Detection of Rickettsia and Anaplasma from hard ticks in Thailand

Transcription

1 262 Journal of Vector Ecology December 2015 Detection of Rickettsia and Anaplasma from hard ticks in Thailand Premnika Malaisri 1, Supanee Hirunkanokpun 3, Visut Baimai 1,2, Wachareeporn Trinachartvanit 1, and Arunee Ahantarig 1,2 1 Biodiversity Research Cluster, Department of Biology, Faculty of Science, Mahidol University, Rama 6 Road, Bangkok 10400, Thailand arunee.aha@mahidol.ac.th 2 Center of Excellence for Vectors and Vector-Borne Diseases, Faculty of Science, Mahidol University at Salaya, Phutthamonthon 4 Road, NakhonPathom 73170, Thailand 3 Department of Biology, Faculty of Science, Ramkhamhaeng University, Ramkhamhaeng Road, Bangkok 10240, Thailand Received 10 February 2015; Accepted 15 April 2015 ABSTRACT: We collected a total of 169 adult hard ticks and 120 nymphs from under the leaves of plants located along tourist nature trails in ten localities. The results present data examining the vector competence of ticks of different genera and the presence of Rickettsia and Anaplasma species. The ticks belonged to three genera, Amblyomma, Dermacentor, and Haemaphysalis, comprising 11 species. Rickettsia bacteria were detected at three collection sites, while Anaplasma bacteria were detected at only one site. Phylogenetic analysis revealed new rickettsia genotypes from Thailand that were closely related to Rickettsia tamurae, Rickettsia monacensis, and Rickettsia montana. This study was also the first to show that Anaplasma bacteria are found in Haemaphysalis shimoga ticks and are closely related evolutionarily to Anaplasma bovis. These results provide additional information for the geographical distribution of tick species and tick-borne bacteria in Thailand and can therefore be applied for ecotourism management. Journal of Vector Ecology 40 (2): Keyword Index: Rickettsia, Anaplasma, ticks, Thailand. INTRODUCTION Tick-associated bacteria have been identified in many regions of the world, including Thailand. The most recent review summarized the pathogenic agents reported in Thailand, where the most predominant tick-borne agents belong to the Order Rickettsiales (Anaplasma, Ehrlichia, and Rickettsia), and are detected in both ticks and vertebrate species (Ahantarig et al. 2008). Spotted Fever Group rickettsia (SFGR) have been associated with diseases that affect public health, according to a previous study reporting cases of spotted fever in people from Chiang Mai Province in 1994 (Sirisanthana et al. 1994) and Kanchanaburi Province in 2003 (Parola et al. 2003). A Rickettsia honei-type strain has also been identified in Ixodes granulatus ticks collected from Nakhon Ratcharima Province in 2001 (Kollars et al. 2001). Known SFGR have been identified in Thailand, whereas novel rickettsia bacteria implicated in human diseases have been isolated from many countries in Asia, such as the incidence of Japanese spotted fever in South Korea caused by Rickettsia japonica reported in 2006 (Chung et al. 2006). In addition, a case of Rickettsia heilongjiangensis infection was recorded in Japan in 2010 (Ando et al. 2010). The first human case of Rickettsia tamurae infection in Japan was reported in 2011 (Imaoka et al. 2011). Rickettsia africae infection in a Japanese traveller with many tick bites was reported in 2012 (Fujisawa et al. 2012). In addition, Anaplasma has been considered a tick-borne pathogen that affects animal and human health worldwide (Rymaszewska and Grenda 2008), and recently human infection with a novel tick-borne Anaplasma species has been reported in China (Li et al. 2015). Evidence of Anaplasma in various ticks in Thailand has long been reported. For example, a partial gene of Anaplasma spp. was detected in Dermacentor auratus, Haemaphysalis lagrangei, and Amblyomma javanense collected from vertebrate hosts, including dogs, bears, and pangolins in the Thai-Myanmar border region (Sangkhlaburi District, Kanchanaburi Province, Thailand) (Parola et al. 2003). The Rickettsia-like Anaplasma platys has recently been identified in Rhipicephalus sanguineus ticks collected from dogs in 2011 (Foongladda et al. 2011). In the present study, we report data concerning the tick species and investigate Rickettsia and Anaplasma bacteria