ROLE OF MEMBRANE BOUND G-PROTEIN COUPLED ESTROGEN RECEPTOR GPR30 AND Z-LINKED RIBOSOMAL GENE S6 (RPS6) IN SEXUALLY

Transcription

1 ROLE OF MEMBRANE BOUND G-PROTEIN COUPLED ESTROGEN RECEPTOR GPR30 AND Z-LINKED RIBOSOMAL GENE S6 (RPS6) IN SEXUALLY DIMORPHIC DEVELOPMENT OF THE ZEBRA FINCH BRAIN A dissertation submitted to Kent State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy by Kalpana D. Acharya August 2012

2 Dissertation written by Kalpana D. Acharya B.A.M.S., Tribhuvan University, 2004 Ph.D., Kent State University, 2012 Approved by Dr. Sean L. Veney Dr. Gail C. Fraizer Dr. Heather K. Caldwell Dr. Eric M. Mintz Dr. Chun-Che Tsai, Chair, Doctoral Dissertation Committee, Member, Doctoral Dissertation Committee, Member, Doctoral Dissertation Committee, Member, Doctoral Dissertation Committee, Member, Doctoral Dissertation Committee Accepted by Dr. Robert V. Dorman Dr. John R.D. Stalvey, Director, School of Biomedical Sciences, Dean, College of Arts and Science ii

3 TABLE OF CONTENTS LIST OFABBREVIATIONS.... vi LIST OF FIGURES x LIST OF TABLES... xii ACKNOWLEDGEMENTS. xiii DEDICATION.....xv OVERALL ABSTRACT....1 CHAPTER I. Introduction Sexual differentiation of the vertebrate nervous system Hormone mediated brain dimorphisms Non-hormonal regulation of brain dimorphisms Zebra finch: A model for sexual dimorphisms Hormonal regulation of zebra finch differentiation Genetic regulation of zebra finch brain differentiation Overall aims References iii

4 CHAPTER II. Characterization of the G-protein coupled membrane bound estrogen receptor GPR30 in the zebra finch brain reveals a sex difference in gene and protein expression (Published online in Journal of Developmental Neurobiology: DOI: /dneu Abstract Introduction Materials and methods Results Discussion Acknowledgements References CHAPTER III. Use of differential display reverse transcription (DDRT) PCR to identify differentially expressed genes in the telencephalon of early post-hatching male and female zebra finches..82 Abstract Introduction Materials and methods Results Discussion References iv

5 CHAPTER IV. Sexually dimorphic expression and estradiol mediated up-regulation of the Z-linked ribosomal gene rps6 in the zebra finch brain Abstract Introduction Materials and methods Results Discussion References CHAPTER V. Global discussion Future directions References v

6 LIST OF ABBREVIATIONS A......arcopallium AA.. anterior arcopallial nucleus AVP.....vasopressin AVPV.. anteroventral periventricular region of the hypothalamus Bas..baso-rostral pallial nucleus BDNF... brain derived neurotrophic factor IGF-II....insulin growth factor-ii BNSTp..... posterior region of the bed nucleus of the stria terminalis Cb.,,.. cerebellum CoA anterior commissure DDRT-PCR... differential display reverse transcription PCR DHT dihydrotestosterone DIG..... digoxigenin DLM dorsolateral nucleus of the medial thalamus E entopallial nucleus E.... embryonic E estradiol EB.....estradiol benzoate vi

7 ERE estrogen response element ERα estrogen receptor α ERαKO estrogen receptor α knock-out mice ERβ estrogen receptor β FA......fronto-arcopallial tract GP......globus pallidus GPR30.. G-protein coupled estrogen receptor G s..... stimulatory G-protein HA apical hyperpallium HD dorsal hyperpallium HP.....hippocampus IEG immediate early gene IHC.... immunohistochemistry IPTG...isopropyl-β-D-thiogalactopyranoside ir immunoreactive ISH in situ hybridization LMAN......lateral magnocellular nucleus of the anterior nidopallium LSt lateral striatum M mesopallium MePD postero-dorsal region of the amygdala MSt medial striatum N nidopallium vii

8 NC caudal nidopallium NCM caudomedial nidopallium Rt nucleus rotundus Nif nucleus interface of the nidopallium nxiit.....tracheosyringeal branch of the hypoglossal nucleus P post-hatching PBF phosphate buffered formalin PBS phosphate buffered saline ORF opening reading frame PI3K phosphoinositol-3 kinase RA......robust nucleus of arcopallium RP.. ribosomal protein RT. reverse transcription SDN-POA...sexually dimorphic nucleus of the pre-optic area SNB....spinal nucleus of bulbocavernosus Sry..... sex-determining region Y SSC.. sodium-chloride-sodium citrate buffer T.. testosterone TEA..... triethanolamine TeO... optic tectum Tfm. testicular feminization mutation TH.... tyrosine hydroxylase viii

9 Tn nucleus taeniae of the amygdala TP.... testosterone propionate Uva.....uvaeformis nucleus V ventricle ix

10 LIST OF FIGURES Page CHAPTER I. Introduction FIGURE 1.1. Flowchart representing the development of brain sex differences as a combined effect of genetic and hormonal sex that gives rise to phenotypic sex...4 FIGURE 1.2. Schematic drawing of the song control regions (showing the posterior forebrain (motor) pathway and anterior forebrain (song learning) pathway) FIGURE 1.3. A gynandromorphic zebra finch with male-specific plumage (zebra stripes and orange cheek patch) on the right side, and female specific plumage (no stripes or cheek patch) on the left side CHAPTER II. Characterization of the G-protein coupled membrane bound estrogen receptor GPR30 in the zebra finch brain reveals a sex difference in gene and protein expression. FIGURE 2.1. Multiple alignments of GPR30 homologues in mouse, rat, human, zebra finch and chicken using clustalw2 program FIGURE 2.2. Relative expression of the GPR30 gene in the zebra finch telencephalon during development and adulthood x

11 FIGURE 2.3. Western blot confirming the specificity of the GPR30 polyclonal antibody FIGURE 2.4. Camera lucida drawings representing the relative intensity of GPR30 immunoreactivity at P FIGURE 2.5. Numbers of GPR30- ir cells counted within a 0.01mm 2 area of HVC...56 FIGURE 2.6. Photomicrographs of GPR30-ir cells in HVC FIGURE 2.7. Numbers of GPR30- ir cells counted within a 0.01 mm 2 area of RA FIGURE 2.8. Photomicrographs of GPR30- ir cells in RA FIGURE 2.9. Numbers of GPR30- ir cells counted within a 0.01mm 2 area of LMAN...61 CHAPTER III. Use of differential display reverse transcription (DDRT) PCR to identify differentially expressed genes in the telencephalon of early post-hatching male and female zebra finches. FIGURE 3.1. Gel showing amplified bands using DDRT- PCR FIGURE 3.2. Bands representing ribosomal gene S6 (rps6) cdna amplified using DDRT-PCR CHAPTER IV. Sexually dimorphic expression and estradiol mediated up-regulation of the Z-linked ribosomal gene rps6 in the zebra finch brain. FIGURE 4.1. Relative expression of rps6 gene in the zebra finch telencephalon.108 xi

12 FIGURE 4.2. RpS6 labeling in HVC of a P10 male and female zebra finch FIGURE 4.3. RpS6 labeled cells counted within a 0.09mm 2 area of HVC in P10 males and females FIGURE 4.4. RpS6 labeling in RA of a P10 male and female FIGURE 4.5. RpS6 labeled cells counted within a 0.09mm 2 area of RA in P10 males and females FIGURE 4.6. Effect of E 2 treatment on rps6 gene expression in P21 male and female zebra finch telencephalon CHAPTER V. Global Discussion. Figure 5.1. Proposed mechanism of membrane bound estrogen receptor GPR30 and rps6 gene in dimorphic development of the neural song system in zebra finch..130 LIST OF TABLES Page Table 2.1: Ages chosen for q-pcr and their significance Table 3.1: Differentially expressed genes in the telencephalon of P3 and P8 animals as identified by DDRT-PCR, their chromosomal location and the direction of expression..90 Table 4.1: Ages chosen for q-pcr and their significance xii

13 ACKNOWLEDGEMENTS First and foremost, I would like to thank my PhD advisor, Dr. Sean Veney for his tremendous guidance and support throughout my graduate life. Coming from a totally different academic background, I was very new to most of the research techniques and protocols when I joined his lab. On top of it, my thick accent surely wasn t a pleasant addition to the situation. Despite these issues, throughout the years in his lab, he has been very motivating and constructive of my mistakes. His consistent positive feedback has been the main fuel for building confidence in me that I lacked a great deal. In addition to excellent guidance in research and academic work, his extremely understanding nature has further increased my respect towards him. Whether it were those difficult times when I had to make two or more emergency visits per week to the hospital, or my theme last minute shocks, he never showed any disappointment or frustration, but provided me whatever it took to cope with those situations. Had I not been blessed with such a PI, I wouldn t have gotten the chance to be where I am now. I am also very grateful to Dr. Eric Mintz for his immense help and guidance. I appreciate his answers for all types of problems from technical, research related to statistical ones, and for assurance through ups and downs of graduate life. I just hope every institution has someone like him who is there to deeply care about students. I would also like to thank Dr. Fraizer for her help with molecular biology techniques and protocols, and consistent feedback for my research. Additionally, I thank Dr. Caldwell for her guidance xiii

14 and her additional help outside of the research. I am also grateful to Dr. Tsai for his valuable feedback on my research. I cannot imagine being able to finish my PhD degree without continuous support from my husband, Dr. Gyanu Acharya. He has always put me first and has provided me all opportunities I would wish for. Most importantly, he has sacrificed excellent career opportunities trying to make sure I am not deprived of any. He has been the best dad for our two boys and has given them love and care above and beyond any limits. I am thankful to two stars of my eyes, Aditya and Adwait. They are the main source of my energy and inspiration every day. I am extremely indebted to my father, Ram Mani Duwadi and my mother, Amrita Duwadi for EVERYTHING they have done to me. No words will be sufficient to thank them enough! I am also grateful to my grandparents, especially to my grandmother, who came all the way here and stayed with me for almost a year to make sure that I could continue my research without any interruption. I also want to extend my thanks to my younger brothers Kapil and Kanchan for their support and love. I would also like to extend my gratitude to past and present colleagues in Veney lab. Specifically, Andie and Andrew have been true friends, and have been there for me through good and rough times. I would like to extend my thanks to Judy for her help xiv

15 with not only department and course related issues but being there for me as a great friend. DEDICATION I would like to dedicate this dissertation to my mother whom I miss every day and wish that I could share all my joys and sorrows with her! xv

16 OVERALL ABSTRACT Neural dimorphisms in the songbird represent one of the most extreme examples of sex differences observed in vertebrates. Interestingly however, despite their identification more than four decades ago, information on the exact mechanisms related to how they arise is very limited. In this dissertation, I provide evidence supporting a potential role of the membrane bound G-protein coupled estrogen receptor GPR30, in estrogenmediated dimorphic brain development of the zebra finch. In particular, this receptor may directly regulate sex differences within song nucleus HVC. Since brain dimorphisms are not completely dependent on sex steroids, the second part of my dissertation identified possible gene candidates that may also be involved. More specifically, I present evidence for a potential role of the Z-linked ribosomal gene rps6 in the development and maintenance of dimorphic features in song nuclei HVC and RA where it is enhanced in males than in females. I sum up this dissertation by providing evidence that the function of rps6 is likely modulated by estrogens, as evidenced by its up-regulation in the presence of estradiol. Taken together, my work provides a model for how genetic and hormonal factors may function to affect neural dimorphisms in the zebra finch. 1

17 CHAPTER I INTRODUCTION SEXUAL DIFFERENTIATION OF THE VERTEBRATE NERVOUS SYSTEM Sex differences in the central nervous system are common features among vertebrates (Cooke et al., 1998; Simerly, 2002; Morris et al., 2004). For example, humans, primates, rodents, and marsupials express dimorphisms in neuronal morphology, physiology and neurochemistry that directly correlate with sex-specific behaviors. Many of these neural differences are permanently organized by exposure to different levels of sex hormones during the perinatal period of development. The sex hormones are primarily secreted from the gonads, which initially develop based on which sex chromosomes are present. In mammals, X and Y are the sex chromosomes; with males being the heterogametic sex (XY) and females the homogametic sex (XX). Located on the Y chromosome is a sexdetermining region Y (sry) that is necessary and sufficient for the formation of testes from an initially bi-potential gonad (Goodfellow and Lovell-Badge, 1993). In females, the absence of the Y chromosome, and thus the absence of the sry gene, initiates the development of ovaries. Soon after the testes are formed (around embryonic (E) day in mice (Karl and Capel, 1998) and rats (Tapanainen et al., 1984; Paranko et al., 1986), and during the 7 th -8 th week of gestation in humans (Tapanainen et al., 1984) they 2

18 3 produce androgens; primarily testosterone (T) and its metabolite dihydrotestosterone (DHT). Both hormones are released into the general circulation where they act to further amplify the masculinization of the partially differentiated gonad. Whereas formation of the testes and development of the associated male reproductive structures are completely masculinized by these hormones, the brain is not. In many mammals including rodents, T can masculinize some parts of the brain, however the vast majority of masculinizing effects occur after its conversion into estradiol (E 2 ); a reaction mediated by the aromatase enzyme. Aromatase is abundantly present in the brain and mediates the local production of E 2 from T (Naftolin and MacLusky, 1984; Lephart, 1996). The resulting estradiol can then bind to estrogen receptors. While T serves as a primary precursor, some androgens, like DHT, cannot be converted into estrogens. Comparatively speaking, in females the ovaries are quiescent during this same period, so the lack of androgens and estrogens results in feminine brain and gonadal development (Figure 1.1). HORMONE MEDIATED BRAIN DIMORPHISMS There are several examples of sex differences in brain morphology and physiology that develop due to the actions of steroid hormones. One such nucleus in the rodent brain, for example, that is masculinized by estrogens is a specific region in the medial pre-optic area of the hypothalamus. This region contains more neurons, and is larger in males than in females (Raisman and Field, 1971, 1973). Later, Gorski and colleagues identified a similar region in rats that contained densely packed neurons and was many times larger in

19 4 Figure 1.1. Flowchart representing the development of brain sex differences in mammals as a combined effect of genetic and hormonal sex that gives rise to phenotypic sex.

20 5 males than in females, thus appropriately named it the sexually dimorphic nucleus of the the pre-optic area (SDN-POA), (Gorski et al., 1980). An analogous nucleus to the SDN-POA was also identified in quails and was named as the medial preoptic nucleus (POM) (Panzica et al., 1987). Since its initial discovery in rats and quails, this nucleus has additionally been described to be larger in other male vertebrates including ferrets (Tobet et al., 1986), gerbils (Commins and Yahr, 1984), guinea pigs (Hines et al., 1985), and humans (Hofman and Swaab 1989; Allen et al., 1989). The SDN-POA is required for copulatory behaviors in male rats, gerbils and quails (De Jonge et al., 1989; Balthazart and Surlemont, 1990; Balthazart et al., 1990; Yahr and Gregory 1993), but its specific role in other mammals in which it has been identified is not clear (reviewed in Cooke et al., 1998). Administration of E 2 or testosterone propionate (TP; an analog of T) shortly after birth masculinizes the volume and the size of neurons within the SDN-POA of females, whereas gonadectomy on the day of birth (Jacobson et al., 1981) or inhibition of aromatase in males (Ohe, 1994) feminizes the nucleus. The inability of the nonaromatizable androgen DHT to masculinize this region in either sex (Korenbrot et al., 1975), combined with the fact that Tfm (testicular feminization mutation) male rats who do not express functional androgen receptors have a normal sized nucleus (Jacobson, 1980) indicate the exclusive role of estrogens, but not androgens in the masculinization of the SDN-POA.

