Study Type of PCR Primers Identified microorganisms
|
|
|
- Andrew Ferguson
- 5 years ago
- Views:
Transcription
1 Study Type of PCR Primers Identified microorganisms Portillo et al, Marín et al, Jacovides et al, Real-time multiplex PCR (SeptiFasta, Roche Diagnostics) 16S rr gene was amplified using conventional PCR. GeneAmp PCR system 9700 (Applied Biosystems Inc.) Deep 16S rr gene sequencing with use of a sequencing system from 454 Life Sciences (Branford, Connecticut). fd1 (forward, 5=-AGAGTTTGATCCTGGCTCAG-3=) rp2 (reverse, 5=-ACGGCTACCTTGTTACGACTT-3=) GloF (forward, 5=-GAAGAGCCAAGGACAGGTAC-3=) GloR (reverse, 5=-GGAAAATAGACCAATAGGCAG-3=) Enterobacter spp. Klebsiella spp. Proteus spp. Coagulase-negative staphylococci S. aureus Enterococcus spp. S. aureus CoNSa/Staphylococcus epidermidis Enterococcus faecalis Streptococcus agalactiae Streptococcus viridans Proteus mirabilis Pseudomonas aeruginosa Propionibacterium acnes Other anaerobes Acinetobacter Campylobacter Candida Cladosporium Corynebacterium Enterococcus Klebsiella Mycoplasma Peptostreptococcus
2 Propionibacterium Pseudomonas Staphylococcus Streptococcus Treponema Other Gomez et al, 16S rr gene real-time PCR using the LightCycler 2.0 instrument (Roche Molecular Diagnostics, Indianapolis, IN) 16S rr gene V3-V4 region(forward- 5 -CGG-CCC-AGA-CTC-CTA-CGG-GAG-GCA140 GCA-3 and reverse - 5 -GCG-TGG-ACT-ACC-AGG-GTA-TCT-AAT-CC-3 ) Streptococcus sp CNS Enterococcus sp. Pseudomonas sp. F. magna S.aureus P. melaninogenica Corynebacterium sp. Pandoraea norinbergensis E. faecalis Staphylococcus lugdunensis Actinomyces neuii GPB Serratia marcescens S. aureus S. epidermidis S. warneri S. hominis S. lugdunensis S. pyogenes M. abscessus E. aerogenes B. fragilis Esteban et al, PCR-based amplification of a fragment from the 16 rr gene using the GenoType commercial system BC Grampositive and BC Gramnegative (Hain Lifescience GmbH, Nehren, Germany)
3 P. aeruginosa K. pneumoniae E. coli R. picketti Burkholderia sp. S. maltophilia Pasteurella sp. Prevotella sp. Candida sp. A. terreus Staphylococcus aureus Methicillin-resistant Staphylococcus aureus Staphylococcus epidermidis Staphylococcus saprophyticus Listeria monocytogenes Enterococcus faecalis Streptococcus pneumoniae Streptococcus pyogenes Streptococcus agalactiae Streptococcus oralis Citrobacter freundii Proteus mirabilis Pseudomonas aeruginosa Acinetobacter baumannii Staphylococcal Bergin et al, 2010 Conserved 16S rr primers were used as a universal screen for bacterial infection and iscript one-step RT-PCR Kit with SYBR Green on an icycler Thermal Cycler (Bio-Rad, Hercules, California). 387-base-pair segment(forward 5 -ATTAGATACCCTGGTAGTCCACGCC- 3 and reverse 5 -CGTCATCCCCACCTTCCTCC-3 ) Group-A Streptococcus (forward 5 -AATACCGCATAAGAGAGACTAACG-3 and reverse 5 -CTCGCTAGAGTGCCCAACTTA-3 ) Group-B Streptococcus ((forward 5 -CTTTCTCTTCGGAGCAGAA-3 and reverse 5 -CTCGCTAGAGTGCCCAACTTA-3 ) Alpha-hemolytic Streptococcus (forward 5 -GTGAGAGTGGAAAGTTCACACTGT-3 and reverse 5 -AGCCTTTAACTTCAGACTTATCTAAC-3 ) Piper et al, 2009, Staphylococcal and rapid-cycle real-time LightCycler PCR. Staphylococcal: targeting tuf : PArA-1 (5 -AAGCG
4 Kobayashi et al, 2009 Kobayashi et al, 2008 Gallo et al, 2008 Moojen et al, 2007 Panousis et al, 2005 Tunney et al, 1999 RT-PCR using the LightCycler system (Roche Diagnostics, Mannheim, Germany). Methicillin-resistant Staphylococcus aureus-specific detection kit (Roche Diagnostics) and broad range detection by universal PCR that targeted a part of the 16S rr gene. Universal PCR PCR assay targeting the 16S rd gene TGAGTGACGGTAATGGGTA-3 and PArA-2 (5 -CCACCATAACGTGCTGGCAACAGT-3 ) Staphylococcus: regions of the tuf gene; S. aureus: (5 -GGCGATGCTCAATACGAAGAAAAAA TC-FITC-3 and 5 -LCRed705-AGA ATCAATGGAAGCTGTAGATAC-phosphate-3 ) (forward primer RW01: 5 AACTGGAGGAAGGTGGGGAT 3 ; reverse primer DG74: 5 TGCGGTTGGATCACCTCCT 3 ) PCR of the 16S rr Gene PCR of the 16S rr Gene PCR of the 16S rr Gene D1(5 -GAGGAAGGTRGGGAYGACGT) D2 (5 -AGGCCC GGGAACGYATTYACCG) Methicillin-resistant Staphylococcus aureus Staphylococcus epidermidis Staphylococcal Staphylococcal Staphylococcus Streptococcus viridans Streptococcus mitis Streptococcus Candida Enterococcus Diphtheroids S. capitis S. epidermidis Staphylococcus haemolyticus Micrococcus agilis