in natural tick populations. MATERIALS AND METHODS Tick collection and identification The ticks were collected from under leaves of plants growing along tourist nature trails at heights of approximately m from the forest floor. Ticks were collected during the dry season (November to May) from The locations of the ten collection sites are shown in Figure 1. The live ticks were collected and subsequently frozen at -80 C until further use. Individual ticks were assessed for sex, stage, and species using a previously described morphological taxonomic key (Tanskul and Inlao 1989, Walker et al. 2000). DNA extraction The ticks were washed with 70% ethanol, 10% sodium hypochlorite, and sterilized distilled water (Hirunkanokpun 2003) to remove microorganisms on the surface of the ticks prior to DNA extraction. DNA was extracted from each

2 Vol. 40, no. 2 Journal of Vector Ecology 263 Location 1 Location 2 Location 3 Location 4 Location 5 Location 6 Location 7 Location 8 Location 9 Location 10 according to the manufacturer s instructions, and verified through sequencing at Macrogen Inc. The obtained sequences were compared using the BLAST search tool. Phylogenetic analysis Partial DNA sequences obtained from the amplified PCR products were aligned with the corresponding sequences of other Rickettsia and Anaplasma species available in GenBank using CLUSTAL W. Phylogenetic analysis was performed using PAUP, version 4.0b1. A maximum parsimony tree was constructed through a heuristic search using general search options. Confidence values for individual branches of the resulting tree were determined through bootstrap analysis with 1,000 replicates. The outgroup for this analysis was Rickettsia bellii, and for the Anaplasma tree, Wolbachia pipientis was selected as an outgroup. RESULTS Figure 1. Collection sites in ecotourism areas. individual adult tick, and the DNA from immature ticks was extracted from pools containing 20 nymphs per group. The extraction of whole genomic DNA was performed using the QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer s instructions. The extracts were preserved at -20 C until further use. Bacteria detection through PCR Prior to screening pathogenic and non-pathogenic bacteria, the quality of the DNA extracts was assessed through PCR using 16s+1/16s-1 primers. These primers were used to amplify a 460 bp fragment of 16S ribosomal DNA from these ticks (Table 1). The references detailing the PCR cycles and primers used in the present study are listed in Table 1. The PCR products were analyzed through electrophoresis on 1% agarose gels, followed by staining with ethidium bromide. The positive DNA amplicons were purified using the High Pure PCR Product Purification Kit (Roche, Basel, Switzerland) Tick samples In the present study, a total of 169 adult hard ticks and 120 nymphs were collected. These ticks belonged to three genera, Amblyomma, Dermacentor, and Haemaphysalis, comprising 11 species. The most to the least abundant species were Haemaphysalis lagrangei (73 adults) followed by Haemaphysalis bispinosa, Haemaphysalis shimoga, Haemaphysalis obesa, Dermacentor auratus, Haemaphysalis semermis, Haemaphysalis hystricis, Dermacentor astrosignatus, Amblyomma integrum, Amblyomma testudinarium (one adult), and Haemaphysalis asiatica (one adult). Additionally, 120 nymphs were collected and identified as Haemaphysalis spp. The diversity of the hard ticks at each collection site was not similar. A total of seven species was collected from two collection sites, locations three and four, representing the largest number of species collected. Only one species was collected from locations one, two, and seven. The species, number, stage, and sex of hard ticks in each collection are shown in Table 2. Table 1. Oligonucleotide primers used for PCR reaction. Primers Target gene Sequence (5 3 ) Product size (bp) Refererence 1. 16s+1 16s-1 16s Mitochondrial DNA of ticks CTGCTCAATGATTTTTTAAATTGCTGTGG CCGGTCTGAACTCAGATCAAGT 460 Black and Piesman RrCS.372 RrCS.989 Citrate synthase (glt A) of SFG Rickettsia TTTGTAGCTCTTCTCATCCTATGGC CCCAAGTTCCTTTAATACTTCTTTGC 617 Kollars et al ge3a ge10r 16S rrna of Anaplasma CACATGCAAGTCGAACGGATTATTC TTCCGTTAAGAAGGATCTAATCTCC 932 Sun et al ge9f ge2r 16S rrna of Anaplasma AACGGATTATTCTTTATAGCTTGCT GGCAGTATTAAAAGCAGCTCCAGG 546 Sun et al. 2008

