Tick-borne Encephalitis Virus in Ixodes Ticks and Wild Birds in the Russia Komi Republic

Size: px
Start display at page:

Download "Tick-borne Encephalitis Virus in Ixodes Ticks and Wild Birds in the Russia Komi Republic"

Transcription

1 Tick-borne Encephalitis Virus in Ixodes Ticks and Wild Birds in the Russia Komi Republic State Research Center for Virology and Biotechnology Vector, Koltsovo, Russia Bangkok December, 2014

2 Family Flaviviridae Genus Flavivirus Pestivirus Hepacivirus unassigned viruses Number: species, viruses, candidate Flavivirus /2 Pestivirus /1 Hepacivirus /2 unassigned viruses 1 3

3 Flavivirus Genome ss (+) RNA genome Approximately 11 kb 5 -m7gpppamp cap Lacks 3 -polya tail Codes for 3 structural proteins Capsid (C), membrane (prm/m), envelope (E) 7 non-structural proteins NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5

4 The main human flaviviral infections: Dengue Yellow fever Japanese encephalitis West Nile fever Tick-borne encephalitis

5 27 viruses were detected in ticks in Europe?! Flaviviruses: TICK-BORNE ENCEPHALITIS, LOUPING-ILL, Tyuleniy and Meaban; Orthobunyaviruses: Bahig, Matruh; Phleboviruses: Grand Arbaud, Ponteves, Uukuniemi, Zaliv Terpeniya and St. Abb's Head; Nairoviruses: Soldado, Puffin Island, Avalon, Clo Mor, CRIMEAN- CONGO HEMORRHAGIC FEVER; Bunyavirus : Bhanja; Coltivirus : Eyach; Orbiviruses: Tribec, Okhotskiy, Cape Wrath, Mykines, Tindholmur and Bauline Thogotoviruses : Thogoto, Dhori; Asfivirus : AFRICAN SWINE FEVER VIRUS Hubálek Z, Rudolf I. Tick-borne viruses in Europe. Parasitol Res Apr 18. In addition: Such viruses were detected also in Russia: OMSK HEMORRHAGIC FEVER, WEST NILE VIRUS, POWASSAN and Kemerovo

6 Main tick-borne infections in Russia: TICK-BORNE ENCEPHALITIS; BORRELIOSIS (Lyme diseases); Rickettsia infections (Spotted fever group); Powassan Encephalitis; Omsk haemorrhagic fever; Anaplasmosis; Ehrlichiosis; Bartonellosis; West Nile fever!? Kemerovo!? The number of tick attacks are between human cases per year in Russia! And it is only official data!

7 1937 discovery of TBEV, putative place of field laboratory in Obor, Khabarovsk kray

8 Tick borne encephalitis in Russia Number cases of TBEV on of population Vector, Koltsovo Sites of study

9 The incidence of tick-borne encephalitis (TBE) has been reported for more than 25 European and Asian countries. This region is a home for over 700 million people, even not including China. Systematic data on the number of TBE cases in China are small.

10 Tick borne encephalitis foci in Europe. European distribution of natural foci of tick-borne encephalitis (CEE and RSSE) and louping ill (asterisks). Explanation: black dots and black areas, TBE virus isolation or the virus disease. The dotted line shows the limits of the Ixodes ricinus plus I.persulcatus area

11 Tick borne encephalitis in Europe.

12 Primorye-270 SALEM 263 HF-Bogolubovka Primorye Primorye-212 Primorye-253 Primorye-69 Far Eastern TBEV Neudoerfl Oshima5-10 European genotype TBEV Spanish sheep Hypr 205 Dalnegorsk Louping ill Sofjin-HO Turkish sheep Glubinnoe/2004 Greek goat Kolarovo-2008 Vasilchenko? Siberian genotype TBEV Zausaev EK SENZHANG MDJ-01 Kavalerovo

13 European genotype Siberian genotype Far Eastern genotype TBEV and molecular hours А О 0.02 Б 2750 years 2250 years 100 Л 1770 yrs. П М K 100 C И 100 Н В Г years. 590 yr. 650 yr. Д З Ж Е years 250 yr AB022291, Oshima3-6, Japan,1995 AB022292, OshimaI-1, Japan, 1996 AB237187, Oshima A-1, Japan,1995 AB001026, Kik629/97, Japan, 1997 AB022293, Oshima5-10, Japan, 1993 AB022294, OshimaC-1, Japan, 1996 AB237189, Oh696/97, Japan,1997 AB237184, Miz416/97, Japan, 1997 AB237188, Miz660/97, Japan, 1997 AF091008, Crimea, Ukraina, 1987 AF091013, N132, Vladivostok, yr. AF091016, RK1424, Latvia, yr. AF091019, T-blood, Perm, 1939 AB237192, Kita987/99, Japan, 1999 AB022703, Sofjin-HO, 1937 AB049345,VL-99-m11, Vladivostok, 1999 AB049346, KH99-m9, Khabarovsk, 1999 AB022295, KH98-2, Khabarovsk, 1998 AB022296, KH98-5, Khabarovsk, 1998 AB022297, KH98-10, Khabarovsk, 1998 AB237185, Kam586/97, Japan, AB237186, Kam588/97, Japan, yrs. AB049347, D1283, Khabarovsk, 1998 DQ862460, Glubinnoe/ yrs. AY174188, Senzhang, China, EU444077, Yar71, Yaroslavl, EU444078, Yar114, Yaroslavl, yrs. EU444079, Yar46-2, Yaroslavl, EU444080, Yar48, Yaroslavl, yrs. 100 AB049349, IR99-1m4, Irkutsk, AB049351, IR99-2m7, Irkutsk, yrs. 100 AF527415, Zausaev, Tomsk, 1985 AF091006, Aina, Irkutsk, 1963 AF069066, Vasilchenko, Novosibirsk, yrs. 99 AB049348, IR99-1m1, Irkutsk, 1999 AB049350, IR99-2m3, Irkutsk, 1999 Y07863, Louping ill, Scotland, 1929 AF091015, Pan, Moscow, yrs. AF091017, Scharl, Austria, 1956 AF091007, Als.I, France, AF ZZ9, Austria, AF091009, Iso 40, Switzerland, 1975 AF091010, K23, Germany, 1975 M27157, Neudoerfl, Austria, yrs. X60286, A52, Finland, AF091005, Absetterov, Sankt-Petersburg, 1951 AF091011, Kem I, Hungary, 1952 WNVNY99, WNV, strain NY99

14 New variants of lethal human TBEV infection Hemorrhagic TBEV (Novosibirsk, 1999) Age: Incubation time (after tick attack) Fever (start of disease) First small hemorrhagic CNS damage Massive hemorrhagic Death years 12,8 days 1 day 7 day 10 day days 16 day