21 6 Although estrogens are mainly responsible for masculinizing many regions of the brain, in some areas, these hormones actively feminize (make smaller) morphological features in other brain areas. For example, the anteroventral periventricular region of the hypothalamus (AVPV), which is larger and has more dopaminergic neurons (containing its precursor, tyrosine hydroxylase; TH) in females as compared to males (Simerly et al., 1985), contains dense expression of estrogen receptors, but no androgen receptors. Exposure to TP (acting on estrogen receptors) during the neonatal period reduces the number of TH immunoreactive (ir) neurons (Simerly et al., 1985), and the size of the nucleus (Davis et al., 1996) in female rats. A similar effect on TH immunoreactivity was observed in the AVPV of Prairie voles after the administration of TP or estradiol benzoate (EB) during the first week after birth (Lansing and Lonstein, 2006). The number of TH-ir neurons is significantly increased in estrogen receptor α knockout male mice (ERαKO) as compared to wild type males. Moreover, there is no difference in the number of TH-ir cells in the AVPV of Tfm males and wild type males (Simerly et al., 1997), all suggesting that the hormonal effect in this region is purely estrogenic. As it turns out, not all brain regions rely exclusively on E 2 for masculinization or feminization. For example, the postero-dorsal region of the medial amygdala (MePD) and the posterior region of the bed nucleus of the stria terminalis (BNSTp) are both masculinized following exposure to androgens (aromatizable and non-aromatizable) or estrogens. The MePD is larger in volume, and contains more neurons with bigger soma sizes in male rodents than in females (Guillamon and Segovia, 1996; Cooke et al., 2003;

22 7 Morris et al., 2008a). This region has more androgen and estrogen receptors, as well as more aromatase containing neurons in male mice as compared to females (Simerly et al., 1990; Wu et al., 2009). The MePD can be masculinized by androgens or estrogens (Nishizuka and Arai, 1981), with the effect being larger when both hormones are used in combination (Cooke et al., 2003). Although a majority of the hormonal effects in this region occur during the organizational period of development (perinatally), either E 2 or androgens can further masculinize the MePD later in life (Cooke et al., 1999), with the effect of E 2 being larger as compared to non-aromatizable androgens (Cooke et al., 2003). The size of MePD in adults changes with the fluctuation of sex hormones suggesting the activational effects to be transient (Morris et al., 2008b). The BNSTp is another sexually dimorphic nucleus that is larger and contains more vasopressin (AVP) expressing neurons in male rats than in females (Del Abril et al., 1987). Similar to the MePD, it also contains more androgen and estrogen receptors in males, and can be masculinized by the perinatal actions of androgens or estrogens (Hines et al., 1985; Guillamon et al., 1988; Han and De Vries, 2003). Whereas castration of male rats on the day of birth decreases the number of AVP-ir neurons to the levels typical of females, either TP or DHT administration during early postnatal period restores it to normal male levels (Wang et al., 1993). AVP neurons in BNSTp are also responsive to sex hormones in adulthood since gonadectomy reduces AVP expression and replacement of TP reinstates it during this period (De Vries et al., 1984). Taken together, these results indicate that androgens or estrogens can masculinize at least two regions of the brain, the

23 8 BNSTp and the MePD, with a larger masculinizing effect occurring when these regions are exposed to both hormones. Thus far, I have discussed how E 2 has both masculinizing and feminizing effects on the brain. I also talked about how some brain regions are masculinized by the actions of androgens or estrogens; or the additive effect of both. Under a third scenario, studies have demonstrated that there are nuclei in the CNS that are masculinized only by androgens and not estrogens. An example of such a case is observed in the sexually dimorphic spinal nucleus of bulbocavernosus (SNB). Motoneurons from this nucleus innervate perineal muscles bulbocavernosus (BC) and levator ani (LA), and are required for male copulatory behavior. The SNB is present in both sexes, and is monomorphic up until early postnatal ages. At that point, in females, the nucleus and target muscles significantly shrink in size due to the absence of androgens (Breedlove, 1992; Forger et al., 1992). In males, the nucleus and muscles grow. The SNB can be restored in females if they are treated with TP (which activate androgen receptors) or DHT within the first week after birth (Breedlove and Arnold, 1983). In Tfm males, the SNB is greatly reduced comparable to females, suggesting that the effect of hormones on the nucleus is exclusively mediated by androgens (Breedlove and Arnold, 1981). The dendrites of SNB neurons as well as target muscle of this nucleus in males can also be increased by androgens during adulthood (Rand and Breedlove, 1995).

24 9 To sum up, region-specific responses are observed in the nervous system that may be regulated by estrogens only, androgens only, or by the exposure to both groups of hormones. Collectively, they all provide evidences for the hormonal regulation of brain dimorphisms. However, some brain regions in mammals as well as some nonmammalian vertebrates display dimorphisms that do not appear to be regulated by sex hormones. NON-HORMONAL REGULATION OF BRAIN DIMORPHISMS Dimorphisms that arise and are maintained in the absence of the sex hormones, or ones that cannot be altered or reversed by pharmacological manipulation of hormones during the critical period of brain development, suggest the role of non-hormonal factors in the process. There are several dimorphisms that have been described in mammals which occur prior to the formation of gonads, and thus likely occur independent of sex hormones. For example, embryos of male rats, mice and cattle are bigger than those of females prior to hormone production from the gonads (Scott and Holson, 1977; Tsunoda et al., 1985; Gardner and Leese, 1987; Avery et al., 1991; Xu et al., 1992). Similarly, TH-ir neurons in the diencephalon of male rats at E14 (before the brain is exposed to a sexually dimorphic level of sex steroids) are larger in males than in females, and are not affected by manipulations of either T or E 2 (Beyer et al., 1991). Instead, TH expression in these neurons can be decreased by down-regulating the sry gene, suggesting the difference to be created by sex-linked gene(s) (Beyer et al., 1991; Dewing et al., 2006). In general, sry and many other sex-linked genes are differentially expressed in the brain

25 10 of embryonic male and female mice before the formation of gonads, and thus may play an essential role in dimorphic brain development (Dewing et al., 2003). ZEBRA FINCH: A MODEL FOR SEXUAL DIMORPHISM In light of the possibility that hormones are not the only factors that are important for brain dimorphisms, the central question becomes what are the specific genes directly regulating this process? To address this question, zebra finches have become a very useful model. They exhibit one of the most extreme sex differences in brain morphology and behavior among all animals. In this species, there is a group of sexually dimorphic nuclei that are more robust in males, and are responsible for the male-exclusive singing behavior that females are not normally capable of producing (Gurney and Konishi, 1980; Goldman and Nottebohm, 1983; Wade, 2001; Wade and Arnold, 2004). These nuclei are interconnected to form two functional circuits (Nottebohm and Arnold, 1976; Gurney, 1982; Konishi and Akutagawa, 1985). One circuit is responsible for song learning and the other for song production. The song learning pathway consists of telencephalic nucleus HVC (used as a proper name), which is connected indirectly to the lateral magnocellular nucleus of the anterior nidopallium (LMAN). The song production pathway consists of HVC connected to the robust nucleus of arcopallium (RA) that sends projections to the vocal organ (syrinx) via the tracheosyringeal branch of the hypoglossal nucleus (nxiits). The motor nucleus HVC gets auditory feedback from two nuclei; uvaeformis nucleus (Uva) and the nucleus interface of the nidopallium (Nif) (Nottebohm

26 11 et al., 1976; Bottjer et al., 1985; Konishi and Akutagawa, 1985; Figure 1.2). There are dimorphisms at several levels within the song circuit. For example, the volumes of HVC, RA, LMAN and nxiits are bigger in males than females. This is partially due to a greater number, size and spacing between neurons within these nuclei. Area X can only be identified in males with a Nissl stain (Nottebohm and Arnold, 1976). And the synaptic connections between HVC and RA are more robust in males (Konishi and Akutagawa, 1985). Hormonal regulation of zebra finch brain differentiation When zebra finches were first used in experiments related to brain development, they were investigated to determine if hormones played a similar role in brain dimorphisms as was observed in mammals. To test this, estrogens as well as androgens were manipulated. Based on the studies in which DHT or TP administration to post-hatching females did not significantly masculinize the song system, the role of androgens was arguably determined to be less important for masculinization of the song system (Gurney ME, 1981; Schlinger and Arnold, 1991). In contrast, E 2 does significantly masculinize the brain of female zebra finches. When females are treated with elevated pharmacological doses within the first few weeks after hatching, they develop a partially masculinized song circuit. This is marked by an increase in the volume of song regions, an increase in the number and size of neurons within these areas as well as the formation of Area X, which is normally not detectable in

27 12 Figure 1.2. Schematic drawing of the song control regions. The black arrows connect the posterior forebrain (motor) pathway, the white arrows show connections within nuclei of anterior forebrain (song learning) pathway and the dotted lines connect the two pathways. HVC: acronym used as the proper name; RA: robust nucleus of the arcopallium; X: Area X; DLM: dorsolateral nucleus of the medial thalamus; LMAN: lateral magnocellular nucleus of anterior nidopallium; nxiits: the tracheosyringeal portion of the hypoglossal nucleus; Uva: nucleus uvaeiformis; NIf: nucleus interface of the nidopallium. (Reproduced with some modifications from Reiner etal., 2004).

28 13 females (Gurney and Konishi, 1980; Gurney, 1981; Simpson and Vicario, 1991; Grisham et al., 1994; Adkins-Regan et al., 1994). Interestingly, even at the highest doses, the morphological effects in treated females are still less than what appears in normal males, suggesting that other factors are likely involved. The effects of E 2 in females are organizational, and are limited to early development. The efficacy of this hormone on the song system is diminished by post-hatching day (P) 30, and has even less effect on the brain after P45 (Konishi and Akutagawa, 1988; Simpson and Vicario, 1991). Based on the masculinizing effects of E 2 in females, it can be predicted that the male brain would be demasculinized when deprived of the hormone, similar to what occurs in many regions of the mammalian brain. Curiously, most studies have reported that preventing the synthesis or action of gonadal E 2 is not sufficient to demasculinize the song system (Wade and Arnold, 1994; Balthazart et al., 1994; Wade et al., 1999). In particular, neither castration at or shortly after birth, nor the exposure to aromatase inhibitors (fadrozole or vorozole) were sufficient to cause a significant demasculinization (Wade and Arnold 1994, Foidart and Balthazart, 1995). Similarly, attempts to block E 2 action by using antagonists such as tamoxifen, LY or CI628 also have been unsuccessful (reviewed in Wade and Arnold, 2004). In contrast, results from our lab have demonstrated demasculinization in some features of the song system when the brain was deprived of E 2. In one study, intracranial injections of the estrogen receptor (ERα) antagonist, ICI 182,780 for 25 days after hatching resulted in a reduction of neuron soma sizes in both sexes (Bender and Veney, 2008). In an additional study, intracranial

29 14 administration of the aromatase inhibitor fadrozole decreased neuron soma size as well as the nuclear volumes of HVC and RA in both males and females (Bender and Veney, personal communication). Although the reasons for the discrepancies between studies are not clear, they may be related to the type of compound used, the dosage, or the route of drug administration. Regardless, even in work from our lab where limiting estrogens did result in significant demasculinzation of the brain, the effects were not detected globally throughout all song control regions, suggesting that other factors are likely involved. And generally speaking, the large number of inconsistencies across studies from other labs makes it difficult to even understand how hormones normally act in this system. The observed sex differences in response to E 2 can be expected to arise as a result of differences in the amount of hormone in the system, or differences in the number of its receptors. In zebra finches, there have been no detectable sex differences in plasma levels of this hormone during early post-hatching development when the brain is in the process of differentiation (Hutchison et al., 1984; Adkins- Regan et al., 1990; Schlinger and Arnold, 1992). Additionally, the available information on estrogen receptors is not conclusive. In particular, the nuclear receptors for estrogens (ERα and ERβ) are the only ones that have been investigated in the zebra finch brain to date. The distribution of ERα mrna has been described at various embryonic, post-hatching and adult ages (Jacobs et al., 1996; Jacobs et al., 1999; Perlman and Arnold, 2003; Saldanha and Coomaralingam, 2005). In general, labeling was detected in several telencephalic regions. More

30 15 specifically, within the song circuit, HVC contained abundant ERα positive cells from P10- P25. RA contained a substantially fewer number, but only at P25 (Jacobs et al., 1999). At embryonic ages, song control nuclei are not yet formed. However, areas that are destined to develop into song regions were devoid of labeling (Perlman and Arnold, 2003). In adults (greater than 100 days of age), HVC was the only song control nucleus that contained labeling. Interestingly, at no age was a sex difference in ERα reported, and no study has detected ERα positive cells in LMAN or Area X. In comparison to ERα, ERβ mrna has not been as extensively investigated in zebra finches. At late embryonic (E30, E34) and an early post-hatching age (P1) ERβ mrna was detected in several telencephalic regions, but without a sex difference. There was no indication that areas destined to develop into song regions contained labeling. Preliminary studies from our lab revealed that there is no sex difference in ERβ gene in the telencephalic extract of post-hatching zebra finches. To our knowledge, ERβ has not been described in detail at later ages in the zebra finch, but in the closely related European Starling, its mrna is not found in song regions of adults (Bernard et al., 1999). Thus, a lack of a sex difference in ERα or ERβ suggests the possibility of the presence of additional estrogen receptor(s) in the brain. Genetic regulation of zebra finch brain differentiation

31 16 The partial role of E 2 in the masculinization of the female brain, and the lack of clear sex difference related to plasma hormone levels, receptor availability and distribution, all additionally suggest the possibility of other mechanisms in the regulation of differentiation of the zebra finch song system. One possibility is that sex-linked genes may direct the earliest occurring dimorphisms that may be further enhanced by the action of hormones. Support for the genetic regulation of song system development is provided by a naturally occurring gynandromorphic zebra finch that displayed male typical features on the right half and female typical features on the left half (Agate et al., 2003; Figure 1.3). Avians have Z and W sex chromosomes, and unlike mammals, females are heterogametic (ZW) and males, homogametic (ZZ). The hermaphrodite brain displayed a split genotype as verified by twice the expression of a Z-linked gene pkc-iz in the right half of the brain as compared to the left. The expression of W-linked genes chd1w and asw was restricted to the left half of the brain (Figure 1.3B and 1.3C). This finding is consistent with a lack of dosage compensation in the avian Z chromosome, which has been further verified by examination of their regulatory regions (Itoh et al., 2007; Warren et al., 2010). In addition to the laterality in genotype, the right brain contained a significantly larger HVC than on the left side, suggesting a clear effect of Z-linked genes on masculine morphology. Although sex-linked genes seemed to have the major affect on the song nucleus development, the presence of slightly larger song nuclei in the female half (left) as compared to normal females, suggest some hormonal influence on the dimorphism.

32 17 Figure 1.3. A gynandromorphic zebra finch with the male-specific plumage, zebra stripes, and orange cheek patch on the right side, and female specific plumage without the cheek patch and the stripes on the left side (A). Hybridization signal for a W-gene asw (B), and for a Z-gene pkci-z (C) representing a split genotype on two halves of the brain (obtained from Agate et al., 2003).

33 18 The recent availability of the zebra finch genome has provided additional insights into genetic regulation of brain dimorphisms by providing information about the chromosomal location of genes, their promoters, and regulatory sequences. In avians, unlike in mammals, a homologue for the mammalian sry gene has not been identified. Instead, a completely different mechanism than in mammals seems to be responsible for the genetic regulation of dimorphisms. Specifically, a lack of dosage compensation (Itoh et al., 2007; Warren et al., 2010) suggests that Z-linked genes are expressed in a double dose, and therefore may directly contribute to the masculinization of males. Recent works have identified some candidate genes. Some examples include trkb (neurotrophin receptor; Chen et al., 2005), ribosomal proteins (rp) L17 and L37 (Tang and Wade, 2006), and mitochondrial rps27, which other labs are currently following up on. In each case, expression of these genes is enhanced within specific song nuclei of developing males as compared to females. Given the likelihood that these may not be the only candidates required for zebra finch brain masculinization, as part of this dissertation, I have investigated additional sex-linked genes that may be required for sex-specific neuronal development. OVERALL AIMS The existing evidence in zebra finches collectively suggests a combined role of genes and hormones in the regulation of differential brain development. My dissertation work focused on identifying hormonal and genetic components that are actively involved in this process during various stages of early development, and examined if there is an

34 19 interaction between them. I have put forth following aims to better understand the regulation of sexual dimorphism in the brain. 1. To determine if GPR30 gene and protein expression are dimorphic in the zebra finch brain. 2. To use differential display reverse transcription PCR as a tool to identify differentially expressed genes in the telencephalon of early post-hatching male and female zebra finches. 3. To examine the expression and distribution of rps6 in the zebra finch brain and investigate if the gene expression is affected by estrogens. REFERENCES Adkins-Regan E, Abdelnabi M, Mobarak M, Ottinger MA Sex steroid levels in developing and adult male and female zebra finches (Poephila guttata). Gen Comp Endocrinol 78: Adkins-Regan E, Ascenzi M Sexual differentiation of behavior in the zebra finch: Effect of early gonadectomy or androgen treatment. Horm Behav 24:

35 20 Adkins-Regan E, Mansukhani V, Seiwert C, Thompson R Sexual differentiation of brain and behavior in the zebra finch: Critical periods for effects of early estrogen treatment. J Neurobiol 25: Agate RJ, Grisham W, Wade J, Mann S, Wingfield J, Schanen C, Palotie A, Arnold AP Neural, not gonadal, origin of brain sex differences in a gynandromorphic finch. Proc Nat Acad Sci USA 100: Allen LS, Hines M, Shryne JE, Gorski RA Two sexually dimorphic cell groups in the human brain. J Neurosci 9: Avery B, Madison V, Greve R Sex and development in bovine in-vitro fertilised embryos. Theriogenology 35: Balthazart J, Surlemont C Androgen and estrogen action in the preoptic area and activation of copulatory behavior in quail. Physiol Behav 48: Balthazart J, Foidart A, Hendrick JC The induction by testosterone of aromatase activity in the preoptic area and activation of copulatory behavior. Physiol Behav 47:83-94.

