Complete coding sequences and phylogenetic analysis of porcine bocavirus
|
|
- Mavis Hill
- 6 years ago
- Views:
Transcription
1 Journal of General Virology (2011), 92, DOI /vir Short Communication Correspondence Shaobo Xiao Received 27 October 2010 Accepted 10 January 2011 Complete coding sequences and phylogenetic analysis of porcine bocavirus Songlin Zeng,3 Dang Wang,3 Liurong Fang, Jun Ma, Tao Song, Ruoxi Zhang, Huanchun Chen and Shaobo Xiao Division of Animal Infectious Diseases, State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan , PR China Here we report, for the first time, the nearly full-length genome sequence of porcine bocavirus (PBoV), a recently discovered parvovirus from pigs. Phylogenetic trees based on this genome sequence showed that PBoV belongs to the branch containing the genus Bocavirus, which comprises canine minute virus (CnMV), bovine parvovirus, gorilla bocavirus and human bocavirus (HBoV), and was most closely related to the group containing CnMV. PBoV was predicted to contain three potential ORFs encoding the non-structural protein NS1, the characteristic NP1 protein and the capsid protein VP1/VP2, with an organization similar to that of known bocaviruses. Interestingly, the NS1 gene of PBoV was more similar in length to the homogeneous gene found in HBoV than to those of other known bocaviruses. In addition, highly conserved unique splicedonor and -acceptor sites were identified in the NS1 gene of HBoV and PBoV. The family Parvoviridae is classified into two subfamilies: the subfamily Parvovirinae, which infects vertebrates, and the subfamily Densovirinae, which infects arthropods. Based on a report published by the International Committee on Taxonomy of Viruses (ICTV), the subfamily Parvovirinae is divided into five genera: Parvovirus, Erythrovirus, Dependovirus, Amdovirus and Bocavirus (Tattersall et al., 2005). Recently, Hokovirus was proposed as a new genus of the subfamily Parvovirinae (Adlhoch et al., 2010; Lau et al., 2008). Bocavirus, one genus of the subfamily Parvovirinae, isa non-enveloped, autonomously replicating, single-stranded DNA virus containing a genome of approximately 5 kb in length, and has close relationships with respiratory and enteric infections in humans and animals (Allander et al., 2005; Chen et al., 1986, 1988, 2010; Kapoor et al., 2010a, b; Manteufel & Truyen, 2008; Schwartz et al., 2002). The genus Bocavirus comprises four members: bovine parvovirus (BPV), canine minute virus (CnMV), human bocavirus (HBoV) and gorilla bocavirus (GBoV), and has gained special attention because of HBoV, which causes respiratory diseases in children. In the field of veterinary medicine, BPV and CnMV were discovered in the 1960s and they share about 40 % sequence identity (Schwartz et al., 2002). 3These authors contributed equally to this work. The GenBank accession number of the nearly full-length genome of PBoV strain WUH1 reported in this paper is HQ A supplementary table of the primers used for the analysis of the complete coding sequence PBoV is available with the online version of this paper. Using random amplification and large-scale sequencing technology, a novel porcine parvovirus was recently discovered in Swedish pigs with post-weaning multisystemic wasting syndrome (PMWS) (Blomström et al., 2009). Based on partial nucleotide sequencing, this novel porcine parvovirus was proposed to be a porcine boca-like virus (PBoV-like). Subsequent studies revealed the high prevalence of this novel PBoV-like in weaning piglets with respiratory tract symptoms or PMWS, and even in pigs without PMWS (Blomström et al., 2010; Zhai et al., 2010). However, to date, the complete genomic sequence for PBoV-like has not been reported. In this study, we first detected the prevalence of this novel PBoV-like from clinical samples collected in central China. Using an established PCR, which amplifies a 496 bp fragment containing the partial VP1/VP2 genes of PBoVlike (Zhai et al., 2010), 120 clinical serum samples from clinically normal pigs from four different farms in Hubei province, China, were analysed. Nearly 40 % (47 of 120) of the samples were positive when tested by PCR (data not shown). The PCR products of eight PBoV-like-positive samples (two samples from each farm) were sequenced and aligned. Only two nucleotide-mutation sites were observed among the eight sequenced samples (data not shown) and they showed % identify with a Swedish PBoV-like reference strain (GenBank accession number FJ872544), indicating that this region is highly conserved in our tested samples. Because the 496 bp sequenced fragments were highly similar, one PBoV-like-positive sample was selected and used to obtain information about the complete genome G 2011 SGM Printed in Great Britain
2 The genome characterization of PBoV Two specific PCR primers, PBoV-1F and PBoV-1R, were first used to amplify a fragment of about 2000 bp, including the complete coding sequence of the NP-1 gene and the partial coding sequence of the putative VP1/2 gene, as described previously (Blomström et al., 2009). A 1929 bp DNA fragment was amplified and sequenced. Based on the sequences obtained, the 59- and 39-end sequences were determined using a primer walking approach, as described previously (Kapoor et al., 2010b). Briefly, each PCR extension step used one primer specific for the novel virus sequence, along with a degenerate primer able to hybridize to all known bocavirus sequences. A schematic diagram of the primer walking approach is depicted in Fig. 1(a) and all of the primers used are listed in Supplementary Table S1 (available in JGV Online). After the complete genome was assembled, each nucleotide was sequenced in triplicate to confirm the sequence. A total of 4786 bp of newly identified PBoV-like genome sequence were assembled and the nearly full-length genome of strain WUH1 was submitted to GenBank under accession number HQ To determine the phylogenetic relationship of PBoV-like with the other members of the subfamily Parvovirinae, phylogenetic analysis and alignment were performed using the neighbour-joining method with the molecular evolutionary genetics analysis (MEGA) 4 software (Tamura et al., 2007). A total of 29 nearly full-length genome sequences representing different