The Case of Color Vision Evolution in New World Monkeys
|
|
- Buddy Bell
- 5 years ago
- Views:
Transcription
1 The Case of Color Vision Evolution in New World Monkeys slide version 2.0
2 About this Case: 1. These slides were created by the Evo-Ed Project: 2. Funding for the Evo-Ed Project is provided by the National Science Foundation and by Lyman Briggs College, Michigan State University. 3. These slides are provided as a teaching resource. You are encouraged to modify them to meet your specific teaching and learning needs. 4. Please adhere to the copyright conditions specified on the following slide. 5. There is a reference slide at the end of the presentation that lists the sources for the images we have used in this presentation. 6. If you would be willing to be in involved in our research study examining how the use of these case studies impacts learning, please contact us at evoed@msu.edu.
3 Copyright: Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported (CC BY-NC-SA 3.0) You are free: to Share to copy, distribute and transmit the work to Remix to adapt the work Under the following conditions: Attribution You must attribute the work to the Evo-Ed Project at Michigan State University using the following url: Noncommercial You may not use this work for commercial purposes. Share Alike If you alter, transform, or build upon this work, you may distribute the resulting work only under the same or similar license to this one. With the understanding that: Waiver Any of the above conditions can be waived if you get permission from Jim Smith, Merle Heidemann or Peter White at Michigan State University, Public Domain Where the work or any of its elements is in the public domain under applicable law, that status is in no way affected by the license. Other Rights In no way are any of the following rights affected by the license: Your fair dealing or fair use rights, or other applicable copyright exceptions and limitations; The author's moral rights; Rights other persons may have either in the work itself or in how the work is used, such as publicity or privacy rights. Notice For any reuse or distribution, you must make clear to others the license terms of this work. The best way to do this is with a link to the web page
4 Introduction These slides are provided as a teaching resource for the Monkey Opsins case as described on A fuller description of the case can be found on the website. Teaching notes can be found in the notes section beneath each slide when viewing the slides in Normal View in PowerPoint. To select this option in PowerPoint, go to the main menu, choose View and then Normal.
5 The Natural History of Color Vision and Colorblindness
6 What is colorblindness? Reduced ability to interpret light as color. 1 in 12 males are colorblind. < 1 in 100 females are colorblind.
7 Are You Colorblind? A) No (Female) A) Yes (Female) A) No (Male) A) Yes, very (Male) A) Yes, somewhat (Male)
8 Color Vision in Monkeys Species: Grey Cheeked Mangabey Lives: Africa Vision: Trichromatic vision (i.e. like most humans) Species: White Headed Capuchin Lives: Central and South America Vision: Dichromatic vision (i.e. colorblind.
9 Color Vision in Monkeys Species: Japanese Macaque Lives: Asia Vision: Trichromatic vision Species: Black Squirrel Monkey Lives: Central and South America Vision: Dichromatic vision
10 Color Vision in Monkeys Species: Guinea Baboon Lives: Africa Vision: Trichromatic vision Species: White Faced Saki Lives: Central and South America Vision: Dichromatic vision
11 Color Vision in Monkeys Species: Roloway Monkey Lives: Africa Vision: Trichromatic vision Species: Pied Tamarin Lives: Central and South America Vision: Dichromatic vision
12 What have you noticed? Is there a relationship between color vision and continent of origin among monkey species?
13 Monkeys of the World
14 Question - Why do most New World Monkeys have dichromatic vision while most Old World Monkeys have trichromatic vision?
15 The Ecology of Color Vision in Monkeys
16 Ecology: Why Trichromatic Vision? DICHROMATIC VISION One of the above leaves has black fungus on it. Can you tell which one?
17 Ecology: Why Trichromatic Vision? TRICHROMATIC VISION Leaf with black fungus
18 Ecology: Why Trichromatic Vision? DICHROMATIC VISION In the above picture, the red leaves are not palatable but the green leaves are nutritious. Which leaves are which?
19 Ecology: Why Trichromatic Vision? DICHROMATIC VISION TRICHROMATIC VISION With trichromatic vision, distinguishing between important colors becomes possible.
20 Food Selection The Driver of Trichromacy Evolution?
21 Research has linked color vision with the ability to select ripe food when foraging. Food Selection
22 Which peaches are ripe? A) A B) B C) Both A and B D) Neither A nor B E) I can t tell A B
23 Which peaches are ripe? A. A B. B C. Both A and B D. Neither A nor B E. I can t tell A B
24 Food Selection The Research Part I TRICHROMATS DICHROMATS Given choice of food vs. Selected ripe fruit 53% of the time. Selected ripe fruit 37% of the time. F 1,10 = 8, p < 0.05, Smith et al., 2003
25 Food Selection The Research Part II Caine and Mundy, 2000
26 Predict: What was the result of the Kix experiment? 1. There was no difference in dichromat and trichromat ability to find the Kix in both environments. 2. Trichromats were superior to dichromats in finding orange Kix; there was no difference in ability to find green Kix. 3. Trichromats could find orange AND green Kix better than dichromats. 4. Trichromats were superior to dichromats in finding orange Kix; dichromats were superior to trichromats in finding green Kix.
27 Food Selection The Research Part II Caine and Mundy, 2000
28 Food Selection The Research Part II Trichromats are more effective than dichromats selecting orange food in a green environment but dichromats are more effective than trichromats selecting green food in a green environment. Could there be an advantage to being dichromatic in certain environments? Caine and Mundy, 2000
29 Online Food Foraging Game and Sim: We ve created an online game and simulation versions of Caine and Mundy s research. Try it out for yourself!
30 If you were in a food-foraging competition, would having color vision give you an advantage over someone who was colorblind? A) Almost certainly. B) Sometimes. C) Unsure. D) Probably not. E) Absolutely not.
31 If you were in a food-foraging competition, would having color vision give you an advantage over someone who was colorblind? Let s investigate further Go to:
32 Online Color-Vision Game Visit the online color vision game at:
33 The DESIGN Food Selection The Research Part III Saito et al, 2005
34 The EXPERIMENT Food Selection The Research Part III TRICHROMATIC VISION DICHROMATIC VISION Photo: KENPEI, J Smith Saito et al, 2005
35 The TRAINING Food Selection The Research Part III Photo: KENPEI Saito et al, 2005
36 The TRAINING Food Selection The Research Part III Photo: KENPEI Saito et al, 2005
37 The TEST Food Selection The Research Part III Photo: KENPEI Saito et al, 2005
38 The TEST Food Selection The Research Part III Photo: KENPEI Saito et al, 2005
39 The TEST Food Selection The Research Part III Photo: KENPEI Saito et al, 2005
40 The TEST Food Selection The Research Part III Photo: KENPEI Saito et al, 2005
41 The TEST Food Selection The Research Part III Photo: KENPEI Saito et al, 2005
42 The TEST Food Selection The Research Part III Photo: KENPEI Saito et al, 2005
43 The TEST Food Selection The Research Part III Photo: KENPEI Saito et al, 2005
44 Food Selection The Research Part III TRICHROMATIC VISION DICHROMATIC VISION Saito et al, 2005
45 The RESULTS Food Selection The Research Part III Saito et al, 2005
46 Food Selection Summary Research suggests that trichromatic vision is more likely to be selected for when food is distinguished from non-food by color. Research suggests that dichromatic vision is more likely to be selected for when food is distinguished from non-food by shape.
