Specificity of a Polymerase Chain Reaction Assay of a Target Sequence on the 31-Kilodalton Brucella Antigen DNA Used to Diagnose Human Brucellosis

Transcription

1 Eur J Clin Microbiol Infect Dis (2001) 20 : Q Springer-Verlag 2001 Note Specificity of a Polymerase Chain Reaction Assay of a Target Sequence on the 31-Kilodalton Brucella Antigen DNA Used to Diagnose Human Brucellosis M.C. Casañas, M.I. Queipo-Ortuño, A. Rodriguez-Torres, A. Orduña, J.D. Colmenero, P. Morata Abstract The aim of this study was to evaluate the specificity of a polymerase chain reaction assay for detecting Brucella DNA using primers specific for the amplification of a 223 bp region of the sequence encoding a 31 kda immunogenic Brucella abortus protein (BCSP31). DNA from all Brucella strains, including type, reference, vaccine and field strains, were correctly amplified. With the exception of Ochrobactrum spp., no other amplification was detected with a broad panel of microorganisms serologically or phylogenetically related to Brucella spp. This very good degree of specificity, together with its high yield demonstrated in previous clinical studies, confirms that this polymerase chain reaction assay could be a useful tool for the diagnosis of human brucellosis. Introduction Brucellosis is a zoonosis that produces severe morbidity in humans [1]. The disease exists worldwide and is endemic in some Mediterranean countries, where it represents an important public health problem. Because the clinical picture of brucellosis is nonspecific M.C. Casañas Microbiology Service, Carlos Haya Hospital, Malaga, Spain M.I. Queipo-Ortuño, P. Morata Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Malaga, Spain A. Rodriguez-Torres, A. Orduña Department of Microbiology, University Hospital, Faculty of Medicine, Valladolid, Spain J.D. Colmenero (Y) Infectious Diseases Unit, Department of Internal Medicine, Carlos Haya Hospital, Camino de Antequera s/n, Malaga, Spain colmene6interbook.net Tel.: c Fax: c and may show great variability, its diagnosis requires laboratory confirmation [2]. However, the laboratory diagnosis of brucellosis is hampered by the slow growth of Brucella spp. in culture and its danger to laboratory personnel [3]. Moreover, although serological tests are easy to perform, they suffer from a lack of specificity, which makes accurate detection of the illness particularly difficult in patients with a recent history of brucellosis, in patients with a suspected relapse, and in areas where the disease is endemic [4]. To date, few attempts to apply techniques of molecular biology to the diagnosis of human brucellosis have been made. Some studies have detected small amounts of Brucella DNA in pure cultures and animal samples by means of polymerase chain reaction (PCR) [5, 6]. Our group recently developed a one-step PCR technique consisting of the amplification of a fragment of 223 base pairs of an antigenic protein of Brucella abortus of 31 kda (BCSP31) using the B 4 and B 5 primers previously described by Baily et al. [7]. Those investigators tested the specificity of these primers in DNA extracted from Branhamella catarrhalis, Yersinia enterocolitica, Campylobacter jejuni, Enterobacter aerogenes, Haemophilus influenzae, Legionella pneumophila and Escherichia coli; no DNA amplification was detected. On the basis of Baily s results concerning primer specificity, we concentrated on optimizing the PCR technique for its use in peripheral blood samples and its diagnostic yield compared with microbiological tests conventionally used for the diagnosis of brucellosis, for post-treatment control and for early detection of relapses [8, 9]. Although the technique has been highly sensitive and specific in clinical studies [8, 9], the existence of the occasional false-positive result prompted us to carry out this study. Our aim was to verify the specificity of the technique using a wide panel of microorganisms serologically or phylogenetically related to Brucella

