classify them:
Name: Class: Date: Classification Life Science Gr6 Write the name of Each animal below and then classify them: giraffe lion falcon/eagle parrot gazelle monkey Can fly Can not fly The others parrot falcon/eagle
Mammal Scavenger Hunt Activity
Mammal Scavenger Hunt Activity Materials: Mammal questions worksheet (pages 2-3) 18 Mammal fact cards (pages 4-8) Tape and scissors Preparation: Print the fact cards on card stock or brightly-colored paper
COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST
COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST In this laboratory investigation, you will use BLAST to compare several genes, and then use the information to construct a cladogram.
Table S1. Duration of defecation, velocity of feces, and thickness of mucus.
Electronic Supplementary Material (ESI) for Soft Matter. This journal is The Royal Society of Chemistry 2017 Supporting Videos Video S1. Defecation of a dog, mass of 9 kg. Video S2. Defecation of a warthog,
COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST
Big Idea 1 Evolution INVESTIGATION 3 COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST How can bioinformatics be used as a tool to determine evolutionary relationships and to
Lecture 11 Wednesday, September 19, 2012
Lecture 11 Wednesday, September 19, 2012 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean
No limbs Eastern glass lizard. Monitor lizard. Iguanas. ANCESTRAL LIZARD (with limbs) Snakes. No limbs. Geckos Pearson Education, Inc.
No limbs Eastern glass lizard Monitor lizard guanas ANCESTRAL LZARD (with limbs) No limbs Snakes Geckos Species: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum:
elephant shrew water shrew Insectivores: sharp, pointy teeth (some with venom!). Emphasize vertical snapping motion of jaws. (why?
Insectivores 1. No more Order Insectivora, but several modern orders generally referred to under this category. 2. Afrotheria (originated in Africa) 1. Order Macroscelidea Family Macroscelididae (elephant
Unterrichtsmaterialien in digitaler und in gedruckter Form. Auszug aus: Cross Curriculum Creativity - Biology - Book 2: Mammals
Unterrichtsmaterialien in digitaler und in gedruckter Form Auszug aus: Cross Curriculum Creativity - Biology - Das komplette Material finden Sie hier: School-Scout.de Contents Introduction 6 Mammals Mammals
Preliminary Results of a Cognitum Study Investigating i the Traditional Tetrapod Classes. Timothy R. Brophy
Preliminary Results of a Cognitum Study Investigating i the Traditional Tetrapod Classes Timothy R. Brophy Liberty University Anastasia Hohriakova, 2002 Out of the ground the LORD God formed every beast
DIVISION 056 IMPORTATION, POSSESSION, CONFINEMENT, TRANSPORTATION AND SALE OF NONNATIVE WILDLIFE
DIVISION 056 IMPORTATION, POSSESSION, CONFINEMENT, TRANSPORTATION AND SALE OF NONNATIVE WILDLIFE 635 056 0010 Definitions For the purposes of these rules, the definitions in ORS 496.004 and OAR 635 045
HEREFORDSHIRE INSECTIVORE ATLAS 1960 to 2015
HEREFORDSHIRE INSECTIVORE ATLAS 1960 to 2015 Produced by Dave Smith, David Lee, Joseph Allsopp and Denise Foster Photograph credits: Steve Evans, Denise Foster and Sue Ellis Herefordshire Mammal Group
Status of introduced vertebrates in Galapagos Gustavo Jiménez-Uzcátegui a, Víctor Carrión b, Jabi Zabala a, Paola Buitrón a & Bryan Milstead a
Status of introduced vertebrates in Galapagos Gustavo Jiménez-Uzcátegui a, Víctor Carrión b, Jabi Zabala a, Paola Buitrón a & Bryan Milstead a a Charles Darwin Foundation, b Galapagos National Park As
Mammalogy Lecture 4B - Therian Mammal Diversity: Eutherians
Mammalogy Lecture 4B - Therian Mammal Diversity: Eutherians VI. Eutherian Groups. We won t go through the diversity here in as great detail as we did for Marsupials - We ll leave a lot of details for the
Species: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum: Chordata
CHAPTER 6: PHYLOGENY AND THE TREE OF LIFE AP Biology 3 PHYLOGENY AND SYSTEMATICS Phylogeny - evolutionary history of a species or group of related species Systematics - analytical approach to understanding
Placental Mammal Phylogeny Orders Bayesian/Max.Likelihood tree 16,610 bp nuclear genes Murphy et al. 2001, Nature Eizirik et al. 2001, J. Heredity 98
Apternodus Placental Mammal Phylogeny Orders Bayesian/Max.Likelihood tree 16,610 bp nuclear genes Murphy et al. 2001, Nature Eizirik et al. 2001, J. Heredity 98 Murphy et al. 2001, Science 59 74 42 94
