Specificity (target gene) Primer name Sequence Product length[bp] GGATTAGATACCCTGGTAGTC TACCTTGTTACGACTT

Transcription

1 Supplementary material for Beneficial Microbes DOI: Individual responses of mother sows to a probiotic Enterococcus faecium strain lead to different microbiota composition in their offspring I.C. Starke,. Pieper, K., Neumann, J. Zentek and W. Vahjen Table S1. Primer sequences, product length and annealing temperatures. Specificity (target gene) Primer name Sequence Product length[bp] Annealing temperature [ C] eference Total bacteria 785f GGATTAGATACCCTGGTAGTC 1512r TACCTTGTTACGACTT Shigella (16S rna) Entero-F GTTAATACCTTTGCTCATTGA Entero- ACCAGGGTATCTAATCCTGTT Enterobacteriaceae (rpob) EntqPC3417f GTBTCDCCCGCAGC EntqPC3852r TGCGYCTGGTATCTA Clostridial-Cluster XIVa (16S rna) g-ccoc-f AAATGACGGTACCTGACTAA g-ccoc- CTTTGAGTTTCATTCTTGCGAA Clostridial-Cluster IV (16S rna) sg-clept-f GCACAAGCAGTGGAGT sg-clept- CTTCCTCCGTTTTGTCAA Porphyromonas (16S rna) BPP1 GGTGTCGGCTTAAGTGCCAT BPP2 CGGAYGTAAGGGCCGTGC Lactobacillus spp. (16S rna) LAC-1 AGCAGTAGGGAATCTTCCA LAC-2 CACCGCTACACATGGAG Streptococcus spp. (soda) Salac5f TCTAGCAAATGCCAATGCTG Salac5r GATGAGGGCTTGACGAATGT Enterococcus spp. (16S rna) Ent1 CCCTTATTGTTAGTTGCCATCATT Ent2 ACTCGTTGTACTTCCCATTGT Bifidobacterium spp. (16S rna) g-bifid-f TCGCGTCYGGTGTGAAAG g-bifid- CCACATCCAGCTCCAC Weissella spp. (16S rna) Weisformod-1 CACGTGGGWAACCTACCTCTTA Weisrevmod-1 ATCTCTTAGTGATAGCAGAACCATC Leuconostoc spp. (16S rna) Leucformod-1 GCGGCTGCGGCGTCACCTAG Leucrevmod-1 GGNTACCTTGTTACGACTTC L. acidophilus (16S rna) L-aci I AGCTGAACCAACAGATTCAC L-aci II ACTACCAGGGTATCTAATCC L. johnsonii (16S rna) L-joh I GAGCTTGCCTAGATGATTTTA L-joh II ACTACCAGGGTATCTAATCC

2 L. mucosae (16S rna) L-muc 2a GGCTATCACTTTGGGATGGA L-muc 2b ATGGACCGTGTCTCAGTTCC L. reuteri (16S rna) L-reu 1 CCCAACTGATTGATGGTGCT L-reu 2 GGGCAGGTTACCTACGTGTT L. amylovorus (16S rna) L-amyl 2a GCGGAACCAACAGATTTACTT L-amyl 2b GTTTCCAAATGGTATCCCAGACTT Probiotic E. faecium Cyl-1a TCGGAATTTGCCAGAAGAAC Cyl-1b CTGGTGAAGCAGGGTTTCAT eferences 1 = inttilä, T., Kassinen, A., Malinen, E., Krogius, L. and