47 The Cell Biology of Color Vision in Monkeys
48 How Does Color Vision Work? Cell Biology
49 How Does Color Vision Work?
50 Three types of Cone Cell Different kinds of opsin proteins embedded in the membrane of cone cells. Central Dogma of Molecular Biology: DNA RNA Protein Genes code for. proteins.
51 Chromatic Vision: Cone Cells Cone cells in the retina of the eye allow light of different wavelengths to be interpreted as color in the brain. Light Waves The Cone cell The Brain Color
52 Opsin Image modified from Scientific American, April 09 All-trans-retinal 11-cis-retinal Opsin To The All-trans-retinal When produce cone 11-cis-retinal cell the sends signal stimulates a absorbs signal for color the to a the photon vision, opsin brain, retinal (a the resulting basic membrane must unit in of stimulate vision. of light), the it cone changes the cell. opsin from protein 11-cis-retinal but this cannot to All-trans-retinal. occur while the retinal molecule is in its cis- conformation.
53 The Role of Opsins There are three types of opsins: Short Wave Sensitive (SWS) Medium Wave Sensitive (MWS) Long Wave Sensitive (LWS) An individual possessing only SWS and MWS opsins will have dichromatic vision. An individual possessing SWS, MWS and LWS opsins will have trichromatic vision.
54 How Does Color Vision Work?
55 Chromatic Vision: Opsins 3D Visualization 2D Visualization The opsin protein is composed of a string of amino acids. Each green dot in the 2D visualization represents one amino acid.
56 Opsin Structure MWS opsin LWS opsin The LWS opsin differs from the MWS opsin in three significant places in the amino acid sequence: Position 180: alanine to serine Position 277: phenylalanine to tyrosine Position 285: alanine to threonine
57 Opsin Response to Light The responses to light of each opsin protein (S, M and L) in trichromats are shown to the right. Note how similar the curves look for M and L. The L curve is shifted by about 30 nm response maximum to the right (longer wavelength).
58 Opsin Response to Light A third opsin provides another channel for sending color signals to the brain. Three opsin proteins allow the eye to detect a richer variety of light wavelengths resulting in the ability to distinguish more colors.
59 The Genetics of Color Vision in Monkeys
60 The Genetics of Color Vision The section of DNA on a chromosome that codes for an opsin protein is called an opsin gene.
61 Location of Opsin Genes The gene coding for the SWS opsin protein is located on chromosome #7. The gene coding for the MWS and LWS opsins are located on the X-chromosome.
62 Evolution of LWS Opsin Gene The LWS gene arose through gene duplication and gene mutation of the MWS gene on the X- chromosome.
63 Origin of the LWS Opsin Gene The LWS gene arose through gene duplication and gene mutation of the MWS gene on the X- chromosome.
64 Gene Duplication
65 Unequal Crossing Over (Meiosis, Prophase 1)
66 Origin of the LWS Opsin Gene The LWS gene arose through gene duplication and gene mutation of the MWS gene on the X- chromosome.
67 Origin of the LWS Opsin Gene The LWS gene arose through gene duplication and gene mutation of the MWS gene on the X- chromosome.
68
69 The MWS Opsin Gene
70 The MWS Opsin Gene 1092 Nucleotides
71 The MWS Opsin Gene GTCGTTAGATAG 1092 Nucleotides
72 MWS Opsin Gene vs. LWS Opsin Gene Each opsin gene is exactly the same length (1092 nucleotides) MWS Opsin Protein vs. LWS Opsin Protein These 1092 nucleotides undergo transcription and translation and result in a protein that is 364 amino acids in length.
73 LWS GENE MWS GENE MWS Opsin Protein vs. LWS Opsin Protein maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvviasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis vvnqvygyfv lghpmcvleg ytvslcgitg lwslaiiswe rwmvvckpfg nvrfdaklai vgiafswiwa avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccit plsiivlcyl qvwlairava kqqkesestq kaekevtrmv vvmvlafcfc wgpyaffacf aaanpgypfh plmaalpaff aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvvtasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis ivnqvsgyfv lghpmcvleg ytvslcgitg lwslaiiswe rwlvvckpfg nvrfdaklai vgiafswiws avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccii plaiimlcyl qvwlairava kqqkesestq kaekevtrmv vvmifaycvc wgpytffacf aaanpgyafh plmaalpayf aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa
74 LWS GENE MWS GENE There are 15 differences between the proteins: maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvviasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis vvnqvygyfv lghpmcvleg ytvslcgitg lwslaiiswe rwmvvckpfg nvrfdaklai vgiafswiwa avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccit plsiivlcyl qvwlairava kqqkesestq kaekevtrmv vvmvlafcfc wgpyaffacf aaanpgypfh plmaalpaff aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvvtasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis ivnqvsgyfv lghpmcvleg ytvslcgitg lwslaiiswe rwlvvckpfg nvrfdaklai vgiafswiws avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccii plaiimlcyl qvwlairava kqqkesestq kaekevtrmv vvmifaycvc wgpytffacf aaanpgyafh plmaalpayf aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa
75 LWS GENE MWS GENE Differences at positions 277 and 285 result in spectral shifts of nm maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvviasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis vvnqvygyfv lghpmcvleg ytvslcgitg lwslaiiswe rwmvvckpfg nvrfdaklai vgiafswiwa avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccit plsiivlcyl qvwlairava kqqkesestq kaekevtrmv vvmvlafcfc wgpyaffacf aaanpgypfh plmaalpaff aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvvtasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis ivnqvsgyfv lghpmcvleg ytvslcgitg lwslaiiswe rwlvvckpfg nvrfdaklai vgiafswiws avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccii plaiimlcyl qvwlairava kqqkesestq kaekevtrmv vvmifaycvc wgpytffacf aaanpgyafh plmaalpayf aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa
76 What difference does 24nm make? The difference between the sensitivity of the MWS opsin protein and the LWS opsin protein is only 30nm (534nm vs. 564nm). Most of the difference between MWS and LWS opsins can therefore be explained by these two differences.
77 LWS GENE MWS GENE A change from alanine to serine at position 180 results in an additional spectral shift of 3-7nm. maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvviasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis vvnqvygyfv lghpmcvleg ytvslcgitg lwslaiiswe rwmvvckpfg nvrfdaklai vgiafswiwa avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccit plsiivlcyl qvwlairava kqqkesestq kaekevtrmv vvmvlafcfc wgpyaffacf aaanpgypfh plmaalpaff aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvvtasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis ivnqvsgyfv lghpmcvleg ytvslcgitg lwslaiiswe rwlvvckpfg nvrfdaklai vgiafswiws avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccii plaiimlcyl qvwlairava kqqkesestq kaekevtrmv vvmifaycvc wgpytffacf aaanpgyafh plmaalpayf aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa
78 Positions 180, 277 and 285 Differences in amino acid identity at these three positions can result in a spectral sensitivity shift of 31nm.