2 128 spp. and strains from patients with clinical pictures involving a differential diagnosis with brucellosis. Materials and Methods Bacterial Strains and Growth Conditions. The strains of Brucella spp. used in this study that are listed in Table 1 were provided by the Microbiology Department of the Faculty of Medicine at Valladolid University. In earlier studies, we used the vaccine strains B-19 and Rev-1 as positive controls; these strains were generously provided by the Agriculture Department of the Andalusian Regional Government [8, 9]. These strains were cultured on Brucella agar (Difco, USA) and incubated at 37 7C with 5% CO 2 for 48 h. Other bacteria, both with and without phylogenetic or antigenic relation to Brucella spp., were also tested (Tables 1 and 2). Neisseria meningitidis, Haemophilus influenzae and Francisella tularensis were cultured at 37 7C on chocolate agar with 10% CO 2 for h. Agrobacterium spp., Phyllobacterium spp. and Ochrobactrum anthropi were grown on blood agar (Difco) at 25 7C for 48 h and Yersinia enterocolitica on the same medium at 30 7C for 24 h. The strains of Mycobacterium tuberculosis were grown on Löwenstein-Jensen medium (Biomedics, Spain) at 37 7C for 3 4 weeks. Because it grows so slowly, the lyophilized Bartonella bacilliformis strain supplied by the Pasteur Institute Paris, France, was processed directly after reconstituting it in phosphate-buffered saline (PBS). Other bacteria used in this study were grown on blood agar (Difco) at 37 7C for 24 h. All organisms were harvested in NaCl 0.85% and the turbidity of bacterial suspensions was adjusted to a McFarland 1 3 standard. Brucella spp., Listeria monocytogenes, Francisella tularensis, Neisseria meningitidis, Salmonella spp. and Mycobacterium tuberculosis were killed with equal parts of pure acetone and NaCl 0.85% held in suspension at 40 7C overnight. Preparation of Genomic DNA. We used two methods of DNA extraction: salting out, as described by Miller et al. [10] and modified by us [8], and the standard method with phenol/chloroform/isoamyl alcohol for gram-positive bacteria and fungi. Extraction of Genomic DNA from Bacterial Cultures using the Salting-Out Method. This method involves salting out the cellular proteins obtained from the cellular lysate with proteinase K by dehydration and precipitation with a saturated (7.5 M) ammonium acetate solution. Bacterial cells were washed twice with PBS and pelleted by centrifugation. The pellet of gram-negative bacteria was resuspended in a solution containing 68 ml of 20 mg/ml lysozyme, 40 ml of 10% sodium dodecyl sulfate (SDS), 80 ml of lysis buffer (375 mm NH 4 Cl, 120 mm Na 2 -EDTA [ph 8.0]) and 157 ml of sterile Milli-Q water, then mixed and incubated for 30 min at 37 7C. For gram-positive bacteria and fungi, the solution contained 100 ml of 20 mg/ml lysozyme, 40 ml of 10% SDS, 80 ml of lysis buffer and 125 ml of sterile Milli-Q water. The incubation was performed for 1 h at 37 7C. Then, 40 ml of 10 mg/ ml proteinase K was added to each tube for both gram-negative and gram-positive bacteria, mixed gently by inverting the tubes several times and incubated for 30 min at 55 7C. Purification and precipitation of DNA was performed as previously reported [8]. Extraction of Genomic DNA from Gram-Positive Bacteria using the Phenol-Chloroform Method. Gram-positive bacteria suspensions were washed twice with PBS, pelleted by centrifugation, resuspended in 0.5 ml of TE buffer (10 mm Tris-HCl, 1 mm EDTA) and incubated at 37 7C for 1 h with 0.5% SDS and proteinase K (100 mg/ml). Cell-wall debris, polysaccharides and the remaining proteins were removed by selective precipitation with 7.5 M ammonium acetate and CTAB-NaCl solution and incubated at 65 7C for 10 min. DNA was extracted using a standard protocol with phenol-chloroform-isoamyl alcohol, precipitated with isopropanol, washed with 70% ethanol and dried. The DNA pellet was redissolved in 0.1 ml of sterile Milli-Q water and rehydrated overnight at room temperature. For both methods, the concentration and purity of the DNA were determined spectrophotometrically by readings at A 260 /A 280 nm. Samples were diluted up to 100 ng/ml and stored at 4 7C until use. After the DNA extraction, purification and measurement steps, most authors store it at 20 7C. However, throughout all our studies we have observed that when DNA is to be used as a sample for PCR, its yield is greater when stored at 4 7C than at 20 7C, even with prolonged storage times (8). DNA Amplification. This procedure was performed as we have previously described [8]. The primers B 4 (5b tggctcggttgccaatatcaa 3b) and B 5 (5b cgcgcttgcctttcaggtctg 3b) [7] generated a 223 bp product of the conserved region of the gene (nucleotides ), which encodes a protein of 31 kda Brucella abortus antigen. PCR was performed in a 50-ml