15 Place of isolation of TBEV, 1937 Human TBEV lethal infection, strain, Glubinnoe/2004

16 Human lethal TBEV infection, Age of patient: strain Glubinnoe/ year Date of tick attack (2 ticks) 30 may 2004 Incubation time Clinical symptoms: 8 days Days Heavy fever 1 First CNS symptoms 2 CNS lesion (Air evacuation, Vladivostok TBEV center, active reanimation) Coma and apnoea 5 Death (heart failure) 10 4

17 Optical density at 492 nm Cultivation Glubinnoe/2004 of TBEV on PEG cells Virus yield, log TCID 50 ml Hours after infection 0

18 Amino acid substitutions for Glubinnoe/2004 in comparison with 205 and Sofjin strains C CTHDpr M E NS1 NS2a NS2b NS3 NS4a 2K NS4b NS5

19 Hypothesis. Mechanisms and pathways of tick-borne infections? Main hypotheses - wild birds. West Nile virus is a typical example. What evidence can provide research: tick-borne encephalitis virus, Omsk hemorrhagic fever virus, Powassan virus

20 Tomsk and tick-borne encephalitis The average incidence of TBEV infection in Russia varied from 1.9 to 4.4 cases per per year between 2001 and 2011 (State report of RF). Tomsk Region, the officially reported incidence of the infection was from 15.5 to 72.5 per in last decade (State report of Tomsk, 2011). The majority of these cases (74%) were within the Tomsk city the largest city in the region. Novosibirsk region located only 200 km to the south of Tomsk has been lower cases for the last three years (State report, Novosibirsk). Even lower incidence (0.36 to 1.0 cases per ) has been reported in Far Eastern region, where TBEV was originally discovered in 1937 (State report, Khabarovsk). Tomsk region Novosibirsk region

21 Tomsk, places for ticks collection N S

22 Tomsk, places for ticks collection

23 Tick-borne encephalitis viruses are genetically different!!! Strains of Kolarovo-2008 (Tomsk ) and Vasylchenko (Novosibirsk), Siberian genotype: The level of genetic difference reaches 10% in nucleotide sequence and 7% of its amino acid sequence. Zausaev (Tomsk) Kolarovo (Tomsk), Siberian genotype: Amino acid substitutions - 124, and the level of homology for 3 '-NCR is only 79%.

24 Phylogenetic tree of TBEV, Tomsk, Siberian genotype of TBEV - predominantly distributed genotype (89.5%) in suburban site, whereas in urban biotopes, 47% isolates of the TBEV were presented by Far Eastern genotype. Chronical TBE infection

25 Phylogenetic tree of TBEV, Tomsk, 2010 Only Far Eastern genotype of TBEV!!!

26 Wild birds and ixodid ticks in Tomsk The 736 wild birds representing 60 species were captured carrying a total of 804 I. pavlovskyi, I.persulcatus and I. plumbeus ticks. TBEV RNA and antigen were found in 9.7% and 22.8% samples collected from wild birds (40 species), respectively. TBEV markers were also detected in 9,8% I. persulcatus ticks, 4,7% - I. pavlovskyi and 4,2% - I. plumbeus ticks collected from wild birds.

27 Fieldfare - the principal disseminator (vector) for ixodid ticks!? Up to 70 ticks per birds (all stages), from these - 18 imago!!! Sand martin with Ixodes plumbeus

28 Ixodes ticks Tree Pipit (Anthus trivialis) - 13,25 ticks/bird Fieldfare (Turdus pilaris) - 5,73 ticks/bird

29 Ixodes ticks Redwing (Turdus iliacus) - 3,33 ticks/bird Common redstart (Phoenicurus phoenicurus) - 1,32 ticks/bird

30 Chaffinch (Fringilla coelebs) - 0,96 ticks/bird Ixodes ticks

31 Genotyping TBEV in birds and ixodid ticks collected from birds 25 isolates from Far Eastern genotype of TBEV, 9 isolates Siberian genotype of TBEV 2 viral strains FE genotype of TBEV were isolated from wild birds. I.pavlovskyi, I.persulcatus and I. plumbeus were collected from wild birds I.pavlovskyi - unusually widespread in urban biotopes of Tomsk and Novosibirsk!!!

32 Tick-borne encephalitis and Komi Republic?! 47 regions of RF Incidence of TBE infections in the Komi Republic (on 100 thousand of population) Russian Federation 1,98 2,62 2,19 Komi Republic 0,42 1,80 3,30

33 Taiga tick on the territory of the Komi Republic detected pathogens: Tick-borne encephalitis virus, West Nile virus, Borrelia spp., Ricketsia spp., Ehrlichia spp., Babesia spp., Bartonella spp., Anaplasma spp.

34 Phylogenetic tree of TBEV, Komi Republic, 2010 Direct genotyping of 16 variants of TBEV in ticks based on the direct sequencing of 5 -NCR showed that 3 isolates can be classified as Siberian genotype of TBEV, while the remaining 13 isolates of TBEV are the highly pathogenic variants of Far Eastern genotype.

35 Instead of conclusion: New flaviviruses, genetic variants, unusual disease outbreaks in recent years:

36 New Flaviviridae, genetic variants, unusual disease outbreaks 2006 Senegal New flavivirus - Ngoye 2007 India Presumably the new genotype of WNV, the level difference between 25-30% Japan New flavivirus - Culex flavivirus (CxFV), 2009 West Africa New flavivirus - Nounane (NOUV) 2009 Japan New flavivirus - Aedes flavivirus (AeFV) 2009 Mexico New flavivirus T Ho 2009 China Nanjianyin virus it is Kyasanur forest disease virus? now Nord Eurasia West Nile virus, genotype 2

37 New Flaviviridae, genetic variants, unusual disease outbreaks 2007 China Donggang virus - genotype 1 of Japanese encephalitis virus, for the first time in China China The outbreak of Duck virus in China, Tembusu virus (described by 1955, Malaysia, Culex mosquitoes) 2009 Finland Virus Lammi new mosquito flavivirus, is close to the Nounane virus 2007, , 2011 Senegal, Israel China, Kenya, Korea Virus Barkedji new mosquito flavivirus, the owner is not known, is close to the Nounane virus Chaoyang virus, discovered in China, then in Kenya and then in the Republic of Korea Portugal Finland Virus Hanko, isolated from mosquitoes, the Negev-like virus is homologous virus Hanko