79 LWS GENE MWS GENE Differences at positions 116, 230 and 233 result in smaller spectral shifts of 1-3nm. maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvviasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis vvnqvygyfv lghpmcvleg ytvslcgitg lwslaiiswe rwmvvckpfg nvrfdaklai vgiafswiwa avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccit plsiivlcyl qvwlairava kqqkesestq kaekevtrmv vvmvlafcfc wgpyaffacf aaanpgypfh plmaalpaff aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvvtasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis ivnqvsgyfv lghpmcvleg ytvslcgitg lwslaiiswe rwlvvckpfg nvrfdaklai vgiafswiws avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccii plaiimlcyl qvwlairava kqqkesestq kaekevtrmv vvmifaycvc wgpytffacf aaanpgyafh plmaalpayf aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa
80 What difference does 1-3nm make? Smaller shifts are called spectral tuning and can result in very slight differences in color perception. Changes resulting from amino acid differences at spectral tuning sites are not significant enough to classify each variant as a separate functional allele.
81 LWS GENE MWS GENE Differences at positions 65, 111, 153, 236, 274, 275, 279 & 298 do not cause changes in spectral properties maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvviasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis vvnqvygyfv lghpmcvleg ytvslcgitg lwslaiiswe rwmvvckpfg nvrfdaklai vgiafswiwa avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccit plsiivlcyl qvwlairava kqqkesestq kaekevtrmv vvmvlafcfc wgpyaffacf aaanpgypfh plmaalpaff aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa maqqwslqrl agrhpqdsye dstqssifty tnsnstrgpf egpnyhiapr wvyhltsvwm ifvvtasvft nglvlaatmk fkklrhplnw ilvnlavadl aetviastis ivnqvsgyfv lghpmcvleg ytvslcgitg lwslaiiswe rwlvvckpfg nvrfdaklai vgiafswiws avwtappifg wsrywphglk tscgpdvfsg ssypgvqsym ivlmvtccii plaiimlcyl qvwlairava kqqkesestq kaekevtrmv vvmifaycvc wgpytffacf aaanpgyafh plmaalpayf aksatiynpv iyvfmnrqfr ncilqlfgkk vddgselssa sktevssvss vspa
82 LWS GENE MWS GENE MWS Opsin Gene vs. LWS Opsin Gene (mutations at the nucleotide level that result in protein functional changes) atggcccagcagtggagcctccaaaggctcgcaggccgccatccgcaggacagctatgaggacagcacccagtccagcatcttca cctacaccaacagcaactccaccagaggccccttcgaaggcccgaattaccacatcgctcccagatgggtgtaccacctcaccag tgtctggatgatctttgtggtcattgcatccgtcttcacaaatgggcttgtgctggcggccaccatgaagttcaagaagctgcgc cacccgctgaactggatcctggtgaacctggcggtcgctgacctggcagagaccgtcatcgccagcactatcagcgttgtgaacc aggtctatggctacttcgtgctgggccaccctatgtgtgtcctggagggctacaccgtctccctgtgtgggatcacaggtctctg gtctctggccatcatttcctgggagaggtggctggtggtgtgcaagccctttggcaatgtgagatttgatgccaagctggccatc gtgggcattgccttctcctggatctgggctgctgtgtggacagccccgcccatctttggttggagcaggtactggccccacggcc tgaagacttcatgcggcccagacgtgttcagcggcagctcgtaccccggggtgcagtcttacatgattgtcctcatggtcacctg ctgcatcaccccactcagcatcatcgtgctctgctacctccaagtgtggctggccatccgagcggtggcaaagcagcagaaagag tctgaatccacccagaaggcagagaaggaagtgacgcgcatggtggtggtgatggtcctggcattctgcttctgctggggaccat acgccttcttcgcatgctttgctgctgccaaccctggctaccccttccaccctttgatggctgccctgccggccttctttgccaa aagtgccactatctacaaccccgttatctatgtctttatgaaccggcagtttcgaaactgcatcttgcagcttttcgggaagaag gttgacgatggctctgaactctccagcgcctccaaaacggaggtctcatctgtgtcctcggtatcgcctgcatga atggcccagcagtggagcctccaaaggctcgcaggccgccatccgcaggacagctatgaggacagcacccagtccagcatcttca cctacaccaacagcaactccaccagaggccccttcgaaggcccgaattaccacatcgctcccagatgggtgtaccacctcaccag tgtctggatgatctttgtggtcattgcatccgtcttcacaaatgggcttgtgctggcggccaccatgaagttcaagaagctgcgc cacccgctgaactggatcctggtgaacctggcggtcgctgacctggcagagaccgtcatcgccagcactatcagcgttgtgaacc aggtctatggctacttcgtgctgggccaccctatgtgtgtcctggagggctacaccgtctccctgtgtgggatcacaggtctctg gtctctggccatcatttcctgggagaggtggctggtggtgtgcaagccctttggcaatgtgagatttgatgccaagctggccatc gtgggcattgccttctcctggatctggtctgctgtgtggacagccccgcccatctttggttggagcaggtactggccccacggcc tgaagacttcatgcggcccagacgtgttcagcggcagctcgtaccccggggtgcagtcttacatgattgtcctcatggtcacctg ctgcatcaccccactcagcatcatcgtgctctgctacctccaagtgtggctggccatccgagcggtggcaaagcagcagaaagag tctgaatccacccagaaggcagagaaggaagtgacgcgcatggtggtggtgatggtcctggcatactgcttctgctggggaccat acaccttcttcgcatgctttgctgctgccaaccctggctaccccttccaccctttgatggctgccctgccggccttctttgccaa aagtgccactatctacaaccccgttatctatgtctttatgaaccggcagtttcgaaactgcatcttgcagcttttcgggaagaag gttgacgatggctctgaactctccagcgcctccaaaacggaggtctcatctgtgtcctcggtatcgcctgcatga
83 LWS GENE MWS GENE MWS Opsin Gene vs. LWS Opsin Gene (mutations at the nucleotide level that result in protein functional changes) atggcccagcagtggagcctccaaaggctcgcaggccgccatccgcaggacagctatgaggacagcacccagtccagcatcttca cctacaccaacagcaactccaccagaggccccttcgaaggcccgaattaccacatcgctcccagatgggtgtaccacctcaccag tgtctggatgatctttgtggtcattgcatccgtcttcacaaatgggcttgtgctggcggccaccatgaagttcaagaagctgcgc cacccgctgaactggatcctggtgaacctggcggtcgctgacctggcagagaccgtcatcgccagcactatcagcgttgtgaacc aggtctatggctacttcgtgctgggccaccctatgtgtgtcctggagggctacaccgtctccctgtgtgggatcacaggtctctg gtctctggccatcatttcctgggagaggtggctggtggtgtgcaagccctttggcaatgtgagatttgatgccaagctggccatc gtgggcattgccttctcctggatctgggctgctgtgtggacagccccgcccatctttggttggagcaggtactggccccacggcc tgaagacttcatgcggcccagacgtgttcagcggcagctcgtaccccggggtgcagtcttacatgattgtcctcatggtcacctg ctgcatcaccccactcagcatcatcgtgctctgctacctccaagtgtggctggccatccgagcggtggcaaagcagcagaaagag tctgaatccacccagaaggcagagaaggaagtgacgcgcatggtggtggtgatggtcctggcattctgcttctgctggggaccat acgccttcttcgcatgctttgctgctgccaaccctggctaccccttccaccctttgatggctgccctgccggccttctttgccaa aagtgccactatctacaaccccgttatctatgtctttatgaaccggcagtttcgaaactgcatcttgcagcttttcgggaagaag gttgacgatggctctgaactctccagcgcctccaaaacggaggtctcatctgtgtcctcggtatcgcctgcatga