36 21 Balthazart J, Absil P, Fiasse V, Ball, GF Effects of the aromatase inhibitor R76713 on sexual differentiation of brain and behavior in zebra finches. Behav 120: Bender AT, Veney SL Treatment with the specific estrogen receptor antagonist ICI 182,780 demasculinizes neuron soma size in the developing zebra finch brain. Brain Res 1246: Bernard DJ, Bentley GE, Balthazart J, Turek FW, Ball GF Androgen receptor, estrogen receptor α, and estrogen receptor β show distinct patterns of expression in forebrain song control nuclei of European Starlings. Endocrinology 140: Beyer C, Pilgrim C, Reisert I Dopamine content and metabolism in mesencephalic and diencephalic cell cultures: sex differences and effects of sex steroids. J Neurosci 11: Bottjer SW, Glaessner SL, Arnold AP Ontogeny of brain nuclei controlling song learning and behavior in zebra finches. J Neurosci 5:

37 22 Breedlove SM Sexual dimorphism in the vertebrate nervous system. J Neurosci 12: Breedlove SM, Arnold AP Sexually dimorphic motor nucleus in the rat lumbar spinal cord: Response to adult hormone manipulation, absence in androgen-insensitive rats. Brain Res 225: Breedlove SM, Arnold AP Hormonal control of a developing neuromuscular system. II. Sensitive periods for the androgen-induced masculinization of the rat spinal nucleus of the bulbocavernosus. J Neurosci 3: Chen X, Agate RJ, Itoh Y, Arnold AP Sexually dimorphic expression of trkb, a Z-linked gene, in early posthatch zebra finch brain. Proc Natl Acad Sci U S A 102: Commins D, Yahr P Acetylcholinesterase activity in the sexually dimorphic area of the gerbil brain: sex differences and influences of adult gonadal steroids. J Comp Neurol. 1:

38 23 Cooke B, Hegstrom CD, Villeneuve LS, Breedlove SM Sexual differentiation of the vertebrate brain: principles and mechanisms. Front Neuroendocrinol. 4: Review. Cooke BM, Tabibnia G, Breedlove SM A brain sexual dimorphism controlled by adult circulating androgens. Proc Natl Acad Sci USA 96: Cooke BM, Breedlove SM, Jordan C Both estrogen receptors and androgen receptors contribute to testosterone-induced changes in the morphology of the medial amygdala and sexual arousal in male rats. Horm Behav 43: Davis EC, Shryne JE, Gorski RA Structural sexual dimorphisms in the anteroventral periventricular nucleus of the rat hypothalamus are sensitive to gonadal steroids perinatally, but develop peripubertally. Neuroendocrinology 63: Del Abril A, Segovia S, Guillamon A The bed nucleus of the stria terminalis in the rat: regional sex differences controlled by gonadal steroids early after birth. Dev Brain Res 32:

39 24 De Jonge, AL Louwerse, MP Ooms, P Evers, E Endert, NE Van de Poll Lesions of the SDN-POA inhibit sexual behavior of male Wistar rats. Brain Res Bull 23: De Vries GJ, Buijs RM, Sluiter AA Gonadal hormone actions on the morphology of the vasopressinergic innervation of the adult rat brain. Brain Res 298: Dewing P, Shi T, Horvath S, Vilain E Sexually dimorphic gene expression in mouse brain precedes gonadal differentiation. Brain Res Mol Brain Res 118: Dewing P, Chiang CW, Sinchak K, Sim H, Fernagut PO, Kelly S, Chesselet MF, Micevych PE, Albrecht KH, Harley VR, Vilain E Direct regulation of adult brain function by the male-specific factor SRY. Curr Biol 16: Foidart A, Balthazart J Sexual differentiation of brain and behavior in quail and zebra finches: studies with a new aromatase inhibitor, R J Steroid Biochem Mol Biol 53: Forger NG, Hodges LL, Roberts SL, Breedlove SM Regulation of motoneuron death in the spinal nucleus of the bulbocavernosus. J Neurobiol 23:

40 25 Gardner DK, Leese HJ Assessment of embryo viability prior to transfer by the non-invasive measurement of glucose uptake. J Exp Zool 242: Goldman SA, Nottebohm F Neuronal production, migration, and differentiation in a vocal control nucleus of the adult female canary brain. Proc Nat Acad Sci USA 8: Goodfellow PN, Lovell-Badge R SRY and sex determination in mammals. Annu Rev Genet 27: Gorski RA, Harlan RE, Jacobson CD, Shryne JE, Southam AM Evidence for the existence of a sexually dimorphic nucleus in the preoptic area of the rat. J Comp Neurol 193: Grisham W, Mathews,GA, Arnold AP Local intracerebral implants of estrogen masculinize some aspects of the zebra finch song system. Dev Neurobio 25: Guillamon A, Segovia S, del Abril A Early effects of gonadal steroids on the neuron number in the medial posterior region and the lateral division of the bed nucleus of the stria terminalis in the rat. Brain Res Dev Brain Res 44:

41 26 Guillamon A, Segovia S Sexual dimorphism in the CNS and the role of steroids. In CNS Neurotransmitters and Neuromodulators Neuroactive Steroids, ed. TW Stone, pp Boca Raton: CRC. Gurney ME and Konishi M Hormone-induced sexual differentiation of brain and behavior in zebra finches. Science 208: Gurney ME Hormonal control of cell form and number in the zebra finch song system. J Neurosci 1: Gurney ME Behavioral correlates of sexual differentiation in the zebra finch song system. Brain Res 231: Han TM, De Vries GJ Organizational effects of testosterone, estradiol, and dihydrotestosterone on vasopressin mrna expression in the bed nucleus of the stria terminalis. J Neurobiol 54: Hines M, Davis FC, Coquelin A, Goy RW, Gorski RA Sexually dimorphic regions in the medial preoptic area and the bed nucleus of the stria terminalis of the guinea pig brain: a description and an investigation of their relationship to gonadal steroids in adulthood. J Neurosci 5: 40 7.

42 27 Hofman MA, Swaab DF The sexually dimorphic nucleus of the preoptic area in the human brain: a comparative morphometric study. J Anat. 164: Hutchison JB, Wingfield JC, Hutchison RE Sex differences in plasma concentrations of steroids during the sensitive period for brain differentiation in the zebra finch. J Endocrinol 103: Itoh Y, Melamed E, Yang X, Kampf K, Wang S, Yehya N, Van Nas A, Replogle K, Band MR, Clayton DF, Schadt EE, Lusis AJ, Arnold AP Dosage compensation is less effective in birds than in mammals. J Biol 6:2. Jacobs EC, Arnold AP, Campagnoni AT Zebra finch estrogen receptor cdna: Cloning and mrna expression. J Ster Biochem Mol Biol 59: Jacobs EC, Arnold AP, Campagnoni AT Developmental regulation of the distribution of aromatase and estrogen receptor mrna expressing cells in the zebra finch brain. Dev Neurosci 21: Jacobson CD The characterization, ontogeny and influence of androgen on the sexually dimorphic nucleus of the preoptic area. PhD dissertation: University of California at Los Angeles.

43 28 Jacobson CD, Csernus VJ, Shryne JE, Gorski RA The influence of gonadectomy, androgen exposure, or a gonadal graft in the neonatal rat on the volume of the sexually dimorphic nucleus of the preoptic area. J Neurosci 1: Karl J, Capel B Sertoli cells of the mouse testis originate from the coelomic epithelium. Dev Biol 203: Konishi M and Akutagawa E Neuronal growth, atrophy and death in a sexually dimorphic song nucleus in the zebra finch brain. Nature 315: Konishi M and Akutagawa E A critical period for estrogen action on neurons of the song control system in the zebra finch. Proc Natl Acad Sci USA 85: Korenbrot CC, Paup DC, Gorski RA Effects of testosterone propionate or dihydrotestosterone propionate on plasma FSH and LH levels in neonatal rats and on sexual differentiation of the brain. Endocrinology 97: Lansing SW, Lonstein JS Tyrosine hydroxylase-synthesizing cells in the hypothalamus of prairie voles (Microtus ochrogaster): sex differences in the anteroventral periventricular preoptic area and effects of adult gonadectomy or neonatal gonadal hormones. J Neurobiol 66:

44 29 Lephart ED A review of brain aromatase cytochrome P450. Brain Res Rev 22:1 26. Morris JA, Jordan CL, Breedlove SM Sexual differentiation of the vertebrate nervous system. Nat Neurosci. 10: Review. Morris JA, Jordan CL, King ZA, Northcutt KV, Breedlove SM. 2008a. Sexual dimorphism and steroid responsiveness of the posterodorsal medial amygdale in adult mice. Brain Res 1190: Morris JA, Jordan CL, Breedlove SM. 2008b. Sexual dimorphism in neuronal number of the posterodorsal medial amygdala is independent of circulating androgens and regional volume in adult rats. J Comp Neurol 506: Naftolin F, MacLusky N Aromatization hypothesis revisited. In: Serio Meal, Ed. Differentiation: Basic and Clinical Aspects. New York: Raven Press; Nishizuka M, Arai Y Sexual dimorphism in synaptic organization in the amygdala and its dependence on neonatal hormone environment. Brain Res 211:

45 30 Nottebohm F, Arnold AP Sexual dimorphism in vocal control areas of the songbird brain. Science 194: Nottebohm F, Stokes TM, Leonard CM Central control of song in the canary, Serinus canarius. J Comp Neurol. 165: Ohe E Effects of aromatase inhibitor on sexual differentiation of SDN-POA in rats. Nihon Sanka Fujinka Gakkai Zasshi 46: Panzica GC, Viglietti-Panzica C, Calacagni M, Anselmetti GC, Schumacher M, Balthazart J Sexual differentiation and hormonal control of the sexually dimorphic medial preoptic nucleus in the quail. Brain Res 416: Paranko J, Foidart JM, Pelliniemi LJ Developmental changes in interstitial collagens of fetal rat genital ducts. Dev Biol 2: Perlman WR, Arnold AP Expression of estrogen receptor and aromatase mrnas in embryonic and post-hatch zebra finch brain. J Neurobiol 55:

46 31 Qi LM, Mohr M and Wade J Enhanced expression of tubulin-specific chaperone protein A, mitochondrial ribosomal protein S27, and the DNA excision repair protein XPACCH in the song system of juvenile male zebra finches. Dev Neurobiol 72: Raisman G, Field PM Sexual dimorphism in the preoptic area of the rat. Science 173: Raisman G, Field PM Sexual dimorphism in the neuropil of the preoptic area of the rat and its dependence on neonatal androgen. Brain Res 54: Rand MN, Breedlove SM Androgen alters the dendritic arbors of SNB motoneurons by acting upon their target muscles. J Neurosci 15: Reiner A, Perkel DJ, Mello CV, Jarvis ED Songbirds and the revised avian brain nomenclature. Ann NY Acad Sci 1016: Saldanha CJ, Coomaralingam L Overlap and co-expression of estrogen synthetic and responsive neurons in the songbird brain- A double-label immunocytochemical study. Gen Comp Endocrinol 141:66-75.

47 32 Schlinger BA, Arnold AP Androgen effects on the development of the zebra finch song system. Brain Res 561: Schlinger BA, Arnold AP Plasma sex steroids and tissue aromatization in hatchling zebra finches: Implications for the sexual differentiation of singing behavior. Endocrinology 130: Scott WJ, Holson JF Weight differences in rat embryos prior to sexual differentiation. J Embryol Exp Morphol 40: Shen P, Schlinger BA, Campagnoni AT, Arnold AP An atlas of aromatase mrna expression in the zebra finch brain. J Comp Neurol 360: Simerly RB, Swanson LW, Handa RJ, Gorski RA Influence of perinatal androgen on the sexually dimorphic distribution of tyrosine hydroxylase-immunoreactive cells and fibers in the anteroventral periventricular nucleus of the rat. Neuroendocrinology 40: Simerly RB, Chang C, Muramatsu M, Swanson LW Distribution of androgen and estrogen receptor mrna-containing cells in the rat brain: an in situ hybridization study. J Comp Neurol 1:76-95.

48 33 Simerly RB, Zee MC, Pendleton JW, Lubahn DB, Korach KS Estrogen receptor dependent sexual differentiation of dopaminergic neurons in the preoptic region of the mouse. Proc Natl Acad Sci USA 94: Simerly RB Wired for reproduction: organization and development of sexually dimorphic circuits in the mammalian forebrain. Ann Rev Neurosci 25: Simpson HB, Vicario DS Early estrogen treatment alone causes female zebra finches to produce learned, male-like vocalizations. J Neurobiol 22: Tang YP, Wade J Sexually dimorphic expression of the genes encoding ribosomal proteins L17 and L37 in the song control nuclei of juvenile zebra finches. Brain Res 1126: Tapanainen J, Kuopio T, Pelliniemi LJ, Huhtaniemi I Rat testicular endogenous steroids and number of Leydig cells between the fetal period and sexual maturity. Biol Repro 5: Tobet SA, Zahniser DJ, Baum MJ Sexual dimorphism in the preoptic/anterior hypothalamic area of ferrets: effects of adult exposure to sex steroids. Brain Res 364:

49 34 Tsunoda Y, Tokunaga T, Sugie T Altered sex ratio of live young after transfer of fast- and slow-developing mouse embryos. Gamete Res 12: Wade J Zebra finch sexual differentiation: The aromatization hypothesis revisited. Microsco Res Tech 54: Wade J, Arnold AP Post-hatching inhibition of aromatase activity does not alter sexual differentiation of the zebra finch song system. Brain Res 639: Wade J and Arnold AP Sexual differentiation of the zebra finch song system. Behav Neurobiol Birdsong 1016: Wade J, Swender DA, McElhinny TL Sexual differentiation of the zebra finch song system parallels genetic, not gonadal, sex. Horm Behav 36: Wang Z, Bullock NA, De Vries GJ Sexual differentiation of vasopressin projections of the bed nucleus of the stria terminalis and medial amygdaloid nucleus in rats. Endocrinology 132:

50 35 Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Künstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED et al., The genome of a songbird. Nature 464: Wu MV, Manoli DS, Fraser EJ, Coats JK, Tollkuhn J, Honda S, Harada N, Shah NM Estrogen masculinizes neural pathways and sex-specific behaviors. Cell 139: Xu KP, Yadav BR, King WA, Betteridge KJ Sex related differences in developmental rates of bovine embryos produced and culture in vitro. Mol Reprod Dev 31: Yahr P, Gregory JE The medial and lateral cell groups of the sexually dimorphic area of the gerbil hypothalamus are essential for male sex behavior and act via separate pathways. Brain Res 631:

51 CHAPTER II CHARACTERIZATION OF THE G-PROTEIN COUPLED MEMBRANE BOUND ESTROGEN RECEPTOR GPR30 IN THE ZEBRA FINCH BRAIN REVEALS A SEX DIFFERENCE IN GENE AND PROTEIN EXPRESSION ** HYPOTHESIS: GPR30 GENE AND PROTEIN ARE DIFFERENTIALLY EXPRESSED IN THE DEVELOPING BRAIN ABSTRACT Estrogen induced structural dimorphisms exist in the songbird brain and correlate with sex differences in singing behavior. How they arise, however, is not clear since there is a scarce distribution of ERα and lack of ERβ in song control nuclei. This suggests that other receptors are involved. The G-protein coupled membrane bound estrogen receptor, GPR30, is a candidate but has never been investigated in songbirds. In this study, we characterized its gene and protein in the zebra finch brain. Analysis of the putative GPR30 protein sequence revealed a strong similarity to avian and mammalian homologues. Quantitative PCR indicated that the gene was elevated in the telencephalon ** Reproduced with permission of John Wiley and Sons Publishing, USA, as it appears in Journal of Developmental Neurobiology (Epub: DOI: /dneu.22004) by K.D. Acharya & S.L. Veney. 36

52 37 of both sexes from posthatching day (P) 15 to P45, with a male biased sex difference at P21 and P30. In comparison, expression at younger post-hatching ages and in adults was significantly less. At P21, GRP30 protein was widespread, non-uniform, and overlapped with song control nuclei. Of particular interest, the number of immunoreactive cells was greatest in HVC and RA, but less in LMAN and Area X. Labeling in HVC was also dimorphic; with more cells present in males than in females. In parallel with the gene, by adulthood, protein expression was also reduced across most brain regions. Taken together, these data suggest that GPR30 may contribute to differences in song system development by mediating dimorphic estrogen responses. In addition, the extensive protein distribution indicates that it may also have a role in general brain development in both sexes. INTRODUCTION Zebra finches are widely studied as a model for understanding how sex differences in brain anatomy and physiology develop and control reproductive behaviors (Gurney and Konishi, 1980; Goldman and Nottebohm, 1983; Wade, 2001; Wade and Arnold, 2004). In this species males produce a courtship vocalization (song) that females are not normally capable of producing. This singing behavior is controlled by a sexually dimorphic group of interconnected nuclei within the telencephalon that are larger and contain more neurons in males as compared to females (Nottebohm and Arnold, 1976; Gurney, 1982; Konishi and Akutagawa, 1985). The factor(s) that direct these brain

53 38 regions to become dimorphic are not known, but may in part depend on steroid hormones. In particular, estradiol (E 2 ) has been most effective at masculinizing the song system in females (Gurney and Konishi, 1980; Gurney, 1981; Simpson and Vicario, 1991; Grisham et al., 1994; Adkins-Regan et al., 1994). Interestingly, most attempts to demasculinize the male brain by blocking the formation or action of E 2 have not been successful (Arnold, 1980; Mathews et al., 1988; Mathews and Arnold, 1990; Balthazart et al., 1994; Wade and Arnold, 1994). However, in our hands, intra-cranial administration of the estrogen receptor antagonist ICI 182,780 did result in a significant reduction of neuron soma size in both sexes (Bender and Veney, 2008). Although the reason(s) for the discrepancy across studies is not clear, one cannot ignore the E 2 manipulations that were effective. The major question, however, is how do estrogens normally act to influence brain sex differences? In songbirds the nuclear receptors for estrogens (ERα and ERβ) are the only ones that have been investigated to date. The distribution of ERα mrna and protein has been described in zebra finches at various embryonic (E), post-hatching (P) and adult ages (Gahr and Konishi, 1988; Jacobs and Arnold, 1996; Jacobs et al., 1999; Perlman and Arnold, 2003). In general, signal was detected throughout several telencephalic regions. Within song control nuclei, HVC (proper name) contained a high amount of labeling from P10 into adulthood. Labeling in the robust nucleus of arcopallium (RA) was detectable only at P25, and was considerably less than that in HVC (Jacobs et al., 1996; Jacobs et al., 1999). In neither of these regions was a sex difference reported. The lateral

54 39 magnocellular nucleus of the anterior nidopallium (LMAN) and Area X did not contain any ERα positive cells. Compared to ERα, ERβ mrna has not been as extensively investigated in zebra finches. At a late embryonic stage (E34) and an early post-hatching age (P1) ERβ mrna was detected in a number of telencephalic regions, however, song control regions are not yet formed and there was no indication that areas destined to develop into song regions contained labeling. To our knowledge ERβ has never been described at later ages in the zebra finch, but in the closely related European Starling, its mrna is not found in song regions (Bernard et al., 1999). Based on this information, it does not seem obvious that ERα or ERβ would be primarily responsible for dimorphic estrogen responses in song nuclei. Therefore it is likely that other estrogen receptor(s) are involved. One possibility is GPR30, a newly characterized G-protein coupled membrane receptor that binds to a stimulatory G protein (G s ) and activates several downstream pathways. It was first identified in breast cancer cells, and is known to play a role in estrogen mediated responses (Filardo et al., 2002; Thomas et al., 2005; Brailoiu et al., 2007; Hazell et al., 2009; Lebesgue et al., 2009). It has also been reported in estrogen-responsive regions of the rat, mouse, and human brain, several of which contain limited ERα and ERβ (Brailoiu et al., 2007; Hazell et al., 2009; Lebesgue et al., 2009). Unfortunately, due to the lack of information on membrane receptors in zebra finches, it is unclear how/if GPR30 contributes to dimorphic brain development. As a first step towards exploring this, we first identified the gene and

55 40 examined its expression at select ages from hatching through adulthood. We also characterized the protein distribution in the juvenile and adult brain. MATERIALS AND METHODS Animals Subjects used in this study were obtained from our animal facility at Kent State University. Zebra finches were housed in communal aviaries, each containing 6-7 pairs of adult breeders held on a 14:10 light: dark cycle. Their diet consisted of finch bird seed and weekly supplements of hard boiled chicken eggs mixed with bread, fresh oranges or spinach. Food and water were available ad libitum. Adequate measures were taken to minimize pain and discomfort. All procedures were in accordance with Kent State University s Institutional Animal Care and Use Committee and conformed to NIH national guidelines. RT- PCR Total RNA was extracted from the telencephalon of P21 zebra finches (n=1 each sex) using the RNeasy Mini kit (Qiagen). This age was chosen because it represents a time when the song control nuclei are visible and show a robust response to E 2 (Gurney and Konishi 1980; Bottjer et al., 1985; Nordeen et al., 1986). We reasoned that if GPR30 is relevant to this system its expression should be abundant during this age. The quantity and quality of RNA was checked on a spectrophotometer and visualized on an RNA gel.