Ontogeny and phylogeny of the mammalian chondrocranium: the cupula nasi anterior and associated structures of the anterior head region
Hüppi et al. Zoological Letters (2018) 4:29 https://doi.org/10.1186/s40851-018-0112-0 RESEARCH ARTICLE Open Access Ontogeny and phylogeny of the mammalian chondrocranium: the cupula nasi anterior and associated
species for use by humans through
1.4 I can define 5 criteria for animal domestication Terms: Domestic Animal an animal that has been genetically altered from the original wild species for use by humans through ARTIFICIAL SELECTION Genetically
Name. Compare the bones found in the foot, as well as the number of digits.
MAMMALOGY LAB 4 LIMBS & LOCOMOTION Today s exercise focuses on the variation in limbs and lifestyles of mammals. You will be interpreting the lifestyles of a number of mammals based on various aspects
Your Eye, My Eye, and the Eye of the Aye Aye: Evolution of Human Vision from 65 Million Years Ago to the Present
# 75 Your Eye, My Eye, and the Eye of the Aye Aye: Evolution of Human Vision from 65 Million Years Ago to the Present Dr. Christopher Kirk December 2, 2011 Produced by and for Hot Science - Cool Talks
Central Florida Invasive Mammals
Central Florida Invasive Mammals Cause Harm Invasive species is an umbrella term referring to alien, exotic, nonindigenous, and non-native species. Invasive species are those that are not native to the
CLADISTICS Student Packet SUMMARY Phylogeny Phylogenetic trees/cladograms
CLADISTICS Student Packet SUMMARY PHYLOGENETIC TREES AND CLADOGRAMS ARE MODELS OF EVOLUTIONARY HISTORY THAT CAN BE TESTED Phylogeny is the history of descent of organisms from their common ancestor. Phylogenetic
Mammalogy: Biology 5370 Syllabus for Fall 2005
Mammalogy: Biology 5370 Syllabus for Fall 2005 Objective: This lecture course provides an overview of the evolution, diversity, structure and function and ecology of mammals. It will introduce you to the
Don Castrup Worldwide Safaris 6499 Outer Lincoln Ave. Newburgh, IN Ph Fax
WWW.AFRICANBOWHUNTER.COM Don Castrup Worldwide Safaris 6499 Outer Lincoln Ave. Newburgh, IN 47630 Ph. 812.853.5759 Fax. 812.858.9168 Castrup@aol.com Elephant Loxodonta Africana Up to 11 feet 7,000-13,200
Human Uniqueness. Human Uniqueness. Why are we so different? 12/6/2017. Four Candidates
Our Hominid Ancestors In humans, brain tissue has more than doubled over the past 2 million years. Break from chimps 3-5 million Our Hominid Ancestors Our Hominid Ancestors Relative Brain Size in Our Ancestors
Wild: Amazing animals in a changing world
Wild: Amazing animals in a changing world Worldwide biodiversity Begin this trail looking over the balcony from Darwin to DNA into Wild. While looking from the balcony, consider the following: Are there
NYC Is a CITY of 8 million PeoPle
The Problem NYC Is a city of 8 million People and over 1 million dogs Dogs who Create unhealthy waste on hard Urban surfaces Rain then Creates A serious Problem But it is not the dogs fault They need to
Animal Traits and Behaviors that Enhance Survival. Copyright 2010:PEER.tamu.edu
Animal Traits and Behaviors that Enhance Survival Copyright 2010:PEER.tamu.edu What We Are Going To Learn: What are traits? Inherited vs. Learned Response to stimuli Evolutionary Adaptations Natural Selection
UNIT III A. Descent with Modification(Ch19) B. Phylogeny (Ch20) C. Evolution of Populations (Ch21) D. Origin of Species or Speciation (Ch22)
UNIT III A. Descent with Modification(Ch9) B. Phylogeny (Ch2) C. Evolution of Populations (Ch2) D. Origin of Species or Speciation (Ch22) Classification in broad term simply means putting things in classes
SIO 133 Marine Mammal Biology. John Hildebrand Scripps Institution of Oceanography April 13, 2018 Biogeography, Sea Otters, Polar Bears
SIO 133 Marine Mammal Biology John Hildebrand Scripps Institution of Oceanography April 13, 2018 Biogeography, Sea Otters, Polar Bears Marine Mammal Science Emerged as a discipline in last 20-30 years
Classification. Grouping & Identifying Living Things
Classification Grouping & Identifying Living Things Taxonomy The study of how living things are classified Classification is the sorting of organisms based on similar characteristics Carolus Linnaeus is
Copyright Yan Li. All rights reserved.