5 B. fragilis E. coli Peptostreptococcus sp. Mariani et al, 1996 PCR of the 16S rr Gene 5' was CGGCAGGCCTAACACATGCAAGTCG; 3' was GGTTGCGGCCGTACTCCCCAGG. Table S1 The information of PCR.
6 FIG. S1 Funnel plots for included studies
C&W Three-Year Cumulative Antibiogram January 2013 December 2015
C&W Three-Year Cumulative Antibiogram January 213 December 215 Division of Microbiology, Virology & Infection Control Department of Pathology & Laboratory Medicine Contents Comments and Limitations...
Aberdeen Hospital. Antibiotic Susceptibility Patterns For Commonly Isolated Organisms For 2015
Aberdeen Hospital Antibiotic Susceptibility Patterns For Commonly Isolated s For 2015 Services Laboratory Microbiology Department Aberdeen Hospital Nova Scotia Health Authority 835 East River Road New
INFECTIOUS DISEASES DIAGNOSTIC LABORATORY NEWSLETTER
INFECTIOUS DISEASES DIAGNOSTIC LABORATORY NEWSLETTER University of Minnesota Health University of Minnesota Medical Center University of Minnesota Masonic Children s Hospital May 2017 Printed herein are
Table 1. Commonly encountered or important organisms and their usual antimicrobial susceptibilities.
Table 1. Commonly encountered or important organisms and their usual antimicrobial susceptibilities. Gram-positive cocci: Staphylococcus aureus: *Resistance to penicillin is almost universal. Resistance
4 th and 5 th generation cephalosporins. Naderi HR Associate professor of Infectious Diseases
4 th and 5 th generation cephalosporins Naderi HR Associate professor of Infectious Diseases Classification Forth generation: Cefclidine, cefepime (Maxipime),cefluprenam, cefoselis,cefozopran, cefpirome
Recommendations Regarding Use of Rapid Blood Pathogen Identification Panel Data
Recommendations Regarding Use of Rapid Blood Pathogen Identification Panel Data Trevor Van Schooneveld MD, Scott Bergman, PharmD, BCPS, Paul Fey, PhD, Mark Rupp, MD The Clinical Microbiology laboratory
2012 ANTIBIOGRAM. Central Zone Former DTHR Sites. Department of Pathology and Laboratory Medicine
2012 ANTIBIOGRAM Central Zone Former DTHR Sites Department of Pathology and Laboratory Medicine Medically Relevant Pathogens Based on Gram Morphology Gram-negative Bacilli Lactose Fermenters Non-lactose
Pathogens commonly isolated from selected diseases
Pathogens commonly isolated from selected diseases Equine pneumonia/pleuropneumonia -hemolytic Strep. Clostridium Pasteurella E. coli Klebsiella pneumoniae Bacteroides Equine enteric pathogens Salmonella
Guidelines for Laboratory Verification of Performance of the FilmArray BCID System
Guidelines for Laboratory Verification of Performance of the FilmArray BCID System Purpose The Clinical Laboratory Improvement Amendments (CLIA), passed in 1988, establishes quality standards for all laboratory
TECHNICAL BULLETIN PURELL Advanced with Aloe Instant Hand Sanitizer
TECHNICAL BULLETIN PURELL Advanced with Aloe Instant Hand Sanitizer INDICATIONS: Hand sanitizer to help reduce bacteria on the skin that could cause disease. Recommended for repeated use. DIRECTIONS: Place
2015 Antibiogram. Red Deer Regional Hospital. Central Zone. Alberta Health Services
2015 Antibiogram Red Deer Regional Hospital Central Zone Alberta Health Services Introduction. This antibiogram is a cumulative report of the antimicrobial susceptibility rates of common microbial pathogens
BACTERIAL SUSCEPTIBILITY REPORT: 2016 (January 2016 December 2016)
BACTERIAL SUSCEPTIBILITY REPORT: 2016 (January 2016 December 2016) VA Palo Alto Health Care System April 14, 2017 Trisha Nakasone, PharmD, Pharmacy Service Russell Ryono, PharmD, Public Health Surveillance
2017 Antibiogram. Central Zone. Alberta Health Services. including. Red Deer Regional Hospital. St. Mary s Hospital, Camrose
2017 Antibiogram Central Zone Alberta Health Services including Red Deer Regional Hospital St. Mary s Hospital, Camrose Introduction This antibiogram is a cumulative report of the antimicrobial susceptibility
2016 Antibiogram. Central Zone. Alberta Health Services. including. Red Deer Regional Hospital. St. Mary s Hospital, Camrose
2016 Antibiogram Central Zone Alberta Health Services including Red Deer Regional Hospital St. Mary s Hospital, Camrose Introduction This antibiogram is a cumulative report of the antimicrobial susceptibility