parvovirus species of the subfamily Parvovirinae, including Parvovirus (HPV, MPV, LuIII, MVM, CPV, FPV and PPV1), Amdovirus (AMDV), Bocavirus (CnMV, BPV, HBoV1 4 and GBoV1), Erythrovirus (B19, SPV2, BPV3 and ChPV), Dependovirus (MDPV and GPV) and Hokovirus (PARV4, BHoV and PHoV) were used in this analysis. In addition, two novel porcine parvoviruses, PPV4 and Cnvirus (PPV-H1), recently discovered in piglets but not classified with any known parvovirus species of the subfamily Parvovirinae (Cheung et al., 2010; Wang et al., 2010), were also included. As shown in Fig. 1(b), the overall branching pattern of the tree was split into several distinct branches, with each branch representing an individual genus. The newly characterized PBoV-like isolate WUH1 belonged to the branch comprising the genus Bocavirus, along with CnMV, BPV, GBoV and HBoV, and showed a close mutual evolutionary relationship that was distant from other genera of the Parvovirinae. Furthermore, other identified parvoviruses from swine, including the recently discovered PPV4 and Cnvirus, formed two distinct branches within other subfamilies of the Parvovirinae (Fig. 1b), consistent with previous studies (Cheung et al., 2010; Wang et al., 2010). Because the closest genetic relative of PBoV-like belonged to the genus Bocavirus, we identified it as a porcine bocavirus (PBoV) strain. As well as encoding non-structural protein NS1 and structural protein VP1/VP2, similar to other members of the family Parvoviridae, bocavirus also contains a characteristic ORF between the ORFs encoding NS1 and VP1/ VP2 that encodes a unique NP1 protein. Using the ORF PBoV-2F PBoV-4F NS1 PBoV-1F PBoV-4R NP1 VP1/2 PBoV-F PBoV-R PBoV-1R PBoV-2R PBoV-3F PBoV-3R Parvovirus Amdovirus Bocavirus Erythrovirus Dependovirus Cnvirus Hokovirus Fig. 1. Identification of a new porcine bocavirus isolate WUH1. (a) Schematic diagram of the primer-walking approach used to determine the nearly full-length genome sequence of porcine bocavirus. The primers used are listed in Supplementary Table S1 (available in JGV Online). (b) Phylogenetic analyses of PBoV-like isolate WUH1 and other parvovirus species of the subfamily Parvovirinae were conducted using the MEGA4 software and the neighbour-joining method. Numbers at nodes indicate the value of 1000 bootstrap analyses. Bar, Base substitutions per site. The sequences were derived from GenBank entries with the following accession numbers: NC (AAV, adeno-associated virus-1), NC (AMDV, Aleutian mink disease virus), NC (B19, human parvovirus B19), EU (BHoV, bovine hokovirus), NC (BPV, bovine parvovirus), NC (BPV-2, bovine parvovirus 2), AF (BPV-3, bovine parvovirus 3), NC (CPV, canine parvovirus type), GQ (ChPV, chipmunk parvovirus), M38246 (FPV, feline panleukopenia virus), HM (GBoV, gorilla bocavirus), NC (GPV, goose parvovirus), U34255 (HPV, hamster parvovirus), NC (HBoV1, human bocavirus), NC (HBoV2, human bocavirus 2), NC (HBoV3, human bocavirus 3), NC (HBoV4, human bocavirus 4), NC (PARV4, human parvovirus 4), NC (LuIII, LuIII virus), AF (CnMV, minute virus of canines), NC (MVM, minute virus of mice), NC (MPV, mouse parvovirus), NC (MDPV, Muscovy duck parvovirus), EU (PHoV, porcine hokovirus), NC (PPV1, porcine parvovirus), HM (PPV4, porcine parvovirus 4), AB (PPV-H1, porcine parvovirus H1) and U26342 (SPV, simian parvovirus). X, Parvovirus isolates from pigs
3 S. Zeng and others finder available at the NCBI website ( nih.gov/gorf/gorf.html), three ORFs were identified in the nearly full-length genome of PBoV, as expected. The first 59 ORF of PBoV, NS1, comprised 1911 bp and encoded 636 aa. The second ORF, NP1, comprised 657 bp and encoded 218 aa. The third ORF, VP1/VP2, comprised 1872 bp and encoded 623 aa. To investigate further the genetic diversity of PBoV, the complete coding sequence of PBoV from strain WUH1 was compared with the other available human and animal bocavirus sequences. The sequence identity between different strains was calculated using the CLUSTAL W program online ( uk/tools/msa/clustalw2). The complete coding sequence of PBoV had sequence similarity at the nucleotide level to CnMV of %, to BPV of %, to GBoV of 50 % and to HBoV of %, supporting the finding that PBoV was phylogenetically related to CnMV (Fig. 1b). To examine the PBoV genome further and identify any unique features, we compared the NS1, NP1 and VP1/VP2 genes of PBoV with other available bocavirus sequences. At the amino acid sequence level, the predicted NS1 gene of PBoV showed sequence identity with CnMV of %, BPV of %, GBoV of 40 % and HBoV of %; the NP1 gene showed sequence identity with CnMV of %, BPV of %, GBoV of 32 % and HBoV of %; and the VP1/VP2 gene showed sequence identity with CnMV of %, BPV of %, GBoV of 34 % and HBoV of %. Phylogenetic trees based on the NS1, NP1 and VP1/VP2 sequences were constructed using both the nucleotide and deduced amino acid sequences. As is shown in Fig. 2, phylogenetic analysis of the nucleotide sequences of NS1 showed that PBoV belonged to the branch containing CnMV. However, phylogenetic analysis of the nucleotide sequences of NP1, a protein of unknown function that is restricted to bocaviruses, indicated that PBoV formed a distinct branch with the other available bocaviruses. Interestingly, phylogenetic analysis of the nucleotide sequence of the VP1/VP2 gene indicated that PBoV formed a distinct branch, whereas phylogenetic analysis of the amino acid sequence of VP1/VP2 indicated that PBoV belonged to the branch containing CnMV (data not shown). According to the criteria of the ICTV for the classification of bocaviruses, NS gene DNA sequence homology is defined as an important marker of different bocavirus species ( In addition, previous studies have revealed that the NS1 protein encoded by animal bocaviruses is longer than that encoded by human bocaviruses (Kapoor et al., 2010b). Although the predicted NS1 gene of PBoV had higher sequence identity with CnMV at the amino acid sequence level, PBoV NS1 encodes a shorter protein (636 aa), which is more similar in length to the NS1 protein found in HBoV, than to that in other known animal bocaviruses (Kapoor et al., 2010a, b; Qiu et al., 2007; Sun et al., 2009). Recently, Kapoor et al. (2010b) showed the presence of highly