Copyright Yan Li All rights reserved. Without limiting the rights under copyright reserved above, no part of this publication may be reproduced, stored in or introduced into a database and retrieval system
Beef... Beef Natural Contamination... Beef liver...
Human... Human Natural Contamination... Human amniotic fluid... Human bile... Human blood... Human brain... Human breast... Human breast milk... Human cervix... Human colon... Human endometrium... Human
Who has got my ears? Animal Elephant Mouse Dog. Ear. Ear. Giraffe
Who has got my ears? Are these animals looking funny? The artist has drawn wrong ears on the heads of the animals. Give correct ears to the animals in the space given below. Animal Ear Animal Elephant
The melanocortin 1 receptor (mc1r) is a gene that has been implicated in the wide
Introduction The melanocortin 1 receptor (mc1r) is a gene that has been implicated in the wide variety of colors that exist in nature. It is responsible for hair and skin color in humans and the various
18th century - first to propose that could change over time and that changes could - proposed that relatively had formed many through.
Early Ideas About Evolution 1795 proposed Same occurring in the also occurred in the. - Hutton explained the of landforms as the result of. Contrasts 18th century - first to propose that could change over
Why should we care about biodiversity? Why does it matter?
1 Why should we care about biodiversity? Why does it matter? 1. Write one idea on your doodle sheet in the first box. (Then we ll share with a neighbor.) What do we know is happening to biodiversity now?
Can humans mate with dogs. Can humans mate with dogs
Paieška Paieška Paieška Can humans mate with dogs Can humans mate with dogs > > Nov 14, 2006. Last week, scientists announced that the human gene pool seems to include DNA from Neanderthals. That suggests
LEARNING OBJECTIVES. Watch and understand a video about a wildlife organization. Watch and listen
Cambridge University Press LEARNING OBJECTIVES Watch and listen Watch and understand a video about a wildlife organization Listening skills Take notes Speaking skills Use signposting language; introduce
MSMR Enrichment Symposium, 15 April 2010 MSMR Enrichment Symposium, 15 April 2010
Group Name: EE 1 Group Name: PS 1 Species: Pig, Sus scrofa domesticus Research: Heart Research. Research Protocol: Periodic surgery or non-invasive imaging, all require anaesthesia. Diet: Normal Pig Pellets.
ANTHR 1L Biological Anthropology Lab
ANTHR 1L Biological Anthropology Lab Name: DEFINING THE ORDER PRIMATES Humans belong to the zoological Order Primates, which is one of the 18 Orders of the Class Mammalia. Today we will review some of
Classification. Chapter 17. Classification. Classification. Classification
Classification Chapter 17 Classification Classification is the arrangement of organisms into orderly groups based on their similarities. Classification shows how organisms are related and different. Classification
Singapore 5th Grade Math Worksheet: 2 Whole Numbers and Fractions
Singapore 5th Grade Math Worksheet: 2 Whole Numbers and Fractions Name: Date: Math Word Problem 1 A marching band wanted to take part in a parade. The number of members in the band was between 30 and 50.