38 New Flaviviridae, genetic variants, unusual disease outbreaks 2011, 2013 Senegal, Polynesia Virus Zika, southeastern Senegal; French Polynesia, Southern Europe?? 2014 Italy AeVF, Aedes flavivirus in north-eastern Italy 2014 South America New strains of Culex flavivirus isolated in Argentina

39 Acknowledgments: SRC VB Vector, Koltsovo Ivanova A.V. Subbotina E.l. Kazachinskaya E.I. Konovalova S.N. Kononova Yu.V. Tupota N.L. Protopopova E.V. Razumov I.A. Riabchikova E.I. Sviatchenko V.A. Ternovoi V.A. Chausov E.V. Shvalov A.N. Mikrukova N.P. Kartashov M.Yu. Agulova L.P. Bolshakova N.P. Gashkov S.I. Ivanova, N.V. Kravchenko L.B. Korobitsyn I.G. Kuranova V.N. Moskvitin S.S. Moskvitina N.S. Romanenko V.N. Suchkova N.G. Tuten kov O.Yu. Komi Republic Glushkova L.I. Korabelnikov I.V. Galimov P.P. Yegorova Yu.I. Many thanks my colleagues who have worked and helped us in these studies

40 Thank you for your attention!

«One world, One health» concept applied to infectious diseases, from the past to the future. Pascal Boireau

«One world, One health» concept applied to infectious diseases, from the past to the future. Pascal Boireau «One world, One health» concept applied to infectious diseases, from the past to the future. Pascal Boireau Animal health laboratory, ANSES, Alfort-EnvA Campus Nocard provided a culture of M. Bovis isolated

More information

Ticks and tick-borne pathogens Jordi Tarrés-Call, Scientific Officer of the AHAW unit

Ticks and tick-borne pathogens Jordi Tarrés-Call, Scientific Officer of the AHAW unit Ticks and tick-borne pathogens Jordi Tarrés-Call, Scientific Officer of the AHAW unit Antwerp, June 2 nd 2010 1 The role of EFSA! To assess and communicate all risks associated with the food chain! We

More information

Encephalomyelitis. Synopsis. Armando Angel Biology 490 May 14, What is it?

Encephalomyelitis. Synopsis. Armando Angel Biology 490 May 14, What is it? Encephalomyelitis Armando Angel Biology 490 May 14, 2009 Synopsis What is it? Taxonomy Etiology Types- Infectious and Autoimmune Epidemiology Transmission Symptoms/Treatments Prevention What is it? Inflammation

More information

Pan European maps of Vector Borne diseases

Pan European maps of Vector Borne diseases Pan European maps of Vector Borne diseases Marieta Braks On behalf of WP4 2 Vbornet AGM 2012, Riga European Network for Arthropod Vector Surveillance for Human Public Health http://www.vbornet.eu/ Project

More information

TICKS AND TICKBORNE DISEASES. Presented by Nicole Chinnici, MS, C.W.F.S East Stroudsburg University Northeast Wildlife DNA Laboratory

TICKS AND TICKBORNE DISEASES. Presented by Nicole Chinnici, MS, C.W.F.S East Stroudsburg University Northeast Wildlife DNA Laboratory TICKS AND TICKBORNE DISEASES Presented by Nicole Chinnici, MS, C.W.F.S East Stroudsburg University Northeast Wildlife DNA Laboratory PA Lyme Medical Conference 2018 New Frontiers in Lyme and Related Tick

More information

Detection and genetic characterization of a wide range of infectious agents in Ixodes pavlovskyi ticks in Western Siberia, Russia

Detection and genetic characterization of a wide range of infectious agents in Ixodes pavlovskyi ticks in Western Siberia, Russia Rar et al. Parasites & Vectors (2017) 10:258 DOI 10.1186/s13071-017-2186-5 RESEARCH Detection and genetic characterization of a wide range of infectious agents in Ixodes pavlovskyi ticks in Western Siberia,

More information

Chart showing the average height of males and females in various world countries.

Chart showing the average height of males and females in various world countries. Chart showing the average height of males and females in various world countries. Country/Region Average male height Average female height Sampled Age Range Albania 174.0 cm (5 ft 8 1/2 in) 161.8 cm (5

More information

Environmental associations of ticks and disease. Lucy Gilbert

Environmental associations of ticks and disease. Lucy Gilbert Environmental associations of ticks and disease Lucy Gilbert Ticks in Europe 1. Ixodes arboricola 2. Ixodes caledonicus 3. Ixodes frontalis 4. Ixodes lividus 5. Ixodes rothschildi 6. Ixodes unicavatus

More information

Vector-Borne Disease Status and Trends

Vector-Borne Disease Status and Trends Vector-Borne Disease Status and Trends Vector-borne Diseases in NY 2 Tick-borne Diseases: Lyme disease Babesiosis Ehrlichiosis/Anaplasmosis Rocky Mountain Spotted Fever Powassan Encephalitis STARI Bourbon

More information

The Essentials of Ticks and Tick-borne Diseases

The Essentials of Ticks and Tick-borne Diseases The Essentials of Ticks and Tick-borne Diseases Presenter: Bobbi S. Pritt, M.D., M.Sc. Director, Clinical Parasitology Laboratory Co-Director, Vector-borne Diseases Laboratory Services Vice Chair of Education

More information

Page 1 of 5 Medical Summary OTHER TICK-BORNE DISEASES This article covers babesiosis, anaplasmosis, and ehrlichiosis. See Rickettsial Infections (tick-borne rickettsia), Lyme Disease, and Tick-Borne Encephalitis

More information

How does tick ecology determine risk?

How does tick ecology determine risk? How does tick ecology determine risk? Sarah Randolph Department of Zoology, University of Oxford, UK LDA, Leicester, July.00 Tick species found in the UK Small rodents Water voles Birds (hole nesting)

More information

Kraichat.tan@mahidol.ac.th 1 Outline Vector Borne Disease The linkage of CC&VBD VBD Climate Change and VBD Adaptation for risk minimization Adaptation Acknowledgement: data supported from WHO//www.who.org

More information

Prevalence of tick-borne encephalitis virus in ticks from southern Korea

Prevalence of tick-borne encephalitis virus in ticks from southern Korea pissn 229-84X, eissn 97-X J. Vet. Sci. (2), (3), 97-23 DOI:.442/jvs.2..3.97 Received: 9 Nov. 29, Accepted: 7 Mar. 2 Original Article JOURNAL OF Veterinary Science Prevalence of tick-borne encephalitis

More information

European poultry industry trends

European poultry industry trends European poultry industry trends November 5 th 2014, County Monaghan Dr. Aline Veauthier & Prof. Dr. H.-W. Windhorst (WING, University of Vechta) 1 Agenda The European Chicken Meat Market - The global

More information

What are Ticks? 4/22/15. Typical Hard Tick Life Cycle. Ticks of the Southeast The Big Five and Their Management

What are Ticks? 4/22/15. Typical Hard Tick Life Cycle. Ticks of the Southeast The Big Five and Their Management Ticks of the Southeast The Big Five and Their Management LT Jeff Hertz, MSC, USN PhD Student, Entomology and Nematology Dept., University of Florida What are Ticks? Ticks are MITES.really, really ig mites.