3 264 Journal of Vector Ecology December 2015 Table 2. The species and number of hard ticks in each collection site and percent Rickettsia positive (below the adult number). Collection sites A. testudinarium A. integrum D. astrosignatus No. of adult and percent Rickettsia positive [(total/female/male)] No. of nymphs D. auratus H. bispinosa H. lagrangei H. shimoga H. obesa H. hystricis H. semermis H. asiatica Haemaphysalis spp. Total no. of individuals Total no. of species % (1/1) female only % (2/2) female only 5 [(2/5)/(1/1) /(1/4)] [(2/22)/ (1/15)/ (1/7)] 16 [(8/16)/ (6/10)/ (2/6)] [(6/18)/ (1/5)/ (5/13)] Total

4 Vol. 40, no. 2 Journal of Vector Ecology 265 Detection rate of Rickettsia and Anaplasma spp. All 169 adult ticks and six nymph pools collected from ten ecotourism areas were screened for the presence of Rickettsia and Anaplasma. Rickettsia bacteria were detected at three ecotourism areas, locations five, four, and eight. The detection of Rickettsia was observed in four species of ticks, A. testudinarium, A. integrum, H. lagrangei, and H. bispinosa. The detection rates are shown in Table 2, calculated from the total number of the adults. Anaplasma bacteria were detected at only one site. The infection rate of Rickettsia spp. was not similar for the same species from different locations. For example, the percent of Rickettsia spp. infection in H. lagrangei at location five was 50%, while the percent of Rickettsia spp. infection in this same species was 9% at location four, 33% at location eight, and undetectable at location three. Anaplasma sp. was detected in one of four H. shimoga ticks collected from location 4 (1/4 ticks and positive only in 1/3 male ticks). All nymphal pools were negative for the bacteria. Comparison of positive Rickettsia sp. and Anaplasma sp. using the NCBI database and phylogenetic analysis The PCR amplicons corresponding to 16S rrna from Anaplasma (ge9f-ge2r) were sequenced and showed 98% identity (465/474bp) with several Anaplasma bovis strains (Accession numbers GU556626, EU181143, AB196475). Based on the amplification and sequencing of a fragment of the glta gene, we detected Rickettsia spp. in H. bispinosa (HBPK), H. lagrangei (HLPK), A. testudinarium (ATPK), and A. integrum (ALKY). Rickettsia sp. from H. bispinosa matched the first three selected Rickettsia spp., R. monacensis (CP003340, 550/561 = 98%), R. montana (U74756, 550/561 = 98%), and R. raoultii (JX885455, 549/561 = 98%). In addition, Rickettsia sp. from H. lagrangei matched the first selected Rickettsia spp., R. tamurae (AB812551, 566/571 = 99%), R. monacensis (KC993860, 567/573, 98%), and the Rickettsia endosymbiont of Amblyomma dubitatum (JN676158, 555/563, 98%). Rickettsia glta gene detected from A. integrum was similar (the first three selected Rickettsia spp.) to the Rickettsia symbiont of Amblyomma dubitatum (JN676158), with 98% identity (551/565), R. tamurae (AB812551) with 97% identity (550/565), and R. monacensis (KC993860) with 97% identity (550/565). Interestingly, the Rickettsia glta gene isolated from A. integrum contained a 10 bp insert (GAACTTACCG) compared with the same region in the glta gene isolated from other Rickettsia strains in the GenBank database. Rickettsia sp. detected from A. testudunarium was identical to R. tamurae (AB and AF394896, 561/565), with 99% identity, and the Rickettsia endosymbiont of Amblyomma dubitatum (JN676158, 560/565=99%). Partial Rickettsia (glt A) DNA sequences were detected in two species of Amblyomma (A. integrum and A. testudinarium, Accession numbers KP and KP637156, respectively). The phylogenetic study revealed that the rickettsial DNA detected in both Amblyomma species was closely related to R. tamaurae (Accession number = AF394896) and R. monacensis (Accession number = KC993860), confirmed through phylogenetic tree construction based on the glta gene (Figure 2). In addition to these results, Rickettsia sp. from H. lagrangei (Accession number = KP637158) grouped with Rickettsia tamurae (Accession number = AF394896) and R. monacensis (Accession number = KC993860), whereas the Rickettsia sp. from H. bispinosa (Accession number = KP637155) is closely related to Rickettsia sp. strain Kagoshima6 (Accession number = JQ697956) and R. montana (Accession number = U74756). Phylogenetic analysis revealed that the Anaplasma sp. in H. shimoga (Accession number = KP659195) is closely related to Anaplasma bovis (Accession number = EU181143) and Ehrlichia bovis (Accession number = U03775) (Figure 3). DISCUSSION In the present study, we identified four hard tick species from Thailand (H. lagrangei, H. bispinosa, A. testudinarium, and A. integrum), harboring Rickettsia spp. We also identified Anaplasma sp. closely related to A. bovis in the tick, H. shimoga. The study provided additional data concerning hard ticks and their associations with these bacteria. The phylogenetic analysis revealed that the new rickettsia genotypes from Thailand were closely related to R. tamurae, R. monacensis, and R. montana. The identification of rickettsia closely related to R. tamurae, R. monacensis, and R. montana is important for understanding the epidemiology of tick-borne diseases in Thailand, because these three species are the causative agent of human diseases. For example, the first clinical case of R. tamurae infection was reported in the western region of Central Japan in 2011 (Imaoka et al. 2011), although R. tamurae was first identified in 2006 (Fournier et al. 2006). The identification of a novel rickettsia species of unknown pathogenicity is significant because later recognition of its role as a pathogen or symbiont is possible, as has been the case for some past species. Rickettsia species closely related to R. tamurae from Thailand were detected in A. testudinarium, the same R. tamurae tick species frequently isolated in Japan (Mahara 1997). These findings also suggest the risk for rickettsioses outbreaks in Thailand. Jado et al. (2006) identified R. monacensis as a cause of acute tick-borne rickettsiosis in two humans. The pathogenic role of these bacteria was assessed through culture and detection in patient blood samples. In addition, R. montana are also pathogenic rickettsiae. Several tick species removed from humans were positive for R. montana (Stromdahl et al. 2001). In the present study, we examined Rickettsia spp. in hard ticks. SFGR genotypes were detected in two species of ticks, A. testudinarium and Haemaphysalis ornithophila (Hirunkanokpun 2003). Studies have shown that H. lagrangei harbors SFGR (Ahantarig et al. 2011). Several species of rickettsia have been detected in Thailand, including Rickettsia sp. strain ATT, Rickettsia strain RDa 420, Rickettsia sp. strain 2464, and R. honei strain TT-118 (Ahantarig et al. 2008). However, epidemiological studies of spotted fever in Thailand report a higher number of actual cases compared with published reports, as these diseases are often misdiagnosed or underdiagnosed when the eschar or rash (the hallmark for Rickettsioses) is absent, and local physicians typically do not recognize these diseases. The results of the present

5 266 Journal of Vector Ecology December c ha nge s R ic k e ttsia hone i -A F R ic k e ttsia slov ac a-u R ic k e ttsia c onorii -U R ic k e ttsia park e ri-u R ic k e ttsia afric ae -U R ic k e ttsia sibiric a-u R ic k e ttsia he ilongjiange nsis -A F R ic k e ttsia japonic a -U R ic k e ttsia raoultii -D Q R ic ke ttsia sp. H B P K 1 R ic k e ttsia sp. strain K agoshim a6-jq Rickettsia m ontana -U Rickettsia m assiliae -U R ic k e ttsia rhipic e phali -U R ickettsia tam urae strain A T1-A F R ic ke ttsia sp. A T P K Rickettsia m onacensis-k C R ic ke ttsia sp. A L K Y R ic ke ttsia sp. H L P K R ic k e ttsia he lv e tic a-u R ic k e ttsia c anade nsis-u Rickettsia prow azekii-m R ic k e ttsia ty phi -U R ic k e ttsia be llii-u Figure 2. Phylogenetic analysis (Maximum parsimony) of the Rickettsia glta sequences. The outgroup for the analysis was Rickettsia bellii. W olbachia pipientis -A F Ehrlichia bovis-a F A naplasm a sp. H SP K Anaplasm a bovis-eu Ehrlichia bovis-u Anaplasm a sp. South A frica-a Y Anaplasm a phagocytophilum -K F Anaplasm a phagocytophilum -K F E hrlic hia sp.-a J E hrlic hia e qui -M Anaplasm a platys-jf c ha nge s Ehrlichia platys -M A naplasm a ov is O V I-A F Anaplasm a m arginale -A F Figure 3. Phylogenetic analysis (Maximum parsimony) of the Anaplasma 16S rdna. The outgroup for the analysis was Wolbachia pipientis.