atggcccagcagtggagcctccaaaggctcgcaggccgccatccgcaggacagctatgaggacagcacccagtccagcatcttca cctacaccaacagcaactccaccagaggccccttcgaaggcccgaattaccacatcgctcccagatgggtgtaccacctcaccag tgtctggatgatctttgtggtcattgcatccgtcttcacaaatgggcttgtgctggcggccaccatgaagttcaagaagctgcgc cacccgctgaactggatcctggtgaacctggcggtcgctgacctggcagagaccgtcatcgccagcactatcagcgttgtgaacc aggtctatggctacttcgtgctgggccaccctatgtgtgtcctggagggctacaccgtctccctgtgtgggatcacaggtctctg gtctctggccatcatttcctgggagaggtggctggtggtgtgcaagccctttggcaatgtgagatttgatgccaagctggccatc gtgggcattgccttctcctggatctggtctgctgtgtggacagccccgcccatctttggttggagcaggtactggccccacggcc tgaagacttcatgcggcccagacgtgttcagcggcagctcgtaccccggggtgcagtcttacatgattgtcctcatggtcacctg ctgcatcaccccactcagcatcatcgtgctctgctacctccaagtgtggctggccatccgagcggtggcaaagcagcagaaagag tctgaatccacccagaaggcagagaaggaagtgacgcgcatggtggtggtgatggtcctggcatactgcttctgctggggaccat acaccttcttcgcatgctttgctgctgccaaccctggctaccccttccaccctttgatggctgccctgccggccttctttgccaa aagtgccactatctacaaccccgttatctatgtctttatgaaccggcagtttcgaaactgcatcttgcagcttttcgggaagaag gttgacgatggctctgaactctccagcgcctccaaaacggaggtctcatctgtgtcctcggtatcgcctgcatga
84 MWS Opsin Gene vs. LWS Opsin Gene (mutations at the nucleotide level that result in protein functional changes) G T T A G A Three simple substitution mutations change the properties of the opsin protein. Now, rather than being maximally stimulated at ~534nm, the resulting opsin protein is maximally stimulated at ~564nm.
85 What difference does this make at the protein level?
86 Evolution of LWS Opsin Gene The LWS gene arose through gene duplication and gene mutation of the MWS gene on the X- chromosome.
87 Clicker Question: Fact or Fiction? A monkey researcher in South America discovered that some monkey females are trichromatic. 1. Definitely Fact 2. Possibly Fact 3. Possibly Fiction 4. Definitely Fiction
88 The Case of Trichromatic Females
89 Genes code for opsin proteins; the opsin proteins facilitate color vision.
90 The Phylogenetics of Color Vision in Monkeys
91 Biogeography of Global Monkeys Photo: Frans de Waal, M Arunprasaad, D Wright, P Gonnet, L DeVoldor, W Endo
92 Monkeys of the World
93 Phylogenetics Exploring Relationships Among Species
94 Geology: Plate Tectonics and Drift
95 How Old are Primates? ~70-80 Million Years Ago
96 When did primates first inhabit North America?
97 Human Chimpanzee Gorilla Orangutan Gibbon Rhesus Baboon Mangabey Mona Langur Colobus Capuchin Squirrel Monkey Owl Monkey Marmoset Sakis Spider Monkey Wooly Monkey Continents Split 50 Million Years Ago Color Vision Evolves! Gene Duplication and Mutation Primates In New/Old World 55 Million Years Ago Rise of Primates 75 Million Years Ago
98
99 Summary and Application - Color Vision in Monkeys
100 Complete Evolutionary Picture Genetics Cell Biology Biogeography Ecology Phylogenetics Paleontology Geology
101 Monkey Color Vision: Natural History
102 Monkey Color Vision: Ecology Apple Photo: Abhijit Tembhekar
103 Monkey Color Vision: Cell Biology MWS opsin LWS opsin
104 Monkey Color Vision: Genetics
105 Human Chimpanzee Gorilla Orangutan Gibbon Rhesus Baboon Mangabey Mona Langur Colobus Capuchin Squirrel Monkey Owl Monkey Marmoset Sakis Spider Monkey Wooly Monkey Monkey Color Vision: Phylogenetics Continents Split 50 Million Years Ago Color Vision Evolves! Gene Duplication and Mutation Primates In New/Old World 55 MA Rise of Primates 75 MYA
106
107 Application Question Many marine mammals have monochromatic vision. Describe this system in terms of its a) Ecology b) Cell Biology c) Genetics d) Phylogenetics
108 Application Question Research indicates that some human females have tetra-chromatic vision. Describe how this can be possible from a cell biology and genetic perspective.
109 References The sources for the images we used in this presentation are listed below. If an image is not listed it is believed to be Public Domain. Did we use one of your pictures and not give you proper credit? If so, please let us know: Section Title, Credit Natural History Section: Mangabey photo, Duncan Wright; Capuchin photo, Jim Smith. Macaque photo, KENPEI; Squirrel Monkey, Claudio Timm Baboon photo, Trisha Sears; Saki photo, Skyscraper Roloway monkey, Public Domain; Tamarin, Whaldener Endo Left column top to bottom: Primate, Public Domain; Bonnet macaque, M Arunprasad; Crested mangabey, Duncan Wright; Blue monkey, Pedro Gonnet. Right column top to bottom: Spider monkey, Public Domain; Capuchin, Whaldener Endo; Squirrel monkey, Linda DeVolder; Capuchins, Frans dewaals. Continental pictures are believed to be Public Domain. All images are previously referenced above. If unreferenced above, they are believed to be Public Domain. Ecology Section: Pears, Public Domain. Black spot, Public Domain; Red and green leaf, Nick Eisen Leaves, 松岡明芳 Apple, Abhujit Tembhekar; Oranges, aliraqicz; Starfruit, S Masters; Lychee, B Navez. Colored shape swatches, Saito, A. et al (2005) American Journal of Primatology 67: Cell Biology Section: Chimpanzee, Thomas Lersch; Eye, believed to be Public Domain; Cone Cell, Ivo Kruusamägi. Light Waves, unknown; Cone cell, as above; Brain, unknown. 3D Opsin, Knierim, B. et al. (2007) PNAS 104: D Opsin, Neitz and Neitz (2000) Arch Ophthalmology 118: Stimulation curve, Molecular Genetics Section: Chromosome, designs and dream designs / FreeDigitalPhotos.net; Primate, Trisha Shears. Chromosome, National Institutes of Health Chromosomes, Evo-Ed Meiosis, Marek Kultys Crossing Over, DNA, Unknown Spectral tuning, Neitz and Neitz (2000) Arch Ophthalmology 118: Biogeography and Phylogenetics: Plate Tectonics, McGraw Hill Companies Inc. Primate, Journal of Mammalian Evolution Phylogenetic tree, Evo-Ed.