conserved potential RNA splicing signals in the NS1 gene of all HBoV species, Nucleotide sequence of the NS1 gene Nucleotide sequence of the NP1 gene Nucleotide sequence of the VP1/2 gene Fig. 2. Phylogenetic analyses of the nucleotide sequences of NS1, NP1 and VP1/VP2 were conducted using the MEGA4 software and the neighbour-joining method. Numbers at the nodes indicate the values of 1000 bootstrap analyses. $, Strain WUH1 PBoV for which a nearly full-length genome is reported in this paper. and revealed a putative elongated aa NS1 protein resulting from such a spliced transcript from HBoV. Using an online program to analyse gene structure ( mit.edu/genscan.html), we found, in all four HBoV species and in PBoV, the presence of a stretch of amino acids similar to those encoded in the C terminus of the longer NS1 proteins of other bocaviruses (Fig. 3a). The genomes of all HBoV species and PBoV were aligned to determine the presence of conserved potential RNA splicing signals and the putative second exon encoding the C-terminal region of NS1 (Fig. 3b, splice donor, branch and splice acceptor sites). The putative NS1 protein resulting from such a spliced transcript encoded a 748 aa protein and an elongated carboxy terminus that showed higher similarity to the NS1 protein of HBoV than to that of other known bocaviruses (Fig. 3c). More recently, Chen et al. (2010) demonstrated that the spliced NS1-transcript of HBoV1 was expressed as a large protein of approximately 100 kda in human alveolar epithelial A549 cells transfected with the nearly full-length clones of HBoV Journal of General Virology 92
4 The genome characterization of PBoV PBoV HBoV BPV CnMV GBoV NS1 NP1 VP1/VP2 Splice donor site Branch site Splice acceptor site NS1 protein before splicing Intron Extended NS1 protein Fig. 3. Unique genomic features of the NS1 gene of PBoV. (a) Genome structure of different species of known bocaviruses. (b) Consensus RNA splicing sequence and the presence of similar sequence motifs that are conserved among the NS1 genes of all HBoV and PBoV. Potential stop codons of the nonspliced NS1 transcripts are underlined. (c) Protein identity between the extended carboxy termini of NS1 of PBoV and the NS1 termini of other animal bocaviruses. Despite the high genetic diversity observed in all HBoV species, the PBoV genome also has highly conserved NSgene RNA splicing sites, suggesting that two different NS proteins of PBoV may be expressed in host cells. As an emerging porcine parvovirus, a high prevalence (nearly 40 %) of PBoV infection in the present study was observed in serum samples from clinically normal pigs. Our results are consistent with previous studies that indicated that 44 % of healthy pigs were PBoV positive (Blomström et al., 2010). It is interesting to note a rather high prevalence (88 %) of PBoV infection in pigs with PMWS (Blomström et al., 2010). Therefore, more studies need to be conducted to see if PBoV contributes to the development of PMWS or to other related complex swine diseases. Because a higher PBoV infection rate was observed in pigs, and to date natural PBoV has not been isolated in vitro, we tried to isolate PBoV from PBoV-positive samples in primary cells isolated from pigs and from some established cell lines in vitro. Although several kinds of cells, including porcine kidney cells (PK-15), swine testicular cells, porcine alveolar macrophages, monkey kidney cells (MARC-145) and human embryonic kidney epithelial cells (HEK293T) cells, were used to propagate this novel PBoV, no growth was detected in any of the cells tested (data not shown). Further studies are therefore required to obtain or establish a permissive cell line for PBoV infection in vitro. In summary, this is the first study to report the nearly fulllength genome sequence of porcine bocavirus. PBoV contains three potential ORFs, with a genome organized similarly to those of known bocaviruses. Phylogenetic analysis revealed that PBoV is most closely related to the group of viruses containing CnMV. The results of this study increase our understanding of animal bocaviruses and provide a foundation for novel detection, diagnosis and prevention strategies for PBoV. Acknowledgements This work was supported by the 863 project (2011AA10A208) and the New Century Excellent Talent Project (NCET ). References Adlhoch, C., Kaiser, M., Ellerbrok, H. & Pauli, G. (2010). High prevalence of porcine Hokovirus in German wild boar populations. Virol J 7, 171. Allander, T., Tammi, M. T., Eriksson, M., Bjerkner, A., Tiveljung- Lindell, A. & Andersson, B. (2005). Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc Natl Acad Sci USA102, Blomström, A. L., Belák, S., Fossum, C., McKillen, J., Allan, G., Wallgren, P. & Berg, M. (2009). Detection of a novel porcine boca-like virus in the background of porcine circovirus type 2 induced postweaning multisystemic wasting syndrome. Virus Res 146,
5 S. Zeng and others Blomström, A. L., Belák, S., Fossum, C., Fuxler, L., Wallgren, P. & Berg, M. (2010). Studies of porcine circovirus type 2, porcine bocalike virus and torque teno virus indicate the presence of multiple viral infections in postweaning multisystemic wasting syndrome pigs. Virus Res 152, Chen, K. C., Shull, B. C., Moses, E. A., Lederman, M., Stout, E. R. & Bates, R. C. (1986). Complete nucleotide sequence and genome organization of bovine parvovirus. J Virol 60, Chen, K. C., Shull, B. C., Lederman, M., Stout, E. R. & Bates, R. C. (1988). Analysis of the termini of the DNA of bovine parvovirus: demonstration of sequence inversion at the left terminus and its implication for the replication model. J Virol 62, Chen, A. Y., Cheng, F., Lou, S., Luo, Y., Liu, Z., Delwart, E., Pintel, D. & Qiu, J. (2010). Characterization of the gene expression profile of human bocavirus. Virology 403, Cheung, A. K., Wu, G., Wang, D., Bayles, D. O., Lager, K. M. & Vincent, A. L. (2010). Identification and molecular cloning of a novel porcine parvovirus. Arch Virol 155, Kapoor, A., Mehta, N., Esper, F., Poljsak-Prijatelj, M., Quan, P. L., Qaisar, N., Delwart, E. & Lipkin, W. I. (2010a). Identification and characterization of a new bocavirus species in gorillas. PLoS ONE 5, e Kapoor, A., Simmonds, P., Slikas, E., Li, L., Bodhidatta, L., Sethabutr, O., Triki,H.,Bahri,O.,Oderinde,B.S.