RCH antibiotic susceptibility data
RCH antibiotic susceptibility data The following represent RCH antibiotic susceptibility data from 2008. This data is used to inform antibiotic guidelines used at RCH. The data includes all microbiological
Microbial DNA qpcr Array Respiratory Infections
Microbial DNA qpcr Array Respiratory Infections Cat. no. 330261 BAID-1404ZRA For real-time PCR-based, application-specific microbial identification or profiling The Respiratory Infections Microbial DNA
2010 ANTIBIOGRAM. University of Alberta Hospital and the Stollery Children s Hospital
2010 ANTIBIOGRAM University of Alberta Hospital and the Stollery Children s Hospital Medical Microbiology Department of Laboratory Medicine and Pathology Table of Contents Page Introduction..... 2 Antibiogram
QUICK REFERENCE. Pseudomonas aeruginosa. (Pseudomonas sp. Xantomonas maltophilia, Acinetobacter sp. & Flavomonas sp.)
Pseudomonas aeruginosa (Pseudomonas sp. Xantomonas maltophilia, Acinetobacter sp. & Flavomonas sp.) Description: Greenish gray colonies with some beta-hemolysis around each colony on blood agar (BAP),
SYMMETRY FOAMING HAND SANITIZER with Aloe & Vitamin E Technical Data
508 SYMMETRY FOAMING HAND SANITIZER with Aloe & Vitamin E Technical Data Physical Properties Active Ingredient: Ethyl Alcohol 62% (70% v/v) Appearance: Clear, Colorless Solution Fragrance: Floral Form:
2009 ANTIBIOGRAM. University of Alberta Hospital and the Stollery Childrens Hospital
2009 ANTIBIOGRAM University of Alberta Hospital and the Stollery Childrens Hospital Division of Medical Microbiology Department of Laboratory Medicine and Pathology 2 Table of Contents Page Introduction.....
microbiology testing services
microbiology testing services You already know Spectra Laboratories for a wide array of dialysis-related testing services. Now get to know us for your microbiology needs. As the leading provider of renal-specific
Vitek QC Sets. Vitek 2 Identification QC Sets
Vitek 2 Identification QC Sets MicroBioLogics is selling two types of Vitek 2 microorganism identification sets. They are listed below in two columns. The first column lists the 2008 quality control microorganisms
Finnzymes Oy. PathoProof Mastitis PCR Assay. Real time PCR based mastitis testing in milk monitoring programs
PathoProof TM Mastitis PCR Assay Mikko Koskinen, Ph.D. Director, Diagnostics, Finnzymes Oy Real time PCR based mastitis testing in milk monitoring programs PathoProof Mastitis PCR Assay Comparison of the
MASTITIS DNA SCREENING
Trusted Dairy Laboratory Services for more than 75 years MASTITIS DNA SCREENING Short Reference Guide Eurofins DQCI 5205 Quincy Street, Mounds View, MN 55112 P: 763-785-0484 F: 763-785-0584 E: DQCIinfo@eurofinsUS.com
Cleaning and Disinfection Protocol Vegetative Bacteria
Cleaning and Disinfection Protocol Vegetative Bacteria This document has been developed in accordance with current applicable infection control and biosecurity guidelines. It is intended for use as a guideline
MOXICIP Eye Ointment (Moxifloxacin 0.5%)
Published on: 19 Sep 2014 MOXICIP Eye Ointment (Moxifloxacin 0.5%) Composition Moxifloxacin 0.5% (5 mg/ml) Dosage Form Ophthalmic Ointment Pharmacology Pharmacodynamics Moxifloxacin is a member of the
Antibiotic. Antibiotic Classes, Spectrum of Activity & Antibiotic Reporting
Antibiotic Antibiotic Classes, Spectrum of Activity & Antibiotic Reporting Any substance of natural, synthetic or semisynthetic origin which at low concentrations kills or inhibits the growth of bacteria
Cleaning and Disinfection Protocol for Gram-Negative and Gram-Positive Bacteria, including Antibiotic Resistant Bacteria
Cleaning and Disinfection Protocol for Gram-Negative and Gram-Positive Bacteria, including Antibiotic Resistant Bacteria This document has been developed in accordance with current applicable infection
IV Antibiotics for Lyme Disease (Ceftriaxone, Cefotaxime sodium, Doxycycline, Penicillin G potassium)
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.01.15 Subject: IV Antibiotics Lyme Disease Page: 1 of 9 Last Review Date: November 30, 2018 IV Antibiotics