More information

Early warning for Lyme disease: Lessons learned from Canada

Early warning for Lyme disease: Lessons learned from Canada Early warning for Lyme disease: Lessons learned from Canada Nick Hume Ogden, National Microbiology Laboratory @ Saint-Hyacinthe Talk outline The biology of Lyme disease emergence in the context of climate

More information

LABORATORY ASSAYS FOR THE DIAGNOSIS OF TICK-TRANSMITTED HUMAN INFECTIONS

LABORATORY ASSAYS FOR THE DIAGNOSIS OF TICK-TRANSMITTED HUMAN INFECTIONS LABORATORY ASSAYS FOR THE DIAGNOSIS OF TICK-TRANSMITTED HUMAN INFECTIONS Stephen R. Graves, Gemma Vincent, Chelsea Nguyen, Haz Hussain-Yusuf, Aminul Islam & John Stenos. Australian Rickettsial Reference

More information

Mosquitoes in a changing environment

Mosquitoes in a changing environment Mosquitoes in a changing environment Anders Lindström National Veterinary Institute Sweden Tree hole mosquito, Aedes geniculatus The One health concept is the realization that we are connected to our environment

More information

About Ticks and Lyme Disease

About Ticks and Lyme Disease About Ticks and Lyme Disease Ticks are small crawling bugs in the spider family. They are arachnids, not insects. There are hundreds of different kinds of ticks in the world. Many of them carry bacteria,

More information

Medical and Veterinary Entomology

Medical and Veterinary Entomology Medical and Veterinary Entomology An eastern treehole mosquito, Aedes triseriatus, takes a blood meal. Urbana, Illinois, USA Alexander Wild Photography Problems associated with arthropods 1) Psychological

More information

Zoonoses - Current & Emerging Issues

Zoonoses - Current & Emerging Issues Zoonoses - Current & Emerging Issues HUMAN HEALTH & MEDICINE VETERINARY HEALTH & MEDICINE Martin Shakespeare RD MRPharmS MCGI Scope Zoonotic Disease What is it? Why is it significant? Current Issues &

More information

Supplementary Table 1. Primers used in the study.

Supplementary Table 1. Primers used in the study. Supplementary Table 1. Primers used in the study. Primer Position (bp) Upstream primer (5 3 ) Downstream primer (5 3 ) Expected (bp) size 1 1 278 ACCAAACAGAGAATCTGTGAG CAGCAATCCGAAGGCAGAATAC 299 2 48 946

More information

PUBLICise HEALTH. Public Health Telegram on Vector-borne Diseases. Issue No 2 TBD

PUBLICise HEALTH. Public Health Telegram on Vector-borne Diseases. Issue No 2 TBD PUBLICise HEALTH Public Health Telegram on Vector-borne Diseases Issue No 2 TBD December 2013 Welcome to the second issue of the EDENext Public Health Telegram, the newsletter from the EDENext project

More information

Bloodsuckers in the woods... Lyric Bartholomay Associate Professor Department of Entomology Iowa State University

Bloodsuckers in the woods... Lyric Bartholomay Associate Professor Department of Entomology Iowa State University Bloodsuckers in the woods... Lyric Bartholomay Associate Professor Department of Entomology Iowa State University Characteristics Adapted for ectoparasitism: Dorsoventrally flattened Protective exoskeleton

More information

Israel Journal of Entomology Vol. XXIII(1989) pp

Israel Journal of Entomology Vol. XXIII(1989) pp Israel Journal of Entomology Vol. XXIII(1989) pp. 51-57 THE PROSPECT OF BACILLUS THURINGIENSIS VAR. ISRAELENSIS AND BACILLUS SPHAERICUS IN MOSQUITO CONTROL IN THAILAND SOMSAK PANTUWATANA Department of

More information

Tick-borne Disease Testing in Shelters What Does that Blue Dot Really Mean?

Tick-borne Disease Testing in Shelters What Does that Blue Dot Really Mean? Tick-borne Disease Testing in Shelters What Does that Blue Dot Really Mean? 2017 ASPCA. All Rights Reserved. Your Presenter Stephanie Janeczko, DVM, MS, DABVP, CAWA Senior Director of Shelter Medical Programs

More information

Anthropogenic Change and the Emergence of Tick-Borne Pathogens in the Northeast US

Anthropogenic Change and the Emergence of Tick-Borne Pathogens in the Northeast US Anthropogenic Change and the Emergence of Tick-Borne Pathogens in the Northeast US Durland Fish, Ph.D. Yale School of Public Heath Yale School of Forestry and Environmental Studies Yale Institute for Biospheric

More information

Tick-borne viral infectious diseases

Tick-borne viral infectious diseases Med. Entomol. Zool. Vol. 64 No. 2 p. 61 66 2013 61 DOI: 10.7601/mez.64.61 065 0013 13 3 1 30 2013 5 10 2013 5 21 Tick-borne viral infectious diseases Ikuo Takashima Department of Nutrition, School of Nursing

More information

Animal reservoirs for Nipah virus

Animal reservoirs for Nipah virus Animal reservoirs for Nipah virus Dr. D. T. Mourya ICMR-National Institute of Virology Pune 411021, INDIA Tracing the source of Infection ICMR-NIV, Pune has team of scientific experts and trained field

More information

Global Monthly October 2016

Global Monthly October 2016 Jan- Feb- Mar- Apr- May- Jun- Jul- Aug- Sep- Global Monthly Index, >5 = expansion 5 Output Export orders 5 9 http://www.worldbank.org/en/research/brief/economic-monitoring Sept ' Dec '5 Sept ' Sept ' Dec

More information

Control of Lyme borreliosis and other Ixodes ricinus-borne diseases

Control of Lyme borreliosis and other Ixodes ricinus-borne diseases Sprong et al. Parasites & Vectors (2018) 11:145 https://doi.org/10.1186/s13071-018-2744-5 REVIEW Control of Lyme borreliosis and other Ixodes ricinus-borne diseases Hein Sprong 1,4*, Tal Azagi 1, Dieuwertje