&otherauthors(2010b).Human bocaviruses are highly diverse, dispersed, recombination prone, and prevalent in enteric infections. JInfectDis201, Lau, S. K., Woo, P. C., Tse, H., Fu, C. T., Au, W. K., Chen, X. C., Tsoi, H. W., Tsang, T. H., Chan, J. S. & other authors (2008). Identification of novel porcine and bovine parvoviruses closely related to human parvovirus 4. J Gen Virol 89, Manteufel, J. & Truyen, U. (2008). Animal bocaviruses: a brief review. Intervirology 51, Qiu, J., Cheng, F., Johnson, F. B. & Pintel, D. (2007). The transcription profile of the bocavirus bovine parvovirus is unlike those of previously characterized parvoviruses. J Virol 81, Schwartz, D., Green, B., Carmichael, L. E. & Parrish, C. R. (2002). The canine minute virus (minute virus of canines) is a distinct parvovirus that is most similar to bovine parvovirus. Virology 302, Sun, Y., Chen, A. Y., Cheng, F., Guan, W., Johnson, F. B. & Qiu, J. (2009). Molecular characterization of infectious clones of the minute virus of canines reveals unique features of bocaviruses. J Virol 83, Tamura, K., Dudley, J., Nei, M. & Kumar, S. (2007). MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24, Tattersall, P., Bergoin, M., Bloom, M. E., Brown, K. E., Linden, R. M., Muzyczka, N., Parrish, C. R. & Tijsses, P. (2005). Family Parvoviridae. In Virus Taxonomy: Classification and Nomenclature of Viruses. Eighth report of the International Committee on the Taxonomy of Viruses, pp Edited by C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger & L. A. Ball. London, UK: Elsevier Academic Press. Wang, F., Wei, Y., Zhu, C., Huang, X., Xu, Y., Yu, L. & Yu, X. (2010). Novel parvovirus sublineage in the family of Parvoviridae. Virus Genes 41, Zhai, S., Yue, C., Wei, Z., Long, J., Ran, D., Lin, T., Deng, Y., Huang, L., Sun, L. & other authors (2010). High prevalence of a novel porcine bocavirus in weanling piglets with respiratory tract symptoms in China. Arch Virol 155, Journal of General Virology 92
Identification and characterization of bocaviruses in cats and dogs reveals a novel feline bocavirus and a novel genetic group of canine bocavirus
Journal of General Virology (2012), 93, 1573 1582 DOI 10.1099/vir.0.042531-0 Identification and characterization of bocaviruses in cats and dogs reveals a novel feline bocavirus and a novel genetic group
More informationThe family Parvoviridae
Arch Virol (2014) 159:9 1247 DOI 10.1007/s00705-013-1914-1 VIROLOGY DIVISION NEWS The family Parvoviridae Susan F. Cotmore Mavis Agbandje-McKenna John A. Chiorini Dmitry V. Mukha David J. Pintel Jianming
More informationDOWNLOAD OR READ : REVERSING BOCAVIRUS INFECTION PDF EBOOK EPUB MOBI
DOWNLOAD OR READ : REVERSING BOCAVIRUS INFECTION PDF EBOOK EPUB MOBI Page 1 Page 2 reversing bocavirus infection reversing bocavirus infection pdf reversing bocavirus infection The Study. Nine (50%) HBoV
More informationCopyright is owned by the Author of the thesis. Permission is given for a copy to be downloaded by an individual for the purpose of research and
Copyright is owned by the Author of the thesis. Permission is given for a copy to be downloaded by an individual for the purpose of research and private study only. The thesis may not be reproduced elsewhere
More informationTOPIC CLADISTICS
TOPIC 5.4 - CLADISTICS 5.4 A Clades & Cladograms https://upload.wikimedia.org/wikipedia/commons/thumb/4/46/clade-grade_ii.svg IB BIO 5.4 3 U1: A clade is a group of organisms that have evolved from a common
More informationCo-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli 4
SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16176 DOI: 10.1038/NMICROBIOL.2016.176 Co-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli 4 5 6 7 8 9 10 11 12 13 14 15 16 17
More informationIn the first half of the 20th century, Dr. Guido Fanconi published detailed clinical descriptions of several heritable human diseases.
In the first half of the 20th century, Dr. Guido Fanconi published detailed clinical descriptions of several heritable human diseases. Two disease syndromes were named after him: Fanconi Anemia and Fanconi
More informationComparing DNA Sequences to Understand Evolutionary Relationships with BLAST
Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST INVESTIGATION 3 BIG IDEA 1 Lab Investigation 3: BLAST Pre-Lab Essential Question: How can bioinformatics be used as a tool to
More informationPORCINE CIRCOVIRUS - 2 AN EMERGING DISEASE OF CROSSBRED PIGS IN TAMIL NADU, INDIA
International Journal of Science, Environment and Technology, Vol. 3, No 3, 2014, 1268 1272 ISSN 2278-3687 (O) PORCINE CIRCOVIRUS - 2 AN EMERGING DISEASE OF CROSSBRED PIGS IN TAMIL NADU, INDIA S. Krishna
More informationCLADISTICS Student Packet SUMMARY Phylogeny Phylogenetic trees/cladograms
CLADISTICS Student Packet SUMMARY PHYLOGENETIC TREES AND CLADOGRAMS ARE MODELS OF EVOLUTIONARY HISTORY THAT CAN BE TESTED Phylogeny is the history of descent of organisms from their common ancestor. Phylogenetic
More informationParvovirus Type 2c An Emerging Pathogen in Dogs. Sanjay Kapil, DVM, MS, PhD Professor Center for Veterinary Health Sciences OADDL Stillwater, OK
Parvovirus Type 2c An Emerging Pathogen in Dogs Sanjay Kapil, DVM, MS, PhD Professor Center for Veterinary Health Sciences OADDL Stillwater, OK Properties of Canine Parvovirus Single-stranded DNA virus
More informationCANINE PARVOVIRUS AND ENTEROTOXIGENIC ESCHERICHIA COLI CAUSING THE DEATH OF A PUPPY IN A KENNEL
Bull. Vet. Inst. Pulawy 47, 287-291, 2003 CANINE PARVOVIRUS AND ENTEROTOXIGENIC ESCHERICHIA COLI CAUSING THE DEATH OF A PUPPY IN A KENNEL ARTUR RZEUTKA, JACEK OSEK* AND BEATA MIZAK Department of Carnivores
More informationAnalysis of CR1 repeats in the zebra finch genome
Analysis of CR1 repeats in the zebra finch genome George E. Liu, Yali Hou* and Twain Brown Bovine Functional Genomics Laboratory, ANRI, ARS, USDA, Beltsville, Maryland 20705, USA *Also affiliated with
More informationName: Date: Hour: Fill out the following character matrix. Mark an X if an organism has the trait.
Name: Date: Hour: CLADOGRAM ANALYSIS What is a cladogram? It is a diagram that depicts evolutionary relationships among groups. It is based on PHYLOGENY, which is the study of evolutionary relationships.