Fundamental Concepts in the Use of Antibiotics. Case. Case. TM is a 24 year old male admitted to ICU after TBI and leg fracture from MVA ICU day 3
Fundamental Concepts in the Use of Antibiotics Todd Miano, PharmD, MSCE Critical Care Pharmacist Pharmacoepidemiology Fellow Perelman School of Medicine at the University of Pennsylvania Case TM is a 24
REDUCTION IN THE BACTERIAL LOAD
Session 267 PresentaGon 2300 REDUCTION IN THE BACTERIAL LOAD ON THE SKIN IN A CLINICAL SETTING David W. Stroman Co-authors: K. Mintun, A. Epstein, C. Brimer, C. Patel, J. Branch, K. Najafi The Skin Microbiome
3 Infection Prevention Solutions
3 Infection Prevention Solutions 3M DuraPrep Surgical Solution Nothing is faster, easier or more effective. We can all make a difference. Fast Not only did 3M design an applicator that is fast to activate
HOSPITAL-ACQUIRED INFECTIONS AND QASM PATIENTS
Royal Australasian College of Surgeons Queensland Audit of Surgical Mortality (QASM) HOSPITAL-ACQUIRED INFECTIONS AND QASM PATIENTS (JULY 2011 TO JUNE 2016) Contact Queensland Audit of Surgical Mortality
Drug Class Prior Authorization Criteria Intravenous Antibiotics
Drug Class Prior Authorization Criteria Intravenous Antibiotics Line of Business: Medicaid P&T Approval Date: August 15, 2018 Effective Date: October 1, 2018 This drug class prior authorization criteria
Validation of the PathoProof TM Mastitis PCR Assay for Bacterial Identification from Milk Recording Samples
Validation of the PathoProof TM Mastitis PCR Assay for Bacterial Identification from Milk Recording Samples Mikko Koskinen, Ph.D. Finnzymes Oy Benefits of using DHI samples for mastitis testing Overview
Page 1 of 9. Moxifloxacin Ophthalmic Solution USP, 0.5% Sterile topical ophthalmic solution Initial U.S. Approval: 1999
HIGHLIGHTS OF PRESCRIBING INFORMATION These highlights do not include all the information needed to use Moxifloxacin Ophthalmic Solution USP safely and effectively. See full prescribing information for
Monitoring of AMR in Russia
Monitoring of AMR in Russia Surveillance studies conducted by Institute of Antimicrobial Chemotherapy (IAC) Centre for Monitoring of Antimicrobial Resistance (CMAR) Prospective surveillance studies on
2015 Antibiotic Susceptibility Report
Citrobacter freundii Enterobacter aerogenes Enterobacter cloacae Escherichia coli Haemophilus influenzenza Klebsiella oxytoca Klebsiella pneumoniae Proteus mirabilis Pseudomonas aeruginosa Serratia marcescens
CUMULATIVE ANTIBIOGRAM
BC Children s Hospital and BC Women s Hospital & Health Centre CUMULATIVE ANTIBIOGRAM 2017 Division of Medical Microbiology Department of Pathology and Laboratory Medicine Page 1 of 5 GRAM-POSITIVE BACTERIA
In Vitro Susceptibility to Pexiganan of Bacteria Isolated from Infected Diabetic Foot Ulcers
In Vitro Susceptibility to Pexiganan of Bacteria Isolated from Infected Diabetic Foot Ulcers Yigong Ge, Dorothy MacDonald, Marietta M. Henry, Howard I. Hait, Kimberly A. Nelson, Benjamin A. Lipsky, Michael
In Vitro Antibacterial Properties of Pexiganan, an Analog of Magainin
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 1999, p. 782 788 Vol. 43, No. 4 0066-4804/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. In Vitro Antibacterial Properties
Classification of Bacteria
Classification of Bacteria MICROBIOLOGY -TAXONOMY Taxonomy is the system to classify living organisms Seven groups kingdom, phylum or div, class, order, family, genus, species Binomial system of nomenclature
2016 Antibiotic Susceptibility Report
Fairview Northland Medical Center and Elk River, Milaca, Princeton and Zimmerman Clinics 2016 Antibiotic Susceptibility Report GRAM-NEGATIVE ORGANISMS 2016 Gram-Negative Non-Urine The number of isolates
Concise Antibiogram Toolkit Background
Background This toolkit is designed to guide nursing homes in creating their own antibiograms, an important tool for guiding empiric antimicrobial therapy. Information about antibiograms and instructions
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Bennett-Guerrero E, Pappas TN, Koltun WA, et al. Gentamicin
CONTAGIOUS COMMENTS Department of Epidemiology
VOLUME XXIX NUMBER 3 November 2014 CONTAGIOUS COMMENTS Department of Epidemiology Bugs and Drugs Elaine Dowell SM MLS (ASCP), Marti Roe SM MLS (ASCP), Sarah Parker MD, Jason Child PharmD, and Samuel R.