110
Teaching Workshop: Color Vision in Primates and Other Mammals
Teaching Workshop: Color Vision in Primates and Other Mammals Carrie C. Veilleux & Amber Heard-Booth Anthropology Department, University of Texas at Austin Trichromatic Color Vision Trichromatic Color
More informationColor Vision: How Our Eyes Reflect Primate Evolution
Scientific American Magazine - March 16, 2009 Color Vision: How Our Eyes Reflect Primate Evolution Analyses of primate visual pigments show that our color vision evolved in an unusual way and that the
More informationHow the eye sees. Properties of light. The light-gathering parts of the eye. 1. Properties of light. 2. The anatomy of the eye. 3.
How the eye sees 1. Properties of light 2. The anatomy of the eye 3. Visual pigments 4. Color vision 1 Properties of light Light is made up of particles called photons Light travels as waves speed of light
More informationEvolutionary Trade-Offs in Mammalian Sensory Perceptions: Visual Pathways of Bats. By Adam Proctor Mentor: Dr. Emma Teeling
Evolutionary Trade-Offs in Mammalian Sensory Perceptions: Visual Pathways of Bats By Adam Proctor Mentor: Dr. Emma Teeling Visual Pathways of Bats Purpose Background on mammalian vision Tradeoffs and bats
More informationColor Vision by Prof/Faten zakareia King Saud University Physiology Dept
Color Vision by Prof/Faten zakareia King Saud University Physiology Dept Objectives: Define color vision Identify and describe the mechanism of colour vision and the three types of cones, including the
More informationa retinal gross potential, the electroretinogram (ERG), recorded the radiance of a flickering monochromatic test light is
Proc. Natl. Acad. Sci. USA Vol. 84, pp. 2545-2549, April 1987 Neurobiology Inheritance of color vision in a New World monkey (Saimiri sciureus) (photopigments/polymorphism/x chromosome/evolution) GERALD
More informationNew World Monkeys and Color
Int J Primatol (2007) 28:729 759 DOI 10.1007/s10764-007-9168-y New World Monkeys and Color Gerald H. Jacobs Received: 24 March 2006 / Accepted: 6 June 2006 / Published online: 9 August 2007 # Springer
More informationA case of achromatopsia. Perceptual Colour Space. Spectral Properties of Light. Subtractive Colour Mixture. Additive Colour Mixture
A case of achromatopsia The wrongness of everything was disturbing, even disgusting he turned increasingly to black and white foods to black olives and white rice, black coffee and yoghurt. These at least
More informationPerception & Attention Course. George Mather
Perception & Attention Course George Mather A case of achromatopsia The wrongness of everything was disturbing, even disgusting he turned increasingly to black and white foods to black olives and white
More informationPSY 2364 Animal Communication. Elk (Cervus canadensis) Extra credit assignment. Sad Underwing (Catocala maestosa) 10/11/2017
PSY 2364 Animal Communication Elk (Cervus canadensis) Kingdom: Phylum: Class: Order: Family: Genus: Species: Animalia Chordata Mammalia Artiodactyla Cervidae Cervus canadensis Extra credit assignment Sad
More informationYour Eye, My Eye, and the Eye of the Aye Aye: Evolution of Human Vision from 65 Million Years Ago to the Present
# 75 Your Eye, My Eye, and the Eye of the Aye Aye: Evolution of Human Vision from 65 Million Years Ago to the Present Dr. Christopher Kirk December 2, 2011 Produced by and for Hot Science - Cool Talks
More informationPrimates. BIOL 111 Announcements. BIOL 111 Organismal Biology. Which statement is not TRUE regarding mammal evolution?
BIOL 111 Announcements Final lab exam, Monday November 23, 6:30-7:30pm CORRECTION: Vertebrate hearts: amphibians + Flip-flop atria and ventricle(s) lungs body Clicker participation: 25 lectures + 2 (maybe
More informationPrimate photopigments and primate color vision (opsin genes polymorphism cones evolution)
Proc. Natl. Acad. Sci. USA Vol. 93, pp. 577 581, January 1996 Colloquium Paper This paper was presented at a colloquium entitled Vision: From Photon to Perception, organized by John Dowling, Lubert Stryer
More informationDID PRIMATE TRICHROMACY EVOLVE FOR FRUGIVORY OR FOLIVORY?
CHAPTER 3 DID PRIMATE TRICHROMACY EVOLVE FOR FRUGIVORY OR FOLIVORY? P. SUMNER AND J. D. MOLLON Introduction Primate colour vision Most mammals have two types of cone photopigment, short-wave-sensitive
More informationLecture 11 Wednesday, September 19, 2012
Lecture 11 Wednesday, September 19, 2012 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean
More informationRCPS7-Science-Evolution (RCPS7-Science-Evolution) 1. Which is an adaptation that makes it possible for the animal to survive in a cold climate?
Name: Date: 1. Which is an adaptation that makes it possible for the animal to survive in a cold climate? A. tail on a lizard B. scales on a fish C. stripes on a tiger D. fur on a bear 2. Use the picture
More informationPerspectives in Basic Science
Perspectives in Basic Science Colour Vision: Why Are We Primates Unique? Petroc Sumner Colour is such an integral part of our visual experience that most people assume that the colours we see are physical
More informationTesting Phylogenetic Hypotheses with Molecular Data 1
Testing Phylogenetic Hypotheses with Molecular Data 1 How does an evolutionary biologist quantify the timing and pathways for diversification (speciation)? If we observe diversification today, the processes
More informationAP Lab Three: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST
AP Biology Name AP Lab Three: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST In the 1990 s when scientists began to compile a list of genes and DNA sequences in the human genome
More informationOne group (Tarsiers) is off on it's own (note clear where they belong). All tarsiers are endangered or threatened to some extent.
Primates, part II Suborder Haplorrhini Divided into two clades (Infraorders?) Platyrrhini (flat noses, with nostrils to side) Catarrhini (nostrils pointing down) One group (Tarsiers) is off on it's own
More informationMammals. Introduction (page 821) Evolution of Mammals (page 821) Form and Function in Mammals (pages ) Chapter 32.
Chapter 32 Mammals Section 32 1 Introduction to the Mammals (pages 821 827) This section describes the characteristics common to all mammals, as well as how mammals carry out life functions. It also briefly
More informationCh 1.2 Determining How Species Are Related.notebook February 06, 2018
Name 3 "Big Ideas" from our last notebook lecture: * * * 1 WDYR? Of the following organisms, which is the closest relative of the "Snowy Owl" (Bubo scandiacus)? a) barn owl (Tyto alba) b) saw whet owl
More informationUnit 7: Adaptation STUDY GUIDE Name: SCORE:
Unit 7: Adaptation STUDY GUIDE Name: SCORE: 1. Which is an adaptation that makes it possible for the animal to survive in a cold climate? A. tail on a lizard B. scales on a fish C. stripes on a tiger D.