Comparing DNA Sequence to Understand
Comparing DNA Sequence to Understand Evolutionary Relationships with BLAST Name: Big Idea 1: Evolution Pre-Reading In order to understand the purposes and learning objectives of this investigation, you
A phylogeny of amniotes Amniotes are named for the major derived character of the clade, the amniotic egg. Reptiles
Mammals A phylogeny of amniotes Amniotes are named for the major derived character of the clade, the amniotic egg Parareptiles Turtles Crocodilians Pterosaurs Ornithischian dinosaurs Saurischian dinosaurs
Creature Features SCAVENGER HUNT. Animals come in a remarkable variety of shapes, sizes, and colors. Find an animal at the Zoo that: Is red
SCAVENGER HUNT Creature Features Animals come in a remarkable variety of shapes, sizes, and colors. Find an animal at the Zoo that: Is red Has whiskers Is green Is covered in fur Is blue Has no fur at
Evolution as Fact. The figure below shows transitional fossils in the whale lineage.
Evolution as Fact Evolution is a fact. Organisms descend from others with modification. Phylogeny, the lineage of ancestors and descendants, is the scientific term to Darwin's phrase "descent with modification."
Evidence for Evolution by Natural Selection. Hunting for evolution clues Elementary, my dear, Darwin!
Evidence for Evolution by Natural Selection Hunting for evolution clues Elementary, my dear, Darwin! 2006-2007 Evidence supporting evolution Fossil record shows change over time Anatomical record comparing
Comparing mythical creatures in Atlantis
Comparing mythical creatures in Atlantis - a project designed, drawn and written by the pupils of class 2A 2010/11 The Eleke was an elephant and a snake. It was bigger than the biggest elephant and longer
Before James Hunt built the Covered Bridge and named the city Coral Springs in
Before James Hunt built the Covered Bridge and named the city Coral Springs in 1963... Before Henry Lyons planted thousands of green beans on thousands of acres in Broward County starting in 1919... 1845
TUSKS! Exhibit Guide
TUSKS! Exhibit Guide Assembling the Guide The pages of this guide are meant to be glued or photocopied back to back in the following order: Page 32/1 (facing down) with Page 2/31 (facing up) Page 30/3
How the Camel Got His Hump
How the Camel Got His Hump BEFORE YOU READ KET 1 THE CAMEL Read this text about camels and complete the spaces. There are two kinds of camels (1)... the world. The Arabian Camel or Dromedary has one hump.
GRASSLAND MAMMALS OF NORTHERN ILLINOIS. * = Illinois endangered species list; ** = threatened in Illinois; # = federally = extirpated
Randa Prairie Ecology GRASSLAND MAMMALS OF NORTHERN ILLINOIS * = Illinois endangered species list; ** = threatened in Illinois; # = federally endangered, @ = extirpated = Prairie specialist = Habitat generalist
Night Life Pre-Visit Packet
Night Life Pre-Visit Packet The activities in this pre-visit packet have been designed to help you and your students prepare for your upcoming Night Life program at the St. Joseph County Parks. The information
Supporting Online Material
Supporting Online Material Supporting Text: Rapprochement in dating the early branching of modern mammals It is important to distinguish the meaning of nodes in the tree (Fig. S1): successive branching
Invertebrates. Brain. Brain 12/2/2017. The Invertebrate Brain. The Invertebrate Brain. Invertebrate brain general layouts some specific functions
Brain Invertebrate brain general layouts some specific functions Vertebrate brain general layout cortical fields evolutionary theory Brain Brain size Invertebrates 1) No brain (only nerve net) jellyfish,
SKU(NI) UPC Item Name Item detail description MSRP/MAPP
Gold Medal Collection 40020 813168040203 Fox Hockey Player Chubbie Buddie Plush Durable Chubbie Buddie $ 19.99 40021 813168040210 Bear Ice Skater Chubbie Buddie Plush Durable Chubbie Buddie $ 19.99 40022
Modern Evolutionary Classification. Lesson Overview. Lesson Overview Modern Evolutionary Classification
Lesson Overview 18.2 Modern Evolutionary Classification THINK ABOUT IT Darwin s ideas about a tree of life suggested a new way to classify organisms not just based on similarities and differences, but
S 0347 S T A T E O F R H O D E I S L A N D
LC0001 01 -- S 0 S T A T E O F R H O D E I S L A N D IN GENERAL ASSEMBLY JANUARY SESSION, A.D. 01 A N A C T RELATING TO ANIMAL AND ANIMAL HUSBANDRY -- REGULATION OF VICIOUS DOGS Introduced By: Senators
Rhett A. Butler. Ring-tailed lemurs in Madagascar W I L D M A D A G A S C A R. O R G WildMadagascar.org. All rights reserved
Ring-tailed lemurs in Madagascar W I L D M A D A G A S C A R. O R G Mammals of Madagascar LEMURS Lemurs are a group of primates found only on the island of Madagascar. Today there are around 60 types of
Biology, Management, Diseases and Uses of Nonrodent Species. Purpose. And the answer is..