Leveraging the Lab and Microbiology Department to Optimize Stewardship
Leveraging the Lab and Microbiology Department to Optimize Stewardship Presented by: Andrew Martinez MLS(ASCP), MT(AMT), MBA Alaska Native Medical Center Microbiology Supervisor Maniilaq Health Center
Cipro for gram positive cocci in urine
Buscar... Cipro for gram positive cocci in urine 20-6-2017 Pneumonia can be generally defined as an infection of the lung parenchyma, in which consolidation of the affected part and a filling of the alveolar
Moxifloxacin has been shown to be active against most strains of the following microorganisms, both in vitro and in clinical infections as:
BASILOX 0.5% Composition Moxifloxacin 0.5% (5 mg/ml) Eye Drops Action BASILOX 0.5 Eye Drops contains the fourth-generation fluoroquinolone, Moxifloxacin. Moxifloxacin has in vitro activity against a wide
CONTAGIOUS COMMENTS Department of Epidemiology
VOLUME XXIII NUMBER 1 July 2008 CONTAGIOUS COMMENTS Department of Epidemiology Bugs and Drugs Elaine Dowell, SM (ASCP), Marti Roe SM (ASCP), Ann-Christine Nyquist MD, MSPH Are the bugs winning? The 2007
RAPID IDENTIFICATION OF RESISTANCE MECHANISMS
RAPID IDENTIFICATION OF RESISTANCE MECHANISMS Christine C. Ginocchio, PhD, MT (ASCP) Professor of Medicine, Hofstra North Shore-LIJ School of Medicine, NY VP, Global Microbiology Affairs, biomerieux VP,
17June2017. Parampal Deol, Ph.D, MBA Senior Director, R&D Microbiology North America
RAPID DETECTION OF BACTERIAL CONTAMINANTS IN PLATELET COMPONENTS: COMPARISON OF TIME TO DETECTION BETWEEN THE BACT/ALERT 3D AND THE BACT/ALERT VIRTUO SYSTEMS. 17June2017 Parampal Deol, Ph.D, MBA Senior
Epidemiology and Microbiology of Surgical Wound Infections
JOURNAL OF CLINICAL MICROBIOLOGY, Feb. 2000, p. 918 922 Vol. 38, No. 2 0095-1137/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Epidemiology and Microbiology of Surgical
Liofilchem. ID-AST systems
Liofilchem ID-AST systems Systems for ID and AST directly from clinical specimens page 1 Integral Systems for ID and AST from isolated colonies page 4 Systems for ID from isolated colonies page 6 Systems
MicroScan LabPro Information Manager
MicroScan LabPro Information Manager Antibiogram Export Tool Instructions Single Institution Format 2016 For use with LabPro version v4.42 Creating an Antibiogram from LabPro Data CLSI M39-A4 recommends
Research Article Susceptibility Pattern of Isolates from Surgical Ward Patients of A Tertiary Care Referral Hospital, Rawalpindi, Pakistan
Cronicon OPEN ACCESS MICROBIOLOGY Research Article Susceptibility Pattern of Isolates from Surgical Ward Patients of A Tertiary Care Referral Hospital, Rawalpindi, Umer Shujat*, Aamer Ikram, Shahid A Abbasi,
HPN HOSPITALIZED PNEUMONIA APPLICATION
HPN HOSPITALIZED PNEUMONIA APPLICATION Investigational Use. Not available for Sale in the United States. Content UNYVERO HPN HOSPITALIZED PNEUMONIA APPLICATION The Unyvero HPN Pneumonia Application combines
Help with moving disc diffusion methods from BSAC to EUCAST. Media BSAC EUCAST
Help with moving disc diffusion methods from BSAC to EUCAST This document sets out the main differences between the BSAC and EUCAST disc diffusion methods with specific emphasis on preparation prior to
In Vitro Antimicrobial Activity of CP-99,219, a Novel Azabicyclo-Naphthyridone
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Feb. 993, p. 39-353 0066-0/93/0039-05$0.00/0 Copyright 993, American Society for Microbiology Vol. 37, No. In Vitro Antimicrobial Activity of, a Novel Azabicyclo-Naphthyridone
Antimicrobial Susceptibility Summary 2011
Antimicrobial Susceptibility Summary 2011 Clinical Microbiology Department of Pathology & Laboratory Medicine 45 Antimicrobial Susceptibility Summary Clinical Microbiology Department of Pathology and Laboratory