56 41 It was reverse transcribed (RT) into cdna with the High Capacity cdna Reverse Transcription kit (ABI), and then amplified by performing PCR (GPR30 forward primer: 5 -GTGAGAAGATGACTATCCCAGACCT-3 and GPR30 reverse primer: 5 - AGACCTCTGATTGCTCATTGCT-3 ). At the time this work was started, the zebra finch genome was not available and no information existed about GPR30 in this species. Thus the primers we used were designed based on the chicken GPR30 sequence. The PCR product was cleaned using the Qiaquick PCR Purification kit (Qiagen). Cloning and sequence analysis The purified product was ligated into the pgem- T Easy vector overnight at 4 C. The vector was then transfected into JM109 competent cells and grown on agar plates containing 100µg/ml of ampicillin, 40µg/ml X-gal, and 0.5mM isopropyl-β-dthiogalactopyranoside (IPTG). Colonies that had incorporated the insert were picked and grown overnight at 37 C in Luria broth containing 100µg/ml of ampicillin. The plasmids were isolated (Wizard plus Miniprep DNA purification system; Promega), digested using a restriction enzyme, and visualized on an agarose gel to verify the correct size of insert prior to sequencing (Ohio State University, Plant Microbes Genomic Sequencing Facility). The zebra finch GPR30 gene was translated into its amino acid sequence using Translate tool (Swiss Institute of Bioinformatics). The protein sequences for human, mice, rat, and chicken GPR30 were aligned with zebra finch GPR30 protein using clustalw2 alignment. Pair wise alignment was performed using the blast program bl2seq to calculate the similarity between examined species.

57 42 Quantitative PCR Total RNA was extracted from the telencephalon of P3, P8, P15, P21, P30, P45, and adult (n=6 males, n=6 females per group) animals using the RNeasy Mini kit protocol (Qiagen). These ages were chosen as snap shot periods during development; ages when significant changes are occurring in the brain as described in Table 2.1. The cdna synthesis was performed as previously explained. Negative RT controls were made for each sample by omitting the reverse transcriptase from the reaction. Quantitative PCR analysis was performed (ABI Prism 7000) using the SYBR Green PCR master mix kit with 20 ng of cdna and 200 nm final primer concentration, in a total volume of 20 μl. IDT primer tool, Primer Quest, was used to design the GPR30 forward (5'- GTGAGAAGATGACTATCCCAGACCT-3') and the GPR30 reverse (5 - ACCTCAATGAGAGAATCAGCGACT-3 ) primers. The reactions were run in triplicate for each sample and primer combination. Amplification of GAPDH gene (forward primer: 5 -TGTGGACCTGACCTGCCGTCTG-3 and reverse primer: 5 - TGAAGTCACAGGAGACAACCTG-3 ) was used as a loading control. Cycling conditions were 50 C for 2 min, 95 C for 10 min, and 40 cycles at 95 C for 15 sec, and 60 C for 1 min. To confirm specific amplification of the GPR30 gene, negative RT controls and no template controls were used. Negative RT controls were synthesized by incubating RNA

58 Table 2.1: Ages chosen for q-pcr and their significance 43

59 44 with the reverse transcription reagents and omitting the reverse transcriptase enzyme. No template controls were run with only the primers. Dissociation curves were examined for both (the controls, neither of which showed any peaks, suggesting no genomic DNA contamination (negative RT) and no primer-dimer formation (no template controls). Dissociation curves were also examined for the samples in which cdna had been synthesized (RT positive) and showed a single peak of the expected size (85 bp long with a T m of 75 C) indicating the absence of non-specific amplification. Moreover, amplification of the GAPDH gene occurred 20 or more cycles later in the negative RT controls as compared to the RT positive samples further confirming the absence of genomic DNA. The average δct was obtained by subtracting the Ct value of GAPDH from the Ct value of GPR30. The relative expressions were calculated using the equation 2^- δct values and were compared against P3 males whose expression was taken as 100%. Statistical analyses were performed using Sigma Stat. A Two Way ANOVA was conducted on relative expression values to examine the effect of age and sex on the gene expression. The level of significance was determined at P<0.05. Western blot analysis To verify the specificity of the GPR30 primary antibody, Western analysis was conducted on telencephalic tissue from P21 animals (n=3; 2 males and 1 female). Brains were collected after rapid decapitation, homogenized using a glass mortar and pestle, and

60 45 placed in ice-cold RIPA lysis buffer containing protease inhibitor. The lysate was kept on ice for half an hour to allow complete lysis followed by centrifugation at 10,000 rpm for 10 minutes at 4 C. The supernatant was collected and protein concentrations were quantified. 50µg of protein were electrophoresed on a 4-15% gradient Tris HCl gel (Bio- Rad) and transferred onto a PVDF membrane, both for 1 hr at 100V. The membrane was exposed to 5% non-fat milk for half an hour at room temperature to minimize nonspecific binding. The membrane was then incubated overnight at 4 C with an anti- GPR30 rabbit polyclonal antibody (LS-A4268; 1:2000; MBL International). It was then treated with a horseradish peroxidase conjugated goat anti-rabbit secondary antibody (1:2500; Vector Labs) at room temperature for 1 hr. Immunoreactivity was detected by chemiluminescence (ECL, LAS-3000, Intelligent Dark Box, FujiFilm) after adding luminol mixed with H 2 O 2 (10:1) to the membrane for 1 min. To further confirm the specificity of the antibody, a pre-adsorption control with 10-fold blocking peptide was also used (LS-P4268; MBL International). The control blot did not reveal any protein bands. Immunohistochemistry (IHC) P21 and adult zebra finches (n=5 males, n=5 females for each group) were used. We chose P21 for three main reasons. First, this was the age at which we initially identified the GPR30 gene. Secondly, song nuclei could be visualized so it would be clearly evident if GPR30 was expressed within each nucleus. Third, preliminary work indicated a sex difference in gene expression at this age and we wanted to verify if this was likely

61 46 to correspond to a functional difference at the protein level. Animals were deeply anesthetized with equithesin and perfused with 0.75% saline followed by 10% phosphate buffered formalin (PBF). The brains were post-fixed for 24 hrs in 10% PBF and cryoprotected overnight in 20% sucrose at 4 C. Tissue was then instant frozen on dry ice and stored at -80 C until processing. Brains were coronally cryo-sectioned into 30 µm slices, mounted onto gelatin-coated slides and once again stored at -80 C until antibody labeling. Adjacent sections were mounted onto alternate slides. On the first day of IHC, tissue was warmed to room temperature followed by fixation in 4% formalin in 0.1M phosphate buffered saline (PBS) for 15 min. The slides were then rinsed 6X in 0.1 M PBS for 5 min each, followed by a 15 min rinse in 0.5% H 2 O 2 to inactivate endogenous peroxidases. To block non-specific binding, 10% donkey serum in PBS with 0.3% Triton X-100 (PBS-T) was added to the sections for 1 hr. They were then rinsed 3X in 0.1 M PBS, each for 5 min. The tissue was incubated with the GPR30 primary antibody (same as used for Western; 1:2500) for 48 hrs at 4 C. After exposure to the primary, sections were rinsed in PBS-T for 5 min, incubated with a biotinylated goat-anti rabbit secondary antibody (1:2000; Vector labs) for 1 hr, followed by another 1 hr exposure to avidinbiotin complex. The immunoreactive product was detected with diaminobenzidine. To confirm the specificity of the labeling, we omitted the primary antibody and used the preadsorbed primary with GPR30 blocking peptide (MBL International). The control IHC sections did not show any signal.

62 47 IHC analysis Sections containing immunoreactive (ir)-gpr30 cells were viewed and digital images were captured at 20X. Since one major goal was to analyze GPR30 protein expression, we utilized thionin stained sections along with the canary atlas (nomenclature updated) to identify brain regions outside of the song control nuclei where labeling was present (Stokes et al., 1974; Reiner et al., 2004). Because ir-cells were widespread, we opted to semi-quantitatively analyze the relative expression based on visual inspection (Veney et al., 2003; Hazell et al., 2009). To get an impression of the overall distribution, an observer blind to the sex of the animals ranked the intensity of labeling on a 4 point scale (represented by different shades of gray). These ratings were designed to be approximately evenly divided over the intensity range. Within song nuclei, a quantitative analysis of labeled cells was also performed. A 0.01mm 2 box was placed within each nucleus. This sized object fit equally within all song control nuclei of both sexes without extending beyond their borders. The analysis was performed bilaterally, using a single representative section at approximately the middle of each nucleus where the area was the greatest. Two way ANOVAs followed by Tukey-Kramer post-hoc tests were conducted on cell counts from HVC, RA and LMAN to test the effect of age and sex on GPR30 immunoreactivity. Cell count data for Area X is reported, however it was not statistically analyzed because this region is not present in females (no sex effect) and in adults, this region is completely devoid of ir-labeling (no age effect).

63 48 RESULTS Zebra finch GPR30 gene sequence An 846 bp cdna coding the partial open reading frame (ORF) of zebra finch GPR30 gene was originally identified (available in NCBI database under accession number GU292793). It shared 90% homology to the chicken GPR30 gene and translated into a 281 amino acid long protein sequence. A few months after this work was completed, the zebra finch genome was published allowing access to the full GPR30 sequence (Warren et al., 2010). Alignment of the complete sequence with our partial sequence revealed a 99% similarity. This verified that the product we originally identified and used to make primers was in fact, GPR30. Pair wise comparisons of the 281 amino acid partial sequence revealed 93% identity and 96% similarity with chicken GPR30 protein. It also shared 80% identity and 88% similarity to human, and 81% identity and 87% similarity to both mouse and rat GPR30 protein (Figure 2.1). GPR30 gene expression Quantitative PCR revealed a significant effect of sex (F= 6.76, P=0.01), age (F= 52.48, P<0.001) and an interaction (F=3.53, P=0.007) on GPR30 gene expression. At P21 and P30, the gene expression was significantly greater in the male telencephalon as compared to that of females. Across the examined ages, GPR30 was elevated from P15- P45, with males showing the highest expression at P30. The lowest levels were detected in P3 and

64 49 Figure 2.1. Multiple alignments of GPR30 homologues of mouse, rat, human, zebra finch and chicken using clustalw2 program. Identical amino acids are denoted by *, conserved substitutions by : and semi-conserved substitutions by.

65 50 adult animals. At P8, the gene expression was greater than P3 and adulthood, but less than P15-P45 (Figure 2.2). GPR30 protein expression Western blot analysis revealed a 37 kda band that corresponded to the expected molecular weight for GPR30 (Figure 2.3). We also detected a faint band of approximately 31 kda. Blasting the antibody sequence to the protein database suggested that the 31 kda band most likely represented nucleolar protein 9. Since this is a nuclear product and GPR30 is cytoplasmic, there were no issues with our ability to correctly identify positively labeled cells. Cells without a clear nucleus, which were rarely noticed, were excluded from the analyses. IHC demonstrated that GPR30 protein was widely distributed throughout the zebra finch brain in both males and females. Based on the morphology of cells that were labeled by antibody, and reports indicating that a majority of cells in song control nuclei are neurons (Kirn and DeVoogd, 1989) we strongly believe that GPR30 is primarily expressed in neurons. It is, however, not exclusive to neurons since some irregularly shaped cells (characteristic of glia) were also positive for the antibody. For all analyses, to aid in the localization of signal, labeled tissue was compared against Nissl stained sections. Because immunoreactivity was variable and detected in some regions that did not contain clearly defined borders, we opted to semi-quantitatively analyze the relative intensity and pattern of labeling (Figure 2.4).

66 51 Figure 2.2. Relative expression of the GPR30 gene in the zebra finch telencephalon during development and adulthood. The expression in P3 males was designated as100% and gene expression for the other groups was compared to this. Bars with different letters indicate significant differences across groups. Asterisks denote sex differences within an age. Error bars represent the standard error of mean.

67 52 Figure 2.3. Western blot confirming the specificity of the GPR30 polyclonal antibody. Arrow points to a 37kDa band corresponding to zebra finch GPR30. The faint band below GPR30, approximately 31kDa, is most likely nucleolar protein 9.

68 53 Figure 2.4. Camera lucida drawings representing the relative intensity of GPR30 immunoreactivity at P21. Darker shades of gray correspond to a greater intensity of labeling. Selected coronal sections are arranged rostral to caudal (top left to bottom right). The distribution pattern was nearly identical in both sexes with the exception of HVC where a sex difference was detected in protein labeling that was significantly less in females. Abbreviations: A, arcopallium; AA, anterior arcopallial nucleus; Bas, basorostral pallial nucleus; Cb, cerebellum; CoA, anterior commissure; E, entopallial nucleus; FA, fronto-arcopallial tract; GP, globus pallidus; HA, apical hyperpallium; HD, dorsal hyperpallium; HP, hippocampus; LMAN, lateral magnocellular nucleus of the anterior nidopallium; LSt, lateral striatum; M, mesopallium; MSt, medial striatum; N, nidopallium; NC, caudal nidopallium; RA, robust nucleus of the arcopallium; Rt, nucleus rotundus; TeO, optic tectum; Tn, nucleus taeniae of the amygdala; V, ventricle.

69 54 The densest GPR30 immunoreactivity was detected in HVC (Figure 2.4E), nucleus taeniae (Figure 2.4F) and the entopallial nucleus (Figures 2.4C and D). Additionally, the rostro-caudal extent of the hippocampus (Figures 2.4D and E), ventro-lateral portion of the caudal regions of the nidopallium and the fronto-arcopallial fiber tract (Figures 2.4E and F) also revealed dense labeling. A moderate intensity of labeling was observed spanning the lateral border of the telencephalon, rostral to caudal, until approximately the level of the entopallial nucleus (Figures 2.4A-C). Moreover, the rostro-caudal extent of the apical hyperpallium (Figures 2.4A-C), lateral striatum (Figures 2.4C and D), ventro-medial border of the medial striatum (Figure 2.4A and B), lateral and medial preoptic areas (Figure 2.4C), caudomedial nidopallium (NCM), RA, ventral border of arcopallium (Figures 2.4E and F), and the anterior commissure (Figure 2.4D) all contained a moderate intensity of ir-gpr30 cells. In addition, we also noticed a continuous band of moderately labeled cells outlining the lateral ventricles that was distinct from the surrounding telencephalon (Figure 2.4A-C). A low intensity of labeling was identified in the mesopallium, dorsal hyperpallium (Figures 2.4A-C), globus pallidus (Figure 2.4C), optic tectum, a majority of the arcopallium (Figures 2.4E and F), dorso-medial portion of the nidopallium surrounding HVC, and the caudal region of the lateral striatum (Figure 2.4E). The lowest intensity of

70 55 immunoreactivity was detected in LMAN, lobus parolfactoris including Area X (Figure 2.4A), cerebellum (Figures 2.4E and F), and a majority of the nidopallium. Overall, the pattern of labeling in adults was similar to that at P21. However, there was a proportional decrease in the intensity as they aged, such that the regions containing dense labeling at P21 had moderate to low labeling in adults. Regions with moderate to low GPR30 labeling at P21, expressed little to no labeling at the later age. Exceptions were noted in the hippocampus, entopallial nucleus and ventro-lateral nidopallium where the intensity of labeling did not differ between P21 and adults. Song control nuclei Quantitative analysis from a single representative section of HVC indicated a significant effect of sex (F=5.16, p =0.03) and age (F=77.73, p<0.001) but no interaction on the number of GPR30-ir cells (Figure 2.5). At P21, ir cells were distributed throughout this nucleus, appeared to define its borders (Figure 2.6A), and were significantly higher in males than in females (Figures 2.6B and 2.6C). In adults, protein expression was less as compared to the juvenile age and no sex difference was detected (Figures 2.6D and 2.6E). Quantitative analysis from a single representative section of RA indicated a significant effect of age (F=123.07, p<0.001), but no effect of sex (F=0.14, p=0.71) (Figure 2.7). Compared to HVC, the numbers of ir-cells in RA were fewer and the nuclear border was

71 56 Figure 2.5. Numbers of GPR30- ir cells counted within a 0.01mm 2 area of HVC. Bars with different letters signify age differences across groups, whereas an asterisk denotes a sex difference within a group.