Palva, A., Development of an extensive set of 16S rdna-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PC. Journal of Applied Microbiology 97: = Malinen, E., Kassinen, A., inttilä, T. and Palva, A., Comparison of real-time PC with SYB Green I or 5'-nuclease assays and dot-blot hybridization with rdnatargeted oligonucleotide probes in quantification of selected faecal bacteria. Microbiology 149: = Walter, J., G.W. Tannock, A. Tilsala-Timisjarvi, S. odtong, D. M. Loach, K. Munro and T. Alatossava, Detection and identification of gastrointestinal Lactobacillus species by using denaturing gradient gel electrophoresis and species-specific PC primers. Applied and Environmental Microbiology 66: = Matsuki, T., Watanabe, K., Fujimoto, J., Takada, T. and Tanaka,., Use of 16S rna gene-targeted group-specific primers for real-time PC analysis of predominant bacteria in human feces. Applied and Environmental Microbiology 70: = Song, Y., Liu, C. and Finegold, S.M., eal-time PC quantitation of clostridia in feces of autistic children. Applied and Environmental Microbiology 70: = unpublished; developed in the Institute of Animal Nutrition, Free University of Berlin. 8 = Lyons, S.., Griffen, A.L. and Leysi, E.J., Quantitative real-time PC for Porphyromonas gingivalis and total bacteria. Journal of Clinical Microbiology 38:

3 Table S2A. Bacterial cell numbers in 12d old piglets grouped into piglets from non-responding (N) or responding () sows according to Group N N N N Total bacteria 8.7 (±0.9) 8.6 (±1.1) 9.3 (±0.7) 7.9 (±1.2) 8.0 (±1.3) 8.4 (±2.4) 8.1 (±1.1) 6.4 (±0.9) 8.4 (±0.1) 9.9 (±0.5) 9.3 (±0.4) 9.9 (±0.1) XIVa 7.5 (±0.9) 7.0 (±0.9) 8.6 (±1.6) 7.1 (±0.9) 6.6 (±1.4) 6.9 (±1.4) 6.9 (±1.3) 8.1 (±1.5) 6.6 (±0.3) 10.6 (±0.9) 10.3 (±0.2) 10.0 (±0.5) IV 7.1 (±0.4) a 7.6 (±1.3) a 6.3 (±0.5) b 6.2 (±1) a 7.2 (±0.2) b 5.8 (±0.4) a 6.9 (±0.8) 6.7 (±0.8) 6.4 (±0.8) 9.9 (±0.7) 9.7 (±0.4) 9.4 (±0.2) Porphyromonas 5.7 (±1.0) 5.2 (±0.4) 6.0 (±1.1) 4.7 (±1.1) 4.1 (±1.1) 4.4 (±1.1) 5.2 (±0.5) 4.1 (±0.8) 4.3 (±1.1) 8.0 (±0.6) 7.5 (±0.3) 7.6 (±0.4) Probiotic n.d. n.d. 