RESISTANCE-SUSCEPTIBILITY PROFILES OF LACTOCOCCUS LACTIS AND STREPTOCOCCUS THERMOPHILUS STRAINS TO EIGHT ANTIBIOTICS AND PROPOSITION OF NEW CUT-OFFS

Transcription

1 International Journal of Probiotics and Prebiotics Vol. 3, No. 4, pp , 2008 ISSN print, Copyright 2008 by New Century Health Publishers, LLC All rights of reproduction in any form reserved RESISTANCE-SUSCEPTIBILITY PROFILES OF LACTOCOCCUS LACTIS AND STREPTOCOCCUS THERMOPHILUS STRAINS TO EIGHT ANTIBIOTICS AND PROPOSITION OF NEW CUT-OFFS Ana Belén Flórez 1, Lorenzo Tosi 2, Morten Danielsen 3, Atte von Wright 4, Jacek Bardowski 5, Lorenzo Morelli 2, and Baltasar Mayo 1 1 Instituto de Productos Lácteos de Asturias (CSIC), Carretera de Infiesto s/n, Villaviciosa, Asturias, Spain; 2 Istituto di Microbiologia, Università Cattolica del Sacro Cuore, Emilia Parmense 84, I 29100, Piacenza, Italy; 3 Chr. Hansen A/S, Bøge Allé 10-12, DK-2970 Hørsholm, Denmark; 4 Institute of Applied Biotechnology, University of Kuopio, Bioteknia 2, PO Box 1627, Kuopio, Finland; and 5 Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, Warsaw, Poland [Received September 30, 2008; Accepted October 19, 2008] ABSTRACT: The minimum inhibitory concentration (MIC) of ampicillin, chloramphenicol, clindamycin, erythromycin, gentamicin, streptomycin, tetracycline, and vancomycin was determined in 89 different Lactococcus lactis and in 64 Streptococcus thermophilus strains in order to establish resistance-susceptibility cut-off values in these dairy important organisms. Cut-offs were defined on the basis of the distribution of the MICs, which in the absence of acquired determinants should approach to a normal statistical distribution. In general, the new cut-off values proposed in this study are higher than previously defined (European Commission, The EFSA Journal 223, 1-12). Based on these new values, all tested strains were either susceptible (ampicillin, chloramphenicol, gentamicine, and vancomycin) or intrinsically resistant (streptomycin) to most antibiotics. However, 11 L. lactis strains (around 7%) (Six strains have been previously selected as tetracycline resistant among 500 isolates) were considered resistant to tetracycline, and 8 S. thermophilus strains (around 11%) were considered resistant to tetracycline, erythromycin or clindamycin. Of these, three S. thermophilus strains proved to be resistant to both tetracycline and erythromycin, and a further strain resistant to tetracycline, erythromycin and clindamycin. By PCR, tet (M) and tet (S) genes were amplified from the L. lactis tetracycline resistant strains. An erm (B) was identified as the genetic baseis of erythromycin resistance in all four S. thermophilus strains. KEY WORDS: antibiotic survey, antimicrobial resistance, Lactococcus lactis, minimum inhibitory concentration, Streptococcus thermophilus, susceptibility testing Corresponding Author: Dr. Baltasar Mayo, Instituto de Productos Lácteos de Asturias, Carretera de Infiesto s/n, Villaviciosa, Spain; Phone: ; Fax: ; baltasar.mayo@ipla.csic.es INTRODUCTION The antibiotic resistance problem Antibiotics are arguably the most successful form of chemotherapy developed over the entire history of medicine. However, their efficacy is being severely threatened by the appearance and worldwide spread of antibiotic resistance. Antibiotic resistance complicates the treatment of infectious diseases, increasing both morbidity and mortality rates (Levy and Marshall, 2004). The phenomenon has been recently defined by the Alliance for the Prudent Use of Antibiotics as a shadow epidemic ( Resistance could be inherent to a bacterial species or genus (referred to as intrinsic or natural resistance) or could be acquired (European Commission, 2005). The acquisition of antibiotic resistance occurs via mutation of pre-existing genes or by horizontal transmission. With some exceptions, intrinsic resistance and resistance by mutation are unlikely to be disseminated, while horizontally acquired genes, particularly those carried on mobile genetic elements, are those most likely to be transmitted (Normark and Normark, 2002). Antibiotic resistance in commensal and beneficial bacteria The fact that commensal bacteria act as a reservoir of resistant elements (plasmids, transposons) able to be transferred to pathogen microorganisms has been firmly stated in some bacterial groups. As an example, the commensal Haemophilus parainfluenzae supplies plasmids encoding β-lactamases to Haemophilus influenzae strains (Salyers et al., 2002). Similarly, strains of Staphylococcus epidermidis serve as a reservoir of resistance genes and plasmids for the pathogenic Staphylococcus aureus strains (Salyers et al., 2002). Although not encoded on mobile elements, the origin of penicillin resistance in Streptococcus pneumoniae has been found in the commesal species Streptococcus viridans, naturally resistant to this antibiotic (Balsalobre et al., 2003). Thus, the fact that commensal bacteria may act as a reservoir for antibiotic resistance that

2 250 Antibiotic resistance in L.lactis and S. thermophilus is finally cross-species transferred to pathogens is firmly supported by a growing body of scientific evidence (Levy and Marshall, 2004; Salyers et al., 2004; At present there is a public health concern that commensal and/or beneficial microbial cultures used for food production or naturally occurring in foods can be vehicles for transmission of antibiotic resistances (Salyers et al., 2004; European Commission, 2005). Moreover, the food chain has been recognized as one of the main routes of transmission of antibiotic resistance from animal to human bacterial populations (Teuber et al., 1999; Witte, 2000; Gevers et al., 2003). However, little is known about the abundance, diversity, and distribution of resistance genes in commensal and beneficial bacterial groups, because, until recently, bacterial pathogens have been the primary focus of studies on antibiotic resistance. Antibiotic resistant lactic acid bacteria (LAB) may be selected for in environments where they come into contact with antibiotics, such as the udder of antibiotictreated cows (Chopra and Roberts, 2001) or food and feed containing antibiotic residues (Donoghue, 2003). Lactoccoccus lactis and Streptococcus thermophilus Added as starters or present as a part of the indigenous milk microbiota, lactic acid bacteria (LAB) species of coccus-type cell morphology, such as L. lactis and S. thermophilus, are of outstanding importance in the dairy industry for the manufacture and ripening of many diary products. L. lactis is the main component of starters cultures for cheesemaking, and is abundantly used in Gouda- and Cheddarlike cheeses. S. thermophilus is mostly used for the manufacture of yoghurt and Italian- and Swiss-type cheeses. The major function of these bacteria in dairy is to produce lactic acid in a rapid way, preventing growth of undesirable bacteria. At the same time, they promote rennet activity and whey drainage, essential processes in cheesemaking (Fox et al., 2000). They further participate in the development of texture and flavour throughout their proteolytic and amino acid conversion pathways (Smit, Smit and Engels, 2005). In addition, L. lactis strains are dominant in natural niches such as cattle mucosas, plant material (Mundt, 1986), and in the intestinal tract of freshwater fishes, allowing the use of selected strains as probiotics in fish farming (Gatesoupe, 2008). Antibiotic resistance in L. lactis and S. thermophilus Pioneering antibiotic surveys have shown L. lactis strains to be susceptible to most antimicrobials (Cogan, 1972; Reimbold and Reddy, 1974; Orberg and Sandine, 1985; Elliot and Facklam, 1996), with the exception of intrinsic resistance to rifampicin (Teuber et al., 1999; Elliot and Facklam, 1996). However, single strains of L. lactis have been shown to harbour acquired resistances to chloramphenicol, clindamycin, streptomycin, erythromycin or tetracycline (Raha et al., 2002; Temmerman et al., 2003; Flórez et al., 2005). Indeed, resistance determinants to all these antimicrobial agents have been reported (Perreten et al., 1997; Raha