Biology, Management, Diseases and Uses of Nonrodent Species Purpose Provide a summary of the biology, management, diseases and research uses of non primate, non rodent, non livestock mammals CPT Joanna
Classification and Taxonomy
NAME: DATE: PERIOD: Taxonomy: the science of classifying organisms Classification and Taxonomy Common names of organisms: Spider monkey Clown fish Mud puppy Black bear Ringworm Sea horse Sea monkey Firefly
Activity 3, Humans Effects on Biodiversity. from the Evolution Unit of the SEPUP course. Science in Global Issues
Activity 3, Humans Effects on Biodiversity from the Evolution Unit of the SEPUP course Science in Global Issues For use only by teachers who attended the Biodiversity session at NSTA on March 19, 2009.
Mammalogy 4764 Lab Practical page 1 Name Key
Mammalogy 4764 Lab Practical page 1 Name Key Comments on exam (LP_2 is this Lab practical): As is kind of typical for the final, students know the taxonomy and identification well, or not so well. I usually
European Convention for the Protection of Vertebrate Animals used for Experimental and Other Scientific Purposes *
European Treaty Series - No. 123 European Convention for the Protection of Vertebrate Animals used for Experimental and Other Scientific Purposes * Strasbourg, 18.III.1986 Appendix B Statistical tables
Product Catalogue Veterinary Models VETERINARY MODELS VET ACUPUNCTURE MODELS VET ANATOMY MODELS
Product Catalogue Veterinary Models VETERINARY MODELS VET ACUPUNCTURE MODELS VET ANATOMY MODELS VET ACUPUNCTURE - MODELS... 3 VET ANATOMY - MODELS... 4 Real Skeleton Models... 4 Artificial Skeleton Models...
Endemics. If Charles Darwin had travelled to the island of Madagascar rather A R C A D M. Text, Photographs and illustrations by nick garbutt
opposite The lesser hedgehog tenrec is unusual in that it is semiarboreal and capable of climbing along thin branches. i n d i a n O c e a n Ankarafantsika kirindy Morondava A G A S A G A S A R C Ankarana
1 Sorting It All Out. Say It
CHAPTER 11 1 Sorting It All Out SECTION Classification 7.3.d California Science Standards BEFORE YOU READ After you read this section, you should be able to answer these questions: What is classification?