Antimicrobial susceptibility testing challenges. Linda Joyce St Vincent s Hospital Melbourne
Antimicrobial susceptibility testing challenges Linda Joyce St Vincent s Hospital Melbourne Bacteria/antimicrobials without breakpoints (B.A.W.B.S.) Enterobacteriacae Pseudomonas aeruginosa, Acinetobacter
CultiControl. Technical Sheet 01
CultiControl Technical Sheet 01 CultiControl freeze-dried microorganisms Packaging: 1 vial containing 5 pellets Non-enumerated CFU Applications: Culture purposes, QC of ID devices, QC of AST devices Quanti-CultiControl
Mercy Medical Center Des Moines, Iowa Department of Pathology. Microbiology Department Antibiotic Susceptibility January December 2016
Mercy Medical Center Des Moines, Iowa Department of Pathology Microbiology Department Antibiotic Susceptibility January December 2016 These statistics are intended solely as a GUIDE to choosing appropriate
Advanced Practice Education Associates. Antibiotics
Advanced Practice Education Associates Antibiotics Overview Difference between Gram Positive(+), Gram Negative(-) organisms Beta lactam ring, allergies Antimicrobial Spectra of Antibiotic Classes 78 Copyright
Supplemental Information. Discovery of Reactive Microbiota-Derived. Metabolites that Inhibit Host Proteases
Cell, Volume 168 Supplemental Information Discovery of Reactive Microbiota-Derived Metabolites that Inhibit Host Proteases Chun-Jun Guo, Fang-Yuan Chang, Thomas P. Wyche, Keriann M. Backus, Timothy M.
Principles of Antibiotics Use & Spectrum of Some
Principles of Antibiotics Use & Spectrum of Some Rabee Adwan. MD Infectious Diseases Consultant (Pediatric and Adult) Head Of ID Unit and IPAC Committee- AL-Makassed Hospital-AlQuds Head of IPAC Committee
Interpretation of Bulk Tank Milk Results
Interpretation of Bulk Tank Milk Results Introduction Culturing bulk tank milk (BTM) to monitor milk quality has limitations based on the amount and frequency of sampling and the amount and types of microorganisms
Antimicrobial Susceptibility Testing: Advanced Course
Antimicrobial Susceptibility Testing: Advanced Course Cascade Reporting Cascade Reporting I. Selecting Antimicrobial Agents for Testing and Reporting Selection of the most appropriate antimicrobials to
BactiReg3 Event Notes Module Page(s) 4-9 (TUL) Page 1 of 21
www.wslhpt.org 2601 Agriculture Drive Madison, WI 53718 (800) 462-5261 (608) 265-1111 2015-BactiR Reg3 Shipment Date: September 14, 2015 Questions or comments should be directed to Amanda Weiss at 800-462-5261
TEST REPORT. Client: M/s Ion Silver AB. Loddekopinge. Sverige / SWEDEN. Chandran. min and 30 min. 2. E. coli. 1. S. aureus
TEST REPORT TEST TYPE: Liquid Suspension Time Kill Study -Quantitative Test Based On ASTM 2315 TEST METHOD of Colloidal Silver Product at Contact time points: 30 sec, 1 min, 2 min, 5 min, 10 min, 15 min
Cleaning & Sanitising Medical range. Working in harmony with nature to protect
Cleaning & Sanitising Medical range Working in harmony with nature to protect Introduction Hospitals, nursing homes and similar establishments are now acknowledged to have a major pathogenic problem Methicillin
Antibiotic Susceptibility of Bacterial Infections in Arizona Companion Animal Species from January 2015 to December 2016
Antibiotic Susceptibility of Bacterial Infections in Arizona Companion Animal Species from January 2015 to December 2016 Item Type text; Electronic Thesis Authors Hefferman, Sarah Marie Publisher The University
Antibiotic Update 2.0, 2017
Case Study 3: My patient has positive blood culture, should I start antibiotic STAT? Ooi Mong How Antibiotic Update 2.0 2017 11-12 March 2017 Sarawak General Hospital A 3-day-old male infant Full term,
Objectives 6/28/2012. Infection, Antibiotic Use & Antimicrobial Resistance A Common Thread?