72 57 Figure 2.6. Photomicrographs of GPR30-ir cells in HVC. (A) represents protein labeling in a P21 male. (B and C) are magnified views in a P21 male and female, respectively, where a sex difference is observed. (D and E) are magnified views in an adult male and female, respectively, where no sex difference is evident. Arrows outline the border of HVC in (A) and in (B) they depict neurons with cytoplasmic labeling and a clear nucleus, which is consistent with GPR30 specific localization.

73 58 Figure 2.7. Numbers of GPR30- ir cells counted within a 0.01 mm 2 area of RA. Bars with different letters signify age differences across groups. There is no sex difference detected in this region at this age.

74 59 not as distinctly defined, so Nissl stained sections were used to verify its extent (Figure 2.8A). There was a similar intensity of labeling in males and females at P21 (Figures 2.8B and 2.8C). In adults very few labeled cells were present in RA and these numbers were significantly less than animals at P21. Similar to RA, GPR30 ir-cells in LMAN and Area X also did not define the borders of these regions, but instead overlapped with them. Using an overlay of Nissl stained tissue to identify the boundaries, an analysis of the number of ir-cells from the single representative section of LMAN revealed that there was an effect of age (F=40.8, p<0.001), but no effect of sex (F=0.09, p=0.76) or an interaction (Figure 2.9). Juvenile tissue contained more labeled cells than adults. Overall, there were fewer GPR30-ir cells in LMAN as compared to HVC and RA. In contrast to all other song control regions, Area X contained the fewest number of ir-cells. At P21, males had an average of (3 + 1) cells counted from the single representative section and area, and in adults this nucleus was completely devoid of immunoreactivity. DISCUSSION This study verified and described the presence of GPR30 in the songbird brain. This membrane bound estrogen receptor is present at various post-hatching ages, as well as in adults. Our findings revealed that gene expression continuously increased from P3 to

75 60 Figure 2.8. Photomicrographs of GPR30- ir cells in RA. (A) represents protein labeling in a P21 male. Arrows outline the border of this nucleus. (B and C) are magnified views in a P21 male and female, respectively.

76 61 Figure 2.9. Numbers of GPR30- ir cells counted within a 0.01mm 2 area of LMAN. Bars with different letters signify age differences across groups.

77 62 P15 in both sexes, and remained elevated until P45, before falling back to minimal levels at adulthood. Expression was greatest in P30 males as compared to all other groups. We also report a sex difference (greater in males than in females) that first becomes detectable around P21 and continues through at least P30. Analysis of GPR30 protein at P21 demonstrated that receptor labeling was in agreement with gene expression. Labeled cells were widely dispersed throughout the brain and overlapped with several song control regions. Closer examination of song nuclei revealed that HVC had the greatest amount of labeling, and that the number of GPR30 positive cells was sexually dimorphic (greater in males than in females). The extensive distribution of GPR30 is consistent with the idea that it may be required for common aspects of general brain development and/or function in both sexes. However, the sex difference in gene and protein suggests that it may also have an increased functionality in males during a restricted period of development. Given the timing of the dimorphic expression, this receptor is most likely not the trigger of neural sex differences in zebra finches (since the first morphological differences appear around P12), but instead may regulate or direct mechanisms of this process once they have started (Nixdorf-Bergweiler BE, 1996). By adulthood, GPR30 gene and protein were significantly reduced as compared to animals at P21; but in a few regions (e.g. hippocampus, entopallial nucleus and the ventro-lateral portion of the caudal nidopallium) the intensity of expression remained the

78 63 same. Although it has not been investigated as extensively in male zebra finches, in females, the reduction in GPR30 parallels a decreased responsiveness to E 2 as they age. More specifically, masculinizing effects of E 2 begin to diminish in females around P35, and have an even lesser effect on altering brain morphology after P45 (Konishi and Akutagawa, 1988). Coincidentally, GPR30 gene expression also declines after P45. Because there have been no reported changes in other estrogen receptors to account for this, we propose that the decreasing effects of E 2 may be directly related to the number of GPR30 receptors available. To our knowledge this study is the first to document a sex difference in an estrogen receptor within the song system at any age. The male biased expression of GPR30 overlaps a period of accelerated brain differentiation marked by an increased amount of apoptosis that occurs in females (Nixdorf-Bergweiler BE, 1996; Kirn and DeVoogd, 1989). Because there is no sex difference in ERα (Jacobs et al., 1996; 1999), and ERβ is not present in HVC (Bernard et al., 1999), we hypothesize that the increased GPR30 protein in males contributes to dimorphic neural development by mediating E 2 induced neuroprotection to maintain a greater number of neurons and a larger nuclear volume. Support for the role of GPR30 in neuroprotection comes from a study where the agonist G1, administered shortly after insult, was sufficient to protect CA1 pyramidal neurons in ovariectomized rats against global ischemia (Lebesgue at al., 2009). Complementary to this, pre-treatment with the GPR30 antagonist G15, abolished the neuroprotective effects

79 64 of E 2 in cultured rat hippocampal neurons (Gingerich et al., 2010). In a more recent study, it was demonstrated that G15 was also able to block the neuroprotection of primary rat neurons by raloxifene (a selective estrogen receptor modulator) (Abdelhamid et al., 2011). The specific cellular mechanisms that occur in response to GPR30 mediated neuroprotection are not known in songbirds. However, in mammals, binding of GPR30 by estrogens activates several signaling molecules and cascades. In particular, GPR30 activation of phosphoinositol-3 kinase (PI3K) affects the cell proliferative kinase Akt, and induces neuroprotection (Abdelhamid et al., 2011). Akt can induce cell survival by inhibiting phosphorylation of the pro-apoptotic protein BAD (Datta et al., 1997) or by the induction of pro-survival genes such as NF-κB (Romashkova and Makarov, 1999). Additionally, GPR30 is known to up-regulate pro-survival genes bcl-2 and pro-caspase 3 in cortical neurons (Liu et al., 2011). Thus, by stimulating these cascades more in males, GPR30 in the songbird brain may be directly contributing to neuron survival and dimorphic development of HVC. Although the number of receptors counted in the representative section of RA at P21 was high, no sex difference was detected. However, we still believe that GPR30 may contribute to dimorphic development of this nucleus. Neurons from HVC make axonal connections with those in RA (Konishi and Akutagawa, 1985). A significance of HVC- RA synapses was revealed by a study demonstrating masculinization of RA when estrogen receptors were activated exclusively in HVC (Meitzen et al., 2007). Such activation up-regulates brain derived neurotrophic factor (BDNF; Dittrich et al., 1999).

80 65 BDNF has a masculinizing effect on the songbird brain as confirmed by its infusion close to RA that increased soma size and neuronal density (Wissman and Brenowitz, 2009). Blocking the activity of BDNF abolished this effect. Thus, we propose that an increased response to estrogens in the male HVC induces a greater production of BDNF that contributes to masculine development of RA. In contrast to HVC and RA, LMAN and Area X contained the fewest number of GPR30- ir neurons at P21. Although these nuclei respond morphologically to E 2 at this age, ERα and ERβ are absent (Jacobs et al., 1996; 1999; Bernard et al., 1999; Metzdorf et al., 1999) and GPR30 is minimal. Thus, dimorphic development of these regions most likely occurs through alternate mechanisms. One possibility is the presence of an unidentified estrogen receptor in these nuclei. Alternatively the effects of E 2 on Area X may be indirect. Similar to that in RA, activation of GPR30 in HVC may also regulate development of Area X. In males, HVC sends projections to Area X and those neurons contain growth promoters such as insulin growth factor (IGF) II that enhance neuronal survival (Holzenberger et al., 1997). Additionally, regulation through cofactors is a third possibility, where the number of receptors does not have to be dimorphic but the response to hormones can be. An example is the co-activator RPL7/SPA, which has a greater expression in the song nuclei of males as compared to females (Duncan and Carruth, 2007). Knocking down this co-activator during early development decreased the volume of Area X (Duncan et al., 2009). Curiously, RPL7/SPA is reported as an ERα specific co-activator, but why and how it affects Area X is not clear since this nucleus is devoid of

81 66 this estrogen receptor. Although we can offer testable hypotheses about how E 2 induced changes in Area X occur, it is less clear how the latter two possibilities, in particular, explain sex differences in LMAN. This nucleus does not receive a direct connection from HVC, and knocking down rpl7/spa does not affect the volume of this nucleus (Duncan et al., 2009). Thus it is not clear how/if GPR30 contributes to dimorphic development of LMAN. In addition to song control regions, high but monomorphic expression of GPR30 protein was detected in many other areas of the brain including the hippocampus, entopallial nucleus and the NCM. Songbirds such as canaries express ERα in the hippocampus, whereas others such as the great tit have both ERα and ERβ in this region (Gahr and Metzdorf, 1997; Hodgson et al., 2008). In contrast, there is some inconsistency in the literature about the expression of estrogen receptors in the zebra finch hippocampus. With the exception of an early study from Gahr et al., (1993) who reported few ER-ir cells in this region (presumably ERα) others do not report the presence of ERα or ERβ (Bernard et al., 1999; Jacobs et al., 1999; Metzdorf et al., 1999). Thus, the majority of the effects of E 2 in the zebra finch hippocampus may depend upon GPR30. For example, E 2 enlarges the size of hippocampal neurons in zebra finches which is thought to be essential for facilitating spatial memory (Oberlander et al., 2004). And fadrozole treatment (estrogen synthase inhibitor) results in a reduced volume of the zebra finch hippocampus (Schlinger and Saldanha, 2005).

82 67 The entopallial nucleus is another brain area where we detected intense GPR30 labeling but to our knowledge does not contain ERα or ERβ. This nucleus is part of the visual processing pathways in birds and lesioning this nucleus abolishes their capacity to discriminate between conspecific individuals and spatial patterns (Karten and Hodos, 1970; Watanabe 1996; 2003). The fact that GPR30 expression in this region varied little between P21animals and adults suggests that estrogens play a major role in this sensory ability throughout life. GPR30 may also play an important functional role in NCM. It is a major auditory processing center (Mello et al; 1992; Mello and Clayton, 1994; Pinaud and Terleph, 2008) that expresses abundant GPR30 as well as ERβ, but minimal ERα (Shen et al., 1995; Saldanha and Coomaralingam, 2005; Jeong et al., 2011). NCM is essential for the recognition of and discrimination between the bird s own song, tutor song and other conspecific songs (Gobes and Bolhuis, 2007; Pinaud and Terleph, 2008; Remage-Healey et al., 2010; Tremere and Pinaud, 2011). The selective responses to these songs are expressed either by increased neuronal firing in NCM (Stripling et al., 1997; Remage- Healey et al., 2010) or by the increased expression of immediate early genes (IEGs) such as zenk, fos, and arc (Bailey et al., 2002; Mello et al., 2002; Tremere et al., 2009). Neuronal activity in NCM can be regulated by E 2. In response to this hormone, firing rate is amplified in both sexes. E 2 can also regulate IEGs in NCM since blocking the hormone decreases their expression (Tremere et al., 2009). These physiological responses occur very rapidly, and although both ERα and ERβ can mediate rapid

83 68 responses in cells (reviewed in Raz et al., 2008), they are primarily regulated by membrane bound receptors. For that reason, we speculate that GPR30 plays an important role in these activities. Interestingly, we also noted that GPR30 protein labeling was not uniform throughout each brain region. For example, moderate labeling was observed along the lateral borders of approximately the rostral half of the telencephalon whereas a decreased intensity of labeling was seen medially. Similarly, densely labeled cells were present in the caudal sections of the ventro-lateral nidopallium compared to the remaining nidopallium, which contained less labeling. Although it is not clear why this pattern exists in either area, the ventro-lateral nidopallium has been reported to contain dense aromatase immunoreactivity in male zebra finches (Balthazart et al., 1996), further supporting the functionality of GPR30 in this region. In summary, GPR30 may contribute to dimorphisms in morphology by influencing structural differences in HVC, RA, and Area X through greater neuroprotection in males. Although its function(s) in behavioral regulation is not known, it is tempting to speculate that it plays a role in song production. Early vocalizations of song begin in males around P25 (Immelmann, 1969; Arnold, 1992). The extensive presence of GPR30 in HVC and RA (a few days earlier at P21), is possibly required for the organization of the circuits necessary for song production. In contrast, minimal expression in LMAN and Area X indicate a lesser or non-existent role in song learning. In addition, GPR30 may also be

84 69 necessary for memories, including that of song, by acting within the NCM and hippocampus. The plentiful expression of this receptor in regions outside of the song system indicate that common estrogenic processes occurring during brain development may also be associated with GPR30. As a next step, follow up studies using gene knockdown or specific antagonists should be conducted to better understand the role of this receptor in sex-specific brain development and behavior. ACKNOWLEDGEMENTS We would like to thank Dr. Eric Mintz for statistical assistance. This work was supported by Kent State University laboratory start-up fund. REFERENCES Abdelhamid R, Luo J, VandeVrede L, Kundu I, Michalsen B, Litosh VA, Schiefer IT, Gherezghiher T, Yao P, Qin Z, Thatcher GRJ Benzothiophene selective estrogen receptor modulators provide neuroprotection by a novel GPR30-dependent mechanism. ACS Chem Neurosci 2:

85 70 Adkins-Regan E, Mansukhani V, Seiwert C, Thompson R Sexual differentiation of brain and behavior in the zebra finch: Critical periods for effects of early estrogen treatment. J Neurobiol 25: Arnold AP Quantitative analysis of sex differences in hormone accumulation in the zebra finch brain: methodological and theoretical issues. J Comp Neurol 189: Arnold AP Developmental plasticity in neural circuits controlling birdsong: Sexual differentiation and the neural basis of learning. J Neurobiol 23: Bailey DJ, Rosebush JC, Wade J The hippocampus and caudomedial neostriatum show selective responsiveness to conspecific song in the female zebra finch. J Neurobiol 52: Balthazart J, Absil P, Fiasse V, Ball GF Effects of the aromatase inhibitor R76713 on sexual differentiation of brain and behavior in zebra finches. Behaviour 13: Balthazart J, Foidart A, Absil P, Harada N Effects of testosterone and its metabolites on aromatase-immunoreactive cells in the quail brain: relationship with the activation of male reproductive behavior. J Steroid Biochem Mol Biol 56:

86 71 Bender AT, Veney SL Treatment with the specific estrogen receptor antagonist ICI 182,780 demasculinizes neuron soma size in the developing zebra finch brain. Brain Res 1246: Bernard DJ, Bentley GE, Balthazart J, Turek FW, Ball GF Androgen receptor, estrogen receptor α, and estrogen receptor β show distinct patterns of expression in forebrain song control nuclei of European Starlings. J Endocrinol 140: Bottjer SW, Glaessner SL, Arnold AP Ontogeny of brain nuclei controlling song learning and behavior in zebra finches. J Neurosci 5: Brailoiu E, Dun SL, Brailoiu GC, Mizuo K, Sklar LA, Oprea TI, Prossnitz ER, and Dun NJ Distribution and characterization of estrogen receptor GPR30 in the rat central nervous system. J Endocrinol 193: Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y, Greenberg ME Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 91:

87 72 Dittrich F, Feng Y, Metzdorf R, Gahr M Estrogen-inducible, sex- specific expression of brain derived neurotrophic factor mrna in a forebrain song control nucleus of the juvenile zebra finch. Proc Natl Acad Sci USA 96: Duncan KA, Carruth LL The sexually dimorphic expression of L7/SPA, an estrogen receptor coactivator, in zebra finch telencephalon. Dev Neurobiol 67: Duncan KA, Jimenez P, Carruth LL The selective estrogen receptor-alpha coactivator, RPL7, and sexual differentiation of the songbird brain. Psychoneuroendocrinology 34:S30-S38. Gahr M, Metzdorf R Distribution and dynamics in the expression of androgen and estrogen receptors in vocal control systems of songbirds. Brain Res Bull 44: Gahr M, Guttinger HR, Kroodsma DE Estrogen receptors in the avian brain: Survey reveals general distribution and forebrain areas unique to songbirds. J Comp Neurol 327: Gahr M, Konishi M Developmental changes in estrogen-sensitive neurons in the forebrain of the zebra finch. Proc Natl Acad Sci USA 85:

88 73 Gingerich S, Kim GL, Chalmers JA, Koletar MM, Wang X, Wang Y, Belsham DD Estrogen receptor alpha and G-protein coupled receptor 30 mediate the neuroprotective effects of 17beta-estradiol in novel murine hippocampal cell models. Neuroscience 170: Gobes SMH, Bolhuis JJ Birdsong memory: A neural dissociation between song recognition and production. Curr Biol 17: Goldman SA, Nottebohm F Neuronal production, migration, and differentiation in a vocal control nucleus of the adult female canary brain. Proc Natl Acad Sci USA 80: Grisham W, Mathews GA, Arnold AP Local intracerebral implants of estrogen masculinize some aspects of the zebra finch song system. Dev Neurobiol 25: Gurney ME, Konishi M Hormone-induced sexual differentiation of brain and behavior in zebra finches. Science 208: Gurney ME Hormonal control of cell form and number in the zebra finch song system. J Neurosci 1:

89 74 Gurney ME Behavioral correlates of sexual differentiation in the zebra finch song system. Brain Res 231: Hazell GG J, Yao ST, Roper JA, Prossnitz ER, O'Carroll AM, Lolait S J Localization of GPR30, a novel G protein-coupled oestrogen receptor, suggests multiple functions in rodent brain and peripheral tissues. J Endocrinol 202: Hodgson ZG, Meddle SL, Christians JK, Sperry TS, Healy SD Influence of sex steroid hormones on spatial memory in a songbird. J Comp Physiol 194: Holzenberger M, Jarvis ED, Chong C, Grossman M, Nottebohm F, Scharff C Selective expression of insulin-like growth factor II in the songbird brain. J Neurosci 17: Immelmann K Song development in the zebra finch and other estrildid finches. In: Hinde RE, editor. Bird vocalizations. Cambridge UK: Cambridge University press, p Jacobs EC, Arnold AP, Campagnoni AT Zebra finch estrogen receptor cdna: Cloning and mrna expression. J Steroid Biochem Mol Biol 59:

90 75 Jacobs EC, Arnold AP, Campagnoni AT Developmental regulation of the distribution of aromatase and estrogen receptor mrna expressing cells in the zebra finch brain. Dev Neurosci 21: Jeong JK, Burrows K, Tremere LA, Pinaud R Neurochemical organization and experience-dependent activation of estrogen-associated circuits in the songbird auditory forebrain. Euro J Neurosci 34: Karten HJ, Hodos W Telencephalic projections of the nucleus rotundus in the pigeon (Columba livia). J Comp Neurol 140: Kirn JR, DeVoogd TJ Genesis and death of vocal control ceurons during sexual differentiation in the zebra finch. J Neurosci 9: Konishi M, Akutagawa E Neuronal growth, atrophy and death in a sexually dimorphic song nucleus in the zebra finch brain. Nature 315: Konishi M, Akutagawa E A critical period for estrogen action on neurons of the song control system in the zebra finch. Proc Natl Acad Sci USA 85:

91 76 Lebesgue D, Chevaleyre V, Zukin RS, Etgen AM Estradiol rescues neurons from global ischemia-induced cell death: Multiple cellular pathways of neuroprotection. Steroids 74: Liu S, Han J, Zhang N, Tian Z, Li X, Zhao M Neuroprotective effects of estrogen against oxidative toxicity through activation of GPR30 receptor. Clini Exp Pharmacol Physiol In press Mathews GA, Brenowitz EA, Arnold, AP Paradoxical hypermasculinization of the zebra finch song system by an antiestrogen. Brain Res 561: Mathews GA, Arnold AP Antiestrogens fail to prevent the masculine ontogeny of the zebra finch song system. Gen Comp Endocrinol 80: Meitzen J, Moore IT, Lent K, Brenowitz EA, Perkel DJ Steroid hormones act trans-synaptically within the forebrain to regulate neuronal phenotype and song stereotypy. J Neurosci 27: Mello CV, Clayton DF Song-induced ZENK gene expression in auditory pathways of songbird brain and its relation to the song control system. J Neurosci 14:

92 77 Mello CV, Vicario DS, Clayton DF Song presentation induces gene expression in the songbird forebrain. Proc Natl Acad Sci USA. 89: Metzdorf R, Gahr M, Fusani L Distribution of aromatase, estrogen receptor, and androgen receptor mrna in the forebrain of songbirds and nonsongbirds. J Comp Neurol 407: Nixdorf-Bergweiler BE Divergent and parallel development in volume sizes of telencephalic song nuclei in and female zebra finches. J Comp Neurol 375: Nordeen KW, Nordeen EJ, Arnold AP Estrogen establishes sex differences in androgen accumulation in zebra finch brain. J Neurosci 6: Nottebohm F, Arnold AP Sexual dimorphism in vocal control areas of the songbird brain. Science 194: Oberlander JG, Schlinger BA, Clayton NS, Saldanha CJ Neural aromatization accelerates the acquisition of spatial memory via an influence on the songbird hippocampus. Horm Behav 45:

93 78 Perlman WR, Arnold AP Expression of estrogen receptor and aromatase mrnas in embryonic and posthatch zebra finch brain. J Neurobiol 55: Pinaud R, Terleph TA A songbird forebrain area potentially involved in auditory discrimination and memory formation. J Biosci 33: Raz L, Khan MM, Mahesh VB, Vadlamudi RK, Brann DW Rapid estrogen signaling in the brain. Neurosignals 16: Reiner A, Perkel DJ, Mello CV, Jarvis ED Songbirds and the revised avian brain nomenclature. Ann N Y Acad Sci 1016: Remage-Healey L, Melissa CJ, Randi OK, Schlinger B Brain estrogens rapidly strengthen auditory encoding and guide song preference in a songbird. Proc Natl Acad Sci USA 107: Saldanha CJ, Tuerk MJ, Kim YH, Fernandes AO, Arnold AP, Schlinger BA Distribution and regulation of telencephalic aromatase expression in the zebra finch revealed with a specific antibody. J Comp Neurol 423:

94 79 Saldanha CJ, Coomaralingam L Overlap and co-expression of estrogen synthetic and responsive neurons in the songbird brain- A double-label immunocytochemical study. Gen Comp Endocrinol 141: Schlinger BA, Saldanha CJ Songbirds: A novel perspective on estrogens and the aging brain. Age 27: Shen P, Schlinger BA, Campagnoni AT, Arnold AP An atlas of aromatase mrna expression in the zebra finch brain. J Comp Neurol 360: Simpson HB, Vicario DS Early estrogen treatment alone causes female zebra finches to produce learned, male-like vocalizations. J Neurobiol 22: Stokes TM, Leonard CM, Nottebohm F The telencephalon, diencephalon, and mesencephalon of the canary, Serinus canaria, in stereotaxic coordinates. J Comp Neurol 156: Stripling R,Volman SF, Clayton DF Response modulation in the zebra finch neostriatum: relationship to nuclear gene regulation. J Neurosci 17:

95 80 Thomas P, Pang Y, Filardo EJ, Dong J Identity of an estrogen membrane receptor coupled to a G- protein in human breast cancer cells. J Endocrinol 146: Tremere LA, Jeong JK, Pinaud R Estradiol shapes auditory processing in the adult brain by regulating inhibitory transmission and plasticity-associated gene expression. J Neurosci 29: Tremere LA, Pinaud R Brain-generated estradiol drives long-term optimization of auditory coding to enhance the discrimination of communication signals. J Neurosci 31: Veney SL, Peabody C, Smith GW, Wade J Sexually dimorphic neurocalcin expression in the developing zebra finch telencephalon. J Neurobiol 56: Wade J Zebra finch sexual differentiation: The aromatization hypothesis revisited. Microsco Res Tech 54: Wade J, Arnold AP Post-hatching inhibition of aromatase activity does not alter sexual differentiation of the zebra finch song system. Brain Res 639:

96 81 Wade J, Arnold AP Sexual differentiation of the zebra finch song system. Behav Neurobiol Birdsong 1016: Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Heger A, et al., The genome of a songbird. Nature 467: Watanabe S Effects of ectostriatal lesions on discriminations of conspecific, species and familiar objects in pigeons. Behav Brain Res 81: Watanabe S Effects of Wulst and ectostriatum lesions on repeated acquisition of spatial discrimination in pigeons. Cogn Brain Res 17: Wissman A, Brenowitz E The role of neurotrophins in the seasonal-like growth of the avian song control system. J Neurosci 29:

97 CHAPTER III USE OF DIFFERENTIAL DISPLAY REVERSE TRANSCRIPTION (DDRT) PCR TO IDENTIFY DIFFERENTIALLY EXPRESSED GENES IN THE TELENCEPHALON OF EARLY POST-HATCHING MALE AND FEMALE ZEBRA FINCHES HYPOTHESIS: SEX-LINKED GENES ARE DIFFERENTIALLY EXPRESSED IN THE BRAIN DURING THE FIRST WEEK POST-HATCHING ABSTRACT Differential display reverse transcription (DDRT) PCR is a technique that allows for the identification of differentially expressed genes when microarray analysis is not available. Random primers are used to amplify genes from a cdna sample. The samples are run on a gel and bands of interest are excised, cloned, sequenced, and compared against known products in a gene database. Since the zebra finch genome was not published and microarray chips were not publicly available at the time this study began, I utilized this method to identify differentially expressed genes at two select ages during the first week 82

98 83 post-hatching. Based on telencephalic tissue from P3 and P8 males and females, 15 genes were found to have a sex-biased expression. Following cloning and sequencing, 12 of these differentially expressed products matched with known homologues in chicken (the closest avian species in the database). The remaining three matched to hypothetical proteins, and thus are not reported here. Interestingly, approximately 50% of the genes identified were Z-linked suggesting not that these products may have roles in sex-specific processes. INTRODUCTION Zebra finches exhibit remarkable sex differences in brain and behavior (Nottebohm and Arnold, 1976; Wade, 2001; Wade and Arnold, 2004). However, little is understood about the exact mechanisms responsible for such differences. As explained in the first chapter of this dissertation, sex-linked genes have been of great interest as one of the earliest factors that may be important for the initiation of neural sex differences. In support of this, several genes have been identified as being differentially expressed during the first few weeks after hatching; a time just prior to, or at the initial stages when dimorphic features are emerging (Veney et al., 2003; Duncan et al., 2009; Tomaszycki et al., 2009). Unfortunately, however, their exact function(s) are not known. Given the possibility that these are not the only products important for this process, the goal of this study was to identify additional differently expressed genes that may also have a role on this process. Since microarray chips were not an option (not commercially available for

99 84 zebra finches) at the time this study began, DDRT-PCR was used to identify genes that may be involved in dimorphic brain development. DDRT-PCR is a technique that can be used for the detection of differentially expressed cdnas from two or more samples (Liang and Pardee, 1992). One disadvantage is that it can give rise to the amplification of a large number of that do not represent true differentially expressed genes. However, modifications such as the use of longer primers or increasing the primer binding specificity by adding specific regulator sequences within primers have been helpful towards improving specificity of the technique. MATERIALS AND METHODS Animals Subjects used in this study were obtained from our animal facility at Kent State University. Zebra finches were housed in communal aviaries, each containing 6-7 pairs of adult breeders held on a 14:10 light: dark cycle. Their diet consisted of finch birdseed and weekly supplements of hard boiled chicken eggs mixed with bread, fresh oranges or spinach. Food and water were available ad libitum. Adequate measures were taken to minimize pain and discomfort. All procedures were in accordance with Kent State University s Institutional Animal Care and Use Committee and conformed to NIH national guidelines.

100 85 DDRT-PCR Total RNA was extracted from the telencephalon of P3 and P8 juveniles (n=2 males, n=2 females per age) using the RNeasy Mini kit (Qiagen). We chose these ages because they represent a period prior to visible detection of song regions (P3), and when the nuclei are first identifiable with a Nissl stain (P8) (Bottjer et al, 1985; Gahr and Metzdorf, 1999). The quantity and quality of RNA was verified. GeneFishing DEG Premix kit was used to synthesize cdna and identify differentially expressed genes during the first week and early second week that may be necessary for the initiation of zebra finch brain dimorphisms. cdna was synthesized by combining 3 µg (1 µg/µl concentration) of RNA with 20 µm of oligo dt arbitrary primer (dt-acp1; GeneFishing DEG Premix kit) in a total volume of 10 µl. The mixture was incubated at 80 C for 3 min in a thermal cycler. Next, 4 µl of 5X RT buffer, 2 µl of 5 mm dntps, 0.5 µl of 40 U/µl RNAse, 1 µl of 200 U/µl M-MLV reverse transcriptase, and water were added to make a total volume of 20 µl. Reverse transcription occurred at 42 C for 90 min, 94 C for 2 min and 4 C for 2 min. The obtained cdna was stored at -20 C until use. 50 ng of cdna, 2 μl of 5 μm arbitrary ACP (1-80), 1 μl of 10 μm dt-acp2, and 10 μl of 2X SeeAmp master mix were combined in a total reaction volume of 20 µl (Gene fishing DEG premix kit) and amplified under following conditions: 94 C for 5 min, 50 C for 3 min, 72 C for 1 min; 40 cycles of 94 C for 40 sec, 65 C for 40 sec, 72 C for 40 sec; followed by a final extension of 72 C for 5 min. The PCR product was combined with DNA loading buffer and loaded onto a 3% agarose gel to run for 3 hours. The gel was

101 86 placed under UV light and bands of interest were excised. Genes that were expressed exclusively in one sex, or more strongly in one sex compared to the other, were of greatest interest. The chosen bands were cleaned using the PCR Cleanup Kit (Qiagen). Cloning and sequencing Purified products were ligated overnight at 4 C into the pgem-t Easy vector. The vector was then transfected into JM109 competent cells and grown on agar plates containing 100µg/ml of ampicillin, 40µg/ml X-gal and 0.5mM isopropyl-β-dthiogalactopyranoside (IPTG). Colonies with the insert were identified and grown overnight at 37 C in Luria broth containing 100µg/ml of ampicillin. The plasmids were isolated (Wizard plus Miniprep DNA purification system; Promega), digested using a restriction enzyme, and visualized on an agarose gel to verify the correct size of the insert. The insert was then sequenced using T7 and SP6 vector primers (Ohio State University, Plant Microbes Genomic Sequencing Facility). RESULTS A large number of products were amplified by DDRT-PCR as detected on the gel. Characteristically, some bands showed a difference in the intensity between the sexes and ages, whereas others were expressed similarly (Figure 3.1). This is very common with DDRT-PCR since degenerate primers used for the amplification identify many more

102 87 Figure 3.1. Gel showing amplified bands using differential display reverse transcription (DDRT) PCR in P3 (n=2 per sex; first six lanes) and P8 (remaining four lanes; n=2 per sex). Females (F) and males (M) of same age were run together to allow accurate comparison. In this specific gel, none of the bands showed a consistent difference between sexes, thus, were not taken for further analysis.

103 88 products than genes with true differences. Such bands were not potentially dimorphic between sexes, and thus, were not examined further. Only those band products where a difference was consistent among samples were chosen for further examination. Based on the animals that were run, a total of 15 cdna bands were expressed in a greater intensity in one sex as compared to the other, although the direction of expression was not same for all samples. Some of the amplified genes were expressed more in males, and others were expressed more in females such that the direction of the sex difference and the age at which a sex difference was detected, varied among genes identified. For example, bands corresponding to rps6 gene were more intense in males than in females at both ages examined (Figure 3.2). These bands were extracted from the gel, cloned and sequenced for their identification. Of them, 12 matched to the genes that had high homology to chicken homologues I compared these products to the chicken genome because during the time of this study, zebra finch genome was not yet available. The genes identified to be expressed differently between the sexes are presented in table 3.1. DISCUSSION DDRT-PCR has been widely used to compare gene expression. The use of degenerate primers where different nucleotide combinations have been used to amplify genes is responsible for non-specific amplification of several products all of which may not be truly differentially expressed among tissues. In this study, I have identified 12 gene

104 89 Figure 3.2. Bands representing ribosomal gene S6 (rps6) cdna amplified using differential display reverse transcription (DDRT) PCR in P3 (n=2 per sex; first four lanes) and P8 (n=1 per sex; 5 th and 6 th lanes). Boxed area contains rps6 bands (were identified after sequencing) in males (M) which are either faint or absent in females (F). Since degenerate primers were used to amplify these bands, extra bands are also seen in the gel.

105 90 Table 3.1: Differently expressed genes in the telencephalon of P3 and P8 males as identified by DDRT-PCR, their location on the chromosome and the direction of expression.

106 91 products that showed a sex biased expression between males and females at P3 and P8. Although false positive rates are high with this technique, 50% (6) of the total examined genes are Z-linked suggesting that the products were specific and real. Nonetheless, further comparison using q-pcr will be necessary to verify the sex differences of these genes. REFERENCES Adkins-Regan E, Ascenzi M Sexual differentiation of behavior in the zebra finch: Effect of early gonadectomy or androgen treatment. Horm Behav 24: Adkins-Regan E, Mansukhani V, Seiwert C, Thompson R Sexual differentiation of brain and behavior in the zebra finch: Critical periods for effects of early estrogen treatment. J Neurobiol 25: Agate RJ, Grisham W, Wade J, Mann S, Wingfield J, Schanen C, Palotie A, Arnold AP Neural, not gonadal, origin of brain sex differences in a gynandromorphic finch. Proc Nat Acad Sci USA 100: Arnold AP Effects of androgens on volumes of sexually dimorphic brain regions in the zebra finch. Brain Res 185:

107 92 Duncan KA, Jimenez P, Carruth LL The selective estrogen receptor-alpha coactivator, RPL7, and sexual differentiation of the songbird brain. Psychoneuroendocrinology 34S: S30-S38. Gahr M, Konishi M Developmental changes in estrogen-sensitive neurons in the forebrain of the zebra finch. Proc Natl Acad Sci USA 85: Grisham W, Mathews,GA, Arnold AP Local intracerebral implants of estrogen masculinize some aspects of the zebra finch song system. Dev Neurobio 25: Gurney ME, Konishi M Hormone-induced sexual differentiation of brain and behavior in zebra finches. Science 208: Gurney ME Hormonal control of cell form and number in the zebra finch song system. J Neurosci 1: Jacobs EC, Arnold AP, Campagnoni AT Zebra finch estrogen receptor cdna: Cloning and mrna expression. J Ster Biochem Mol Biol 59: Jacobs EC, Arnold AP, Campagnoni AT Developmental regulation of the distribution of aromatase and estrogen receptor mrna expressing cells in the zebra finch brain. Dev Neurosci 21:

108 93 Liang P, Pardee AB Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science 257: Mathews GA, Arnold AP Antiestrogens fail to prevent the masculine ontogeny of the zebra finch song system. Gen Comp Endocrinol 80: Nottebohm F, Arnold AP Sexual dimorphism in vocal control areas of the songbird brain. Science 194: Perlman WR, Arnold AP Expression of estrogen receptor and aromatase mrnas in embryonic and posthatch zebra finch brain. J Neurobiol 55: Simpson HB, Vicario DS Early estrogen treatment alone causes female zebra finches to produce learned, male-like vocalizations. J Neurobiol 22: Tomaszycki ML, Peabody C, Replogle K, Clayton DF, Tempelman RJ, Wade J Sexual differentiation of the zebra finch song system: Potential roles for sex chromosome genes. BMC Neurosci 10:24.

109 94 Veney SL, Peabody C, Smith GW, Wade J Sexually dimorphic neurocalcin expression in the developing zebra finch telencephalon. J Neurobiol 56: Wade J Zebra finch sexual differentiation: The aromatization hypothesis revisited. Microsco Res Tech 54: Wade J, Arnold AP Post-hatching inhibition of aromatase activity does not alter sexual differentiation of the zebra finch song system. Brain Res 639: Wade J, Arnold AP Sexual differentiation of the zebra finch song system. Behav Neurobiol Birdsong 1016: Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Künstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED et al., The genome of a songbird. Nature 464:757-6.