6 Vol. 40, no. 2 Journal of Vector Ecology 267 study provide additional information supporting the impact of spotted fever on Thai public health (Parola et al. 2003, Suttinont et al. 2006). Moreover, we provided the first evidence of A. bovis in H. shimoga. However, additional Anaplasma species, such as Anaplasma platys, have been identified in Rhipicephalus sanguineus on dogs in Thailand (Foongladda et al. 2011). These data suggest that domestic dogs might serve as reservoir hosts in rural areas or villages near the forest, and additional surveys and pathogen screening of tick species will increase the current understanding of the disease transmission cycle. The observation that ticks are present on the vegetation along natural trails where tourists walk suggests that as humans, ticks, and animals are located in the same area, tourists should be cautious of tick-biting. The results of this research provide information concerning the geographical distribution of tick species in Thailand, and this information can be applied for ecotourism management and provide additional information concerning tick-borne diseases in Thailand. Acknowledgments This study was supported by grants from the Faculty of Science, Mahidol University, Thailand (SCM55-004), a Mahidol University Research grant (and SCJV ), the Biodiversity Research and Training Programme (BRT T252060), and the Higher Education Research Promotion (HERP), Thailand. REFERENCES CITED Ahantarig, A., W. Trinachartvanit, and J. Milne Tickborne pathogens and diseases of animals and humans in Thailand. Southeast Asian J. Trop. Med. Publ. Hlth. 39: Ahantarig, A., P. Malaisri, S. Hirunkanokpun, C. Sumrandee, W. Trinachartvanit, and V. Baimai Detection of Rickettsia and a novel Haemaphysalis shimoga symbiont bacterium in ticks in Thailand. Curr. Microbiol. 62: Ando, S., M. Kurosawa, A. Sakata, H. Fujita, K. Sakai, M. Sekine, M. Katsumi, W. Saitou,Y. Yano, N. Takada, A. Takano, H. Kawabata, N. Hanaoka, H. Watanabe, I. Kurane, and T. Kishimoto Human Rickettsia heilongjiangensis infection, Japan. Emerg. Infect. Dis. 16: Black, W.C. and J. Piesman Phylogeny of hard-and softtick taxa (Acari: Ixodida) based on mitochondrial 16S rdna sequences. Proc. Natl. Acad. Sci. USA 91: Chung, M.H., S.H. Lee, K. Mi-Jeong, L.Jung-Hee, K. Eun- Sil, L. Jin-Soo, K. Mee-Kyung, P. Mi-Yeoun, and K. Jae-Seung Japanese Spotted Fever, South Korea. Emerg. Infect. Dis. 12: Foongladda, S., D. Inthawong, U. Kositanont, and J. Gaywee Rickettsia, Ehrlichia, Anaplasma, and Bartonella in ticks and fleas from dogs and cats in Bangkok. Vector Borne Zoonot. Dis. 11: Fournier, P.E., N. Takada, H. Fujita, and D. Raoult Rickettsia tamurae sp. nov., isolated from Amblyomma testudinarium ticks. Int. J. Syst. Evol. Microbiol. 56: Fujisawa, T., T. Kadosaka, H. Fujita, S. Ando, A. Takano, Y. Ogasawara, H. Kawabata, and M. Seishima Rickettsia africae infection in a Japanese traveller with many tick bites. Acta Derm. Venereol. 