Infection, Antibiotic Use & Antimicrobial Resistance A Common Thread? Jennifer Schmitz, PharmD, BCPS Clinical Pharmacist, Infectious Diseases Via Christi Hospitals Wichita, Inc. September 21, 2012 Objectives
Interpretation of results from milk samples tested for mastitis bacteria with Mastit 4 qpcr test from DNA Diagnostic
Mastit 4 Interpretation of results from milk samples tested for mastitis bacteria with Mastit 4 qpcr test from DNA Diagnostic The 40th ICAR Biennial Session Puerto Varas, Chile, 24-28 october 2016 Jorgen
Clinical Theriogenology Volume 6, Number 3 September 2014
Effect of antibacterial agents in semen extender on bacterial growth in extended canine semen held at 5 o C and 20 o C for up to 48 hours Carla Barstow, Margaret V. Root Kustritz College of Veterinary
Liofilchem Chromatic Chromogenic culture media for microbial identification and for the screening of antimicrobial resistance mechanisms
Liofilchem Chromatic Chromogenic culture media for microbial identification and for the screening of antimicrobial resistance mechanisms Microbiology Products since 1983 Liofilchem Chromatic ESBL Selective
V Rx Only. Staph ID/R Blood Culture Panel. Intended Use
V Rx Only Staph ID/R Blood Culture Panel Intended Use The Great Basin Staph ID/R Blood Culture Panel is a qualitative, multiplex, nucleic acid-based in vitro diagnostic assay intended for the simultaneous
THE NAC CHALLENGE PANEL OF ISOLATES FOR VERIFICATION OF ANTIBIOTIC SUSCEPTIBILITY TESTING METHODS
THE NAC CHALLENGE PANEL OF ISOLATES FOR VERIFICATION OF ANTIBIOTIC SUSCEPTIBILITY TESTING METHODS Stefanie Desmet University Hospitals Leuven Laboratory medicine microbiology stefanie.desmet@uzleuven.be
MICRONAUT MICRONAUT-S Detection of Resistance Mechanisms. Innovation with Integrity BMD MIC
MICRONAUT Detection of Resistance Mechanisms Innovation with Integrity BMD MIC Automated and Customized Susceptibility Testing For detection of resistance mechanisms and specific resistances of clinical
ORIGINAL PAPERS. Microbiological Spectrum and Susceptibility Pattern of Clinical Isolates from the Neonatal Unit in a Single Medical Center
ORIGINAL PAPERS Adv Clin Exp Med 205, 24,, 522 DOI: 0.729/acem/3870 Copyright by Wroclaw Medical University ISSN 8995276 Aneta Nitsch-Osuch, AE, Irena Choroszy-Król 2, AE, Ernest Kuchar 3, AE, Krzysztof
Dairy/Milk Testing Report Detecting Elevated Levels of Bacteria in Milk-On-Site Direct- From-The-Cow Within Minutes as Indicator of Mastitis
Dairy/Milk Testing Report Detecting Elevated Levels of Bacteria in Milk-On-Site Direct- From-The-Cow Within Minutes as Indicator of Mastitis EnZtek Diagnostics Incorporated has investigated and successfully
The β- Lactam Antibiotics. Munir Gharaibeh MD, PhD, MHPE School of Medicine, The University of Jordan November 2018
The β- Lactam Antibiotics Munir Gharaibeh MD, PhD, MHPE School of Medicine, The University of Jordan November 2018 Penicillins. Cephalosporins. Carbapenems. Monobactams. The β- Lactam Antibiotics 2 3 How
Dairy Calf, BVDv-PI Dead & Chronic Monitoring Program
ANIMAL PROFILING INTERNATIONAL, INC Dairy Calf, BVDv-PI Dead & Chronic Monitoring Program PURPOSE Identification and removal of BVDv-PI animals will have a positive impact on herd health. QUICK OVERVIEW:
SIDP Antimicrobial Stewardship Certificate Program Antimicrobial Stewardship and Microbiology: Focus on Rapid Diagnostic Tests
Antimicrobial Stewardship Certificate Program Antimicrobial Stewardship and Microbiology: Focus on Rapid Diagnostic Tests Karri A. Bauer, PharmD, BCPS (AQ-ID) Specialty Practice Pharmacist Infectious Diseases
to severe renal impairment Route, reduce dose, and Reasonable oral absorption (oral preparation) enterococcal strains usually respond to
Drug class Aminopenicillin Aminopenicillin Aminopenicillin/βlactam inhibitor combination Drug Ampicillin Amoxicillin Amoxicillin/ clavulanate TABLE J.1 Aminopenicillins LWBK1580-App-J_p1852-1874.indd 1852