More informationComparing DNA Sequences Cladogram Practice
Name Period Assignment # See lecture questions 75, 122-123, 127, 137 Comparing DNA Sequences Cladogram Practice BACKGROUND Between 1990 2003, scientists working on an international research project known
More informationAnimal reservoirs for Nipah virus
Animal reservoirs for Nipah virus Dr. D. T. Mourya ICMR-National Institute of Virology Pune 411021, INDIA Tracing the source of Infection ICMR-NIV, Pune has team of scientific experts and trained field
More informationOccurrence, molecular characterization and predominant genotypes of Enterocytozoon bieneusi in dairy cattle in Henan and Ningxia, China
Li et al. Parasites & Vectors (2016) 9:142 DOI 10.1186/s13071-016-1425-5 SHORT REPORT Occurrence, molecular characterization and predominant genotypes of Enterocytozoon bieneusi in dairy cattle in Henan
More informationEpigenetic regulation of Plasmodium falciparum clonally. variant gene expression during development in An. gambiae
Epigenetic regulation of Plasmodium falciparum clonally variant gene expression during development in An. gambiae Elena Gómez-Díaz, Rakiswendé S. Yerbanga, Thierry Lefèvre, Anna Cohuet, M. Jordan Rowley,
More informationSupplemental Information. A Deletion in the Canine POMC Gene. Is Associated with Weight and Appetite. in Obesity-Prone Labrador Retriever Dogs
Cell Metabolism, Volume 23 Supplemental Information A Deletion in the Canine POMC Gene Is Associated with Weight and Appetite in Obesity-Prone Labrador Retriever Dogs Eleanor Raffan, Rowena J. Dennis,
More informationCh 1.2 Determining How Species Are Related.notebook February 06, 2018
Name 3 "Big Ideas" from our last notebook lecture: * * * 1 WDYR? Of the following organisms, which is the closest relative of the "Snowy Owl" (Bubo scandiacus)? a) barn owl (Tyto alba) b) saw whet owl
More informationCOMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST
COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST In this laboratory investigation, you will use BLAST to compare several genes, and then use the information to construct a cladogram.
More informationCOMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST
Big Idea 1 Evolution INVESTIGATION 3 COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST How can bioinformatics be used as a tool to determine evolutionary relationships and to
More informationGenotypes of Cornel Dorset and Dorset Crosses Compared with Romneys for Melatonin Receptor 1a
Genotypes of Cornell Dorset and Dorset Crosses Compared with Romneys for Melatonin Receptor 1a By Christian Posbergh Cornell Undergraduate Honor Student, Dept. Animal Science Abstract: Sheep are known
More informationIntegrating genomics, testing, and management strategies to control OPP
Integrating genomics, testing, and management strategies to control OPP Kreg Leymaster USDA, Agricultural Research Service, U.S. Meat Animal Research Center, Clay Center, NE USDA is an equal opportunity
More informationPathogenic Potential of Canine Parvovirus Types 2a and 2c in Domestic Cats
CLINICAL AND DIAGNOSTIC LABORATORY IMMUNOLOGY, May 2001, p. 663 668 Vol. 8, No. 3 1071-412X/01/$04.00 0 DOI: 10.1128/CDLI.8.3.663 668.2001 Copyright 2001, American Society for Microbiology. All Rights
More informationEvolutionary Trade-Offs in Mammalian Sensory Perceptions: Visual Pathways of Bats. By Adam Proctor Mentor: Dr. Emma Teeling
Evolutionary Trade-Offs in Mammalian Sensory Perceptions: Visual Pathways of Bats By Adam Proctor Mentor: Dr. Emma Teeling Visual Pathways of Bats Purpose Background on mammalian vision Tradeoffs and bats
More informationLecture 11 Wednesday, September 19, 2012
Lecture 11 Wednesday, September 19, 2012 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean
More informationResearch in rabbit science. University of Bari
Research in rabbit science. University of Bari Antonio Camarda Università of Bari Aldo Moro Faculty of Veterinary Medicine Dept of Veterinary Public Health and Animal Sciences a.camarda@veterinaria.uniba.it
More informationSupplementary Table 1. Primers used in the study.
Supplementary Table 1. Primers used in the study. Primer Position (bp) Upstream primer (5 3 ) Downstream primer (5 3 ) Expected (bp) size 1 1 278 ACCAAACAGAGAATCTGTGAG CAGCAATCCGAAGGCAGAATAC 299 2 48 946
More informationJerry and I am a NGS addict
Introduction Identification and Management of Loss of Function Alleles Impacting Fertility L1 Dominette 01449 Jerry and I am a NGS addict Jerry Taylor taylorjerr@missouri.edu University of Missouri 2014
More informationUNIT III A. Descent with Modification(Ch19) B. Phylogeny (Ch20) C. Evolution of Populations (Ch21) D. Origin of Species or Speciation (Ch22)
UNIT III A. Descent with Modification(Ch9) B. Phylogeny (Ch2) C. Evolution of Populations (Ch2) D. Origin of Species or Speciation (Ch22) Classification in broad term simply means putting things in classes
More informationPavel Vejl Daniela Čílová Jakub Vašek Naděžda Šebková Petr Sedlák Martina Melounová
Czech University of Life Sciences Prague Faculty of Agrobiology, Food and Natural Resources Department of Genetics and Breeding Department of Husbandry and Ethology of Animals Pavel Vejl Daniela Čílová
More informationPathomorphological and Molecular Studies on an Outbreak of Feline Parvo Viral Infection in a Colony of Cats
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 06 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.706.214
More informationThe melanocortin 1 receptor (mc1r) is a gene that has been implicated in the wide
Introduction The melanocortin 1 receptor (mc1r) is a gene that has been implicated in the wide variety of colors that exist in nature. It is responsible for hair and skin color in humans and the various
More informationMRSA ST398 from swine and cattle
Novel antimicrobial resistance genes among livestock-associated MRSA ST398 from swine and cattle Kristina Kadlec, Andrea Feßler and Stefan Schwarz Institute of Farm Animal Genetics,, Friedrich-Loeffler
More informationSpike Protein Fusion Peptide and Feline Coronavirus Virulence
Spike Protein Fusion Peptide and Feline Coronavirus Virulence Hui-Wen Chang, Herman F. Egberink, Rebecca Halpin, David J. Spiro, and Peter J.M. Rottier Coronaviruses are well known for their potential
More informationLineage Classification of Canine Title Disorders Using Mitochondrial DNA 宮原, 和郎, 鈴木, 三義. Journal of Veterinary Medical Sci Citation
' ' Lineage Classification of Canine Title Disorders Using Mitochondrial DNA TAKAHASI, Shoko, MIYAHARA, Kazuro Author(s) Hirosi, ISHIGURO, Naotaka, SUZUKI 宮原, 和郎, 鈴木, 三義 Journal of Veterinary Medical Sci
More informationMyxosporeans and myxosporidiosis of common carp and gibel carp in China
Myxosporeans and myxosporidiosis of common carp and gibel carp in China Zhang Jinyong, Liu Xinhua, Xi Bingwen, Kálmán Molnár zhangjy@ihb.ac.cn Hungary 2015 June.3 Laboratory of Fish Diseases; Institute
More informationAalborg Universitet. Published in: Journal of Wildlife Diseases. Publication date: Document Version Early version, also known as pre-print
Aalborg Universitet High prevalence of Aleutian mink disease virus in free-ranging mink on a remote Danish island. Jensen, Trine Hammer; Christensen, L. S. ; Chriél, M. ; Harslund, J. ; Salomonsen, C.