mixture containing 100 ng template DNA, PCR buffer [10 mmtris-hcl (ph 8.4), 50 mm KCL, 1.0 mm MgCl 2 ], 100 nm of each PCR primer (Pharmacia LKB, Barcelona, Spain), 200 mm each deoxyribonucleoside triphosphate (dntps; Boehringer Mannheim, Germany) and 1.25 U Taq polymerase (Boehringer Mannheim). The reaction was performed in a DNA thermal cycler without mineral oil (Perkin-Elmer 2400; USA.). PCR consisted of preheating at 93 7C for 5 min, 35 cycles of 90 7C for 1 min, 60 7C for 30 s and 72 7C for 1 min, and incubation at 72 7C for 7 min. The PCR products were electrophoretically separated on agarose gel (2%) and stained with 2 mg/ml ethidium bromide to determine the size of the amplified products. Negative controls of PCR containing all of the reagents but lacking template DNA were routinely processed exactly as has been described to monitor for contamination with Brucella DNA. All were negative in all experiments. Positive controls with 100 ng of genomic DNA isolated from a suspension of Brucella abortus B-19 were included in each experiment. All PCR reactions were carried out in duplicate. A strain of Escherichia coli from our hospital was used as a control for the DNA extraction and contamination: its PCR was negative in all the experiments carried out. Results and Discussion The extraction and purification of DNA in our previous studies was made by salting out, with excellent yields in concentration and purity. We therefore decided to apply the same technique to all the microorganisms tested in the present study. A good yield was obtained for gram-negative bacteria for both concentration and purity with the salting-out method, although there was considerable variability in the amount of DNA for the different strains. With regard to the various Brucella strains, values of DNA above 100 mg/ml were obtained in all cases with a high degree of purity. On the other hand, the DNA obtained from the gram-positive microorganisms with the salting-out method was much less than that for the gram-negative organisms, even though we modified the original procedure by using higher concentrations of lysozyme and a longer incubation period. However, DNA extraction of gram-positive microorganisms with the phenol-chloroform method increased the yield considerably, although the purity was substantially reduced (data not shown).

3 Table 1 PCR results with DNA from different Brucella strains and from bacteria antigenically or genetically related to Brucella spp. Species (no. of isolates) Biovar Strain Origin PCR result Brucella melitensis 1 16 M FMV c Brucella melitensis 1 Rev 1 CAJA c Brucella melitensis 2 63/9 FMV c Brucella melitensis 3 Ether FMV c Brucella melitensis (5) 2 FMV (clinical strain) c Brucella melitensis (6) 3 FMV (clinical strain) c Brucella abortus (2) 1 FMV (clinical strain) c Brucella abortus 1 B19 CAJA c Brucella abortus 2 86/8/59 FMV c Brucella abortus 3 Tulya FMV c Brucella abortus FMV c Brucella abortus 5 B3196 FMV c Brucella abortus FMV c Brucella abortus 7 63/75 FMV c Brucella abortus 9 C/68 FMV c Brucella suis FMV c Brucella suis FMV c Brucella suis FMV c Brucella suis 4 40 FMV c Brucella suis FMV c Brucella neotomae FMV c Brucella ovis Reo198 FMV c Brucella canis FMV c Antigenically related bacteria Escherichia coli O:157 CECT P Francisella tularensis H: 7 FMV P Pasteurella multocida CECT P Salmonella urbana CECT P Yersinia enterocolitica O:9 FFG P Genetically related bacteria Agrobacterium radiobacter CECT P Agrobacterium tumefaciens CECT P Agrobacterium vitis CECT P Bartonella bacilliformis IP P Ochrobactrum intermedium 3301 FMN c Ochrobactrum anthropi 3331 FMN c Ochrobactrum anthropi CECT c Ochrobactrum anthropi HCH P Phyllobacterium myrsincearum CECT P Phyllobacterium rubiacearum CECT P Vibrio cholerae CECT P 129 FMV, Facultad de Medicina Valladolid, Valladolid, Spain; CAJA, Consejeria de Agricultura, Junta de Andalucia, Seville, Spain; CECT, Colección Española de Cultivos Tipo, Valencia, Spain; FFG, Facultad de Farmacia de Granada, Granada, Spain; FMN, Facultad de Medicina de Navarra, Pamplona, Spain; IP, Institut Pasteur, Paris, France; HCH, Hospital Carlos Haya, Málaga, Spain All strains of Brucella spp. showed clear amplification of the DNA with the PCR we developed (Table 1). These results, therefore, support those obtained previously by DNA-DNA hybridization and different PCR assays using primers specific for the genes