110 CHAPTER IV SEXUALLY DIMORPHIC EXPRESSION AND ESTRADIOL MEDIATED UP- REGULATION OF A SEX-LINKED RIBOSOMAL GENE RPS6 IN THE ZEBRA FINCH BRAIN HYPOTHESIS: THE Z-LINKED RPS6 IS EXPRESSED GREATER IN MALES AND THE GENE EXPRESSION IS UPREGULATED IN RESPONSE TO ESTROGENS EXPOSURE. ABSTRACT Sex-linked genes have been considered as the primary regulators of sex differences among vertebrates. In mammals, sex-linked genes that are expressed in a dimorphic manner prior to an exposure of the brain to gonadal steroids initiate brain dimorphisms. In this study, I have characterized a Z-linked gene rps6 in the zebra finch brain that is enhanced in males throughout life. The gene expression is approximately twice in males as compared to females at all ages examined, consistent with incomplete dosage compensation in avians. The expression also differed among ages such that the gene expression was highest at P3 and P8, started to decrease by P15, and reached at the lowest level in both sexes by adulthood. Analysis of the mrna distribution at P10, an age when the gene is not only up-regulated in both sexes, but also when song control 95

111 96 nuclei begin to be visible, revealed a widespread distribution throughout the brain. Specifically, more numbers of rps6 positive cells were present in song nuclei HVC and RA of males as compared to females. To investigate if rps6 interacts with estrogens to possibly influence dimorphic development of these regions, the gene expression was investigated at different time intervals following a single systemic injection of estradiol (E 2 ). A significant up-regulation of the gene was observed in both males and females as an effect of the hormone treatment, and E 2 mediated up-regulation was approximately twice in males as compared to females. Thus, these pieces of information suggest that rps6 may be a possible candidate in the sexual differentiation of the zebra finch brain, and its function may be facilitated by E 2. INTRODUCTION Zebra finches serve as a useful vertebrate model to study brain sex differences. Within the telencephalon of this songbird, there are dimorphic nuclei involved in song learning and production collectively referred to as the neural song system (Nottebohm and Arnold, 1976; Wade and Arnold, 2004). This interconnected circuit consists of nuclei HVC (proper name), RA (robust nucleus of the arcopallium), LMAN (lateral magnocellular nucleus of the anterior nidopallium) and Area X. The volumes of HVC and RA are greater in males than in females, in part, due to larger and more numerous neurons (Bottjer et al., 1985; Konishi and Akutagawa, 1985). LMAN is monomorphic in volume; however, the soma sizes of neurons within this nucleus are larger in males (Nixdorf-

112 97 Bergweiler, 1996). Area X, which is easily identifiable in males with a Nissl stain, is not present in females (Nottebohm and Arnold, 1976). These male-biased morphological differences are responsible for observed behavioral differences; only males normally sing (Bottjer et al., 2002). The current hypothesis is that a combined effect of hormonal and genetic factors account for sex differences within the song system (reviewed in Wade and Arnold, 2004; London et al., 2009). Although the exact connection is not entirely clear, the contribution of hormones in this system has historically gained the most attention. Only more recently has focus shifted towards understanding the genetic influences. In particular, one family of proteins that has gained increasing interest in the past few years is ribosomal proteins (RP). Although they are widely accepted as housekeeping components necessary for general cellular processes that occur in both sexes, studies in zebra finches have challenged this idea since some are dimorphically expressed in the brain during early development or are located on sex chromosomes. For example, rpl17, rpl37, and mitochondrial (M) rps27 are present on the Z sex chromosome (Tang and Wade, 2006; Qi et al., 2012). In avians, males are homogametic (ZZ sex chromosomes) and females heterogametic (ZW). Because sex chromosome dosage compensation is not as efficient in zebra finches as in mammals (Warren et al., 2010), these genes have enhanced expression in males as compared to females. More specifically, at post-hatching (P) day 25, when song nuclei are rapidly differentiating to give rise to masculine morphology, the ribosomal genes L17 and L37 are detected in Area X (which is present in males only)

113 98 and expressed more greatly in male RA. In addition, the gene for M rps27 is expressed more significantly in male HVC. Although the specific role of these ribosomal genes as it relates to dimorphic brain development has not yet been identified, the timing and differential expression suggests that they may promote processes associated with masculine brain development. In addition, another ribosomal protein, L7/SPA is also dimorphically expressed during an early posthatching period when some of the earliest morphological differences in the song circuit begin to appear (Duncan and Carruth, 2007, 2009). Although rpl7/spa is not sex-linked, both its gene and protein show a greater expression in the developing male brain, implying its potential role in sex-specific brain development. In the current study we report on the identification of an additional novel rp (rps6; also known as phosphoprotein NP33), that may also be important for brain dimorphisms. As reported in the previous chapter, this gene showed a male-biased expression in P3 and P8 males through DDRT-PCR. The goal of the current study was to characterize rps6 by examining its gene expression in the telencephalon of both sexes at select ages during the first month after hatching and in adults. We also localized its mrna within specific anatomical brain regions at an early developmental age. In addition, because dimorphisms in the brain are believed to result from a combination of hormonal and nonhormonal factors, and rps L17 and L37 are reported to have a possible interaction with estradiol (Tang and Wade, 2009), we wanted to investigate if a similar regulatory relationship existed with rps6.

114 99 MATERIALS AND METHODS Animals Subjects used in this study were obtained from our animal facility at Kent State University. Zebra finches were housed in communal aviaries, each containing 6-7 pairs of adult breeders held on a 14:10 light: dark cycle. Their diet consisted of finch birdseed and weekly supplements of hard boiled chicken eggs mixed with bread, fresh oranges or spinach. Food and water were available ad libitum. Adequate measures were taken to minimize pain and discomfort. All procedures were in accordance with Kent State University s Institutional Animal Care and Use Committee and conformed to NIH national guidelines. Quantitative PCR To confirm the differential expression of rps6 and extend the ages for gene investigation, additional animals were used. Non-perfused telencephalic tissue was collected from animals at P3, P8, P15, P21, P30 and adults over 100 days old (n= 6 males, n=6 females per group). These ages represent snap-shot developmental periods when significant morphological changes are occurring in the brain. Significances of these ages are summarized on table 4.1. RNA was extracted using the RNeasy mini kit (Qiagen). After verifying the quality, it was then reverse transcribed into cdna with the High Capacity cdna Reverse

115 Table 4.1 Ages chosen for q-pcr and their significance are summarized. 100

116 101 Transcription kit (ABI). Negative RT controls were made for each sample by omitting the reverse transcriptase from the reaction. Quantitative (q) PCR analysis was performed (ABI Prism 7500) using the SYBR Green PCR master mix kit with 20 ng of cdna and 200 nm final primer concentration, in a total volume of 20 μl. IDT primer design tool primer quest was used to design the primers for the rps6 and GAPDH gene (used as a normalizer). The partial sequence of rps6 gene amplified using ddpcr was used as the template to design the primers. The primers for GAPDH were designed based on the conserved regions of chicken and mammalian homologues since the zebra finch sequences were not published when this work was started. RpS6 forward primer (5 - TTGGATCTTGGGAGCTTTCG -3 ), rps6 reverse primer (5 - AACTGTGCCCCGTCGTCT-3 ), GAPDH forward primer (5 - TGTGGACCTGACCTGCCGTCTG-3 ), and GAPDH reverse primer: 5 - TGAAGTCACAGGAGACAACCTG-3 ) were used to amplify the respective zebra finch genes. The absence of primer-dimer formation for both primer pairs was verified by running control reactions with water instead of cdna template. The PCR reactions were run in triplicate for each sample and primer combination. Cycling conditions were 50 C for 2 min, 95 C for 10 min, 40 cycles at 95 C for 15 sec, and 60 C for 1 min. The dissociation curves of the amplified PCR products were examined to confirm the absence of DNA contamination and any unwanted products. The average δct was obtained by subtracting the Ct value of GAPDH from the Ct value of rps6. Relative expression values were calculated using the equation 2 -δδct. Statistical analysis was performed using Sigma Stat. A Two Way ANOVA was conducted on relative expression values to

117 102 examine the effect of age and sex on gene expression. The level of significance was determined at P<0.05. Riboprobe synthesis for in situ hybridization (ISH) The plasmid containing the rps6 insert that was amplified from DDPCR and confirmed to be rps6 gene after sequencing was used as the template for in vitro transcription. The transcription was carried out using the Megascript protocol (Ambion) with SP6 and T7 primers. Digoxigenin (DIG) labeled UTP was added to the transcription reaction and incorporated into the probe, which at the end of the reaction, was cleaned by precipitating in a sodium acetate solution. The probe quality was confirmed prior to its use by running it on an agarose gel and checking absorbance values on a spectrophotometer. The incorporation of the DIG UTP was confirmed by dot blot (Roche). In situ hybridization P10 animals (n=6 males, n=6 females) were used for this study. Preliminary gene expression of rps6 revealed an overall increase at P8 that decreased by P15. Since song control nuclei are minimally visible at P8, we opted to use an age greater than this when the nuclei would be more discernible and gene expression would likely be abundant, but not as late as P15 when expression decreased. Animals were anesthetized with CO 2 and trans-cardially perfused with 0.75% saline followed by 10% phosphate buffer formalin (PBF). The brain was removed and stored overnight in 10% PBF at 4 C to complete the fixation. The next day it was transferred to 20% sucrose, held at 4 o C overnight, quickly

118 103 frozen, and stored at -80 C. Each brain was coronally cryo-sectioned into 15µm thick sections onto alternate slides and stored at -80 C until further use. One set of slides was used for Nissl staining and utilized to aid in in identifying the brain regions. The remaining two sets were used for in situ labeling with one each for antisense and sense labeling. On the first day of in situ, tissue was removed from the freezer and air dried to room temperature (RT) for 20 min. The slides were then fixed in 4% formaldehyde at RT for another 20 min. Sections were acetylated with 0.25% acetic anhydride in 0.1% triethanolamine (TEA) followed by two washes with phosphate buffered saline (PBS) for 5 min each. Tissue was then covered with 300 µl of pre-hybridization buffer (containing 4X SSC, 10% dextran sulphate, Denhardt s solution, 2mM EDTA, 50% deionized formamide, herring sperm DNA) for 90 min. To prepare the probe, it was first denatured at 80 C for 5 min and mixed with hybridization buffer (same as prehybridization buffer) to make a final concentration of 200ng/ml. Two hundred µl was dispensed onto each slide, covered by parafilm strips, and allowed to hybridize with the tissue in a moist chamber for hours at 55 C. On the second day, slides were removed from the oven and dipped in 1X SSC (sodium chloride- sodium citrate buffer) for 5 min at RT. They were placed in 50% formamide and 50% 2X SSC for 5 min at 50 o C. Tissue was then washed in 1X SSC followed by 0.5X SSC, each for 5 min, at 37 C. Slides were placed in wash buffer (100mM Tris-HCl and 150mM NaCl; ph 7.5) for 5 min. Tissue was then blocked in 1% sheep serum in wash buffer for 1 hr, followed by incubation in anti-dig-ap diluted in 1% sheep serum in

119 104 wash buffer (1:2500) for 2 hrs. Brain sections were dipped in wash buffer twice for 5 min at RT, and placed in Tris buffer (100mM Tris-HCl and 100mM NaCl, ph 9.5) for 10 min. Detection buffer (NBT/BCIP and Levamisole dissolved in Tris buffer) was added and slides were stored in a dark humid chamber overnight (16-24 hrs) at RT. The reaction was stopped by rinsing the tissue in TE buffer (10mM Tris-HCl, 1mM EDTA, ph 8.0) for 5 min. The sections were then washed, mounted with Aquamount and coverslipped. Quantitative analysis of rps6 labeled cells within song control nuclei Images were captured under bright field microscopy at 40X using an Olympus BX51 microscope. Since one major goal was to analyze rps6 mrna distribution, we utilized thionin stained sections and a zebra finch atlas (Nixdorf-Bergweiler and Bischof, 2007) to identify where labeling was present. HVC and RA were most clearly identifiable in Nissl stained tissue at P10 so a quantitative analysis was performed within these nuclei. In contrast, LMAN and Area X were not consistently identifiable among all animals studied, and thus, was not analyzed. For the analysis, a 0.09mm 2 box, which covered the maximum cross-sectional area of RA and HVC without extending outside the borders, was placed at approximately the middle of each nucleus. In all cases, Nissl stained sections were used to identify the borders of song nuclei. RpS6 labeled cells in RA and HVC were counted bilaterally in two sections on each side and added together. A twotailed unpaired t-test was conducted to examine the effect of sex on the number of labeled

120 105 cells in HVC and RA in (n=6) males, (n=6) females. The sections hybridized to the sense probe were examined to confirm the absence of any non-specific labeling. E 2 injections and gene quantification P21 animals (n=6 males, n= 6 females per injection group) were collected for this study. At this age, the zebra finch brain is highly responsive to estrogens, thus, we reasoned that if rps6 is affected by E 2, it would likely occur at this age (Gurney and Konishi 1980; Nordeen et al., 1986). Animals were subcutaneously injected with a single dose of 50μg of E 2 and collected 2, 6 and 18 hrs post-injection. This dose has been previously used and shown to be effective in partially masculinizing the song system in females (Konishi and Akutagawa, 1988; Grisham et al., 2008). We chose these time points to represent a range when changes in gene expression, as a result of treatment, were expected to occur. Controls were injected with vehicle (propylene glycol) and animals for this group were also collected 2, 6 and 18 hrs post-injection. However, since relative expression on rps6 gene did not differ among controls collected at different time points, these data were pooled and presented as a single data point. To examine the effect of E 2 on rps6 gene expression, telencephalon from control and E 2 treated animals were used. Since song control nuclei are located in the telencephalon, we looked at the change in gene expression in this brain region. Non-perfused telencephalic tissue was collected and rapidly frozen in ice-cold methylbutane from P21 animals at 2, 6 and 18 hrs post-injection.

121 106 RNA extraction, cdna synthesis and q-pcr were performed as explained previously. Similarly, δct and relative expressions were calculated as described above. A Two-Way ANOVA (sex x time) was performed on relative expression values to examine the effect of E 2 treatment on rps6 gene expression. The level of significance was determined at P<0.05. RESULTS RpS6 gene sequence Blasting the 820 bp long sequence obtained from DDRT-PCR against the chicken genome (the zebra finch genome was not published when this work was started) confirmed that the gene was rps6, since it shared 98% identity to the chicken homologue. Months later when the zebra finch genome became available, blasting the sequence (that was initially identified) against the full length zebra finch rps6 sequence (which was 833 bp in length) indicated 100% identity, further confirming that we had isolated rps6. The full length gene translated into a 247 amino acid long sequence. A 2kb long promoter sequence was obtained from NCBI, and examined it for possible hormone responsive regions. Analysis using the MatInspector software revealed the presence of a potential estrogen response element (ERE) 393 bp upstream of the transcription start site, which indicated that this gene may directly respond to estrogens.

122 107 Gene expression Statistical analysis of rps6 gene expression at P3, P8, P15, P21, P30 and adults indicated a significant effect of sex (F=57.155, p<0.001) and age (F=20.002, p<0.001). The sex difference persisted through adulthood with males having a greater expression at all ages as compared to females. The dimorphism was greatest at P3 and P8. From P15 through adulthood, although gene expression was still greater in males, overall expression was less compared to the younger ages (Figure 4.1). Messenger RNA distribution At P10, expression of rps6 mrna was ubiquitous throughout the brain as would be expected for a ribosomal gene (Tang and Wade, 2006; Duncan and Carruth, 2011). Based on a visual inspection, no qualitative sex difference was observed in its distribution outside the song control nuclei. As previously explained, labeling in HVC and RA were quantitatively analyzed since only these two nuclei were clearly identified in Nissl stained tissue. In HVC, the labeled neurons clearly defined the border of the nucleus (Figure 4.2). In addition, a clear sex difference was detected with a significantly higher number of rps6 labeled neurons in HVC of males as compared to females (t=5.76, p<0.001; Figure 4.3). Similar to HVC, rps6 labeling also defined the border of RA (Figure 4.4). Within the defined region, the number of rps6 labeled cells was significantly higher in males as compared to females (t = 6.11, p<0.001; Figure 4.5).

123 108 Figure 4.1. Relative expression of rps6 gene in the zebra finch telencephalon (n=6 males, 6 females per group). Two Way ANOVA was conducted on the relative expression values to examine the effect of age and sex on the gene. The expression in P3 females was designated as 100% and gene expression for the other groups was compared to this. Across ages, bars with different letters are significantly different from each other. Asterisks denote a difference within the group. Error bars represent the standard error of mean.

124 109 A C B D Figure 4.2. RpS6 labeling in the song control nucleus HVC of a P10 male (A) and a female zebra finch (B). White arrows outline the border of the song nucleus (confirmed with Nissl). (C) Magnified view of labeling in (A) where arrowheads point to the neurons with cytoplasmic labeling. The sections hybridized to the sense probe (D) did not contain labeling indicating the specificity of the probe.

125 Figure 4.3. Counts + SEM of rps6 labeled cells in the song control nucleus HVC of P10 male and female zebra finches (n=6 males, 6 females). Measurements were performed bilaterally from two adjacent sections, within a 0.09mm 2 sized box placed in the middle of the nucleus where the area was greatest. A significant effect of sex on the number of labeled cells was observed (t=5.76, p<0.001). 110

126 111 A B Figure 4.4. RpS6 labeling in the song control nucleus RA of a P10 male (A) and female zebra finch (B). White arrows outline the border of the song nucleus.