et al., 2002). In contrast, acquired resistance has never been reported in S. thermophilus (Teuber et al., 1999; Katla et al., 2001; Temmerman et al., 2003; Aslim and Beyatli, 2004). Although it was not the first report on acquired antibiotic resistance in a LAB strain, the presence of a multiple resistance plasmid in L. lactis K214 isolated from a raw-milk cheese shocked the scientific community (Perreten et al., 1997). As much as three acquired antibiotic resistance genes were found to be encoded on the 30-kbp plasmid pk214; namely, a tet(s) gene showing a complete identity to genes previously described in Listeria monocytogenes, and one gene each coding for streptomycin-inactivating adenylase and chloramphenicol acethyltransferase, respectively, identical to others from Staphylococcus aureus (Perreten et al., 1997). Further to these, the presence of the tetracycline resistance gene tet(m) has also been reported in some other strains (Chopra and Roberts, 2001). In addition to dedicated resistance mechanisms, general detoxification systems may contribute to enhancing the MICs of otherwise susceptible strains. In this sense, a secondary multidrug transporter, LmrP, has been implicated in the resistance of L. lactis to a broad range of clinically important antibiotics (Putman et al., 2001). Cells expressing LmrP showed increased resistance to lincosamide, streptogramin, tetracycline and the 14- and 15-C member lactone ring macrolides. Moreover, the efflux system encoded by the mdt(a) gene from pk214 conferred increased resistance to macrolides, lincosamides, streptogramins and tetracyclines in L. lactis and Escherichia coli (Perreten et al., 2001). Therefore, besides meeting a series of desirable technological properties, strains of L. lactis and S. thermophilus intended to be used in food systems as either starters or probiotics should be free of potentially transferable antibiotic resistances. Outline of this work This paper reports on an antibiotic survey of a collection of L. lactis and S. thermophilus strains isolated from distinct geographical locations over many years (from 1950 to the present), different dairy products and animal environments. Antibiotics analysed included inhibitors of the synthesis of proteins (chloramphenicol, clindamycin, erythromycin, gentamicin, streptomycin, and tetracycline) or the synthesis of the cell wall (ampicillin and vancomycin). The analysis of the minimum inhibitory concentration (MIC) in a large series of unrelated strains from different ecotypes allowed as to update the cut-off values recently defined by the FEEDUP panel for L. lactis (European Commission, 2005) and to propose resistance/susceptibility cut-offs for S. thermophilus. This paper summarizes published results on the antibiotic resistancesusceptibility profiles to eight antibiotics in L. lactis (Flórez et al., 2007) and S. thermophilus (Tosi et al., 2007) but also unpublished data, and discusses the detection of antibiotic resistance genes. MATERIAL AND METHODS Bacterial strains, growth media and culture conditions Ninety-three L. lactis isolates from industrial starter cultures (26), cows milk (12), artisanal starter-free cheeses (39), cat (4) and fish (5) intestines, and culture collections (3) were surveyed for antimicrobial resistance. The isolates were geographically well separated, as they were collected in Spain (31), Denmark (15), Belgium (18), Poland (7), Finland (5) and other European countries (13). Most were isolated in the 1980s and 1990 s (73), but several were collected before the generalized use of antibiotics (20), the so-called pre-antibiotic era (Teuber et al., 1999). The 64 S. thermophilus strains included in this study were obtained from the culture collection of the Istituto di Microbiologia, Università Cattolica del Sacro Cuore, Italy (isolated from traditional