More informationCladistics (reading and making of cladograms)
Cladistics (reading and making of cladograms) Definitions Systematics The branch of biological sciences concerned with classifying organisms Taxon (pl: taxa) Any unit of biological diversity (eg. Animalia,
More informationEvolution in dogs. Megan Elmore CS374 11/16/2010. (thanks to Dan Newburger for many slides' content)
Evolution in dogs Megan Elmore CS374 11/16/2010 (thanks to Dan Newburger for many slides' content) Papers for today Vonholdt BM et al (2010). Genome-wide SNP and haplotype analyses reveal a rich history
More informationBioinformatics: Investigating Molecular/Biochemical Evidence for Evolution
Bioinformatics: Investigating Molecular/Biochemical Evidence for Evolution Background How does an evolutionary biologist decide how closely related two different species are? The simplest way is to compare
More informationMyxosporeans and myxosporidiosis of allogynogenetic gibel carp (Carassius auratus gibelio Bloch) in China
Myxosporeans and myxosporidiosis of allogynogenetic gibel carp (Carassius auratus gibelio Bloch) in China Zhang Jinyong zhangjy@ihb.ac.cn Laboratory of Fish Diseases; Institute of Hydrobiology (IHB), Chinese
More informationSpecies: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum: Chordata
CHAPTER 6: PHYLOGENY AND THE TREE OF LIFE AP Biology 3 PHYLOGENY AND SYSTEMATICS Phylogeny - evolutionary history of a species or group of related species Systematics - analytical approach to understanding
More informationSingle nucleotide polymorphism mining and nucleotide sequence analysis of Mx1 gene in exonic regions of Japanese quail
Veterinary World, EISSN: 2231-0916 Available at www.veterinaryworld.org/vol.8/december-2015/12.pdf RESEARCH ARTICLE Open Access Single nucleotide polymorphism mining and nucleotide sequence analysis of
More informationAP Lab Three: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST
AP Biology Name AP Lab Three: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST In the 1990 s when scientists began to compile a list of genes and DNA sequences in the human genome
More informationIndex. Note: Page numbers of article titles are in boldface type.
Index Note: Page numbers of article titles are in boldface type. A Abdominal viscera, examination of, in investigation of emerging infectious diseases of food animals, 6 American Veterinary Medical Association,
More informationGenetics of Arrhythmogenic Right Ventricular Cardiomyopathy in Boxer dogs: a cautionary tale for molecular geneticists.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Genetics of Arrhythmogenic Right Ventricular Cardiomyopathy in Boxer dogs: a cautionary tale for molecular geneticists.
More informationMethicillin-Resistant Staphylococcus aureus
Methicillin-Resistant Staphylococcus aureus By Karla Givens Means of Transmission and Usual Reservoirs Staphylococcus aureus is part of normal flora and can be found on the skin and in the noses of one
More informationA. Pulse-field gel of hummingbird genomic DNA. B. Bioanalyzer plot of hummingbird SMRTbell library
A. Pulse-field gel of hummingbird genomic DNA 1: Sheared gdna: 35 kb & 40 kb 2: BluePippin sizeselected library (17 kb cut-off) 3: Original gdna B. Bioanalyzer plot of hummingbird SMRTbell library 5kb
More informationMitochondrial Phylogenomics yields Strongly Supported Hypotheses for Ascaridomorph Nematodes
Supplementary Info Mitochondrial Phylogenomics yields Strongly Supported Hypotheses for Ascaridomorph Nematodes Guo-Hua Liu 1,2, Steven A. Nadler 3, Shan-Shan Liu 1, Magdalena Podolska Stefano D Amelio
More informationBioSci 110, Fall 08 Exam 2
1. is the cell division process that results in the production of a. mitosis; 2 gametes b. meiosis; 2 gametes c. meiosis; 2 somatic (body) cells d. mitosis; 4 somatic (body) cells e. *meiosis; 4 gametes
More informationESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED
ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED Caroline Pissetti 1, Jalusa Deon Kich 2, Heather K. Allen 3, Claudia Navarrete
More informationMartin Chénier, Ph.D. Microbiology. Antibiotics in Animal Production: Resistance and Alternative Solutions
Faculty of Agricultural and Environmental Sciences Department of Food Science, Department of Animal Science Martin Chénier, Ph.D. Microbiology Antibiotics in Animal Production: Resistance and Alternative
More informationTesting Phylogenetic Hypotheses with Molecular Data 1
Testing Phylogenetic Hypotheses with Molecular Data 1 How does an evolutionary biologist quantify the timing and pathways for diversification (speciation)? If we observe diversification today, the processes
More informationYes, heterozygous organisms can pass a dominant allele onto the offspring. Only one dominant allele is needed to have the dominant genotype.