4.1 (±0.8) n.d n.d. n.d. n.d. n.d (±0.8) Enterococcus spp. 4.8 (±0.9) 5.0 (±0.5) 6.2 (±1.9) 5.6 (±2.1) 4.7 (±1.3) 8.1 (±2.6) 5.3 (±1.3) 4.1 (±1.0) 5.3 (±1.1) 6.7 (±1.1) 6.5 (±2.1) 7.3 (±1.8) Streptococcus spp. 6.5 (±1.1) 6.8 (±1.0) 6.9 (±0.7) 5.5 (±1.3) 5.5 (±1.7) 6.0 (±2.5) 5.0 (±1.5) 3.4 (±0.9) 5.6 (±0.3) 6.2 (±0.9) 6.0 (±1.6) 6.8 (±0.5) Shigella 5.5 (±1.5) a 4.4 (±0.2) b 7.4 (±2.3) b 7.3 (±1.9) 5.9 (±2.9) 8.0 (±0.4) 7.1 (±1.2) n.d. 7.5 (±0.7) 6.1 (±1.2) 5.4 (±1.3) 6.2 (±2.1) Bifidobacterium spp. 6.6 (±1.6) 6.9 (±1.7) 7.3 (±1.7) 5.6 (±1.4) a 6.8 (±1.8) ab 8.3 (±0.6) b 5.4 (±0.7) 4.6 (±1.2) 5.5 (±1.6) 6.6 (±2.1) 6.5 (±1.1) 6.9 (±1.2) Lactobacillus spp. 9.3 (±1.1) 9.1 (±1) 10.0 (±0.7) 7.8 (±1.3) 6.8 (±2.9) 7.9 (±3.2) 7.4 (±1) 3.9 (±0.6) 6.8 (±0.1) 8.6 (±1.6) a 7.4 (±1.1) b 8.6 (±0.8) a L. amylovorus 6.4 (±0.7) 6.3 (±0.5) 7.0 (±0.4) 5.1 (±1.0) 4.9 (±1.3) 5.7 (±2.1) 5.6 (±0.8) 4.7 (±0.8) 5.4 (±0.2) 5.8 (±1) a 5.0 (±0.2) b 6.1 (±0.4) a L. acidophilus 6.6 (±0.6) 5.8 (±1.1) 7.1 (±0.5) 5.5 (±0.6) 4.8 (±1.6) 5.8 (±1.7) 4.7 (±1.9) 3.3 (±0.6) 5.4 (±0.3) 6.1 (±0.8) a 5.4 (±0.2) b 6.4 (±0.4) a L. mucosae 8.5 (±1.7) 8.1 (±2.4) 10.2 (±1.9) 6.5 (±1.6) 5.4 (±1.2) 6.4 (±4.1) 5.8 (±1.9) n.d. 4.8 (±0.7) 7.6 (±2.6) 5.5 (±2.2) 7.4 (±0.2) L. reuteri 8.6 (±0.7) 8.4 (±1.2) 9.2 (±0.6) 7.3 (±1.0) 7.2 (±2.5) 7.5 (±1.6) 7.4 (±0.7) 6.4 (±0.9) 7.2 (±0.3) 8.3 (±0.9) 7.4 (±0.7) 8.2 (±0.2) L. johnsonii 6.3 (±2.2) n.d. 6.9 (±1.3) 6.4 (±2.0) n.d. 6.3 (±0.4) 5.2 (±2.0) n.d (±1.9) n.d. n.d. Total cell number 9.5 (±0.9) 9.1 (±1.0) 10.1 (±0.7) 7.9 (±2.1) 7.8 (±2.0) 9.3 (±1.1) 8.2 (±0.7) 8.1 (±0.8) 7.8 (±0.4) 10.8 (±0.9) 10.4 (±0.2) 10.3 (±0.1) 1 = single value.

4 Table S2B. Bacterial cell numbers in 26d old piglets grouped into piglets from non-responding (N) or responding () sows according to Group N N N N Total bacteria 8.9 (±0.9) 9.1 (±0.4) 9.7 (±0.8) 8.2 (±0.8) a 6.7 (±0.9) b 8.4 (±0.4) a 9.8 (±0.5) 9.6 (±0.6) 9.7 (±0.3) 9.7 (±0.3) 9.7 (±0.4) 9.9 (±0.6) Lactobacillus spp. 8.8 (±1.5) 8.1 (±1.3) 9.1 (±1.9) 7.7 (±1.8) a 4.6 (±2.2) b 8.0 (±0.6) a 9.6 (±1.0) 8.5 (±0.4) 9.9 (±0.4) 7.5 (±1.4) 7.3 (±0.3) 8.2 (±1.4) Clostridial cluster IV 7.5 (±0.6) 7.7 (±0.5) 8.1 (±0.9) 7.0 (±0.9) a 7.3 (±0.5) a 5.5 (±0.6) b 7.6 (±0.6) 7.3 (±0.3) 7.4 (±0.3) 9.9 (±0.5) 10.1 (±0.4) 9.9 (±0.4) Clostridial cluster XIVa 7.8 (±0.8) a 8.1 (±0.8) a 9.2 (±0.6) b 7.0 (±1.0) a 3.9 (±2.8) b 7.9 (±0.2) a 8.3 (±0.4) 8.5 (±0.4) 8.5 (±0.9) 10.4 (±0.3) 10.8 (±0.5) 10.8 (±0.4) Porphyromonas 5.9 (±0.7) 6.2 (±0.7) 7.1 (±0.9) 5.1 (±1.0) ab 3.6 (±0.3) b 5.5 (±1.3) a 5.8 (±0.7) 5.6 (±0.4) 5.9 (±1.3) 7.7 (±0.3) 7.8 (±0.7) 7.8 (±0.2) Probiotic n.d. 5.2 (±0.7) n.d. 3.1 (±0.0) 3.4 (±0.4) n.d. 3.9 (±0.7) n.d. n.d Enterococcus spp. 5.9 (±1.1) 6.1 (±1.2) 6.3 (±1.6) 5.3 (±1.4) 4.2 (±0.4) 5.0 (±1.0) 5.9 (±1.1) 6.1 (±1.6) 6.2 (±0.7) 6.2 (±0.5) 6.4 (±0.3) 6.6 (±0.5) Streptococcus spp. 6.3 (±1.1) 7.0 (±0.5) 7.2 (±0.7) 5.7 (±0.9) a 3.9 (±0.7) b 5.9 (±0.2) a 7.2 (±0.7) 7.5 (±0.9) 7.7 (±0.2) 5.6 (±0.6) 6.3 (±0.6) 6.1 (±0.7) Shigella 6.9 (±1.6) 6.7 (±1.3) 8.1 (±0.5) 4.8 (±0.4) 4.4 (±0.1) 5.5 (±1.0) 7.4 (±0.5) 5.6 (±1.7) 8.4 (±1.4) 6.4 (±0.4) a 4.7 (±0.4) b 7.1 (±0.6) a Bifidobacterium spp. 6.1 (±0.4) 6.7 (±0.6) 7.6 (±1.5) 5.5 (±1.2) 5.3 (±2.4) 6.3 (±0.9) 6.8 (±0.5) 7.0 (±0.5) 7.3 (±1.7) 6.4 (±1.4) 6.4 (±0.5) 7.1 (±1.7) L. acidophilus 6.2 (±0.7) 5.9 (±1.2) 6.3 (±1) 5.5 (±1.9) ab 3.5 (±1.7) b 6.4 (±0.5) a 6.6 (±0.8) a 5.6 (±0.3) b 6.8 (±0.6) a 5.5 (±1.1) 5.5 (±0.5) 5.9 (±0.7) L. amylovorus 6 (±0.8) 5.5 (±1.1) 6.1 (±1.2) 5.8 (±1.4) a 3.8 (±1.3) b 6.0 (±0.4) a 6.6 (±0.6) a 5.5 (±0.8) b 6.8 (±0.7) a 5.3 (±1.0) 5.2 (±0.3) 5.7 (±0.9) L. johnsonii 7.8 (±0.9) 7.2 (±0.8) 7.6 (±1.4) 6.0 (±1.5) (±1.7) 8.4 (±0.9) a 6.9 (±0.8) c 7.7 (±1.6) b 7.3 (±1.6) 6.5 (±0.2) L. mucosae 9.0 (±2.4) 7.2 (±2.5) 9.7 (±3.0) 7.0 (±2.6) 4.3 (±4.1) 7.4 (±1.3) 10.2 (±1.5) a 7.4 (±0.6) c 8.8 (±1.6) b 6.6 (±2.4) 6.3 (±1.7) 7.4 (±4.0) L. reuteri 8.5 (±1.1) 7.8 (±0.7) 8.8 (±1.1) 7.6 (±1.0) a 5.7 (±1.4) b 7.7 (±0.6) a 9.0 (±0.5) a 7.3 (±0.9) b 8.6 (±0.2) a 7.9 (±0.8) 7.4 (±0.2) 8.1 (±1.1) Total cell number 9.1 (±1.1) 9.0 (±0.7) 10.0 (±1.0) 8.2 (±1.2) 6.0 (±1.3) 8.4 (±0.4) 9.7 (±0.8) ab 8.9 (±0.3) a 10.0 (±0.5) b 10.6 (±0.3) 10.9 (±0.4) 10.9 (±0.3) 1 = single value.