3 Antibiotic resistance in L.lactis and S. thermophilus 251 Italian cheeses, 52 strains) and from international culture collections (12 strains). Strains were identified by phenotypic and genetic methods and typed by random amplification of polymorphic DNA (RAPD) and/or pulsed field gel electrophoresis (PFGE) analyses. Lactococci were cultured in Mueller-Hinton agar at 32ºC for h, and S. thermophilus strains were grown in SSM agar (Iso-Sensitest 90% v/v; M17 10% v/v; lactose 0.5% w/v) (Tosi et al., 2007) at 42ºC for 42 h. MIC determination by the Etest method Individual colonies from Mueller-Hinton or SSM agar plates were suspended in a sterile glass or plastic tube containing 2-5 ml of sterile saline (Oxoid) until a density corresponding to McFarland standard 1 or its spectrophotometric equivalent (corresponding to around 3x10 8 cfu/ml) was obtained. A sterile cotton swab was dipped into the above McFarland suspension and used to inoculate agar plates of the same media. The agar surface was then allowed to dry for approximately 15 min before applying the Etest strips (AB Biodisk, Solna, Sweden). Readings were recorded after 48 h of incubation at 28ºC (or 25ºC for L. lactis fish isolates), following the manufacturer s recommendations. Susceptibility testing by microdilution Determination of the MICs by the microdilution method was accomplished using dedicated plates (VetMIC TM, National Veterinary Institute of Sweden, Uppsala, Sweden) containing serial two-fold dilutions of the selected antibiotics. The McFarland suspension was diluted 1:1000 with LSM for the inoculation of the VetMIC TM plates (final concentration 3x10 5 cfu /ml). One hundred microlitres of these inocula were added to each well within 30 min of preparation, and incubated at 28ºC for 48 h. Bacterial growth was detected as a pellet in the bottom of the well. The MIC was defined as the lowest antibiotic concentration at which no visual growth was observed. As a negative control, a tube of non-inoculated test medium was incubated under the same conditions. PCR amplification of antibiotic resistance genes Total DNA from resistant strains was isolated by using a commercial kit (GenElute bacterial genomic DNA kit; Sigma-Altdrich Co., St. Louis, Mo., USA). DNA dilutions were used as template in PRC reactions with universal primers of ribosomal protection genes (DI, 5 -GA(T/C)ACICCIGGICA(T/C)(A/G)TIGA(T/C)TT-3 ; DII, 5 -GCCCA(A/G)(T/A)IGG(A/G)TTIGGIGGIAC(T/C)TC-3 ) (Clermont et al., 1997), as well as specific primers for tet(k) (TetK- FW1 5 -TTATGGTGGTTGTAGCTAGAAA-3 ; TetK-RV1 5 - AAAGGGTTAGAAACTCTTGAAA-3 ), tet(l) (TetL-FW3 5 - GYMHYYHVHVHVYSYSYYVV-3 ; TetL-RV3 5 - GTGAAMGRWAGCCCACCTAA-3 ), and tet(m) (DI and tetmr, 5 -CACCGAGCAGGGATTTCTCCAC-3 ) (Gevers et al., 2003). Erythromycin and streptomycin S. thermophilus resistant strains were respectively searched for the erythromycin resistance gene erm(b) (ermb-f, 5'-GTTTACGAAATTGGAACAGG; ermb-r 5'- CCATTTTGAAACAAAGTACG), and for the adenyltransferase genes aad(a) (adda-f, 5 -TGATTTGCTGGTTACGGTGAC-3 ; adda-r, 5 -CGCTATGTTCTCTTGCTT TTG-3 ) and aad(e) (adde-f, 5 -ACTGGCTTAATCAATTTGGG-3 ; adde-r, 5 - GCCTTTCCGCCACCTCACCG-3 ) (Clark et al., 1999) by using previously reported PCR conditions. Amplicons were purified using Microcon PCR filters (Millipore, Bedford, Ma., USA) and double-stranded sequenced in an ABI 370 Genetic Analyzer (Applied Biosystems, Warrington, UK). Sequences were then compared to other in the EMBL data library by using the online BLASTN resource ( Table 1. Distribution of MICs for the selected antibiotics in Lactococcus lactis and Streptococcus thermophilus as determined by the Etest method in Mueller-Hinton (L. lactis) or SSM (S. thermophilus). Species No. of isolates with the corresponding MIC (µg/ml) a Antibiotic (no. of strains) Lactococcus lactis Ampicillin (12) Chloramphenicol (60) Clindamycin (74) Erythromycin (89) Gentamicin (12) Streptomycin (89) Tetracycline (89) Vancomycin (70) Streptococcus thermophilus Ampicillin (64) b Chloramphenicol (2) 2 Clindamycin (64) b Erythromycin (64) Gentamicin (64) b Streptomycin (64) Tetracycline (64) Vancomycin (2) 2 a In order of clarity, Etest raw data have been grouped in classes b Only microdilution MICs are available for these antibiotics in S. thermophilus.