Name: Period: Unit 4: Inheritance of Traits Scopes 9-10: Inheritance and Mutations 1. What is an organism that has two dominant alleles for a trait? Homozygous dominant Give an example of an organism with
More informationDrd. OBADĂ MIHAI DORU. PhD THESIS ABSTRACT
UNIVERSITY OF AGRICULTURAL SCIENCES AND VETERINARY MEDICINE ION IONESCU DE LA BRAD IAŞI FACULTY OF VETERINARY MEDICINE SPECIALIZATION MICROBIOLOGY- IMUNOLOGY Drd. OBADĂ MIHAI DORU PhD THESIS ABSTRACT RESEARCHES
More information7.013 Spring 2005 Problem Set 2
MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel NAME TA 7.013 Spring 2005 Problem Set 2 FRIDAY February
More informationWarm-Up: Fill in the Blank
Warm-Up: Fill in the Blank 1. For natural selection to happen, there must be variation in the population. 2. The preserved remains of organisms, called provides evidence for evolution. 3. By using and
More informationDynamic evolution of venom proteins in squamate reptiles. Nicholas R. Casewell, Gavin A. Huttley and Wolfgang Wüster
Dynamic evolution of venom proteins in squamate reptiles Nicholas R. Casewell, Gavin A. Huttley and Wolfgang Wüster Supplementary Information Supplementary Figure S1. Phylogeny of the Toxicofera and evolution
More informationGerman Experiences in Teaching Animal Welfare at TiHo Hannover Germany and Nanjing Agricultural University P.R. China - Capacity building -
German Experiences in Teaching Animal Welfare at TiHo Hannover Germany and Nanjing Agricultural University P.R. China - Capacity building - Jörg Hartung 1 and Endong Bao 2 1 Hannover, Germany 2 (NAU),
More informationManhattan and quantile-quantile plots (with inflation factors, λ) for across-breed disease phenotypes A) CCLD B)
Supplementary Figure 1: Non-significant disease GWAS results. Manhattan and quantile-quantile plots (with inflation factors, λ) for across-breed disease phenotypes A) CCLD B) lymphoma C) PSVA D) MCT E)
More informationSeroprevalence and genotype of Toxoplasma gondii in pigs, dogs and cats from Guizhou province, Southwest China
Li et al. Parasites & Vectors (2015) 8:214 DOI 10.1186/s13071-015-0809-2 SHORT REPORT Seroprevalence and genotype of Toxoplasma gondii in pigs, dogs and cats from Guizhou province, Southwest China Open
More informationSupplementary Figure S WebLogo WebLogo WebLogo 3.0
A B Normalized Count Density Density -10 CC A T A T C A T C A T C T AA 5' Fragment End A T C CT AA TC AC CTA T -5 0 CC AT TAC AC T T Supplementary Figure S1 A TA C C TCT TC TC CA C A AAAT TC CT TAA 5 10
More informationVeterinary Diagnostics Portfolio Overview. Complete solutions for veterinary testing and pathogen research
Veterinary Diagnostics Portfolio Overview Complete solutions for veterinary testing and pathogen research Sample preparation products Cat. no. (number of preps) Target analyte Product Short description
More informationGENETICS. Two maternal origins of Chinese domestic goose
GENETICS Two maternal origins of Chinese domestic goose H. F. Li,* 1 W. Q. Zhu, K. W. Chen, Y. H,* W. J. Xu,* and W. Song * Institute of Poultry Science, Chinese Academy of Agricultural Science, Sangyuan
More informationTHE GENETIC CUL-DE-SAC
THE GENETIC CUL-DE-SAC by Susan Thorpe-Vargas Ph.D., John Cargill MA, MBA, MS, D. Caroline Coile, Ph.D. DOGS AS AN ENDANGERED SPECIES Why the dog opted to share his fate with men, may never be known, we
More informationAKC Canine Health Foundation Grant Updates: Research Currently Being Sponsored By The Vizsla Club of America Welfare Foundation
AKC Canine Health Foundation Grant Updates: Research Currently Being Sponsored By The Vizsla Club of America Welfare Foundation GRANT PROGRESS REPORT REVIEW Grant: 00748: SNP Association Mapping for Canine
More informationProf. Neil. J.L. Heideman
Prof. Neil. J.L. Heideman Position Office Mailing address E-mail : Vice-dean (Professor of Zoology) : No. 10, Biology Building : P.O. Box 339 (Internal Box 44), Bloemfontein 9300, South Africa : heidemannj.sci@mail.uovs.ac.za
More informationQUANTITATIVE AND QUALITATIVE IMPROVEMENT OF THE SHEEP MUTTON PRODUCTION WITH THE HELP OF MOLECULAR MARKER AND GENOME EDITING TECHNOLOGY : A REVIEW
Bhartiya Krishi Anushandhan Patrika, 31(4), 285-291, 2016 QUANTITATIVE AND QUALITATIVE IMPROVEMENT OF THE SHEEP MUTTON PRODUCTION WITH THE HELP OF MOLECULAR MARKER AND GENOME EDITING TECHNOLOGY : A REVIEW
More informationSelection, Recombination and History in a Parasitic Flatworm (Echinococcus) Inferred from Nucleotide Sequences
Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 93(5): 695-702, Sep./Oct. 1998 Selection, Recombination and History in a Parasitic Flatworm (Echinococcus) Inferred from Nucleotide Sequences KL Haag, AM Araújo,
More informationPanleuk Basics Understanding, preventing, and managing feline parvovirus infections in animal shelters
Panleuk Basics Understanding, preventing, and managing feline parvovirus infections in animal shelters Your Presenter Stephanie Janeczko, DVM, MS, DABVP, CAWA Senior Director of Shelter Medical Programs
More informationModern Evolutionary Classification. Lesson Overview. Lesson Overview Modern Evolutionary Classification
Lesson Overview 18.2 Modern Evolutionary Classification THINK ABOUT IT Darwin s ideas about a tree of life suggested a new way to classify organisms not just based on similarities and differences, but
More informationStudent Exploration: Mouse Genetics (One Trait)
Name: Date: Student Exploration: Mouse Genetics (One Trait) Vocabulary: allele, DNA, dominant allele, gene, genotype, heredity, heterozygous, homozygous, hybrid, inheritance, phenotype, Punnett square,
More informationVaccines for Cats. 2. Feline viral rhinotracheitis, FVR caused by FVR virus, also known as herpes virus type 1, FHV-1
Vaccines for Cats Recent advances in veterinary medical science have resulted in an increase in the number and type of vaccines that are available for use in cats, and improvements are continuously being
More informationStoat zona pellucida genes with potential for immunocontraceptive biocontrol in New Zealand
zona pellucida genes with potential for immunocontraceptive biocontrol in New Zealand Ronald J. Jackson, Sandra Beaton and David J. Dall DOC Research & Development Series 275 Published by Science & Technical
More informationReceived 18 June 2007/Returned for modification 24 July 2007/Accepted 31 July 2007
JOURNAL OF CLINICAL MICROBIOLOGY, Oct. 2007, p. 3239 3244 Vol. 45, No. 10 0095-1137/07/$08.00 0 doi:10.1128/jcm.01226-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Longitudinal
More informationHow the eye sees. Properties of light. The light-gathering parts of the eye. 1. Properties of light. 2. The anatomy of the eye. 3.
How the eye sees 1. Properties of light 2. The anatomy of the eye 3. Visual pigments 4. Color vision 1 Properties of light Light is made up of particles called photons Light travels as waves speed of light
More information2008 FELINE HEALTH GRANT AWARDS 10 projects funded for a total of $135,860
2008 FELINE HEALTH GRANT AWARDS 10 projects funded for a total of $135,860 The Winn Feline Foundation receives proposals from veterinary researchers around the world who are interested in improving feline
More informationSession Fur & Wool. Qian Q.X., Ma J.X., Zhang G.Z., Xie C.S., Ren L., Qian B.Q. BREEDING AND APPLICATION OF ZHEXI ANGORA RABBITS.