5 Table S3A. Bacterial cell numbers in 32d old piglets grouped into piglets from non-responding (N) or responding () sows according to Group N N N N Total bacteria 8.2 (±1.1) 7.6 (±1.6) 7.8 (±0.6) 7.9 (±0.6) ab 6.7 (±1) a 8.4 (±1) b 8.2 (±1.1) 8.1 (±0.4) 8.4 (±1.2) 9.6 (±0.9) 9.7 (±0.1) 9.8 (±0.2) IV 6.6 (±0.5) b 7.1 (±0.6) c 5.5 (±0.7) a 6.6 (±0.7) 6.2 (±0.2) 5.6 (±1.3) 7.4 (±0.7) 6.3 (±1.3) 5.7 (±1.2) 10.8 (±0.7) 10.4 (±0.6) 9.9 (±0.9) XIVa 8.8 (±1.2) 6.8 (±3.2) 6.9 (±1.8) 7.3 (±0.9) 5.7 (±1.3) 7.2 (±2.2) 6.8 (±0.8) 6.3 (±1) 7.0 (±2.1) 11.9 (±0.6) 11.5 (±0.5) 11.1 (±0.9) Porphyromonas 7.1 (±0.8) 6.9 (±1) 6.7 (±1) 5.7 (±0.8) 4.6 (±0.8) 5.6 (±1.5) 5.4 (±0.8) 5.4 (±0.7) 6.2 (±2.1) 8.3 (±0.3) 7.9 (±0.2) 8.0 (±0.2) Probiotic n.d. 4.0 (±0.5) 3.4 (±0.4) n.d. 3.9 (±0.6) 4.3 (±0.6) n.d. 5.4 (±0.5) 4.9 (±1.3) n.d. 3.9 (±1) 3.8 (±0.3) Enterococcus spp. 4.0 (±0.6) 4.4 (±0.8) 4.4 (±0.7) 3.6 (±0.4) a 5.9 (±0.3) c 4.8 (±0.7) b 4.1 (±0.7) 5.2 (±0.4) 5.1 (±1.7) 5.9 (±0.5) 5.6 (±0.2) 6.0 (±1.1) Streptococcus spp. 5.0 (±0.5) b 4.9 (±0.2) b 4.2 (±0.3) a 3.9 (±0.4) 3.6 (±0.3) 4.4 (±0.9) 4.2 (±1.3) 5.4 (±0.6) 5.2 (±0.9) 5.5 (±0.7) 5.1 (±1) 5.9 (±1.0) Shigella 5.5 (±1.5) 4.6 (±0.3) 4.5 (±0.3) 5.1 (±1.5) 5.7 (±2.2) 4.7 (±0.3) 6.3 (±1.8) 7.5 (±0.7) 6.3 (±0.8) 6.7 (±1.7) 6.7 (±1.4) 7.6 (±0.2) Bifidobacterium spp. 7.7 (±0.8) 7.5 (±0.7) 6.4 (±1.1) 7.3 (±1) ab 6.4 (±0.9) a 8.1 (±1.1) c 7.2 (±1.2) 7.2 (±0.5) 7.6 (±0.7) 8.0 (±0.3) b 6.6 (±0.5) a 7.9 (±0.5) b Lactobacillus spp. 7.3 (±1.4) 7.4 (±1.3) 6.1 (±1) 5.3 (±0.5) 4.6 (±0.7) 6.4 (±1.2) 6.6 (±1.5) 8.4 (±0.6) 7.4 (±0.4) 8.0 (±1.9) 7.4 (±1.0) 7.4 (±0.7) L. acidophilus 5.1 (±1.2) 5.6 (±1.6) 4.2 (±0.7) 3.7 (±0.2) 3.2 (±0.8) 4.3 (±1.3) 5.1 (±1.2) 6.5 (±0.6) 5.8 (±0.5) 6.1 (±1.5) 6.3 (±0.8) 5.6 (±0.7) L. amylovorus 5.2 (±0.8) 5.4 (±0.5) 4.4 (±0.7) 5.1 (±0.4) 5.0 (±0.7) 5.7 (±0.7) 5.8 (±0.7) 6.9 (±0.3) 5.6 (±0.4) 5.8 (±0.8) 5.8 (±0.7) 5.4 (±0.5) L. johnsonii 5.6 (±2.2) (±1.8) 3.5 (±0.3) (±0.5) 4.3 (±0.6) 4.4 (±1.6) 6.1 (±1.9) 6 (±1.4) 6.3 (±3.1) L. mucosae 8.0 (±2.1) 7.8 (±0.4) 7.4 (±0.6) 5.3 (±0.7) b 3.8 (±0.9) a 6.1 (±0.2) c 4.7 (±1.3) 5.0 (±0.2) 6.4 (±2.1) 7.5 (±1.4) 5.9 (±1.8) 7.1 (±1.6) L. reuteri 8.2 (±0.7) 8.4 (±0.6) 8.2 (±0.3) 6.9 (±0.5) 6.5 (±0.4) a 7.3 (±0.3) b 6.9 (±0.5) 7.1 (±0.3) 7.4 (±0.8) 7.9 (±0.8) 7.5 (±0.9) 8.0 (±0.7) Total cell number 9.0 (±1.0) 8.7 (±1.6) 7.5 (±1.2) 8.0 (±0.4) 7.5 (±0.6) 8.4 (±1.1) 8.1 (±0.8) 8.6 (±0.3) 8.3 (±0.7) 12.0 (±0.6) 11.6 (±0.4) 11.2 (±0.8) 1 = single value.

6 Table S3B. Bacterial cell numbers in 53d old piglets grouped into piglets from non-responding (N) or responding () sows according to Group N N N N Total bacteria 7.7 (±1.5) 7.3 (±1.3) 8.2 (±1.4) 6.9 (±1.2) 6.7 (±0.8) 6.6 (±0.7) 9.1 (±1.1) 9.1 (±1) 9.3 (±1.2) 10.1 (±0.5) 10 (±0.4) 10.2 (±0.7) IV 6.0 (±1.3) 5.9 (±0.9) 6.9 (±0.8) 5.4 (±0.4) 5.8 (±0.8) 5.3 (±0.5) 7.6 (±1.2) 6.6 (±0.7) 7.2 (±1.1) 10.8 (±0.4) 10.7 (±0.4) 10.9 (±0.3) XIVa 6.7 (±2.4) 6.5 (±2.0) 8 (±0.9) 5.4 (±0.7) 5.5 (±1) 5.0 (±0.6) 8.7 (±1.9) 7.9 (±1.8) 8.3 (±1.8) 11.5 (±0.9) 11.3 (±0.5) 11.6 (±0.8) Porphyromonas 5.8 (±1.3) 6.1 (±0.7) 6.3 (±1.1) 4.7 (±1.0) 5.1 (±0.9) 4.7 (±0.6) 6.4 (±0.8) b 5.7 (±0.7) a 5.8 (±0.2) a 8.3 (±0.5) 8.2 (±0.5) 8.7 (±0.4) Probiotic n.d. 4.2 (±1.1) 4.1 (±y) n.d. 3.9 (±0.5) 4.2 (±0.5) n.d. 5.0 (±0.4) 4.8 (±2.5) n.d. 4.3 (±0.9) 