4 252 Antibiotic resistance in L.lactis and S. thermophilus RESULTS AND DISCUSSION MICs and MIC distributions in L. lactis and S. thermophilus In this study, MICs of eight antibiotics with action on Gram-positive bacteria were evaluated by microdilution, Etest or both methods in 89 L. lactis and 64 S. thermophilus strains from different environments, locations and periods of time. Variations in the MIC values between species and strains were found by either the two methods. In general, MICs by microdilution were equal to those obtained by Etest; although by this last technique lower values were usually obtained. Table 1 shows the distribution of MICs for the several antibiotics in both L. lactis and S. thermophilus as determined by Etest. Grouping the strains by year of isolation, geographical origin or environment appeared to have no influence on the distribution of the MICs. Variations in the MICs similar to those obtained in the present work have been reported by other authors for both L. lactis (Orberg and Sandine, 1985; Katla et al., 2001) and S. thermophilus (Katla et al., 2001; Temmerman et al., 2003) species. Reported antibiotic resistance-susceptibility levels of LAB species have been obtained by different methodologies, e.g., the Etest (Charteris et al., 2001; Danielsen and Wind, 2003), disk diffusion (Tosi et al., 2007), and microdilution (Flórez et al., 2005; Tosi et al., 2007), by which the results cannot be directly compared. In addition, variations in the cation content or the concentration of thymine or other critical compounds in the test medium can further influence antibiotic susceptibility results (Huys et al., 2002; Danielsen et al., 2004; Klare et al., 2005). Even the inoculum size, the temperature and incubation period can be a source of differences (Egervärn et al., 2007). In the present work, the standardised protocol and the harmonized media and culture conditions used probably reduced the differences. Unimodal MIC distributions for all antibiotics were encountered, except for tetracycline in both L. lactis and S. thermophilus, and for erythromycin and clindamycin in S. thermophilus. Bimodal distributions may indicate subpopulations having acquired resistances (Murray et al., 2003). As an example, Figure 1 shows the MIC distributions of erythromycin (normal distribution) and tetracycline (bimodal distribution) for the L. lactis strains. The curves for tetracycline, chloramphenicol and vancomycin were very narrow, while those for ampicillin, erythromycin, clindamycin, gentamicin and streptomycin were wider. Comparison of the MICs and analysis of their distributions, identified 11 L. lactis strains (around 12%) as resistant to tetracycline (six of which had been selected by their tetracycline resistance phenotype after screening of a collection of 500 dairy lactococci for resistance to this antibiotic; J. Zycka, J. B. Lampkowska and J. Bardowski, unpublished); and seven S. thermophilus strains (around 10%) were considered resistant to tetracycline, four to erythromycin and one to clindamycin. Of these, three S. thermophilus strains proved to be resistant to both tetracycline and erythromycin, and a further single strain resistant to tetracycline, erythromycin and clindamycin. Figure 1. Distribution of erythromycin (in green) and tetracycline MICs (in black) for Lactococcus lactis strains. The unimodal distribution of erythromycin MICs suggests the presence of no resistant strains, while the clear bimodal distribution of tetracycline MICs indicates the presence of qualitatively-distinct resistant strains (in red). From Ammor et al. (2008), appearing in the Journal of Molecular Microbiology and Biotechnology, published by KARGER Medical and Scientific Publishers (Basel, Switzerland). Proposition of new microbiological susceptibility-resistance cut-off values The term microbiological breakpoint was introduced to replace the concept of clinical breakpoint for the purpose of identifying bacterial strains with acquired and potentially transferable resistance determinants (Olsson-Liljequist et al., 1997). In the present work, however, a microbiological term more related to risk assessment is used: the resistancesusceptibility cut-off value. The cut-off for each antibiotic was considered as the second MIC above the apparently normal range of the MICs. The large number of strains examined allows the proposition of the resistance-susceptibility cut-offs shown in Table 