More informationBioSci 110, Fall 08 Exam 2
1. is the cell division process that results in the production of a. mitosis; 2 gametes b. meiosis; 2 gametes c. meiosis; 2 somatic (body) cells d. mitosis; 4 somatic (body) cells e. *meiosis; 4 gametes
More informationCOMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST
Big Idea 1 Evolution INVESTIGATION 3 COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST How can bioinformatics be used as a tool to determine evolutionary relationships and to
More informationEvolution as Fact. The figure below shows transitional fossils in the whale lineage.
Evolution as Fact Evolution is a fact. Organisms descend from others with modification. Phylogeny, the lineage of ancestors and descendants, is the scientific term to Darwin's phrase "descent with modification."
More informationCLADISTICS Student Packet SUMMARY Phylogeny Phylogenetic trees/cladograms
CLADISTICS Student Packet SUMMARY PHYLOGENETIC TREES AND CLADOGRAMS ARE MODELS OF EVOLUTIONARY HISTORY THAT CAN BE TESTED Phylogeny is the history of descent of organisms from their common ancestor. Phylogenetic
More informationComparing DNA Sequences to Understand Evolutionary Relationships with BLAST
Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST INVESTIGATION 3 BIG IDEA 1 Lab Investigation 3: BLAST Pre-Lab Essential Question: How can bioinformatics be used as a tool to
More informationThe Genetics of Color In Labradors
By Amy Frost Dahl, Ph.D. Oak Hill Kennel First published in The Retriever Journal, June/July 1998 Seeing that two of the dogs I brought in for CERF exams were black Labs, the vet's assistant started telling
More informationNAME: DATE: SECTION:
NAME: DATE: SECTION: MCAS PREP PACKET EVOLUTION AND BIODIVERSITY 1. Which of the following observations best supports the conclusion that dolphins and sharks do not have a recent common ancestor? A. Dolphins
More informationTOPIC CLADISTICS
TOPIC 5.4 - CLADISTICS 5.4 A Clades & Cladograms https://upload.wikimedia.org/wikipedia/commons/thumb/4/46/clade-grade_ii.svg IB BIO 5.4 3 U1: A clade is a group of organisms that have evolved from a common
More informationShared Humanity Written by Marilee Joy Mayfield
Lesson: The Gorillas of Uganda Lesson Topic: Shared Humanity Shared Humanity Written by Marilee Joy Mayfield We often don t think of ourselves as animals, but we are. Humans are more similar to other animals
More informationDo the traits of organisms provide evidence for evolution?
PhyloStrat Tutorial Do the traits of organisms provide evidence for evolution? Consider two hypotheses about where Earth s organisms came from. The first hypothesis is from John Ray, an influential British
More informationColor vision perception in the capuchin monkey (Cebus apella): a re-evaluation of procedures using Munsell papers
Behavioural Brain Research 129 (2002) 153 157 www.elsevier.com/locate/bbr Research report Color vision perception in the capuchin monkey (Cebus apella): a re-evaluation of procedures using Munsell papers
More informationWhat Birds. Evolution has endowed birds with a system of color vision that surpasses that of all mammals, including humans
What Birds Evolution has endowed birds with a system of color vision that surpasses that of all mammals, including humans 68 S C I E N T I F I C A M E R I C A N J U LY 2 0 0 6 SeeBy Timothy H. Goldsmith
More informationProf Michael O Neill Introduction to Evolutionary Computation
Prof Michael O Neill Introduction to Evolutionary Computation Origin of the Species Million Years Ago Event? Origin of Life 3500 Bacteria 1500 Eukaryotic Cells 600 Multicellular Organisms 1 Human Language
More informationSELECTIVE PRESSURES INFLUENCING COLOR-VISION IN NEOTROPICAL PRIMATES
SELECTIVE PRESSURES INFLUENCING COLOR-VISION IN NEOTROPICAL PRIMATES A thesis submitted to Kent State University in partial fulfillment of the requirements for the degree of Master of Arts by Eric S. Seemiller
More information13. Cell division is. assortment. telophase. cytokinesis.
Sample Examination Questions for Exam 1 Material Biology 3300 / Dr. Jerald Hendrix Warning! These questions are posted solely to provide examples of past test questions. There is no guarantee that any
More informationThe effect of colour vision status on the detection and selection of fruits by tamarins (Saguinus spp.)
The Journal of Experimental Biology 206, 3159-3165 2003 The Company of Biologists Ltd doi:10.1242/jeb.00536 3159 The effect of colour vision status on the detection and selection of fruits by tamarins
More informationEOQ 3 Exam Review. Genetics: 1. What is a phenotype? 2. What is a genotype?
EOQ 3 Exam Review Genetics: 1. What is a phenotype? 2. What is a genotype? 3. The allele for freckles (f) is recessive to not having freckles (F). Both parents have freckles but only 3 of their 4 children
More informationDetection of fruit and the selection of primate visual pigments for color vision
Detection of fruit and the selection of primate visual pigments for color vision Article (Unspecified) Osorio, D., Smith, A.C., Vorobyev, M. and Buchanan-Smith, H.M. (2004) Detection of fruit and the selection
More informationComparing DNA Sequences Cladogram Practice
Name Period Assignment # See lecture questions 75, 122-123, 127, 137 Comparing DNA Sequences Cladogram Practice BACKGROUND Between 1990 2003, scientists working on an international research project known
More informationTE 408: Three-day Lesson Plan
TE 408: Three-day Lesson Plan Partner: Anthony Machniak School: Okemos High School Date: 3/17/2014 Name: Theodore Baker Mentor Teacher: Danielle Tandoc Class and grade level: 9-10th grade Biology Part
More informationName: Date: Hour: Fill out the following character matrix. Mark an X if an organism has the trait.
Name: Date: Hour: CLADOGRAM ANALYSIS What is a cladogram? It is a diagram that depicts evolutionary relationships among groups. It is based on PHYLOGENY, which is the study of evolutionary relationships.
More informationEvidence for Evolution by Natural Selection. Hunting for evolution clues Elementary, my dear, Darwin!
Evidence for Evolution by Natural Selection Hunting for evolution clues Elementary, my dear, Darwin! 2006-2007 Evidence supporting evolution Fossil record shows change over time Anatomical record comparing
More informationSurvey of the Primates
Survey of the Primates Classification of the order Primates Classification of the order Primates Superfamily: End -OIDEA Family: End -IDAE CebOIDEA CebIDAE Subfamily: End -INAE Genus and species: Both
More informationResources. Visual Concepts. Chapter Presentation. Copyright by Holt, Rinehart and Winston. All rights reserved.
Chapter Presentation Visual Concepts Transparencies Standardized Test Prep Introduction to Vertebrates Table of Contents Section 1 Vertebrates in the Sea and on Land Section 2 Terrestrial Vertebrates Section
More informationEffect of polymorphic colour vision for fruit detection in the spider monkey Ateles geoffroyi
The Journal of Experimental Biology 207, 2465-2470 Published by The Company of Biologists 2004 doi:10.1242/jeb.01046 2465 Effect of polymorphic colour vision for fruit detection in the spider monkey Ateles
More informationMonkey Business. Monkey Business. Visit for thousands of books and materials.