More information

TICK-BORNE DISEASES: OPENING PANDORA S BOX

TICK-BORNE DISEASES: OPENING PANDORA S BOX TICK-BORNE DISEASES: OPENING PANDORA S BOX Seta Jahfari TICK-BORNE DISEASES: OPENING PANDORA S BOX SETA JAHFARI Tick-borne Diseases: Opening Pandora s Box Teken-overdraagbare ziekten: het openen van de

More information

Mosquitoes and the diseases they spread. An Independent District Protecting Public Health since 1930

Mosquitoes and the diseases they spread. An Independent District Protecting Public Health since 1930 Mosquitoes and the diseases they spread An Independent District Protecting Public Health since 1930 Berkeley City Council Presentation 12/13/2016 What we ll talk about today Overview of ACMAD Mosquito

More information

This document is available on the English-language website of the Banque de France

This document is available on the English-language website of the Banque de France JANUARY 7 This document is available on the English-language website of the www.banque-france.fr Countries ISO code Date of entry into the euro area Fixed euro conversion rates France FR //999.97 Germany

More information

SCIENTIFIC OPINION. EFSA Panel on Animal Health and Welfare (AHAW) 2, 3. European Food Safety Authority (EFSA), Parma, Italy

SCIENTIFIC OPINION. EFSA Panel on Animal Health and Welfare (AHAW) 2, 3. European Food Safety Authority (EFSA), Parma, Italy SCIENTIFIC OPINION Scientific Opinion on Geographic Distribution of Tick-borne Infections and their Vectors in Europe and the other Regions of the Mediterranean Basin 1 EFSA Panel on Animal Health and

More information

Wild animals as hosts for anthropophilic tick species in Serbia

Wild animals as hosts for anthropophilic tick species in Serbia Wild animals as hosts for anthropophilic tick species in Serbia Snežana Tomanović,, PhD Laboratory for Medical Entomology, Center of excellence for food and vector borne zoonoses Institute for Medical

More information

Topics. Ticks on dogs in North America. Ticks and tick-borne diseases: emerging problems? Andrew S. Peregrine

Topics. Ticks on dogs in North America. Ticks and tick-borne diseases: emerging problems? Andrew S. Peregrine Ticks and tick-borne diseases: emerging problems? Andrew S. Peregrine E-mail: aperegri@ovc.uoguelph.ca Topics Ticks on dogs in Ontario and the pathogens they transmit? Should dogs be routinely screened

More information

Prevalence of pathogens in ticks feeding on humans. Tinne Lernout

Prevalence of pathogens in ticks feeding on humans. Tinne Lernout Prevalence of pathogens in ticks feeding on humans Tinne Lernout Contexte Available data for Belgium: localized geographically questing ticks or feeding ticks on animals collection at one moment in time

More information

WHO laboratory-based global survey on multidrug-resistant organisms (MDROs) in health care interim analysis

WHO laboratory-based global survey on multidrug-resistant organisms (MDROs) in health care interim analysis WHO laboratory-based global survey on multidrug-resistant organisms (MDROs) in health care interim analysis Aim: to estimate the burden of MDROs isolated among inpatients in a wide range of health-care

More information

Cracking open or keeping a lid on? The Pandora s Box of human infectious disease risks associated with (intact) forests

Cracking open or keeping a lid on? The Pandora s Box of human infectious disease risks associated with (intact) forests Cracking open or keeping a lid on? The Pandora s Box of human infectious disease risks associated with (intact) forests Kris Murray kris.murray@imperial.ac.uk @earthfluenza Hiral Shah Arran Hamlet Elizabeth

More information

Multiplex real-time PCR for the passive surveillance of ticks, tick-bites, and tick-borne pathogens

Multiplex real-time PCR for the passive surveillance of ticks, tick-bites, and tick-borne pathogens Multiplex real-time PCR for the passive surveillance of ticks, tick-bites, and tick-borne pathogens Guang Xu, Stephen Rich Laboratory of Medical Zoology University of Massachusetts Amherst TICKS ARE VECTORS

More information

Panel & Test Price List

Panel & Test Price List Effective October 16, 2017 we are offering our new tests for Lyme IGXSpot, Lyme Borreliosis, and Tick-borne Relapsing Fever Borreliosis The new ImmunoBlot tests have replaced the original Western Blot

More information

Climate Change and Vector-borne Disease Risk in Minnesota. Dave Neitzel, MS Minnesota Department of Health March, 2010

Climate Change and Vector-borne Disease Risk in Minnesota. Dave Neitzel, MS Minnesota Department of Health March, 2010 Vectorborne Disease Climate Change and Vector-borne Disease Risk in Minnesota Dave Neitzel, MS Minnesota Department of Health March, 2010 Objectives 1. Outline the primary tick and mosquitotransmitted

More information

Articles on Tick-borne infections UK / Ireland

Articles on Tick-borne infections UK / Ireland Articles on Tick-borne infections UK / Ireland By Jenny O Dea April 18 2011 Rickettsia First detection of spotted fever group rickettsiae in Ixodes ricinus and Dermacentor reticulatus ticks in the UK.

More information

The Increase and Spread of Mosquito Borne Diseases. Deidre Evans

The Increase and Spread of Mosquito Borne Diseases. Deidre Evans The Increase and Spread of Mosquito Borne Diseases Deidre Evans Mosquito Borne Diseases A rise in temperature is one on of the most common factors contributing to the increase of mosquito borne diseases.

More information

Climate change impact on vector-borne diseases: an update from the trenches

Climate change impact on vector-borne diseases: an update from the trenches Climate change impact on vector-borne diseases: an update from the trenches Dr C. Caminade Institute of Infection and Global Health Cyril.Caminade@liverpool.ac.uk Vector Borne diseases Diseases transmitted

More information

Mosquito Control Matters

Mosquito Control Matters Mosquito Control Matters Community Presentation: FIGHT THE BITE Mosquitoes and West Nile Virus Prevention Luz Maria Robles Public Information Officer Sacramento Yolo Mosquito & Vector Control District

More information

Parvovirus Type 2c An Emerging Pathogen in Dogs. Sanjay Kapil, DVM, MS, PhD Professor Center for Veterinary Health Sciences OADDL Stillwater, OK

Parvovirus Type 2c An Emerging Pathogen in Dogs. Sanjay Kapil, DVM, MS, PhD Professor Center for Veterinary Health Sciences OADDL Stillwater, OK Parvovirus Type 2c An Emerging Pathogen in Dogs Sanjay Kapil, DVM, MS, PhD Professor Center for Veterinary Health Sciences OADDL Stillwater, OK Properties of Canine Parvovirus Single-stranded DNA virus