PROCEEDINGS OF THE 11 th WORLD RABBIT CONGRESS Qingdao (China) - June 15-18, 2016 ISSN 2308-1910 Session Fur & Wool Qian Q.X., Ma J.X., Zhang G.Z., Xie C.S., Ren L., Qian B.Q. BREEDING AND APPLICATION
More informationHistory of Lineages. Chapter 11. Jamie Oaks 1. April 11, Kincaid Hall 524. c 2007 Boris Kulikov boris-kulikov.blogspot.
History of Lineages Chapter 11 Jamie Oaks 1 1 Kincaid Hall 524 joaks1@gmail.com April 11, 2014 c 2007 Boris Kulikov boris-kulikov.blogspot.com History of Lineages J. Oaks, University of Washington 1/46
More informationThe genetic basis of breed diversification: signatures of selection in pig breeds
The genetic basis of breed diversification: signatures of selection in pig breeds Samantha Wilkinson Lu ZH, Megens H-J, Archibald AL, Haley CS, Jackson IJ, Groenen MAM, Crooijmans RP, Ogden R, Wiener P
More informationOIE RL for Rabies in China: Activities and Challenges
OIE RL for Rabies in China: Activities and Challenges Email: changchun_tu@hotmail.com http://cvrirabies.bmi.ac.cn Diagnostic Laboratory on Rabies and Wildlife Associated Zoonoses (DLR), Chinese Ministry
More informationPCR detection of Leptospira in. stray cat and
PCR detection of Leptospira in 1 Department of Pathology, School of Veterinary Medicine, Islamic Azad University, Shahrekord Branch, Shahrekord, Iran 2 Department of Microbiology, School of Veterinary
More informationThe Search For Antibiotics BY: ASLEY, ELIANA, ISABELLA AND LUNISCHA BSC1005 LAB 4/18/2018
The Search For Antibiotics BY: ASLEY, ELIANA, ISABELLA AND LUNISCHA BSC1005 LAB 4/18/2018 The Need for New Antibiotics Antibiotic crisis An antibiotic is a chemical that kills bacteria. Since the 1980s,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12234 Supplementary Figure 1. Embryonic naked mole-rat fibroblasts do not undergo ECI. Embryonic naked mole-rat fibroblasts ( EF) were isolated from eight mid-gestation embryos. All the
More informationPolyA_DB: a database for mammalian mrna polyadenylation
D116 D120 Nucleic Acids Research, 2005, Vol. 33, Database issue doi:10.1093/nar/gki055 PolyA_DB: a database for mammalian mrna polyadenylation Haibo Zhang 1,2, Jun Hu 2, Michael Recce 1 and Bin Tian 2,
More informationTick-borne viral infectious diseases
Med. Entomol. Zool. Vol. 64 No. 2 p. 61 66 2013 61 DOI: 10.7601/mez.64.61 065 0013 13 3 1 30 2013 5 10 2013 5 21 Tick-borne viral infectious diseases Ikuo Takashima Department of Nutrition, School of Nursing
More informationUnderstanding and prevention of transmission of antibiotic resistance between bacterial populations and One Health reservoirs
Priority Topic D - Transmission Understanding and prevention of transmission of antibiotic resistance between bacterial populations and One Health reservoirs The overarching goal of this priority topic
More informationInfectiousness of brain and salivary gland suspension from rabies suspected dogs
International Journal of Public Health and Epidemiology Vol. 1 (3), pp. 031-034, December, 2012. Available online at www.internationalscholarsjournals.org International Scholars Journals Full Length Research
More informationCollege of Animal Science and Technology, Sichuan Agricultural University, Ya an, Sichuan, 0,/*+., China
http://www.jstage.jst.go.jp/browse/jpsa doi: +*.,+.+/jpsa.**3*.1 Copyright,*+*, Japan Poultry Science Association. + Bing Zhou, Shi-Yi Chen, Qing Zhu, Yong-Gang Yao and Yi-Ping Liu + +,, +, + College of
More informationInheritance of Livershunt in Irish Wolfhounds By Maura Lyons PhD
Inheritance of Livershunt in Irish Wolfhounds By Maura Lyons PhD Glossary Gene = A piece of DNA that provides the 'recipe' for an enzyme or a protein. Gene locus = The position of a gene on a chromosome.
More informationINFECTIOUS DISEASES IN COMPANION ANIMALS ONLINE TRAINING PLATFORM
INFECTIOUS DISEASES IN COMPANION ANIMALS User name Password Log in User name Log out MY PAGE USER GUIDE WELCOME TO THE INFECTIOUS DISEASES IN COMPANION ANIMALS Main infectious diseases in dogs and cats
More informationDevelopmental expression of synthetic cis-regulatory systems composed of spatial control elements from two different genes
Proc. Natl. Acad. Sci. USA Vol. 93, pp. 13849 13854, November 1996 Developmental Biology Developmental expression of synthetic cis-regulatory systems composed of spatial control elements from two different
More information17.2 Classification Based on Evolutionary Relationships Organization of all that speciation!
Organization of all that speciation! Patterns of evolution.. Taxonomy gets an over haul! Using more than morphology! 3 domains, 6 kingdoms KEY CONCEPT Modern classification is based on evolutionary relationships.
More informationPhenotype Observed Expected (O-E) 2 (O-E) 2 /E dotted yellow solid yellow dotted blue solid blue
1. (30 pts) A tropical fish breeder for the local pet store is interested in creating a new type of fancy tropical fish. She observes consistent patterns of inheritance for the following traits: P 1 :
More informationSupplementary Information. Chlamydia gallinacea is the endemic chlamydial species in chicken (Gallus gallus) Chengming Wang 1 **
1 Supplementary Information 2 3 gallinacea is the endemic chlamydial species in chicken (Gallus gallus) 4 5 6 Weina Guo 1,2*, Jing Li 1*, Bernhard Kaltenboeck 3, Jiansen Gong 4, Weixing Fan 5 & Chengming
More informationWINN FELINE FOUNDATION For the Health and Well-being of All Cats
Ending FIP, Is There Hope? A Summary of Dr. Niels Pedersen s Presentation at the Winn Feline Foundation Symposium Chicago July 29 th, 2017 Carol Johnson DVM, Ph.D and Heather Lorimer Ph.D. Additional information
More informationSUPPLEMENTARY MATERIAL
10.1071/ZO13105_AC CSIRO 2014 Australian Journal of Zoology 2014, 62(3), 195-199 SUPPLEMENTARY MATERIAL The koala immunological toolkit: sequence identification and comparison of key markers of the koala
More informationYour web browser (Safari 7) is out of date. For more security, comfort and the best experience on this site: Update your browser Ignore
Your web browser (Safari 7) is out of date. For more security, comfort and the best experience on this site: Update your browser Ignore Activitydevelop EXPLO RING VERTEBRATE CL ASSIFICATIO N What criteria
More information