2. Strains with a MIC equal to or higher than the cut-off values were considered resistant. In the experimental conditions of this study, some of the cut-offs were quite different to previously published breakpoints, such us those of the European Commission Scientific Panel Committee on additives and products or substances used in animal feed (FEEDAP) (European Commission, 2005). To validate the new cut-offs, analysis of the resistant strains for antibiotic resistance determinants is essential; as well as a careful inspection of the strains contributing to the higher MIC levels, to exclude the presence of dedicated (acquired) mechanisms of resistance. Antimicrobial resistance genes Few antimicrobial resistance determinants have been found in strains of L. lactis, although plasmid-encoded genes have been reported

5 Antibiotic resistance in L.lactis and S. thermophilus 253 for tetracycline [tet(s)], macrolides [mdt(a) and erm(t)], chloramphenicol (cat) and streptomycin (str) (Perreten et al., 1997; Raha et al., 2002). The tetracycline resistant strains were screened for tetracycline resistance determinants by using universal primers for ribosome protection genes and primers specific for tet(k), tet(l), and tet(m). In a first instance, the S. thermophilus resistant strains were only searched for tet(m), erm(b) and aad(a) and aad(e) genes. An amplification product of around 1.5-kbp was obtained by using specific primers for tet(m) when DNA from two L. lactis resistant strains from a farmhouse cheese (Spain) and a resistant strain from a cat tonsil (BCCM TM, Belgium) was used as a template. The partial sequences of all these genes proved to be 100% identical to each other and also to the tet(m) gene from Tn916 of Enterococcus faecalis (Su et al., 1992). Further, two different tetracycline resistance genes were detected among the six Polish L. lactis resistant strains; tet(m) and tet(s) were found in four strains each (J. Zycka-Krzesinska, L. Tranda and Bardowski, J., unpublished). Consequently, two strains contained at the same time both resistance genes. From the two tetracycline resistant fish isolates, a segment of a tet(l) gene could be recovered (J. Korhonen and A. von Wright, unpublished). Hybridisation experiments indicated that a majority of the tetracycline resistance genes found in L. lactis are located on resident plasmids, some of which have been proved to be transmissible by conjugation to lactococci and enterococci species (Flórez et al., 2008; Lampkowska et al., 2008). In S. thermophilus the erythromycin resistance phenotype was associated with the presence of an erm(b) gene in all four resistant strains. However, tet(m) or any of the two genes devoted to aminoglycoside resistance were not detected. By using a microarray hybridisation technique a tet(s) gene was identified in the tetracycline resistant strains (Aarts et al., 2008). Table 2. Microbiological susceptibility-resistance cut-off values proposed for Lactococcus lactis and Streptococcus thermophilus to the eight antibiotics of this study. Proposed susceptibility-resistance cut-off MICs (µg/ml) ANTIBIOTIC Lactococcus lactis Streptococcus thermophilus This work FEEDAP a This work FEEDAP Ampicillin Chloramphenicol 16 8 Nd 8 Clindamycin Erythromycin Gentamycin Streptomycin > > Tetracycline Vancomycin 8 4 Nd 4 a FEEDAP, Scientific Panel on additives and products or substances used in animal feed. Breakpoints as related on a recent report (European Commission, 2005). In bold, microbiological cut-offs different from the FEEDAP breakpoints. Nd, not determined. CONCLUSIONS Microdilution and Etest are convenient techniques to accurately determine antibiotic MICs in LAB species, such as L. lactis and S. thermophilus. The analysis of large collection of strains from different ecotypes is a useful method for defining cut-off values separating acquired resistances from all other types, and revealing acquired resistances already spread among the populations. Only a minority of LAB strains from dairy sources showed resistance levels compatible with acquired resistances. Indeed, the presence of some antibiotic resistance determinants was clearly stated. However, this relative small fraction justifies monitoring antibiotic resistance programs for species intended to be used in food and feed systems. ACKNOWLEDGEMENTS This work was supported by a EU project within the sixth Framework Programme (ACE-ART, Ref. CT ). CONFLICT OF INTEREST STATEMENT