More information

STATUS OF HAEMAPHYSALIS LONGICORNIS IN THE UNITED STATES

STATUS OF HAEMAPHYSALIS LONGICORNIS IN THE UNITED STATES STATUS OF HAEMAPHYSALIS LONGICORNIS IN THE UNITED STATES D E N I S E B O N I L L A U S D A, A P H I S V E T E R I N A R Y S E R V I C E S C AT T L E H E A LT H C E N T E R N AT I O N A L C AT T L E F E

More information

Seroprevalence of Dengue in Antenatal and Paediatric Patients - In a Tertiary Care Hospital, Puducherry

Seroprevalence of Dengue in Antenatal and Paediatric Patients - In a Tertiary Care Hospital, Puducherry International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 06 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.706.077

More information

Biology and Control of Insects and Rodents Workshop Vector Borne Diseases of Public Health Importance

Biology and Control of Insects and Rodents Workshop Vector Borne Diseases of Public Health Importance Vector-Borne Diseases of Public Health Importance Rudy Bueno, Jr., Ph.D. Director Components in the Disease Transmission Cycle Pathogen Agent that is responsible for disease Vector An arthropod that transmits

More information

Presentation Outline. Commercial RVF vaccines. RVF Clone 13 performance in the field. Candidate RVF vaccines in the pipeline

Presentation Outline. Commercial RVF vaccines. RVF Clone 13 performance in the field. Candidate RVF vaccines in the pipeline Presentation Outline Commercial RVF vaccines Old Smithburn, inactivated New Clone 13 RVF Clone 13 performance in the field Candidate RVF vaccines in the pipeline 2 Onderstepoort Biological Products November

More information

Zoonoses in food and feed

Zoonoses in food and feed Zoonoses in food and feed Jaap Wagenaar, DVM PhD Faculty of Veterinary Medicine, Utrecht University, the Netherlands Central Veterinary Institute, Lelystad, the Netherlands j.wagenaar@uu.nl Outline Zoonoses

More information

2017 REPORT OF VECTOR CONTROL ACTIVITIES

2017 REPORT OF VECTOR CONTROL ACTIVITIES Ventura County Environmental Health Division 800 S. Victoria Ave., Ventura CA 93009-1730 TELEPHONE: 805/654-2813 or FAX: 805/654-2480 Internet Web Site Address: www.vcrma.org/envhealth 2017 REPORT OF VECTOR

More information

Their Biology and Ecology. Jeannine Dorothy, Entomologist Maryland Department of Agriculture, Mosquito Control Section

Their Biology and Ecology. Jeannine Dorothy, Entomologist Maryland Department of Agriculture, Mosquito Control Section Their Biology and Ecology Jeannine Dorothy, Entomologist Maryland Department of Agriculture, Mosquito Control Section Mosquito Biology 60+ species in Maryland in 10 genera 14 or more can vector disease

More information

Detection and Identification of Rickettsia helvetica and Rickettsia sp. IRS3/IRS4 in Ixodes ricinus Ticks found on humans in Spain.

Detection and Identification of Rickettsia helvetica and Rickettsia sp. IRS3/IRS4 in Ixodes ricinus Ticks found on humans in Spain. 1 Title Detection and Identification of Rickettsia helvetica and Rickettsia sp. IRS3/IRS4 in Ixodes ricinus Ticks found on humans in Spain. Authors P. Fernández-Soto, R. Pérez-Sánchez, A. Encinas-Grandes,

More information

Slide 1. Slide 2. Slide 3

Slide 1. Slide 2. Slide 3 1 Exotic Ticks Amblyomma variegatum Amblyomma hebraeum Rhipicephalus microplus Rhipicephalus annulatus Rhipicephalus appendiculatus Ixodes ricinus 2 Overview Organisms Importance Disease Risks Life Cycle

More information

Update on Lyme disease and other tick-borne disease in North Central US and Canada

Update on Lyme disease and other tick-borne disease in North Central US and Canada Update on Lyme disease and other tick-borne disease in North Central US and Canada Megan Porter, DVM Michigan State University 2018 CIF-SAF Joint Conference Tick season is here! Today s objectives: To

More information

sanguineus, in a population of

sanguineus, in a population of BVA Student Travel Grant Final Report Prevalence of the Brown Dog tick, Rhipicephalus sanguineus, in a population of dogs in Zanzibar, and its role as a vector of canine tickborne disease. Bethan Warner

More information

Santa Clara County Vector Control District Operations and Surveillance Report February 2018

Santa Clara County Vector Control District Operations and Surveillance Report February 2018 Page 1 Santa Clara County Vector Control District Operations and Surveillance Report February 2018 District Mission Table of Contents page Manager s Message 1 Operations Report: Curbs and Catchbasins 2

More information

Monitoring of AMR in Russia

Monitoring of AMR in Russia Monitoring of AMR in Russia Surveillance studies conducted by Institute of Antimicrobial Chemotherapy (IAC) Centre for Monitoring of Antimicrobial Resistance (CMAR) Prospective surveillance studies on

More information

soft ticks hard ticks

soft ticks hard ticks Ticks Family Argasidae soft ticks Only 4 genera of Argasidae Argas, Ornithodoros, Otobius (not covered) and Carios (not covered) Family Ixodidae hard ticks Only 4 genera of Ixodidae covered because of

More information

ZIKA VIRUS. Vector Containment Activities. Highway and Bridge Maintenance Division Mosquito Control

ZIKA VIRUS. Vector Containment Activities. Highway and Bridge Maintenance Division Mosquito Control Highway and Bridge Maintenance Division Mosquito Control ZIKA VIRUS Vector Containment Activities Mosquito Control: About Us Countywide, year-round mosquito-abatement program for tracking, spraying and

More information

Emerging Infections and the Ecotone. Cover: Emerging Zoonoses and Pathogens of Public Health Concern

Emerging Infections and the Ecotone. Cover: Emerging Zoonoses and Pathogens of Public Health Concern Emerging Infections and the Ecotone Cover: Emerging Zoonoses and Pathogens of Public Health Concern To learn more, log on to: www.medicalecology.org An ecotone is a narrow transition zone between one

More information

Food & Veterinary Office

Food & Veterinary Office EUROPEAN COMMISSION HEALTH & CONSUMER PROTECTION DIRECTORATE-GENERAL Directorate F - Food and Veterinary Office DG(SANCO) F6(2004)D/660037 Food & Veterinary Office Programme of Inspections 2004 July -

More information

The challenge of growing resistance

The challenge of growing resistance EXECUTIVE SUMMARY Around 2.4 million people could die in Europe, North America and Australia between 2015-2050 due to superbug infections unless more is done to stem antibiotic resistance. However, three