127 Figure 4.5. Counts + SEM of rps6 labeled cells in RA (n=6 males, 6 females). Measurements were performed bilaterally from two adjacent sections, within a 0.09mm 2 sized box placed in the middle of the nucleus where the area was greatest. A significant effect of sex on the number of labeled cells was observed (t=6.11, p<0.001). 112

128 113 Apart from the song nuclei HVC and RA, at the age of investigation (P10), borders of LMAN and Area X could not be clearly identified in all animals even in the Nissl stained sections. However, labeling in the presumptive regions appeared to be of a similar intensity as in other song control nuclei. In addition, the labeling was continuous in the surrounding region from corresponding LMAN and Area X making it very difficult to choose a region within the nuclei with certainty. Therefore, counting was not performed in regions representing LMAN and Area X. Effect of E 2 on rps6 gene expression Quantitative analysis of gene expression following E 2 injection revealed a significant effect of sex (F=84.84, p<0.001) and treatment (F=30.64, p<0.001). In particular, males and females exhibited a significant increase in the rps6 gene 2 hrs after a single E 2 injection. Although the effect of treatment was significant in both sexes, it was approximately twice as robust in males as compared to females. Six hours post-injection, there was a significant drop in both sexes as compared to the 2 hrs-post treatment level. The gene expression did not differ between controls and 6 hrs post-treatment. By 18 hrs following the injection, the gene had decreased significantly in both males and females as compared to the controls (Figure 4.6).

129 Figure 4.6. Effect of E 2 treatment (a single subcutaneous injection of 50 µg) on rps6 gene expression in P21 males and females (n=6 males, 6 females per group) examined by using a two way ANOVA on relative expression values. Gene expression in controls at different time points did not differ from each other, thus these data were pooled and presented as a single data point. The expression in control P3 females was designated as 100% and gene expression for the other groups was compared to this. Within each sex and at the same time point across sexes, bars with different letters are significantly different from each other. A significant effect of sex (F=84.84, p<0.001) and treatment (F=30.64, p<0.001) was revealed. 114

130 115 DISCUSSION In the current study, we present evidence for a potential role of the Z-linked gene rps6 in dimorphic development of the zebra finch brain. From an early post-hatching age through adulthood, rps6 expression is more enhanced in males as compared to females. Moreover, expression in males is approximately twice the level than in females, and is greatest in both sexes during the first and early half of the second week post-hatching. Analysis of the mrna indicated a widespread distribution throughout the brain that appeared monomorphic. However, within song nuclei HVC and RA, quantitatively there were more rps6 positive cells in males than in females. Consistent with existing studies in this and other vertebrate models in which the effects of a gene can be modulated by hormones (Dittrich et al., 1999; Peterson et al., 2001; Carrer and Cambiasso, 2002; Sanford et al., 2010), a single systemic injection of E 2 at P21 resulted in an up-regulation of rps6 in both sexes. Collectively, these results suggest that rps6 plays an important role in dimorphic development of the brain, and that E 2 may have a facilitative effect on rps6 function. The specific mechanisms by which rps6 may affect brain sex differences is not exactly known. However, one hypothesis can be made based on its pattern and timing of expression. For example, one possibility is that it may be essential for the incorporation of new neurons into HVC. In males, during the first and second week after hatching, more neurons are added into HVC from the proliferative VZ that borders this nucleus,

131 116 than at any other age (Alvarez-Buylla et al., 1990; Burek et al., 1994; DeWulf and Bottjer, 2005; Scott and Lois, 2007). Since rps6 labeling was greater in male HVC compared to female at least at one age during this period, the gene may affect the dimorphism in neuronal addition within the nucleus. Interestingly, our data revealed that rps6 displayed dimorphic expression even at ages earlier than when HVC (and all other song control nuclei) have morphologically developed. Thus, this suggests that rps6 may additionally be involved in early processes that direct the initial formation of song nuclei. In addition to HVC, rps6 is also dimorphic in RA. Existing data suggest that a similar number of neurons are added to RA in males and females beginning at an early embryonic period and lasting through P6 (Kirn and DeVoogd, 1989). However, glia are added throughout the first month at a greater rate in males than in females (Nordeen et al., 1996). Although we examined mrna distribution at P10 only when labeling was greater in this song nucleus, the telencephalic gene expression profile revealed dimorphism throughout life, suggesting that rps6 may mediate dimorphism in recruitment of glia in RA. In mammals, sex-chromosome inactivation is a process that allows females to have the same complement of X-linked genes as males. Interestingly, sex-chromosome inactivation is not common in avians, and this may result in dimorphic effects on a

132 117 system (Itoh et al., 2007; Ellegren et al., 2007; Warren et al., 2010). Consistent with this idea, approximately twice the expression of rps6 in males from the earliest age examined (P3) through adulthood implies that the transcription of both copies of this Z-linked gene exert a double effect in males (ZZ) as compared to females (ZW). This, along with malebiased expression of its mrna in HVC and RA, all suggest a dimorphic effect of rps6 on brain development. In vertebrates, the effects of genes can be amplified by their interaction with hormones (Dittrich et al., 1999; Peterson et al., 2001; Sanford et al., 2010). In the current study, a significant up-regulation of rps6 gene was observed following E 2 treatment. RpS6 may primarily act to enhance addition of neurons and glia into HVC and RA respectively, and E 2 by itself is also known to increase the recruitment of both of these cell types (Nordeen and Nordeen, 1989; Burek et al., 1997; Peterson et al., 2004; Lee et al., 2007). Thus, we propose that these two components acting together may lead to a greater enhancement of neuronal and glial recruitment into these song control nuclei. The ERE identified in the zebra finch rps6 promoter through in silico analysis suggests that its interaction with E 2 is mediated by nuclear estrogen receptors. The most common way of E 2 mediated upregulation of target genes containing an ERE is through nuclear receptors (ERα and ERβ) that act as transcription factors (reviewed in Tsai and O Malley, 1994; Nilsson et al., 2001). The activated receptors form dimers and translocate to the nucleus, bind to ERE, and mediate gene transcription (reviewed in Tetel et al., 2009). In zebra finches, ERβ has not been shown to be present in song control nuclei (Bernard et al., 1999; Perlman and

133 118 Arnold, 1999). In contrast, ERα is present, but in limited amounts and only within specific song control nuclei. For example, it is present in HVC (Jacobs et al., 1996; 1999; Gahr and Metzdorf, 1998), which also contains male-biased rps6 expression. Thus, there may be a direct interaction of these two components at this site to induce masculinization. In RA, ERα expression is very minimal (Gahr and Metzdorf, 1998; Jacobs et al., 1999) making it less likely to have a significant effect on rps6. Instead, dimorphic effect of rps6 within RA may be independent of local estrogenic effects within the nucleus. Alternatively, neuronal projections from HVC possibly exert dimorphic effects of E 2 on rps6 function within RA since E 2 induced masculinization has been previously reported in RA (Dittrich et al., 1999). In song nuclei LMAN and Area X, the role of rps6 is less clear. Dense rps6 labeling was observed in brain regions that corresponded to where LMAN and Area X would be located. However, we were unable to specifically measure gene expression in these nuclei due to difficulty in consistently identifying borders in all animals. Although both of these nuclei can be masculinized by E 2 in females, the interaction of hormone with rps6 is unlikely since they do not express nuclear estrogen receptors (Jacobs et al., 1996, 1999; Bernard et al., 1999). Instead, Area X is regulated by afferents from HVC, which provide IGF-II to this nucleus (Holzenberger et al., 1997). Since LMAN receives only indirect connections through Area X and RA (Nottebohm et al., 1976; Nottebohm and Arnold 1976), whether its regulation is possible through HVC is unknown.

134 119 In sum, we have shown that rps6 is a sex-linked gene in avians with a potential role in masculinization of HVC and RA in males. This is one of very few genes to show a malebiased expression throughout life suggesting that it may be essential to initiate and maintain masculinization of the song system. However, its function in brain dimorphisms and its possible interaction with E 2 has not been previously explored in other vertebrates, thus requiring future research. REFERENCES Agate RJ, Grisham W, Wade J, Mann S, Wingfield J, Schanen C, Palotie A, Arnold AP Neural, not gonadal, origin of brain sex differences in a gynandromorphic finch. Proc Nat Acad Sci USA 100: Alvarez-Buylla A, Kirn JR, Nottebohm F Birth of projection neurons in adult avian brain may be related to perceptual or motor learning. Science 249: Bernard DJ, Bentley GE, Balthazart J, Turek FW, Ball GF Androgen receptor, estrogen receptor α, and estrogen receptor β show distinct patterns of expression in forebrain song control nuclei of European Starlings. J Endocrinol 140:

135 120 Bottjer SW, Glaessner SL, Arnold AP Ontogeny of brain nuclei controlling song learning and behavior in zebra finches. J Neurosci 5: Bottjer SW Neural strategies for learning during sensitive periods of development. J Comp Physiol A Neuroethol Sens Neural Behav Physiol 188: Burek MJ, Nordeen KW, Nordeen EJ Sexually dimorphic neuron addition to an avian song-control region is not accounted for by sex differences in cell death. J Neurobiol. 33: Burek MJ, Nordeen KW, Nordeen EJ Ontogeny of sex differences among newly generated neurons of the juvenile avian brain. Brain Res Dev Brain Res 78: Carrer HF, Cambiasso MJ Sexual differentiation of the brain: genes, estrogen, and neurotrophic factors. Cell Mol Neurobiol 5-6: Review. DeWulf V, Bottjer SW Age and sex differences in mitotic activity within the zebra finch telencephalon. J Neurosci 22:

136 121 DeWulf V, Bottjer SW Neurogenesis within the juvenile zebra finch telencephalic ventricular zone: A map of proliferative activity. J Comp Neurol 481: Dittrich F, Feng Y, Metzdorf R, Gahr M Estrogen-inducible, sex- specific expression of brain derived neurotrophic factor mrna in a forebrain song control nucleus of the juvenile zebra finch. Proc Natl Acad Sci USA 96: Duncan KA, Carruth LL The sexually dimorphic expression of L7/SPA, an estrogen receptor coactivator, in zebra finch telencephalon. Dev Neurobiol 67: Duncan KA, Jimenez P, Carruth LL The selective estrogen receptor-alpha coactivator, RPL7, and sexual differentiation of the songbird brain. Psychoneuroendocrinology 34S: S30 S38. Duncan KA, Jimenez P, Carruth LL Distribution and sexually dimorphic expression of steroid receptor coactivator-1 (SRC-1) in the zebra finch brain. Gen Comp Endocrinol 170:

137 122 Ellegren H, Hultin-Rosenberg L, Brunström B, Dencker L, Kultima K, Scholz B Faced with inequality: chicken do not have a general dosage compensation of sex-linked genes. BMC Biol 5:40. Gahr M and Metzdorf R Distribution and dynamics in the expression of androgen and estrogen receptors in vocal control systems of songbirds. Brain Res Bull 44: Gahr M, Konishi M Developmental changes in estrogen-sensitive neurons in the forebrain of the zebra finch. Proc Natl Acad Sci USA 85: Grisham W, Lee J, Park SH, Mankowski JL, Arnold AP A dose-response study of estradiol s effects on the developing zebra finch song system. Neurosci Lett 445: Gurney ME and Konishi M Hormone-induced sexual differentiation of brain and behavior in zebra finches. Science 208: Holzenberger M, Jarvis ED, Chong C, Grossman M, Nottebohm F, Scharff C Selective expression of insulin-like growth factor II in the songbird brain. J Neurosci 17:

138 123 Itoh Y, Melamed E, Yang X, Kampf K, Wang S, Yehya N, Van Nas A, Replogle K, Band MR, Clayton DF, Schadt EE, Lusis AJ, Arnold AP Dosage compensation is less effective in birds than in mammals. J Biol 6:2. Jacobs EC, Arnold AP, Campagnoni AT Zebra finch estrogen receptor cdna: Cloning and mrna expression. J Ster Biochem Mol Biol 59: Jacobs EC, Arnold AP, Campagnoni AT Developmental regulation of the distribution of aromatase and estrogen receptor mrna expressing cells in the zebra finch brain. Dev Neurosci 21: Kirn JR, DeVoogd TJ Genesis and death of vocal control neurons during sexual differentiation in the zebra finch. J Neurosci 9: Konishi M and Akutagawa E A critical period for estrogen action on neurons of the song control system in the zebra finch. Proc Natl Acad Sci USA 85: Lee DW, Fernando G, Peterson RS, Allen TA, Schlinger BA Estrogen mediation of injury-induced cell birth in neuroproliferative regions of the adult zebra finch brain. Dev Neurobiol 67:

139 124 London SE, Clayton DF Genomic and neural analysis of the estradiol-synthetic pathway in the zebra finch. BMC Neurosci 11:46. London SE, Dong S, Replogle K, Clayton DF Developmental shifts in gene expression in the auditory forebrain during the sensitive period for song learning. Dev Neurobiol 69: Nilsson S, Mäkelä S, Treuter E, Tujague M, Thomsen J, Andersson G, Enmark E, Pettersson K, Warner M, Gustafsson JA Mechanisms of estrogen action. Physiol Rev 4: Nixdorf-Bergweiler BE Divergent and parallel development in volume sizes of telencephalic song nuclei in and female zebra finches. J Comp Neurol 375: Nixdorf-Bergweiler BE and Bischof HJ A stereotaxic atlas of the brain of the zebra finch, Taeniopygia Guttata with special emphasis on telencephalic visual and song system nuclei in transverse and sagittal sections. Bethesda (MD): National Center for Biotechnology Information (US).

140 125 Nordeen EJ, Nordeen KW Estrogen stimulates the incorporation of new neurons into avian song nuclei during adolescence. Brain Res Dev Brain Res 49: Nordeen EJ, Nordeen KW Sex difference among non-neuronal cells precedes sexually dimorphic neuron growth and survival in an avian song control nucleus. J Neurobiol 30: Nordeen EJ, Voelkel L, Nordeen KW Fibroblast growth factor-2 stimulates cell proliferation and decreases sexually dimorphic cell death in an avian song control nucleus. J Neurobiol 37: Nordeen KW, Nordeen EJ, Arnold AP Estrogen establishes sex differences in androgen accumulation in zebra finch brain. J Neurosci 6: Nottebohm F, Arnold AP Sexual dimorphism in vocal control areas of the songbird brain. Science 194: Perlman WR, Arnold AP Expression of estrogen receptor and aromatase mrnas in embryonic and posthatch zebra finch brain. J Neurobiol 55:

141 126 Peterson RS, Lee DW, Fernando G, Schlinger BA Radial glia express aromatase in the injured zebra finch brain. J Comp Neurol 475: Peterson RS, Saldanha CJ, Schlinger BA Rapid upregulation of aromatase mrna and protein following neuronal injury in the zebra finch (Taeniopygia guttata). J Neuroendocrinol 13: Qi LM, Mohr M and Wade J Enhanced expression of tubulin-specific chaperone protein A, mitochondrial ribosomal protein S27, and the DNA excision repair protein XPACCH in the song system of juvenile male zebra finches. Dev Neurobiol 72: Saldanha CJ, Coomaralingam L Overlap and co-expression of estrogen synthetic and responsive neurons in the songbird brain- A double-label immunocytochemical study. Gen Comp Endocrinol 141: Sanford SE, Lange HS, Maney DL Topography of estradiol-modulated genomic responses in the songbird auditory forebrain. Dev Neurobiol 70:73-86.

142 127 Scott BB, Lois C Developmental origin and identity of song system neurons born during vocal learning in songbirds. J Comp Neurol. 502: Tang YP, Wade J Sexually dimorphic expression of the genes encoding ribosomal proteins L17 and L37 in the song control nuclei of juvenile zebra finches. Brain Res 1126: Tang YP, Wade J Effects of estradiol on incorporation of new cells in the developing zebra finch song system: potential relationship to expression of ribosomal proteins L17 and L37. Dev Neurobiol 69: Tetel MJ, Auger AP, Charlier TD Who's in charge? Nuclear receptor coactivator and corepressor function in brain and behavior. Front Neuroendocrinol 3: Tremere LA, Jeong JK, Pinaud R Estradiol shapes auditory processing in the adult brain by regulating inhibitory transmission and plasticity-associated gene expression. J Neurosci 29:

143 128 Tsai MJ, O'Malley BW Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 63: Wade J, Arnold AP Sexual differentiation of the zebra finch song system. Behav Neurobiol Birdsong 1016: Walton C, Pariser E, Nottebohm F The zebra finch paradox: song is little changed, but number of neurons doubles. J Neurosci 32: Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Künstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED et al., The genome of a songbird. Nature 464:757-6.

144 CHAPTER V GLOBAL DISCUSSION Traditionally, rodents have been used as the models for studying brain sex differences, and based on these species it was demonstrated that hormones play a primary role. That conclusion, however, has been challenged by research in the zebra finch which has identified that not just hormones, but rather a combined effect of sex-linked genes and hormones are most likely the major contributors of brain dimorphisms in vertebrates. Currently, however, very little is known about what the exact factors are and how they act to create sex differences within the brain. My work suggests that the hormonal actions may occur through the membrane bound estrogen receptor GPR30, and the nonhormonal effects through the Z-linked gene rps6. Additionally, my research has provided evidence suggesting a role for the interaction of the rps6 gene and estrogens, most likely through nuclear estrogen receptors. Based on conclusions derived from my data and existing studies, I propose a model on how GPR30 and rps6 may contribute to dimorphic development of the songbird brain (Figure 5.1). I hypothesize that rps6 acts during the first and second week post-hatching to direct the formation of song control nuclei. In particular, it may induce masculinization of HVC and RA, possibly by facilitating male-biased neuron and glia addition, respectively. Even though morphological differences in the song system are not detectable until around P12 (Bottjer et al., 1985), sex differences in rps6 that were 129

145 130 Figure 5.1. Proposed mechanism of action for the membrane bound estrogen receptor GPR30 and the rps6 gene in dimorphic development of the neural song system in zebra finches.