Begin Reading with CAT the CAT
Begin Reading with CAT the CAT Grow with Mo! Mo Willems is the award-winning author and illustrator of groundbreaking books beloved by kids, parents, teachers, and librarians. Now kids can begin reading
Zoonotic Diseases. Risks of working with wildlife. Maria Baron Palamar, Wildlife Veterinarian
Zoonotic Diseases Risks of working with wildlife www.cdc.gov Definition Zoonoses: infectious diseases of vertebrate animals that can be naturally transmitted to humans Health vs. Disease Transmission -
Introduction to ANIMAL SCIENCE
Introduction to ANIMAL SCIENCE Objectives: A. List 5 functions of domestic animals B. Describe and define what considers an animal to be domesticated C. Define common terminology used in animal science
Supplementary Fig. 1: 16S rrna rarefaction curves indicating mean alpha diversity (observed 97% OTUs) for different mammalian dietary categories,
Supplementary Fig. 1: 16S rrna rarefaction curves indicating mean alpha diversity (observed 97% OTUs) for different mammalian dietary categories, error bars indicating standard deviations. Odontocetes
Select Mammals of Loudoun County
Select Mammals of Loudoun County Class Mammalia Warm-blooded Fur Produce Milk Most bear live young Order: Marsupialia Marsupials The Pouched Mammals Opossum (Didelphis virginianus) Only marsupial in North
Folk knowledge of non-domestic mammals among ethnic Hungarians in North-Western Romania
NORTH-WESTERN JOURNAL OF ZOOLOGY 9 (2): 383-398 NwjZ, Oradea, Romania, 2013 Article No.: 131705 http://biozoojournals.3x.ro/nwjz/index.html Folk knowledge of non-domestic mammals among ethnic Hungarians
Mammal Identification In Ontario. Niagara College Fauna Identification Course # ENVR9259
Mammal Identification In Ontario Niagara College Fauna Identification Course # ENVR9259 About Mammals Mammals evolved from reptiles 200,000,000 years ago. Their rise and subsequent proliferation coincided
The Sheep and the Goat by Pie Corbett. So, they walked and they walked and they walked until they met a hare. Can I come with you? said the hare.
1 The Sheep and the Goat by Pie Corbett Once upon a time, there was a sheep and a goat who lived on the side of a hill. In the winter, it was too chilly. In the summer, it was too hot. So, one day the
SUPPLEMENTARY MATERIAL
10.1071/ZO13105_AC CSIRO 2014 Australian Journal of Zoology 2014, 62(3), 195-199 SUPPLEMENTARY MATERIAL The koala immunological toolkit: sequence identification and comparison of key markers of the koala
How to draw. pets & farm animals. with basic shapes!
How to draw pets & farm animals with basic shapes! Learn to draw fun pictures in 5 simple steps or less, all while learning your basic geometric shapes and practicing following directions! Table of contents
If fungi, plants, and animals all have nuclei, this makes them which type of cell? What trait do the mushroom and gecko share that the tree lacks?
Objectives Before doing this lab you should understand what cladograms show and how they are constructed. After doing this lab you should be able to use cladograms to answer questions on how different
!"#$%&&%"'#())*+,-.*#/0-,-"1#)%0#233#4,56*",7!!
" "#$%&&%"'#())*+,-.*#/0-,-"1#)%0#233#4,56*",7 "#$$%&'(#)#*+$$,'-.%)'/#01,234$%56789: "#$%&#'&()*+,#-(.,.+/#0*1123*(2,.4&5#6.,%#7,89&+,#:;%.&4&)&+,## # 619 File Name: N3R My Lost Kittens
Mammals. Sample file. by Vicky Franchino. Content Adviser: Terrence E.Young Jr., M.Ed., M.L.S., Jefferson Parish (La.
S I M P L Y S C I E N C E Mammals by Vicky Franchino Content Adviser: Terrence E.Young Jr., M.Ed., M.L.S., Jefferson Parish (La.) Public Schools Reading Adviser: Dr. Linda D. Labbo, Department of Reading
Treasure Chest Rhyming Neuhaus Education Center Activities
Phonological Awareness When children have trouble grasping a basic concept like rhyming, the Neuhaus Education Center recommends having the child work with concrete objects and then move on to more abstract
Minnesota_mammals_Info_9.doc 11/04/09 -- DRAFT Page 1 of 64. Minnesota mammals
Minnesota_mammals_Info_9.doc 11/04/09 -- DRAFT Page 1 of 64 Minnesota mammals This is a short guide to Minnesota mammals, with information drawn from Hazard s Mammals of, Walker s Mammals of the World,
Old Dominion University Tick Research Update Chelsea Wright Department of Biological Sciences Old Dominion University
Old Dominion University Tick Research Update 2014 Chelsea Wright Department of Biological Sciences Old Dominion University Study Objectives Long-term study of tick population ecology in Hampton Roads area
EOQ 3 Exam Review. Genetics: 1. What is a phenotype? 2. What is a genotype?