More information

Suggested vector-borne disease screening guidelines

Suggested vector-borne disease screening guidelines Suggested vector-borne disease screening guidelines SNAP Dx Test Screen your dog every year with the SNAP Dx Test to detect exposure to pathogens that cause heartworm disease, ehrlichiosis, Lyme disease

More information

RISK OF VECTOR- BORNE DISEASES FROM CLIMATE CHANGE

RISK OF VECTOR- BORNE DISEASES FROM CLIMATE CHANGE RISK OF VECTOR- BORNE DISEASES FROM CLIMATE CHANGE OBJECTIVES 1. Describe the effects of climate change on vectorborne diseases 2. Discuss the new and most important vectorborne infections 3. Identify

More information

Vector-borne Diseases in Minnesota

Vector-borne Diseases in Minnesota Vector-borne Diseases in Minnesota David Neitzel, MS Hannah Friedlander, MPH Minnesota Department of Health Acute Disease Investigation and Control Morrison-Todd-Wadena Board of Health Meeting April 27,

More information

The prevalence of Borrelia burgdorferi sensu lato in Ixodes persulcatus and I. ricinus ticks in the zone of their sympatry

The prevalence of Borrelia burgdorferi sensu lato in Ixodes persulcatus and I. ricinus ticks in the zone of their sympatry FOLIA PARASITOLOGICA 48: 63-68, 2001 The prevalence of Borrelia burgdorferi sensu lato in Ixodes persulcatus and I. ricinus ticks in the zone of their sympatry Edward I. Korenberg, Yurii V. Kovalevskii,

More information

of Emerging Infectious Diseases in Wildlife Trade in Lao

of Emerging Infectious Diseases in Wildlife Trade in Lao 10th APEIR Regional Meeting: The New Wave of Regional EID Research Partnership" Bali, Indonesia, 13-14 October 2016 Wildlife trade project in Lao PDR Progress of the project implementation on Surveillance

More information

Northwest Mosquito Abatement District

Northwest Mosquito Abatement District Introduction to Northwest Mosquito Abatement District Patrick Irwin, MS. PhD. Entomologist NWMAD 147 W. Hintz Rd. Wheeling, IL 60090 1 847 537 2306 nwmadil.com Northwest Mosquito Abatement District Formed

More information

Canine Anaplasmosis Anaplasma phagocytophilum Anaplasma platys

Canine Anaplasmosis Anaplasma phagocytophilum Anaplasma platys Canine Anaplasmosis Anaplasma phagocytophilum Anaplasma platys It takes just hours for an infected tick to transmit Anaplasma organisms to a dog. What is canine anaplasmosis? Canine anaplasmosis is a disease

More information

Ticks and tick-borne diseases

Ticks and tick-borne diseases Occupational Diseases Ticks and tick-borne diseases Ticks Ticks are small, blood sucking arthropods related to spiders, mites and scorpions. Ticks are only about one to two millimetres long before they

More information

1. INTRODUCTION. Ticks are obligate haematophagous ectoparasites with. worldwide distribution and they have a significant impact on human

1. INTRODUCTION. Ticks are obligate haematophagous ectoparasites with. worldwide distribution and they have a significant impact on human 1. INTRODUCTION Ticks are obligate haematophagous ectoparasites with worldwide distribution and they have a significant impact on human and animal health. A total of ~850 tick species have been catalogued

More information

( ) Page: 1/6 COMMUNICATION FROM THE WORLD ORGANISATION FOR ANIMAL HEALTH (OIE)

( ) Page: 1/6 COMMUNICATION FROM THE WORLD ORGANISATION FOR ANIMAL HEALTH (OIE) 14 October (16-5561) Page: 1/6 Committee on Sanitary and Phytosanitary Measures Original: English/French/Spanish 67 TH MEETING OF THE SPS COMMITTEE COMMUNICATION FROM THE WORLD ORGANISATION FOR ANIMAL

More information

Gregory DeMuri M.D. Department of Pediatrics School of Medicine and Public Health

Gregory DeMuri M.D. Department of Pediatrics School of Medicine and Public Health Gregory DeMuri M.D. Department of Pediatrics School of Medicine and Public Health I have no financial disclosures relevant to this presentation. I will reference non-fda approved indications for medications

More information

INVASIVE MOSQUITO SPECIES ALERT Aedes aegypti

INVASIVE MOSQUITO SPECIES ALERT Aedes aegypti INVASIVE MOSQUITO SPECIES ALERT Aedes aegypti The Aedes aegypti mosquito has been found in several areas throughout California. Help us protect public health by educating yourself on how to identify and

More information

Key concepts of Article 7(4): Version 2008

Key concepts of Article 7(4): Version 2008 Species no. 32: Rock Partridge Alectoris graeca Distribution: This European endemic partridge inhabits both low-altitude rocky steppes and mountainous open heaths and grasslands. It occurs in the Alps,

More information

SUMMARY. Mosquitoes are surviving on earth since millions of years. They are the

SUMMARY. Mosquitoes are surviving on earth since millions of years. They are the SUMMARY Mosquitoes are surviving on earth since millions of years. They are the important carriers of various diseases like malaria, dengue, filaria, Japanese encephalitis, west nile virus and chikun gunia.

More information

POLICY ACTIONS IDENTIFIED IN CALLISTO CYCLE 1 IN EU COUNTRIES AND DEALING WITH THE PARADIGMATIC DISEASES. Bacterial diseases

POLICY ACTIONS IDENTIFIED IN CALLISTO CYCLE 1 IN EU COUNTRIES AND DEALING WITH THE PARADIGMATIC DISEASES. Bacterial diseases 1 ANNEX 1 POLICY ACTIONS IDENTIFIED IN CALLISTO CYCLE 1 IN EU COUNTRIES AND DEALING WITH THE PARADIGMATIC DISEASES Bacterial s Multidrug resistance Bite wound infections Campylobacteriosis Bartonellosis

More information

Free-Ranging Wildlife. Biological Risk Management for the Interface of Wildlife, Domestic Animals, and Humans. Background Economics

Free-Ranging Wildlife. Biological Risk Management for the Interface of Wildlife, Domestic Animals, and Humans. Background Economics Biological Risk Management for the Interface of Wildlife, Domestic Animals, and Humans Free-Ranging Wildlife This presentation concerns free-ranging birds and mammals John R. Fischer, DVM, PhD Southeastern

More information

Ordering Arbovirus Serology and Other Zoonotic Tests Complementary Notes

Ordering Arbovirus Serology and Other Zoonotic Tests Complementary Notes Supplementary information is provided in the table that follows to assist with the ordering of tests on the new ProvLab Zoonotic Requisition. Many of these tests are sent to the National Microbiology Laboratory,