Monkey Business A Reading A Z Level S Leveled Reader Word Count: 1,659 LEVELED READER S Monkey Business Written by Brian Roberts Visit www.readinga-z.com for thousands of books and materials. www.readinga-z.com
More informationCOMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST
COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST In this laboratory investigation, you will use BLAST to compare several genes, and then use the information to construct a cladogram.
More informationBiology 201 (Genetics) Exam #1 120 points 22 September 2006
Name KEY Section Biology 201 (Genetics) Exam #1 120 points 22 September 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More informationThe Mystery of the Skulls: What Old Bones Can Tell Us About Hominins
The Mystery of the Skulls: What Old Bones Can Tell Us About ominins Name: In this laboratory activity, you and your investigative team will examine 9 skulls to expose the secrets of how these species lived.
More informationSkulls & Evolution. 14,000 ya cro-magnon. 300,000 ya Homo sapiens. 2 Ma Homo habilis A. boisei A. robustus A. africanus
Skulls & Evolution Purpose To illustrate trends in the evolution of humans. To demonstrate what you can learn from bones & fossils. To show the adaptations of various mammals to different habitats and
More informationANTHR 1L Biological Anthropology Lab
ANTHR 1L Biological Anthropology Lab Name: DEFINING THE ORDER PRIMATES Humans belong to the zoological Order Primates, which is one of the 18 Orders of the Class Mammalia. Today we will review some of
More informationSoap Opera Genetics Genetics to Resolve Family Arguments 1
Soap Opera Genetics Genetics to Resolve Family Arguments 1 I. How could our baby be an albino? Tiffany and Joe have just had a baby and are very surprised to learn that their baby is albino with very pale
More informationUnit Calendar: Subject to Change
NAME : Block : Notes Page 6-1 SOL Objectives LS 12, Genetics By the end of this unit, the students should understand that organisms reproduce and transmit genetic information to new generations: a) the
More informationNext Wednesday declaration of invasive species due I will have Rubric posted tonight Paper is due in turnitin beginning of class 5/14/1
Next Wednesday declaration of invasive species due I will have Rubric posted tonight Paper is due in turnitin beginning of class 5/14/1 4/13. Warm-up What is the difference between mrna and trna: mrna
More informationHEREDITY HOW YOU BECAME YOU!
HEREDITY HOW YOU BECAME YOU! ESSENTIAL QUESTIONS Why do individuals of the same species vary in how they look, function and behave? WHY DO INDIVIDUALS OF THE SAME SPECIES VARY IN HOW THEY LOOK, FUNCTION
More informationOur Origins Discovering Physical Anthropology
W. W. Norton & Company Our Origins Discovering Physical Anthropology Second Edition by Clark Spencer Larsen Chapter 7 Clark Spencer Larsen Our Origins DISCOVERING PHYSICAL ANTHROPOLOGY C. Milner-Rose Chapter
More informationGenetics Assignment. Name:
Genetics Assignment Name: 1. An organism is heterozygous for two pairs of genes. The number of different combinations of alleles that can form for these two genes in the organism s gametes is A. 1 B.
More informationSoap Opera Genetics Genetics to Resolve Family Arguments 1
Soap Opera Genetics Genetics to Resolve Family Arguments 1 I. How could our baby be an albino? Tiffany and Joe have just had a baby and are very surprised to learn that their baby is albino with very pale
More informationLesson Overview. Human Chromosomes. Lesson Overview Human Chromosomes
Lesson Overview 14.1 Karyotypes To find what makes us uniquely human, we have to explore the human genome. A genome is the full set of genetic information that an organism carries in its DNA. A study of
More informationOur training program... 4
1 Introduction Agility truly is the ultimate dog sport! It combines speed and precision, teamwork and independence, dog training skills and handler finesse in a wonderfully complex mix. Agility has the
More informationMendelian Genetics SI
Name Mendelian Genetics SI Date 1. In sheep, eye color is controlled by a single gene with two alleles. When a homozygous brown-eyed sheep is crossed with a homozygous green-eyed sheep, blue-eyed offspring
More informationThis AHT Information Sheet contains details on late-onset PRA in three breeds: Gordon Setters, Irish Setters and Tibetan Terriers.
This AHT Information Sheet contains details on late-onset PRA in three breeds: Gordon Setters, Irish Setters and Tibetan Terriers. Late-Onset Progressive Retinal Atrophy in the Gordon Setter A mutation
More informationBi156 Lecture 1/13/12. Dog Genetics
Bi156 Lecture 1/13/12 Dog Genetics The radiation of the family Canidae occurred about 100 million years ago. Dogs are most closely related to wolves, from which they diverged through domestication about
More informationBiodiversity and Distributions. Lecture 2: Biodiversity. The process of natural selection
Lecture 2: Biodiversity What is biological diversity? Natural selection Adaptive radiations and convergent evolution Biogeography Biodiversity and Distributions Types of biological diversity: Genetic diversity
More informationBioinformatics: Investigating Molecular/Biochemical Evidence for Evolution
Bioinformatics: Investigating Molecular/Biochemical Evidence for Evolution Background How does an evolutionary biologist decide how closely related two different species are? The simplest way is to compare
More information+ Karyotypes. Does it look like this in the cell?
+ Human Heredity + Karyotypes A genome is the full set of genetic information that an organism carries in its DNA. Karyotype: Shows the complete diploid set of chromosomes grouped together in pairs, arranged
More information2013 Holiday Lectures on Science Medicine in the Genomic Era
INTRODUCTION Figure 1. Tasha. Scientists sequenced the first canine genome using DNA from a boxer named Tasha. Meet Tasha, a boxer dog (Figure 1). In 2005, scientists obtained the first complete dog genome
More informationRETINITIS PIGMENTOSA*
Brit. J. Ophihal. (1955), 39, 312. ABNORMAL FUNDUS REFLEXES AND RETINITIS PIGMENTOSA* BY R. P. CRICK Royal Eye Hospital, London THE normal variation of the fundus reflex which gives a " shot-silk" appearance
More informationComparing DNA Sequence to Understand
Comparing DNA Sequence to Understand Evolutionary Relationships with BLAST Name: Big Idea 1: Evolution Pre-Reading In order to understand the purposes and learning objectives of this investigation, you
More informationYes, heterozygous organisms can pass a dominant allele onto the offspring. Only one dominant allele is needed to have the dominant genotype.
Name: Period: Unit 4: Inheritance of Traits Scopes 9-10: Inheritance and Mutations 1. What is an organism that has two dominant alleles for a trait? Homozygous dominant Give an example of an organism with
More informationAlthough owls can t move their eyes, many other adaptations help these raptors spot prey.