92: Hirunkanokpun, S., P. Kittayapong, J.P. Cornet, and J.P. Gonzalez Molecular evidence for novel tickassociated spotted fever group rickettsiae from Thailand. J. Med. Entomol. 40: Imaoka, K., S. Kaneko, K.Tabara, K. Kusatake, and E. Morita The first human case of Rickettsia tamurae Infection in Japan. Case Rprt. Dermatol. 3: Jado, I, R. Escudero, H. Gill, M.I. Jiménez-Alonso, R Sousa, A.L. García-Pérez, M. Rodríguez-Vargas, B. Lobo, and P. Anda Molecular method for identification of Rickettsia species in clinical and environmental samples. J. Clin. Microbiol. 44: Kollars Jr., T., B. Tippayachai, and D. Bodhidatta Short report: Thai tick typhus, Rickettsia honei, and a unique rickettsia detected in Ixodes granulatus (Ixodidae:Acari) from Thailand. Am. J. Trop. Med. Hyg. 65: Li, H., Y.C. Zheng, L. Ma, N. Jia, B.G. Jiang, R.R. Jiang, Q.B. Huo, Y.W. Wang, H.B. Liu, Y.L. Chu, Y.D. Song, N.N. Yao, T. Sun, F.Y. Zeng, J.S. Dumler, J.F. Jiang, and W.C. Cao Human infection with a novel tick-borne Anaplasma species in China: a surveillance study. Lancet Infect. Dis. pii: S (15) doi: / S (15) Mahara, F Japanese spotted fever: report of 31 cases and review of the literature. Emerging Infect. Dis. 3: Parola, P., R.S. Miller, P. McDaniel, S.R. Telford III, J.M. Rolain, C. Wongsrichanalai, and D. Raoult Emerging rickettsioses of the Thai-Myanmar border. Emerging Infect. Dis. 9: Rymaszewska, A. and S. Grenda Bacteria of the genus Anaplasma characteristics of Anaplasma and their vectors: a review. Vet. Med. Czech. 53: Sirisanthana, T., V. Pinyopornpanit, V. Sirisanthana, D. Strickman, D.J. Kelly, and G.A. Dasch First cases of spotted fever group rickettsiosis in Thailand. Am. J. Trop Med. Hyg. 50: Stromdahl, E.Y., S.R. Evans, J.J. O Brien, and A.G. Gutierrez Prevalence of infection in ticks submitted to the human tick test kit program of the U.S. Army Center for Health Promotion and Preventive Medicine. J. Med. Entomol. 38: Sun, J., Q. Liu, L. Lu, G. Ding, J. Guo, G. Fu, J. Zhang, F. Meng, H. Wu, X. Song, D. Ren, D. Li, Y. Guo, J. Wang, G. Li, J. Liu, and H. Lin Coinfection with four genera of bacteria (Borrelia, Bartonella, Anaplasma, and Ehrlichia) in Haemaphysalis longicornis and Ixodes sinensis ticks from China. Vector Borne Zoonot. Dis. 8: Suttinont, C., K. Losuwanaluk, K. Niwatayakul, S. Hoontrakul, W. Intaranongpai, S. Silpasakorn, D. Suwancharoen, P.

7 268 Journal of Vector Ecology December 2015 Panlar, W. Saisongkorh, J. M. Rolain, D. Raoult, and Y. Suputtamongkol Causes of acute, undifferentiated, febrile illness in rural Thailand: results of a prospective observational study. Ann. Trop. Med. Parasitol. 100: Tanskul, P.L. and I. Inlao, Keys to adult ticks of Haemaphysalis Koch, 1844, in Thailand with notes on changes in taxonomy (Acari: Ixodoidea: Ixodidae). J. Med. Entomol. 26: Walker, J.B., J.E. Keirans, and I.G. Horak The genus Rhipicephalus (Acari, Ixodidae): A Guide to the Brown Ticks of the World. Cambridge University Press, Cambridge.