Authors declare no conflicts of interest REFERENCES Aarts, H.J.M. et al., and van Hoek, A.H.A.M The characterization of tetracycline and erythromycin antibiotic resistance genes in Lactic Acid Bacteria and Bifidobacteria and their relation to observed resistance. International Journal of Probiotics and Prebiotics (In Press) Ammor, M.S., Flórez, A.B., van Hoek, A.H., de los Reyes-Gavilán, C.G., Margolles, A., and Mayo, B Molecular characterization of intrinsic and acquired antibiotic resistance in lactic acid bacteria and bifidobacteria. Journal of Molecular Microbiology and Biotechnology 14: Balsalobre, L., Ferrandiz, M.J., Linares, J., Tubau, F. and de la Campa, A.G. (2003) Viridans group streptococci are donors in horizontal transfer of topoisomerase IV genes to Streptococcus pneumoniae. Antimicrobial Agents and Chemotherapy 47: Charteris, W.P., Kelly, P.M., Morelli, L. and Collins, J.K. (2001) Gradient diffusion antibiotic susceptibility testing of potentially probiotic lactobacilli. Journal of Food Protection 64: Chopra, I. and Roberts, M. (2001) Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiology and Molecular Biology Reviews 65: Clark, N.C., Olsvik, O., Swenson, J.M., Spiegel, C.A. and Tenover, F.C. (1999) Detection of a streptomycin/ spectinomycin adenylyltransferase gene (aada) in Enterococcus faecalis. Antimicrobial Agents and Chemotherapy 43: Clermont, D., Chesneau, O., de Cespedes, G. and Horaud, T. (1997) New tetracycline resistance determinants coding for ribosomal protection in streptococci and nucleotide sequence of tet(t) isolated from Streptococcus pyogenes A498. Antimicrobial Agents and Chemotherapy 41:

6 254 Antibiotic resistance in L.lactis and S. thermophilus Cogan, T.M. (1972) Susceptibility of cheese and yogurt starter bacteria to antibiotics. Applied Microbiology 23: Danielsen, M. and Wind, A. (2003) Susceptibility of Lactobacillus spp. to antimicrobial agents. International Journal of Food Microbiology 82: Danielsen, M., Andersen, H.S. and Wind, A. (2004) Use of folic acid casei medium reveals trimethoprim susceptibility of Lactobacillus species. Letters in Applied Microbiology 38: Donoghue, D.J. (2003) Antibiotic residues in poultry tissues and eggs: human health concerns? Poultry Science 82: Egervärn, M., Lindmark, H., Roos, S., Huys, G. and Lindgren, S. (2007) Effects of inoculum size and incubation time on broth microdilution susceptibility testing of lactic acid bacteria. Antimicrobial Agents and Chemotherapy 51: Elliot, J.A. and Facklam, R.R. (1996) Antimicrobial susceptibilities of Lactococcus lactis and Lactococcus garviae and a proposed method to discriminate between them. Journal of Clinical Microbiology 34: European Commission. (2005) Opinion of the scientific panel on additives and products in substances used in animal feed on the updating of the criteria used in the assessment of bacteria for resistance to antibiotics of human and veterinary importance. The EFSA Journal 223: Flórez, A.B., Delgado, S. and Mayo, B. (2005) Antimicrobial susceptibility of lactic acid bacteria isolated from a cheese environment. Canadian Journal of Microbiology 51: Flórez, A.B., Danielsen, M., Korhonen, J., Zycka, J., von Wright, A., Bardowski, J. and Mayo, B. (2006) Antibiotic survey of Lactococcus lactis strains to six antibiotics by Etest, and establishment of new susceptibility-resistance cut-off values. Journal of Dairy Research 74: Flórez, A.B., Ammor, M.S. and Mayo, B. (2008) Identification of tet(m) in two Lactococcus lactis strains isolated from a Spanish traditional starter-free cheese made of raw milk and conjugative transfer of tetracycline resistance to lactococci and enterococci. International Journal of Food Microbiology 121: Fox, P.F., Guinee, T.P., Cogan, T.M. and McSweeney, P.L.H. (2000) Fundamentals of Cheese Science, (Gaithersburg, Ma., USA: AN Aspen Publishers Inc). Gatesoupe, F.J. (2008) Updating the importance of lactic Acid bacteria in fish farming: natural occurrence and probiotic treatments. Journal of Molecular Microbiology and Biotechnology 14: Gevers, D., Masco, L., Baert, L., Huys, G., Debevere, J. and Swings, J. (2003) Prevalence and diversity of tetracycline resistant lactic acid bacteria and their tet genes along the process line of fermented dry sausages. Systematic and Applied Microbiology 26: Gevers, D., Danielsen, M., Huys, G. and Swings, J. (2003) Molecular characterization of tet(m) genes in Lactobacillus isolates from