This website would like to remind you: Your browser (Apple Safari 7) is out of date. Update your browser for more security, comfort and the best experience on this site. Media Spotlight Bird s Eye View
More informationPre-natal construction of neural circuits (the highways are genetically specified):
Modification of Brain Circuits as a Result of Experience Chapter 24, Purves et al. 4 th Ed. Pre-natal construction of neural circuits (the highways are genetically specified): (1/6/2010) Mona Buhusi Postnatal
More informationUnit 3: DNA and Genetics Module 8: Genetics
Unit 3: DNA and Genetics Module 8: Genetics NC Essential Standard: 3.2.2 Predict offspring ratios based on a variety of inheritance patterns 3.2.3 Explain how the environment can influence expression of
More informationWhy Don t These Drugs Work Anymore? Biosciences in the 21 st Century Dr. Amber Rice October 28, 2013
Why Don t These Drugs Work Anymore? Biosciences in the 21 st Century Dr. Amber Rice October 28, 2013 Outline Drug resistance: a case study Evolution: the basics How does resistance evolve? Examples of
More informationYour web browser (Safari 7) is out of date. For more security, comfort and the best experience on this site: Update your browser Ignore
Your web browser (Safari 7) is out of date. For more security, comfort and the best experience on this site: Update your browser Ignore Activityapply ADAPTIVE RADIATIO N How do species respond to environmental
More informationPutting Science into Animal Science Projects. Area: Using Genetics (advanced members) Activity: Eradicate Scrapie in Sheep through Genetic Selection
Putting Science into Animal Science Projects Area: Using Genetics (advanced members) Activity: Eradicate Scrapie in Sheep through Genetic Selection Goal: Provide advanced members with the information and
More informationIn the first half of the 20th century, Dr. Guido Fanconi published detailed clinical descriptions of several heritable human diseases.
In the first half of the 20th century, Dr. Guido Fanconi published detailed clinical descriptions of several heritable human diseases. Two disease syndromes were named after him: Fanconi Anemia and Fanconi
More informationEvolution of Birds. Summary:
Oregon State Standards OR Science 7.1, 7.2, 7.3, 7.3S.1, 7.3S.2 8.1, 8.2, 8.2L.1, 8.3, 8.3S.1, 8.3S.2 H.1, H.2, H.2L.4, H.2L.5, H.3, H.3S.1, H.3S.2, H.3S.3 Summary: Students create phylogenetic trees to
More informationModern Evolutionary Classification. Lesson Overview. Lesson Overview Modern Evolutionary Classification
Lesson Overview 18.2 Modern Evolutionary Classification THINK ABOUT IT Darwin s ideas about a tree of life suggested a new way to classify organisms not just based on similarities and differences, but
More informationStudying Gene Frequencies in a Population of Domestic Cats
Studying Gene Frequencies in a Population of Domestic Cats Linda K. Ellis Department of Biology Monmouth University Edison Hall, 400 Cedar Avenue, W. Long Branch, NJ 07764 USA lellis@monmouth.edu Description:
More informationAnimal Evolution The Chordates. Chapter 26 Part 2
Animal Evolution The Chordates Chapter 26 Part 2 26.10 Birds The Feathered Ones Birds are the only animals with feathers Descendants of flying dinosaurs in which scales became modified as feathers Long
More informationEVOLUTIONARY GENETICS (Genome 453) Midterm Exam Name KEY
PLEASE: Put your name on every page and SHOW YOUR WORK. Also, lots of space is provided, but you do not have to fill it all! Note that the details of these problems are fictional, for exam purposes only.
More informationGenes What are they good for? STUDENT HANDOUT. Module 4
Genes What are they good for? Module 4 Genetics for Kids: Module 4 Genes What are they good for? Part I: Introduction Genes are sequences of DNA that contain instructions that determine the physical traits
More information1 This question is about the evolution, genetics, behaviour and physiology of cats.
1 This question is about the evolution, genetics, behaviour and physiology of cats. Fig. 1.1 (on the insert) shows a Scottish wildcat, Felis sylvestris. Modern domestic cats evolved from a wild ancestor
More informationTutorial 9 notes Super Bug: Antibiotics & Evolution Kristy J. Wilson Department of Pathology Emory University History of Antibiotics http://videos.howstuffworks.com/science-channel/29783-100-greatest-discoveries-penicillinvideo.htm
More information1 In 1958, scientists made a breakthrough in artificial reproductive cloning by successfully cloning a
1 In 1958, scientists made a breakthrough in artificial reproductive cloning by successfully cloning a vertebrate species. The species cloned was the African clawed frog, Xenopus laevis. Fig. 1.1, on page
More informationLesson Overview. Human Chromosomes. Lesson Overview Human Chromosomes
Lesson Overview 14.1 Genome a full set of all the genetic information that an organism carries in its DNA. Karyotypes Karyotype a picture that shows the complete diploid set of human chromosomes, They
More informationNatural Selection. What is natural selection?
Natural Selection Natural Selection What is natural selection? In 1858, Darwin and Alfred Russell proposed the same explanation for how evolution occurs In his book, Origin of the Species, Darwin proposed
More informationUNIT III A. Descent with Modification(Ch19) B. Phylogeny (Ch20) C. Evolution of Populations (Ch21) D. Origin of Species or Speciation (Ch22)
UNIT III A. Descent with Modification(Ch9) B. Phylogeny (Ch2) C. Evolution of Populations (Ch2) D. Origin of Species or Speciation (Ch22) Classification in broad term simply means putting things in classes
More informationAgile Gibbon Hylobates agilis
#1 Agile Gibbon Hylobates agilis The agile gibbon, also known as the blackhanded gibbon, is an Old World primate found in Indonesia on the island of Sumatra, Malaysia, and southern Thailand. They are an
More informationIf fungi, plants, and animals all have nuclei, this makes them which type of cell? What trait do the mushroom and gecko share that the tree lacks?
Objectives Before doing this lab you should understand what cladograms show and how they are constructed. After doing this lab you should be able to use cladograms to answer questions on how different
More informationZoo Crew. A SmithSoniAn S national Zoo FAmily EduCAtion GuidE
Zoo Crew A SmithSoniAn S national Zoo FAmily EduCAtion GuidE join the Zoo CrEw! Are you ready to become a wildlife conservationist and part of the Zoo Crew? During your visit to the Smithsonian s National
More informationName: Per. Date: 1. How many different species of living things exist today?
Name: Per. Date: Life Has a History We will be using this website for the activity: http://www.ucmp.berkeley.edu/education/explorations/tours/intro/index.html Procedure: A. Open the above website and click
More informationHe mustn t hear me breathe.
He mustn t hear me breathe. Njabulo stands stock-still, eyes pinned to the slow-slow movement. He knows it s going to happen, but when it does, he is still surprised. Dog-biscuit brown to spring-leaf yellow,
More informationLAB. NATURAL SELECTION
Period Date LAB. NATURAL SELECTION This game was invented by G. Ledyard Stebbins, a pioneer in the evolution of plants. The purpose of the game is to illustrate the basic principles and some of the general
More information7. Describe the following with words and give an example: Heterozygous, homozygous recessive, homozygous dominant
Name: Genetics UNIT EXAM Review Below are review questions for each of the 5 learning goals we have addressed during this unit. This is the majority of the science content we covered. However, as a disclaimer
More informationSimple Genetics Quiz
Simple Genetics Quiz Matching: Match the terms below to their correct definition. (1 point each) 1. heterozygous 2. homozygous 3. dominant 4. recessive 5. phenotype 6. Cystic Fibrosis 7. Sickle Cell Anemia
More information