encoding different Brucella proteins and 16S rrna [11, 12]. With the exception of Ochrobactrum spp., no similar amplification products were detected in any microorganisms related genetically or antigenically to Brucella spp. (Table 1). No cross-reactions were found using a wide panel of microorganisms. The panel included intracellular bacteria, some of which show a clear tendency to cause bacteraemia, as well as others that are able to produce a clinical picture involved in the differential diagnosis of brucellosis (Table 2). The panel of microorganisms against which our PCR assay was tested is the widest studied to date and included a strain of Bartonella spp. related phylogenetically to Brucella spp. that has not yet been studied. These data reflect the high specificity of this PCR assay and to some extent explain the low rate of false-positive results found in clinical studies in which it has been tried [8, 9]. The existence of a cross-reaction with Ochrobactrum spp. in our PCR assay is not surprising if we consider that Ochrobactrum spp. is the closest known relative of

4 130 Table 2 PCR results with DNA from other non-brucella organisms Organisms (no. of isolates) Source PCR result Acinetobacter baumannii (2) HCH Alcaligenes denitrificans (1) CECT Aeromonas hydrophila (1) CECT Aeromonas sobria (1) HCH Bacillus cereus (1) CECT Bacillus megaterium (1) CECT Bacillus subtilis (1) CECT Bacteroides fragilis (2) HCH Bordetella bronchiseptica (1) CECT Campylobacter spp. (2) HCH Candida albicans (2) HCH Candida glabrata (2) HCH Candida guillermondii (1) HCH Candida humicola (1) HCH Citrobacter freundii (1) HCH Corynebacterium spp. (1) HCH Enterobacter aerogenes (1) HCH Enterobacter cloacae (1) HCH Enterococcus faecalis (2) HCH Enterococcus faecium (1) HCH Escherichia coli (4) HCH Haemophilus influenzae (2) HCH Klebsiella pneumoniae (2) HCH Listeria monocytogenes (1) CECT Morganella morganii (1) HCH Mycobacterium tuberculosis (5) HCH Neisseria meningitidis (2) HCH Proteus mirabilis (2) HCH Providencia stuartii (1) HCH Pseudomonas aeruginosa (2) HCH Pseudomonas cepacia (1) HCH Salmonella spp. (2) HCH Serratia marcescens (2) HCH Shigella dysenteriae (1) CECT Staphylococcus aureus (2) HCH Staphylococcus epidermidis (2) HCH Staphylococcus haemolyticus (2) HCM Stenotrophomonas maltophilia (1) HCH Streptococcus agalactiae (2) HCH Streptococcus pneumoniae (2) HCH Streptococcus pyogenes (1) HCH CECT, Colección Española de Cultivos Tipo, Valencia, Spain; HCH, Hospital Carlos Haya, Málaga, Spain brucellae. In fact, Velasco et al. [13] assessed this relatedness by whole-cell protein profiling, immunological methods and 16S rrna sequence analysis. Da Costa et al. [11] and Romero et al. [12] have reported similar results using PCR assays with different DNA targets specific to Brucella genus. Three of the four strains of Ochrobactrum tested gave positive results: LMG 3301, now redenominated Ochrobactrum intermedium, LMG 3331 and CECT However, the DNA from a clinical strain of Ochrobactrum spp. from a specimen collected in our hospital gave a negative result. This strain was finally identified as Ochrobactrum anthropi and was from a patient with end-stage renal disease. The patient had a peritoneal infection and was undergoing ambulatory peritoneal dialysis. The reason for this negative result is not completely clear, though it could be related to the presumed heterogeneity existing in strains of Ochrobactrum anthropi. Recent studies have shown greater genetic similarity between Brucella spp. and Ochrobactrum intermedium than between Brucella spp. and Ochrobactrum anthropi. This observation would explain why Ochrobactrum intermedium always gave positive PCR results in our study, and in others, whereas amplification of the strains of Ochrobactrum anthropi has given variable results [11, 12]. We wondered how this cross-reaction might affect the molecular diagnosis of brucellosis by means of PCR. Ochrobactrum spp., formerly in CDC group Vd, comprises a group of ubiquitous microorganisms that appear to be distributed worldwide [14]. Although its ecology is not well known, it has been isolated from soil, water, multiple hospital materials and different clinical specimens, and it may be part of the normal flora of the large intestine. Although this microorganism would seem to occupy a microbial niche similar to that of Pseudomonas aeruginosa, its pathogenic role remains