different types of fermented dry sausage. Applied and Environmental Microbiology 69: Huys, G., D Haene, K. and Swings, J. (2002) Influence of the culture medium on antibiotic susceptibility testing of foodassociated lactic acid bacteria with the agar overlay disc diffusion method. Letters in Applied Microbiology 34: Klare, I., Konstabel, C., Müller-Bertling, S., Reissbrodt, R., Huys, G., Vancanneyt, M., Swings, J., Goossens, H. and Witte, W. (2005) Evaluation of new broth media for microdilution antibiotic susceptibility testing of lactobacilli, lactococci, pediococci, and bifidobacteria. Applied and Environmental Microbiology 71: Lampkowska, J., Feld, L., Monaghan, A., Toomey, N., Schjørring, S., Jacobsen, B., van der Voet, H., Andersen, S.R., Bolton, D., Aarts, H., Krogfelt, K.A., Wilcks, A., and Bardowski, J A standardized conjugation protocol to assess antibiotic antibiotic resistance transfer between lactococcal species. International Journal of Food Microbiology 127: Levy, S.B. and Marshall, B. (2004) Antibacterial resistance worldwide: causes, challenges and responses. Nature Medicine 10: Mundt, J.O. (1986) Lactic acid streptococci. In: Sneath, P.H.A., Mair, N.S., Sharpe, M.E. and Holt, J.G. (Eds), Bergey s Manual of Systematic Bacteriology, Vol. 2. (Baltimore, USA: Williams and Wilkins), pp Murray, P.R., Baron, E.J., Jorgensen, J.H., Pfaller, M.A. and Yolken, R.H. (2003) Manual of Clinical Microbiology, (Wahington DC, USA: American Society for Microbiology). Normark, B.H. and Normark, S. (2002) Evolution and spread of antibiotic resistance. Journal of Internal Medicine 252: Olsson-Liljequist, B., Larsson, P., Walder, M. and Miorner, H. (1997) Antimicrobial susceptibility testing in Sweden. III. Methodology for susceptibility testing. Scandinavian Journal of Infectious Diseases 105: 13S-23S. Orberg, P.K. and Sandine, W.E. (1985) Survey of antimicrobial resistance in lactic streptococci. Applied and Environmental Microbiology 49: Perreten, V., Schwarz, F., Cresta, L., Boeglin, M., Dasen, G. and Teuber, M. (1997) Antibiotic resistance spread in food. Nature 389:

7 Antibiotic resistance in L.lactis and S. thermophilus 255 Perreten, V., Schwarz, F.V., Teuber, M. and Levy, S.B. (2001) Mdt(A), a new efflux protein conferring multiple antibiotic resistance in Lactococcus lactis and Escherichia coli. Antimicrobials Agents and Chemotherapy 45: Putman, M., van Veen, H.W., Degener, J.E. and Konings, W.N. (2001) The lactococcal secondary multidrug transporter LmrP confers resistance to lincosamides, macrolides, streptogramins and tetracyclines. Microbiology 147: Raha, A.R., Ross, E., Yusoff, K., Manap, M.Y. and Ideris, A. (2002) Characterisation and molecular cloning of an erythromycin resistance plasmid of Lactococcus lactis isolated from chicken cecum. Journal of Biochemistry, Molecular Biology and Biophysics 6: Reinbold, G.W. and Reddy, M.S. (1974) Sensitivity or resistance of dairy starter and associated microorganisms to selected antibiotics. Journal of Milk and Food Technology 37: Salyers, A.A., Shoemaker, N.B. and Bonheyo, G.T. (2002) The ecology of antibiotic resistance genes, In: Lewis, K., Salyers, A.A., Taber, H.W. and Wax, R.G. (Eds), Bacterial Resistance to Antimicrobials (New York: Marcel Dekker Inc), pp Salyers, A.A., Gupta, A. and Wang, Y. (2004) Human intestinal bacteria as reservoirs for antibiotic resistance genes. Trends in Microbiology 12: Smit, G., Smit, B.A. and Engels, W.J.M. (2005) Flavour formation by lactic acid bacteria and biochemical flavours profiling of cheese products. FEMS Microbiology Reviews 29: Su, Y.A., He, P. and Clewell, D.B. (1992) Characterization of the tet(m) determinant of Tn916: evidence for regulation by transcription attenuation. Antimicrobial Agents and Chemotherapy 36: Temmerman, R., Pot, B., Huys, G. and Swings, J. (2003) Identification and antibiotic susceptibility of bacterial isolates from probiotic products. International Journal of Food Microbiology 81: Teuber, M., Meile, L. and Schwarz, F. (1999) Acquired antibiotic resistance in lactic acid bacteria from food. Antonie van Leeuwenhoek 76: Tosi, L., Berruti, G., Danielsen, M., Wind, A., Huys, G., and Morelli, L. (2007) Susceptibility of Streptococcus thermophilus to antibiotics. Antonie van Leeuwenhoek 92: Witte, W. (2000) Selective pressure by antibiotic use in livestock. International Journal of Antimicrobial Agents 16: S19-S24.

8 256 Antibiotic resistance in L.lactis and S. thermophilus