OCTOBER 7-10 PHILADELPHIA, PENNSYLVANIA
OMED 17 OCTOBER 7-10 PHILADELPHIA, PENNSYLVANIA 29.5 Category 1-A CME credits anticipated ACOFP / AOA s 122 nd Annual Osteopathic Medical Conference & Exposition Joint Session with ACOFP and Cleveland
Infection Linelist. Infections Occurred Between 10/1/ :00:00 AM To 11/1/ :00:00 AM 2RCW2. Gastroenteritis (Adult) Urinary Tract
Infection Linelist Infections Occurred Between 10/1/2013 12:00:00 AM To 11/1/2013 12:00:00 AM 2RCW2 10/9/13 02407693 36890294 2094 1 32 M CLOSTRIDIUM DIFFICILE 10/26/13 99342791 37024716 2046 1 42 M CLOSTRIDIUM
INFECTION PREVENTION SILVER ANTI-MICROBIAL TEXTILES
INFECTION PREVENTION SILVER ANTI-MICROBIAL TEXTILES Agenda SILVERGUARD background Infection management challenges and the SILVER antimicrobial technology solution Case studies and clinical data SILVERGUARD
SYMMETRY ANTIMICROBIAL FOAMING HANDWASH with 0.3% PCMX Technical Data
408 SYMMETRY ANTIMICROBIAL FOAMING HANDWASH with 0.3% PCMX Technical Data Physical Properties Active Ingredient: Chloroxylenol (PCMX) 0.3% Appearance: Clear, Amber Solution Fragrance: Floral Form: Liquid
Antimicrobial Stewardship:
Antimicrobial Stewardship: Inpatient and Outpatient Elements Angela Perhac, PharmD afperhac@carilionclinic.org Disclosure I have no relevant finances to disclose. Objectives Review the core elements of
A Multi-Laboratory Study of the BIOMIC Automated Well Reading Instrument versus
JCM Accepts, published online ahead of print on 13 March 2013 J. Clin. Microbiol. doi:10.1128/jcm.03088-12 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 3 A Multi-Laboratory
Doripenem: A new carbapenem antibiotic a review of comparative antimicrobial and bactericidal activities
REVIEW Doripenem: A new carbapenem antibiotic a review of comparative antimicrobial and bactericidal activities Fiona Walsh Department of Clinical Microbiology, Trinity College Dublin, Dublin, Ireland
ANTIBIOTICS USED FOR RESISTACE BACTERIA. 1. Vancomicin
ANTIBIOTICS USED FOR RESISTACE BACTERIA 1. Vancomicin Vancomycin is used to treat infections caused by bacteria. It belongs to the family of medicines called antibiotics. Vancomycin works by killing bacteria
Susceptibility Testing and Resistance Phenotypes Detection in Bacterial Pathogens Using the VITEK 2 System
Polish Journal of Microbiology 2005, Vol. 54, No 4, 311 316 Susceptibility Testing and Resistance Phenotypes Detection in Bacterial Pathogens Using the VITEK 2 System EL BIETA STEFANIUK*, AGNIESZKA MRÓWKA
Antimicrobial susceptibility
Antimicrobial susceptibility PATTERNS Microbiology Department Canterbury ealth Laboratories and Clinical Pharmacology Department Canterbury District ealth Board March 2011 Contents Preface... Page 1 ANTIMICROBIAL
CME/SAM. Validation and Implementation of the GeneXpert MRSA/SA Blood Culture Assay in a Pediatric Setting
Microbiology and Infectious Disease / Xpert MRSA/SA in Pediatric Blood Cultures Validation and Implementation of the GeneXpert MRSA/SA Blood Culture Assay in a Pediatric Setting David H. Spencer, MD, PhD,
OYRON WELL D-ONE Rev /10/2015
OYRON Well D-ONE System for the presumptive identification and antimicrobial susceptibility test of most common microorganisms in urinary tract infections 1. INTRODUCTION Urinary tract infections (UTI)
Dalbavancin, enterococci, Gram-positive cocci, Latin America, staphylococci, streptococci
ORIGINAL ARTICLE 10.1111/j.1469-0691.2004.01051.x Antimicrobial activity of dalbavancin tested against Gram-positive clinical isolates from Latin American medical centres A. C. Gales 1, H. S. Sader 1,2
AMR epidemiological situation: ECDC update
One Health Network on Antimicrobial Resistance (AMR) AMR epidemiological situation: ECDC update Dominique L. Monnet, on behalf of ECDC Antimicrobial Resistance and Healthcare-Associated Infections (ARHAI)