5.1 (±0.6) Enterococcus spp. 5.0 (±1.2) 4.9 (±1.1) 4.9 (±1.5) 4.1 (±0.7) 4.4 (±1.1) 4.4 (±0.2) 5.3 (±1.4) 5.6 (±0.7) 5.8 (±1.2) 5.9 (±0.9) 6.1 (±0.8) 6.2 (±1.5) Streptococcus spp. 4.4 (±1.4) 4.5 (±0.9) 4.4 (±1.8) 4.1 (±0.8) 3.6 (±0.9) 4.1 (±0.1) 6.3 (±1.6) 6.1 (±1.7) 6.2 (±1.9) 6.9 (±1.4) 6.9 (±0.7) 7.6 (±1.3) Shigella 4.8 (±1.4) 5.1 (±1.2) 5.0 (±0.9) 4.6 (±0.5) 4.9 (±0.7) 4.7 (±0.6) 6.0 (±1.2) a 6.4 (±1.3) ab 7.9 (±1.3) c 6.1 (±1.2) 7.1 (±0.7) 7.3 (±1.4) Bifidobacterium spp. 6.4 (±1.8) 6.0 (±1.4) 7.1 (±1.5) 5.9 (±1.0) 5.7 (±1.3) 5.9 (±0.9) 7.4 (±2) 7.6 (±1) 8.0 (±1.0) 7.6 (±0.8) 7.9 (±0.6) 7.8 (±0.7) Lactobacillus spp. 6.6 (±2.6) 5.9 (±4.5) 6.7 (±2.3) 5.7 (±1.4) 5.5 (±2.3) 4.1 (±1.0) 6.8 (±3.0) 7.5 (±2.2) 7.0 (±1.8) 7.8 (±1.5) 7.6 (±1.0) 7.9 (±1.3) L. acidophilus 4.0 (±1.6) 4.0 (±1.9) 4.8 (±1.1) 3.1 (±1.3) 3.5 (±1.5) 2.3 (±1.1) 4.9 (±2.1) 5.4 (±1.7) 5.4 (±1.1) 6.0 (±1.3) 5.4 (±0.8) 5.5 (±1.2) L. amylovorus 3.5 (±1.6) 4.1 (±2.0) 4.0 (±1.9) 4.0 (±1.9) 4.0 (±1.2) 4.5 (±1.2) 5.1 (±1.3) 5.3 (±1.3) 5.4 (±1.1) 5.7 (±1.0) 5.3 (±0.7) 5.8 (±0.3) L. johnsonii 6.3 (±0.7) 5.3 (±1.5) 7.6 (±1.5) 4.4 (±1.5) 4.3 (±0.4) n.d. 7.7 (±0.7) 6.2 (±1.8) 7.5 (±0.5) 6.3 (±2.0) a 7.4 (±0.9) ab 8.7 (±0.5) c L. mucosae 4.8 (±4.3) 4.7 (±4.5) 5.3 (±5.1) 5.7 (±1.4) a 4.2 (±1.5) b 3.6 (±2.2) b 7.9 (±3.5) 7.3 (±2.4) 7.6 (±2.2) 8.0 (±0.7) 7.7 (±1.9) 9.4 (±1.1) L. reuteri 6.8 (±1.8) 6.8 (±1.8) 7.0 (±1.8) 6.8 (±1.3) 6.4 (±1.1) 6.5 (±1.1) 7.8 (±1.4) 7.6 (±1.1) 8.0 (±0.7) 8.1 (±0.2) 8.0 (±0.8) 8.6 (±0.2) Total cell number 7.4 (±1.9) 7.7 (±1.8) 8.3 (±1.1) 6.3 (±0.9) 6.6 (±0.6) 6.3 (±0.5) 9.1 (±1.7) 8.9 (±1.4) 9.1 (±1.1) 11.6 (±0.8) 11.5 (±0.4) 11.7 (±0.7)