More information

Activities of OIE Collaborating Centre for Surveillance and Control of Animal Protozoan Diseases and Protozoan Diseases in wildlife

Activities of OIE Collaborating Centre for Surveillance and Control of Animal Protozoan Diseases and Protozoan Diseases in wildlife Activities of OIE Collaborating Centre for Surveillance and Control of Animal Protozoan Diseases and Protozoan Diseases in wildlife Prof. Ikuo Igarashi National Research Center for Protozoan Diseases Obihiro

More information

Research Center for Ecological Safety, Russian Academy of Sciences, St. Petersburg, Russia;

Research Center for Ecological Safety, Russian Academy of Sciences, St. Petersburg, Russia; æcluster: VULNERABLE POPULATIONS IN THE ARCTIC The impact of climate change on the expansion of Ixodes persulcatus habitat and the incidence of tickborne encephalitis in the north of European Russia Nikolay

More information

Zoonoses. Viral, Rickettsial and Prion Diseases

Zoonoses. Viral, Rickettsial and Prion Diseases Zoonoses Viral, Rickettsial and Prion Diseases The Editor Dr. Sudhi Ranjan Garg is a senior Professor of Veterinary Public Health and Epidemiology in the College of Veterinary Sciences, Lala Lajpat Rai

More information

Tick-borne Diseases, an Emerging Health Threat to US Forces Korea

Tick-borne Diseases, an Emerging Health Threat to US Forces Korea Tick-borne Diseases, an Emerging Health Threat to US Forces Korea Terry A. Klein, COL (Ret), PhD Vector-borne Disease Program Manager FHP&PM, AGENDA Objectives, Concept, Organization Mite-, Tick, and Flea-borne

More information

Regional research activities and state of the art of Vmerge Project: Emerging viralvector

Regional research activities and state of the art of Vmerge Project: Emerging viralvector Regional research activities and state of the art of Vmerge Project: Emerging viralvector borne diseases Joint permanent committee 4th November 2014 Cirad Key features of Vmerge Cirad - F Borne Objectives

More information

Genetic diversity of Russian native cattle breeds on the genes associated with milk production. Sulimova, G., Lazebnaya, I., Khatami, S., Lazebny, O.

Genetic diversity of Russian native cattle breeds on the genes associated with milk production. Sulimova, G., Lazebnaya, I., Khatami, S., Lazebny, O. Genetic diversity of Russian native cattle breeds on the genes associated with milk production Sulimova, G., Lazebnaya, I., Khatami, S., Lazebny, O. Estimation of the genetic diversity of local cattle

More information

County of San Diego Vector Control Program. Mosquitoes, Rats, Ticks and More!

County of San Diego Vector Control Program. Mosquitoes, Rats, Ticks and More! County of San Diego Vector Control Program Mosquitoes, Rats, Ticks and More! What is a Vector? Any organism capable of carrying and transferring a disease Common vectors: Mosquitoes Ticks Rats Flies What

More information

Food & Veterinary Office

Food & Veterinary Office EUROPEAN COMMISSION HEALTH & CONSUMER PROTECTION DIRECTORATE-GENERAL Directorate F - Food and Veterinary Office DG(SANCO)D(2005)660066 Food & Veterinary Office Programme of Inspections 2005 July - December

More information

Marin/Sonoma Mosquito & Vector Control District. Update to the Town of San Anselmo May 9, 2017

Marin/Sonoma Mosquito & Vector Control District. Update to the Town of San Anselmo May 9, 2017 Marin/Sonoma Mosquito & Vector Control District Update to the Town of San Anselmo May 9, 2017 The Marin/Sonoma MVCD has provided comprehensive mosquito and disease control services to areas in Marin since

More information

Hyalomma impeltatum (Acari: Ixodidae) as a potential vector of malignant theileriosis in sheep in Saudi Arabia

Hyalomma impeltatum (Acari: Ixodidae) as a potential vector of malignant theileriosis in sheep in Saudi Arabia Veterinary Parasitology 99 (2001) 305 309 Hyalomma impeltatum (Acari: Ixodidae) as a potential vector of malignant theileriosis in sheep in Saudi Arabia O.M.E. El-Azazy a,, T.M. El-Metenawy b, H.Y. Wassef

More information

OIE Collaborating Centres Reports Activities

OIE Collaborating Centres Reports Activities OIE Collaborating Centres Reports Activities Activities in 2017 This report has been submitted : 2018-01-13 02:04:00 Title of collaborating centre: Diagnosis and Vaccine Evaluation in the Address of Collaborating

More information

Dog survey in Russian veterinary hospitals: tick identification and molecular detection of tick-borne pathogens

Dog survey in Russian veterinary hospitals: tick identification and molecular detection of tick-borne pathogens Livanova et al. Parasites & Vectors (2018) 11:591 https://doi.org/10.1186/s13071-018-3161-5 RESEARCH Open Access Dog survey in Russian veterinary hospitals: tick identification and molecular detection

More information

MEETING REPORT. Summary. Expert consultation on tick-borne diseases with emphasis on Lyme borreliosis and tick-borne encephalitis

MEETING REPORT. Summary. Expert consultation on tick-borne diseases with emphasis on Lyme borreliosis and tick-borne encephalitis MEETING REPORT Expert consultation on tick-borne diseases with emphasis on Lyme borreliosis and tick-borne encephalitis Stockholm, 23 24 November 2010 Summary Tick-borne diseases are the most common vector-borne

More information

IWC Symposium and Workshop on the Mortality of Cetaceans in Passive Fishing Nets and Traps. Gillnets and Cetaceans

IWC Symposium and Workshop on the Mortality of Cetaceans in Passive Fishing Nets and Traps. Gillnets and Cetaceans IWC 1990 Symposium and Workshop on the Mortality of Cetaceans in Passive Fishing Nets and Traps Gillnets and Cetaceans 1994 PARTICIPANTS Argentina Australia Belgium Brazil Canada Chile China Denmark France

More information

Global diversity of cystic echinococcosis. Thomas Romig Universität Hohenheim Stuttgart, Germany

Global diversity of cystic echinococcosis. Thomas Romig Universität Hohenheim Stuttgart, Germany Global diversity of cystic echinococcosis Thomas Romig Universität Hohenheim Stuttgart, Germany Echinococcus: generalized lifecycle Cystic echinococcosis: geographical spread Acephalocystis cystifera

More information

Rainy With a Chance of Plague

Rainy With a Chance of Plague Rainy With a Chance of Plague Gregory Glass, PhD Director, Global Biological Threat Reduction Program Southern Research Institute Birmingham, AL Professor, Departments of Molecular Microbiology & Immunology

More information