EOQ 3 Exam Review Genetics: 1. What is a phenotype? 2. What is a genotype? 3. The allele for freckles (f) is recessive to not having freckles (F). Both parents have freckles but only 3 of their 4 children
WHOM DO YOU PET & WHOM DO YOU EAT?
THE INSTITUTE FOR HUMANE EDUCATION P.O. BOX 260 SURRY, MAINE 04684 207.667.1025 info@humaneeducation.org www.humaneeducation.org WHOM DO YOU PET & WHOM DO YOU EAT? Grades: 4 and up Time: 60 minutes Materials:
Animals WORKSHEET 3.1 Animals
Animals WORKSHEET 3.1 Animals 1. Are these sentences true or false? Correct the false ones. a) A butterfly is a non-living thing. b) Water is a non-living thing. c) Living things are born, die, reproduce
Evolutionary Trade-Offs in Mammalian Sensory Perceptions: Visual Pathways of Bats. By Adam Proctor Mentor: Dr. Emma Teeling
Evolutionary Trade-Offs in Mammalian Sensory Perceptions: Visual Pathways of Bats By Adam Proctor Mentor: Dr. Emma Teeling Visual Pathways of Bats Purpose Background on mammalian vision Tradeoffs and bats
Hedgehogs, shrews, moles, and solenodons (Eulipotyphla)
Hedgehogs, shrews, moles, and solenodons (Eulipotyphla) Christophe J. Douady a,b,c * and Emmanuel J. P. Douzery d,e a Université de Lyon, F-69622, Lyon, France; b Université Lyon 1, F-69622 Villeurbanne,
PRACTICE 1 1. Many people (buy, by) exotic animals for pets. Stop (buy, by) some pet stores, and you
HAPTER 24: ommonly onfused Words Answer Key PRATIE 1 1. Many people (buy, by) exotic animals for pets. Stop (buy, by) some pet stores, and you will see monkeys, snakes, and wild cats. For example, a capuchin
MAMMAL LESSON PLAN. Understanding (s)/goals Students will understand that mammals are a unique group within the animal kingdom.
MAMMAL LESSON PLAN Lesson Topic: Mammals Grade level: Elementary Grades Length of lesson: Approximately 5 days; will vary based on age and ability Curriculum Developer: Jennifer Mooney, M.Ed. Stage 1 Desired
AlphaToons Following Directions. Developed by Cherry Carl Illustrated by Ron Leishman Images Toonaday.com/Toonclipart.com
AlphaToons Following Directions Developed by Cherry Carl Illustrated by Ron Leishman Images Toonaday.com/Toonclipart.com Directions: Color the big A blue. Color the apple red. Color the small a orange.
10 Didelphimorphia (opossums)
Chiroptera (bats) 1 1 Perissodactyla (horses, rhinos) Carnivora (lions, wolves) 180 170 MYA c. 120 MYA c. 90 MYA 90 80 MYA 80 70 MYA Pholidota (pangolins) Artiodactyla (deer, pigs) 2 Cetacea (whales, dolphins)
AP Biology. Animal Characteristics. Kingdom: Animals. Body Cavity. Animal Evolution. Invertebrate: Porifera. Invertebrate: Cnidaria.
Kingdom: Animals Eukarya Bacteria Archaea Eukarya Animal Characteristics Heterotrophs must ingest others for nutrients Multicellular complex bodies No cell walls allows active movement Sexual reproduction
Area: 1,221,037 sq km (9 provinces)(25 th ) Birds: 865 spp (Avibase) Frogs: 110 spp Mammals: 300 spp (Bats 56)
Dr Ali Halajian Area: 1,221,037 sq km (9 provinces)(25 th ) Birds: 865 spp (Avibase) Frogs: 110 spp Mammals: 300 spp (Bats 56) With nearly 8% of all known species of Birds 6% of the World`s Mammal species,
Identification of Common Exotic Species
Identification of Common Exotic Species Course 106 Module 2 Slide 2 Exotic Pets You should encourage clients to do their homework before they purchase an exotic pet Exotic pets can require special accommodations