poorly understood. Since Ochrobactrum infection was first reported in the form of a pancreatic abscess in 1980 [15], only 40 cases have been described in the literature. Almost all cases occurred in severely immunosuppressed patients or those with debilitating illnesses. The infections were nosocomial, occurring in patients with catheters or other foreign bodies [16, 17]. Thus, from a clinical point of view, this scenario is very different compared with infection with Brucella spp. With the exception of infections that occur in laboratory personnel, Brucella infection is always communityacquired and generally affects immunocompetent subjects. Since 1997, when we first started to work with this PCR assay, none of the 9,735 clinically relevant cases of bacteraemia detected in our hospital had been caused by Ochrobactrum spp. Only 3 (0.0001%) of 24,471 isolates from other nonblood clinical samples were identified as Ochrobactrum spp.; all three were from two patients undergoing peritoneal dialysis. For these reasons, we agree with others [12] that cross-reaction between Brucella spp. and Onchrobactrum spp. in PCR is unlikely and is of little clinical relevance. Acknowledgements This research was supported by funds from the Comisión Interministerial de Ciencia y Tecnología (CICYT) Spain, and the European Commision (FEDER): Ref. 1FD We also thank I. Johnstone for his help translating the text. References 1. Matyas Z, Fujikura T: Brucellosis as a world problem. Developments in Biological Standardization (1984) 56: Colmenero JD, Reguera JM, Martos F, Sanchez-Mora D, Delgado M, Causse M, Martin-Farfan A, Juarez C: Complications associated with Brucella melitensis infection: a study of 530 cases. Medicine (Baltimore) (1996) 75 :

5 Yagupsky P: Detection of Brucella melitensis by BACTEC NR660 blood culture system. Journal of Clinical Microbiology (1994) 32: Ariza J, Pellicer T, Pallarés R, Foz A, Gudiol F: Specific antibody profile in human brucellosis. Clinical Infectious Diseases (1992) 14: Leal-Klevezas D, Martinez-Vazquez IO, Lopez-Merino A, Martinez-Soriano JP: Single-step PCR for detection of Brucella spp. from blood and milk of infected animals. Journal of Clinical Microbiology (1995) 33: Matar GM, Khneisser IA, Abdelnoor AM: Rapid laboratory confirmation of human brucellosis by PCR analysis of a target sequence on the 31-kilodalton Brucella antigen DNA. Journal of Clinical Microbiology (1996) 34 : Baily GG, Krahn JB, Drasar BS, Stoker NG: Detection of Brucella melitensis and Brucella abortus by DNA amplification. Journal of Tropical Medicine and Hygiene (1992) 95: Queipo-Ortuño MI, Morata P, Ocon P, Manchado P, Colmenero JD: Rapid diagnosis of human brucellosis by peripheral blood PCR assay. Journal of Clinical Microbiology (1997) 35: Morata P, Queipo-Ortuño MI, Reguera JM, Garcia-Ordoñez MA, Pichardo C, Colmenero JD: Posttreatment follow-up of brucellosis by PCR assay. Journal of Clinical Microbiology (1999) 37: Miller SA, Dykes DD, Polesky HF: A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Research (1988) 16: Da Costa M, Guillou JP, Garin-Bastuji B, Thiébaud M, Dubray G: Specificity of six gene sequences for the detection of the genus Brucella by DNA amplification. Journal of Applied Bacteriology (1996) 81: Romero C, Gamazo C, Pardo M, López-Goñi I: Specific detection of Brucella DNA by PCR. Journal of Clinical Microbiology (1995) 33 : Velasco J, Romero C, López-Goñi I, Leiva J, Diaz R, Moriyon I: Evaluation of the relatedness of Brucella spp. and Ochrobactrum anthropi and description of Ochrobactrum intermedium sp. nov., a new species with a closer relationship to Brucella spp. International Journal of Systematic Bacteriology (1998) 48: Holmes B, Popoff M, Kiredjian M, Kersters K: Ochrobactrum anthropi gen. nov., sp. nov. from human clinical specimens and previously known as group Vd. International Journal of Systematic Bacteriology (1988) 38 : Appelbaum PC, Campbell DB: Pancreatic abscess associated with Achromobacter group Vd, biovar 1. Journal of Clinical Microbiology (1980) 12 : Ezzedine H, Mourad M, van Ossel C, Logghe C, Squifflet JP, Renault F, Wauters G, Gigi J, Wilmotte L, Haxhe JJ: An outbreak of Ochrobactrum anthropi bacteremia in five organ transplant patients. Journal of Hospital Infection (1994) 27: Gransden WR, Eykyn SJ: Seven cases of bacteremia due to Ochrobactrum anthropi. Clinical Infectious Diseases (1992) 15: