Co-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli 4
|
|
- Patience Clarke
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTARY INFORMATION ARTICLE NUMBER: DOI: /NMICROBIOL Co-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli Jian Sun a,b#, Run-Shi Yang a,b#, Qijing Zhang c, Youjun Feng d, Liang-Xing Fang a,b, Jing Xia a,b, Liang Li a,b, Xiao-Yue Lv a,b, Jia-Hong Duan a,b, Xiao-Ping Liao a,b* and Ya-Hong Liu a,b,e* a National Risk Assessment Laboratory for Antimicrobial Resistance of Animal Original Bacteria, South China Agricultural University, Guangzhou, P. R. China. b College of Veterinary Medicine, South China Agricultural University, Guangzhou, P. R. China. c Department of Veterinary Microbiology and Preventive Medicine, College of Veterinary Medicine, Iowa State University, USA. d Department of Medical Microbiology and Parasitology, Zhejiang University School of Medicine, Zhejiang , P. R. China. e Jiangsu Co-Innovation Centre for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou, Jiangsu, P. R. China. # These two authors contributed equally to this work. * Corresponding author: Xiao-Ping Liao, PH.D, National Risk Assessment Laboratory for Antimicrobial Resistance of Animal Original Bacteria, College of Veterinary Medicine, South China Agricultural University, Guangzhou, P. R. China. xpliao@scau.edu.cn. Tel: ; Fax: Ya-Hong Liu, PH.D, National Risk Assessment Laboratory for Antimicrobial Resistance of Animal Original Bacteria, College of Veterinary Medicine, South China Agricultural University, Guangzhou, P. R. China. lyh@scau.edu.cn. Tel: ; Fax: NATURE MICROBIOLOGY Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
2 Supplementary Figure 1. Localization of bla NDM-5 and mcr-1 in E. coli CQ and CQ02-121T by S1-PFGE and Southern hybridization. (a) S1-PFGE gel of the original isolate E. coli CQ (Lanes 2 and 4) and its transconjugant CQ02-121T (Lanes 1 and 3). Lane M: XbaI-digested genomic DNA of reference Salmonella enterica serotype Braenderup, strain H9812 (sizes are given in Kb). The arrow indicates the location of plasmid pcq (b) and (c) Southern hybridization conducted with a probe specific for bla NDM and mcr-1, respectively. Lane 2 and 4: E. coli CQ02-121; Lane 1 and 3: transconjugant CQ02-121T. A representative result of three independent experiments is shown.
3 Supplementary Figure 2. Measurement of pcq stability in E. coli CQ and transconjugant CQ02-121T in liquid media (a) and on agar plates (b). In panel (a), data points and error bars represent means ± SD of three independent lineages.
4 Supplementary Figure 3. PCR verification of the recombination junctions of pcq in E. coli CQ and its transconjugant CQ02-121T. Five colonies from the original isolate or its transconjugant were randomly selected and tested by PCR. (a) The PCR results obtained by using primers hica-f and taxb-r that amplify the region from nucleotide 43,281 to 44,648. (b) The PCR results obtained by using primer tat-f and IS26ext-R that amplify a region from nucleotide 8,991 to 10,254. In both panels, Lanes 1-5: CQ02-121; Lanes 6-10: CQ02-121T; Lane P: positive control (template was plasmid DNA extracted from CQ02-121T); Lane N: negative control (template DNA from E. coli C600); Lane M: DL2000 marker. The corresponding locations of the PCR primers in pcq are shown in Figure 1b. A representative result of three independent experiments is shown.
5 Supplementary Table 1: Antibiotic resistance phenotypes of E. coli CQ02-121, E. coli C600, and transconjugant CQ02-121T. The MICs of various antimicrobial agents were determined by both agar dilution and broth dilution. The breakpoints for each antimicrobial were set as recommended by the Clinical and Laboratory Standards Institute, Veterinary CLSI and the European Committee on Antimicrobial Susceptibility Testing. Antibiotic MIC in µg/ml(interpretation) a E. coli CQ Transconjugant CQ02-121T E. coli C600 Cefoxitin >256(R) 128(R) 4(S) Ceftazidime >256(R) 128(R) 0.125(S) Cefotaxime 256(R) 128(R) 0.06(S) Ceftiofur b 256(R) 128(R) 0.5(S) Aztreonam 64(R) 1(S) 0.25(S) Meropenem 16(R) 4(R) 0.008(S) Imipenem 16(R) 8(R) 0.125(S) Ertapenem >64(R) 64(R) 0.008(S) Amikacin 4(S) 4(S) 4(S) Gentamicin 128(R) 2(S) 0.5(S) Tobramycin 32(R) 1(S) 0.5(S) Florfenicol b 256(R) 1(S) 1(S) Ciprofloxacin 256(R) 0.015(S) 0.03(S) Enrofloxacin b 256(R) 0.015(S) 0.03(S) Tetracycline >256(R) 1(S) 2(S) Tigecycline c 1(S) 0.25(S) 0.25(S) Colistin c 8(R) 4(R) 0.125(S) Fosfomycin d >256(R) 2(S) 2(S) Co-trimoxazole >320(R) 10(S) 10(S) MIC - minimal inhibitory concentration; R: resistant; S: susceptible; a According to Clinical and Laboratory Standards Institute (CLSI) criteria. b According to the veterinary CLSI criteria. c According to European Committee on Antimicrobial Susceptibility Testing (EUCAST) clinical breakpoints. d Agar dilution using agar media supplemented with 25 μg/ml of glucose-6-phosphate.
6 77 78 Supplementary Table 2: PCR primers used to amplify the genetic structure of plasmid pcq Primer Name Sequence (5'-3') Expected amplicon size (bp) Nucleotide positions Target Reference hica-f TGCTGAAATCAATCACACCA junction This study 1,368 43,281-44,648 between hica taxb-r TAAACGCCCATGATTACACC and taxb This study tat-f GGACAGGACGAAGACCTC junction This study 1,264 8,991-10,254 between tat IS26ext-R TAAAATGCAACAGCGACAGA and IS26 This study LNDM-F GCAGCACACTTCCTATCTCG upstream of This study ,224-12,816 IS26-R TTACATTTCAAAAACTCTGCTTACC bla NDM-5 This study ISAba125A TGTATATTTCTGTGACCCAC downstream Poirel et al ,597-14,538 bleo-r GGCGATGACAGCATCATCCG of bla NDM-5 Poirel et al pir-f ATGCGGCTTATCTTGCTT genetic This study ,181-7,257 environment para-r AAATGCCAGCCAAATACGTT around mcr-1 This study hica-ext-f TATTACGCAGATCAGATGCAA This study ,389-46,512 yaja-r AATGAAACCCGATAATACACC junction This study yaja-f TCCCTTTTGCAGAGCACGTA between hica This study ,294-47,712 dnaj-r GCACTGATGAACATGCACGA downstream This study dnaj-ext-f GCCAGGAACGACTATCCACA and dnaj This study , dnaj-ext-r ATGATTATTACCCGCAAGCTA This study
Recommendations to take it forward!
Capacity Building and Strengthening of Hospital Infection Control to detect and prevent antimicrobial resistance in India AIIMS-ICMR-CDC EQAS Recommendations to take it forward! Top regional diagnostic
More informationa. 379 laboratories provided quantitative results, e.g (DD method) to 35.4% (MIC method) of all participants; see Table 2.
AND QUANTITATIVE PRECISION (SAMPLE UR-01, 2017) Background and Plan of Analysis Sample UR-01 (2017) was sent to API participants as a simulated urine culture for recognition of a significant pathogen colony
More informationEuropean Committee on Antimicrobial Susceptibility Testing
European Committee on Antimicrobial Susceptibility Testing Routine and extended internal quality control as recommended by EUCAST Version 5.0, valid from 015-01-09 This document should be cited as "The
More informationEuropean Committee on Antimicrobial Susceptibility Testing
European Committee on Antimicrobial Susceptibility Testing Routine and extended internal quality control for MIC determination and disk diffusion as recommended by EUCAST Version 8.0, valid from 018-01-01
More informationEUCAST recommended strains for internal quality control
EUCAST recommended strains for internal quality control Escherichia coli Pseudomonas aeruginosa Staphylococcus aureus Enterococcus faecalis Streptococcus pneumoniae Haemophilus influenzae ATCC 59 ATCC
More informationANTIMICROBIAL RESISTANCE IN COMMENSAL E. COLI FROM LIVESTOCK IN BELGIUM: Veterinary Epidemiology
ANTIMICROBIAL RESISTANCE IN COMMENSAL E. COLI FROM LIVESTOCK IN BELGIUM: TREND ANALYSIS 2011-2017 Veterinary Epidemiology 03.05.2018 General objectives Monitoring and reporting of antimicrobial resistance
More information1 INTRODUCTION OBJECTIVES OUTLINE OF THE SALM/CAMP EQAS
PROTOCOL For antimicrobial susceptibility testing of Salmonella, Campylobacter and optional genotypic characterisation of AmpC-, ESBL- and carbapenemase-producing test strains 1 INTRODUCTION... 1 2 OBJECTIVES...
More informationRoutine internal quality control as recommended by EUCAST Version 3.1, valid from
Routine internal quality control as recommended by EUCAST Version.1, valid from 01-01-01 Escherichia coli Pseudomonas aeruginosa Staphylococcus aureus Enterococcus faecalis Streptococcus pneumoniae Haemophilus
More informationAntibiotic Reference Laboratory, Institute of Environmental Science and Research Limited (ESR); August 2017
Antimicrobial susceptibility of Shigella, 2015 and 2016 Helen Heffernan and Rosemary Woodhouse Antibiotic Reference Laboratory, Institute of Environmental Science and Research Limited (ESR); August 2017
More informationESBL Producers An Increasing Problem: An Overview Of An Underrated Threat
ESBL Producers An Increasing Problem: An Overview Of An Underrated Threat Hicham Ezzat Professor of Microbiology and Immunology Cairo University Introduction 1 Since the 1980s there have been dramatic
More informationESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED
ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED Caroline Pissetti 1, Jalusa Deon Kich 2, Heather K. Allen 3, Claudia Navarrete
More informationObjectives. Antibiotics uses in food animals 3/25/2018. California Dairy Productions. Antimicrobial Resistance in the Animal Production Environment
Antimicrobial Resistance in the Animal Production Environment Xunde Li Western Institute for Food Safety and Security Department of Population Health and Reproduction University of California Davis Objectives
More informationSuggestions for appropriate agents to include in routine antimicrobial susceptibility testing
Suggestions for appropriate agents to include in routine antimicrobial susceptibility testing These suggestions are intended to indicate minimum sets of agents to test routinely in a diagnostic laboratory
More informationUnderstanding the Hospital Antibiogram
Understanding the Hospital Antibiogram Sharon Erdman, PharmD Clinical Professor Purdue University College of Pharmacy Infectious Diseases Clinical Pharmacist Eskenazi Health 5 Understanding the Hospital
More informationSMART WORKFLOW SOLUTIONS Introducing DxM MicroScan WalkAway System* ...
SMART WORKFLOW SOLUTIONS Introducing DxM MicroScan WalkAway System* The next-generation MicroScan WalkAway System combines proven technology and reliability with enhanced ease-of-use features to streamline
More informationPROTOCOL for serotyping and antimicrobial susceptibility testing of Salmonella test strains
PROTOCOL for serotyping and antimicrobial susceptibility testing of Salmonella test strains 1 INTRODUCTION... 1 2 OBJECTIVES... 2 3 OUTLINE OF THE EQAS 2017... 2 3.1 Shipping, receipt and storage of strains...
More informationBackground and Plan of Analysis
ENTEROCOCCI Background and Plan of Analysis UR-11 (2017) was sent to API participants as a simulated urine culture for recognition of a significant pathogen colony count, to perform the identification
More informationAntimicrobial Susceptibility Testing: The Basics
Antimicrobial Susceptibility Testing: The Basics Susan E. Sharp, Ph.D., DABMM, FAAM Director, Airport Way Regional Laboratory Director, Regional Microbiology and Molecular Infectious Diseases Laboratories
More informationPerformance Information. Vet use only
Performance Information Vet use only Performance of plates read manually was measured in three sites. Each centre tested Enterobacteriaceae, streptococci, staphylococci and pseudomonas-like organisms.
More informationHelp with moving disc diffusion methods from BSAC to EUCAST. Media BSAC EUCAST
Help with moving disc diffusion methods from BSAC to EUCAST This document sets out the main differences between the BSAC and EUCAST disc diffusion methods with specific emphasis on preparation prior to
More informationTwenty Years of the National Antimicrobial Resistance Monitoring System (NARMS) Where Are We And What Is Next?
Twenty Years of the National Antimicrobial Resistance Monitoring System (NARMS) Where Are We And What Is Next? Patrick McDermott, Ph.D. Director, NARMS Food & Drug Administration Center for Veterinary
More informationConcise Antibiogram Toolkit Background
Background This toolkit is designed to guide nursing homes in creating their own antibiograms, an important tool for guiding empiric antimicrobial therapy. Information about antibiograms and instructions
More informationHelen Heffernan and Rosemary Woodhouse Antibiotic Reference Laboratory
METHODS USED IN NEW ZEALAND DIAGNOSTIC LABORATORIES TO IDENTIFY AND REPORT EXTENDED-SPECTRUM β-lactamase- PRODUCING ENTEROBACTERIACEAE by Helen Heffernan and Rosemary Woodhouse Antibiotic Reference Laboratory
More informationDetection of Methicillin Resistant Strains of Staphylococcus aureus Using Phenotypic and Genotypic Methods in a Tertiary Care Hospital
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 7 (2017) pp. 4008-4014 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.607.415
More informationDefining Extended Spectrum b-lactamases: Implications of Minimum Inhibitory Concentration- Based Screening Versus Clavulanate Confirmation Testing
Infect Dis Ther (2015) 4:513 518 DOI 10.1007/s40121-015-0094-6 BRIEF REPORT Defining Extended Spectrum b-lactamases: Implications of Minimum Inhibitory Concentration- Based Screening Versus Clavulanate
More informationMICRONAUT MICRONAUT-S Detection of Resistance Mechanisms. Innovation with Integrity BMD MIC
MICRONAUT Detection of Resistance Mechanisms Innovation with Integrity BMD MIC Automated and Customized Susceptibility Testing For detection of resistance mechanisms and specific resistances of clinical
More informationAMR Industry Alliance Antibiotic Discharge Targets
AMR Industry Alliance Antibiotic Discharge Targets List of Predicted No-Effect Concentrations (PNECs) The members of the AMR Industry Alliance have developed a unified approach to establishing discharge
More informationTHE NAC CHALLENGE PANEL OF ISOLATES FOR VERIFICATION OF ANTIBIOTIC SUSCEPTIBILITY TESTING METHODS
THE NAC CHALLENGE PANEL OF ISOLATES FOR VERIFICATION OF ANTIBIOTIC SUSCEPTIBILITY TESTING METHODS Stefanie Desmet University Hospitals Leuven Laboratory medicine microbiology stefanie.desmet@uzleuven.be
More informationAntimicrobial susceptibility of Salmonella, 2016
susceptibility of Salmonella, 06 Hospital and community laboratories are requested to refer all Salmonella isolated from human salmonellosis cases to ESR for serotyping and the laboratory-based surveillance
More informationجداول میکروارگانیسم های بیماریزای اولویت دار و آنتی بیوتیک های تعیین شده برای آزمایش تعیین حساسیت ضد میکروبی در برنامه مهار مقاومت میکروبی
جداول میکروارگانیسم های بیماریزای اولویت دار و آنتی بیوتیک های تعیین شده برای آزمایش تعیین حساسیت ضد میکروبی در برنامه مهار مقاومت میکروبی ویرایش دوم بر اساس ed., 2017 CLSI M100 27 th تابستان ۶۹۳۱ تهیه
More informationUniversity Ss Cyril and Methodius in Skopje Faculty of veterinary medicine-skopje
University Ss Cyril and Methodius in Skopje Faculty of veterinary medicine-skopje ACTIVITIES of the NRL-AR in Macedonia Food institute NRL AR, MK assist. prof. d-r Sandra Mojsova, Head of food and feed
More informationMain objectives of the EURL EQAS s
EQAS Enterococci, Staphylococci and E. coli EURL workshop, April, 11 Lourdes García Migura Main objectives of the EURL EQAS s To improve the comparability of antimicrobial susceptibility testing (AST)
More informationThe Basics: Using CLSI Antimicrobial Susceptibility Testing Standards
The Basics: Using CLSI Antimicrobial Susceptibility Testing Standards Janet A. Hindler, MCLS, MT(ASCP) UCLA Health System Los Angeles, California, USA jhindler@ucla.edu 1 Learning Objectives Describe information
More informationSurveillance for antimicrobial resistance in enteric bacteria in Australian pigs and chickens
Surveillance for antimicrobial resistance in enteric bacteria in Australian pigs and chickens Dr Pat Mitchell R & I Manager Production Stewardship APL CDC Conference, Melbourne June 2017 Dr Kylie Hewson
More informationJanuary 2014 Vol. 34 No. 1
January 2014 Vol. 34 No. 1. and Minimal Inhibitory Concentration (MIC) Interpretive Standards for Testing Conditions Medium: diffusion: Mueller-Hinton agar (MHA) roth dilution: cation-adjusted Mueller-Hinton
More informationgroup and their transferability in resistant clinical isolates of Salmonella serogroups from several hospitals of Tehran
Volume 7 Number 4 (August 2015) 203-207 ORIGINAL ARTICLE Prevalence of the bla CTX-M-1 group and their transferability in resistant clinical isolates of Salmonella serogroups from several hospitals of
More informationAntimicrobial Susceptibility Testing: Advanced Course
Antimicrobial Susceptibility Testing: Advanced Course Cascade Reporting Cascade Reporting I. Selecting Antimicrobial Agents for Testing and Reporting Selection of the most appropriate antimicrobials to
More informationEducating Clinical and Public Health Laboratories About Antimicrobial Resistance Challenges
Educating Clinical and Public Health Laboratories About Antimicrobial Resistance Challenges Janet Hindler, MCLS MT(ASCP) UCLA Medical Center jhindler@ucla.edu also working as a consultant with the Association
More informationAvailable online at ISSN No:
Available online at www.ijmrhs.com ISSN No: 2319-5886 International Journal of Medical Research & Health Sciences, 2017, 6(4): 36-42 Comparative Evaluation of In-Vitro Doripenem Susceptibility with Other
More informationCompliance of manufacturers of AST materials and devices with EUCAST guidelines
Compliance of manufacturers of AST materials and devices with EUCAST guidelines Data are based on questionnaires to manufacturers of materials and devices for antimicrobial susceptibility testing. The
More informationPlease distribute a copy of this information to each provider in your organization.
HEALTH ADVISORY TO: Physicians and other Healthcare Providers Please distribute a copy of this information to each provider in your organization. Questions regarding this information may be directed to
More informationProject Summary. Principal Investigators: Ross Beier 1, T. Poole 1, Dayna Harhay 2, and Robin Anderson 1 1
Project Summary Antibiotic and Disinfectant Susceptibility Profiles of Escherichia coli O157:H7 Cattle Feces, Hide, Carcass, and Ground Meat Isolates from the United States Principal Investigators: Ross
More informationMRSA surveillance 2014: Poultry
Vicky Jasson MRSA surveillance 2014: Poultry 1. Introduction In the framework of the FASFC surveillance, a surveillance of MRSA in poultry has been executed in order to determine the prevalence and diversity
More informationAntimicrobial susceptibility testing of Campylobacter jejuni and C. coli. CRL Training course in AST Copenhagen, Denmark 23-27th Feb.
Antimicrobial susceptibility testing of Campylobacter jejuni and C. coli CRL Training course in AST Copenhagen, Denmark 23-27th Feb. 2009 Methodologies E-test by AB-biodisk A dilution test based on the
More informationComparative Assessment of b-lactamases Produced by Multidrug Resistant Bacteria
Comparative Assessment of b-lactamases Produced by Multidrug Resistant Bacteria Juhee Ahn Department of Medical Biomaterials Engineering Kangwon National University October 23, 27 Antibiotic Development
More informationCompliance of manufacturers of AST materials and devices with EUCAST guidelines
Compliance of manufacturers of AST materials and devices with EUCAST guidelines Data are based on questionnaires to manufacturers of materials and devices for antimicrobial susceptibility testing. The
More informationAntibiotics: mode of action and mechanisms of resistance. Slides made by Special consultant Henrik Hasman Statens Serum Institut
Antibiotics: mode of action and mechanisms of resistance. Slides made by Special consultant Henrik Hasman Statens Serum Institut This presentation Definitions needed to discuss antimicrobial resistance
More informationUNDERSTANDING YOUR DATA: THE ANTIBIOGRAM
UNDERSTANDING YOUR DATA: THE ANTIBIOGRAM April Abbott, PhD, D(ABMM) Deaconess Health System Evansville, IN April.Abbott@Deaconess.com Special thanks to Dr. Shelley Miller for UCLA data WHAT WE WILL COVER
More informationThe First Report of CMY, AAC(6')-Ib and 16S rrna Methylase Genes among Pseudomonas aeruginosa Isolates from Iran
1 2 The First Report of CMY, AAC(6')-Ib and 16S rrna Methylase Genes among Pseudomonas aeruginosa Isolates from Iran Sedigheh Rafiei Tabatabaei, MD, MPH Associate Professor of Pediatric Infectious Diseases
More informationAntimicrobial Resistance: Do we know everything? Dr. Sid Thakur Assistant Professor Swine Health & Production CVM, NCSU
Antimicrobial Resistance: Do we know everything? Dr. Sid Thakur Assistant Professor Swine Health & Production CVM, NCSU Research Focus Antimicrobial Resistance On farm, Slaughter, Retail, Human Sample
More informationReceived 14 August 2004/Returned for modification 8 November 2004/Accepted 1 May 2005
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 2005, p. 3533 3537 Vol. 49, No. 8 0066-4804/05/$08.00 0 doi:10.1128/aac.49.8.3533 3537.2005 Copyright 2005, American Society for Microbiology. All Rights Reserved.
More informationEUCAST Workshop: Antimicrobial susceptibility testing with EUCAST breakpoints and methods
EUCAST Workshop: Antimicrobial susceptibility testing with EUCAST breakpoints and methods Susceptibility testing of infrequently isolated fastidious organisms Luis Martinez-Martínez Service of Microbiology
More information21 st Expert Committee on Selection and Use of Essential Medicines Peer Review Report Antibiotics Review
(1) Have all important studies/evidence of which you are aware been included in the application? Yes No Please provide brief comments on any relevant studies that have not been included: (2) For each of
More informationThe effects of ceftiofur and chlortetracycline treatment on antibiotic resistant Salmonella populations in feedlot cattle
The effects of ceftiofur and chlortetracycline treatment on antibiotic resistant Salmonella populations in feedlot cattle Naomi Ohta Department of Veterinary Pathobiology, College of Veterinary Medicine
More information2 0 hr. 2 hr. 4 hr. 8 hr. 10 hr. 12 hr.14 hr. 16 hr. 18 hr. 20 hr. 22 hr. 24 hr. (time)
Key words I μ μ μ μ μ μ μ μ μ μ μ μ μ μ II Fig. 1. Microdilution plate. The dilution step of the antimicrobial agent is prepared in the -well microplate. Serial twofold dilution were prepared according
More informationMark Your Calendars Now! Next Event Ships: September 14, 2015
www.wslhpt.org 2601 Agriculture Drive Madison, WI 53718 (800) 462-5261 (608) 265-1111 Shipment Date: June 15, 2015 Questions or comments should be directed to Amanda Weiss at 800-462-5261 x51 or amanda.weiss@slh.wisc.edu.
More informationEARS Net Report, Quarter
EARS Net Report, Quarter 4 213 March 214 Key Points for 213* Escherichia coli: The proportion of patients with invasive infections caused by E. coli producing extended spectrum β lactamases (ESBLs) increased
More informationAntimicrobial Stewardship Strategy: Antibiograms
Antimicrobial Stewardship Strategy: Antibiograms A summary of the cumulative susceptibility of bacterial isolates to formulary antibiotics in a given institution or region. Its main functions are to guide
More informationTECHNICAL REPORT External quality assessment of laboratory performance European Antimicrobial Resistance Surveillance Network (EARS-Net), 2017
TECHNICAL REPORT External quality assessment of laboratory performance European Antimicrobial Resistance Surveillance Network (EARS-Net), 2017 www.ecdc.europa.eu ECDC TECHNICAL REPORT External quality
More informationActivity of a novel aminoglycoside, ACHN-490, against clinical isolates of Escherichia coli and Klebsiella pneumoniae from New York City
Journal of Antimicrobial Chemotherapy Advance Access published July 31, 2010 J Antimicrob Chemother doi:10.1093/jac/dkq278 Activity of a novel aminoglycoside, ACHN-490, against clinical isolates of Escherichia
More informationMonitoring of antimicrobial resistance in Campylobacter EURL AR activities in framework of the new EU regulation Lina Cavaco
Monitoring of antimicrobial resistance in Campylobacter EURL AR activities in framework of the new EU regulation Lina Cavaco licav@food.dtu.dk 1 DTU Food, Technical University of Denmark Outline EURL-AR
More informationREVOLUTIONARY. MMinimum. BBiofilm EEradication Concentration. inimizing WE HAVE FOUND THE ANSWER.
REVOLUTIONARY. Are recurrent bacterial infections a frustration in your practice? WE HAVE FOUND THE ANSWER. MMinimum inimizing BBiofilm EEradication C oncentration Concentration www.becscreen.com WHY BIOFILM
More informationWhat s new in EUCAST methods?
What s new in EUCAST methods? Derek Brown EUCAST Scientific Secretary Interactive question 1 MIC determination MH-F broth for broth microdilution testing of fastidious microorganisms Gradient MIC tests
More informationPrevalence of Extended Spectrum Beta- Lactamase Producers among Various Clinical Samples in a Tertiary Care Hospital: Kurnool District, India
International Journal of Current Microbiology and Applied Sciences ISSN: 319-77 Volume Number (17) pp. 57-3 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/1.5/ijcmas.17..31
More informationFlorida Health Care Association District 2 January 13, 2015 A.C. Burke, MA, CIC
Florida Health Care Association District 2 January 13, 2015 A.C. Burke, MA, CIC 11/20/2014 1 To describe carbapenem-resistant Enterobacteriaceae. To identify laboratory detection standards for carbapenem-resistant
More informationPresenter: Ombeva Malande. Red Cross Children's Hospital Paed ID /University of Cape Town Friday 6 November 2015: Session:- Paediatric ID Update
Emergence of invasive Carbapenem Resistant Enterobacteriaceae CRE infection at RCWMCH Ombeva Oliver Malande, Annerie du Plessis, Colleen Bamford, Brian Eley Presenter: Ombeva Malande Red Cross Children's
More informationResearch on pathogenic bacteria and antibiotic resistance of Enterobacteriaceae in hospitalized elderly patients.
Biomedical Research 2017; 28 (16): 7243-7247 ISSN 0970-938X www.biomedres.info Research on pathogenic bacteria and antibiotic resistance of Enterobacteriaceae in hospitalized elderly patients. Feng Zheng
More informationAntimicrobial resistance in Vietnam
Antimicrobial resistance in Vietnam Patrick De Mol Medical Microbiology p.demol@ulg.ac.be with the support of Wallonie-Bruxelles International Antibiotic Resistance A Catastrophic Threat Consequences of
More informationESBL- and carbapenemase-producing microorganisms; state of the art. Laurent POIREL
ESBL- and carbapenemase-producing microorganisms; state of the art Laurent POIREL Medical and Molecular Microbiology Unit Dept of Medicine University of Fribourg Switzerland INSERM U914 «Emerging Resistance
More informationBrief reports. Heat stability of the antimicrobial activity of sixty-two antibacterial agents
Journal of Antimicrobial Chemotherapy (5) 35, -5 Brief reports Heat stability of the antimicrobial activity of sixty-two antibacterial agents Walter H. Traub and Birgit Leonhard Institut fur Medizinische
More informationShould we test Clostridium difficile for antimicrobial resistance? by author
Should we test Clostridium difficile for antimicrobial resistance? Paola Mastrantonio Department of Infectious Diseases Istituto Superiore di Sanità, Rome,Italy Clostridium difficile infection (CDI) (first
More informationAcinetobacter Outbreaks: Experience from a Neurosurgery Critical Care Unit. Jumoke Sule Consultant Microbiologist 19 May 2010
Acinetobacter Outbreaks: Experience from a Neurosurgery Critical Care Unit Jumoke Sule Consultant Microbiologist 19 May 2010 Epidemiology of Acinetobacter spp At least 32 different species Recovered from
More informationEuropean Food Safety Authority (EFSA), Pierre-Alexandre Beloeil, Beatriz Guerra and Anca-Violeta Stoicescu
TECHNICAL REPORT APPROVED: 25 January 2018 doi: 10.2903/sp.efsa.2018.EN-1369 Manual for reporting on antimicrobial resistance within the framework of Directive 2003/99/EC and Decision 2013/652/EU for information
More informationWhat does multiresistance actually mean? Yohei Doi, MD, PhD University of Pittsburgh
What does multiresistance actually mean? Yohei Doi, MD, PhD University of Pittsburgh Disclosures Merck Research grant Clinical context of multiresistance Resistance to more classes of agents Less options
More informationPrinciples and Practice of Antimicrobial Susceptibility Testing. Microbiology Technical Workshop 25 th September 2013
Principles and Practice of Antimicrobial Susceptibility Testing Microbiology Technical Workshop 25 th September 2013 Scope History Why Perform Antimicrobial Susceptibility Testing? How to Perform an Antimicrobial
More informationVersion 1.01 (01/10/2016)
CHN58: ANTIMICROBIAL SUSCEPTIBILITY TESTING (CLSI) 1.0 PURPOSE / INTRODUCTION: 1.1 Introduction Antimicrobial susceptibility tests are performed in order to determine whether a pathogen is likely to be
More informationESCMID Online Lecture Library. by author
Expert rules in susceptibility testing EUCAST-ESGARS-EPASG Educational Workshop Linz, 16 19 September, 2014 Dr. Rafael Cantón Hospital Universitario Ramón y Cajal SERVICIO DE MICROBIOLOGÍA Y PARASITOLOGÍA
More informationDISCLAIMER: ECHO Nevada emphasizes patient privacy and asks participants to not share ANY Protected Health Information during ECHO clinics.
DISCLAIMER: Video will be taken at this clinic and potentially used in Project ECHO promotional materials. By attending this clinic, you consent to have your photo taken and allow Project ECHO to use this
More informationTrends en voorkomen van resistenties bij Salmonella, Campylobacter en E. coli geïsoleerd uit de voeding
Trends en voorkomen van resistenties bij Salmonella, Campylobacter en E. coli geïsoleerd uit de voeding Cristina Garcia-Graells, Nadine Botteldoorn, Katelijne Dierick NRL AMR Food Pathogens - AMCRA 30/06/2017
More informationAntimicrobial susceptibility of Salmonella, 2015
Antimicrobial susceptibility of Salmonella, 2015 Hospital and community laboratories are requested to refer all Salmonella isolated from human salmonellosis cases to ESR for serotyping and the laboratory-based
More informationINCIDENCE OF BACTERIAL COLONISATION IN HOSPITALISED PATIENTS WITH DRUG-RESISTANT TUBERCULOSIS
INCIDENCE OF BACTERIAL COLONISATION IN HOSPITALISED PATIENTS WITH DRUG-RESISTANT TUBERCULOSIS 1 Research Associate, Drug Utilisation Research Unit, Nelson Mandela University 2 Human Sciences Research Council,
More informationThe European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2015
SCIENTIFIC REPORT ADOPTED: 26 January 2017 doi: 10.2903/j.efsa.2017.4694 The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in
More informationHospital ID: 831. Bourguiba Hospital. Tertiary hospital
Global Point Prevalence Survey of Antimicrobial Consumption and Resistance in hospitals worldwide Hospital ID: 831 Habib Bourguiba Hospital Tertiary hospital Tunisia Point Prevalence Survey Habib 2017
More informationAntimicrobial Resistance Strains
Antimicrobial Resistance Strains Microbiologics offers a wide range of strains with characterized antimicrobial resistance mechanisms including: Extended-Spectrum β-lactamases (ESBLs) Carbapenamases Vancomycin-Resistant
More informationCharacterization of isolates from a multi-drug resistant outbreak of Shiga toxin-producing Escherichia. coli O145 infections in the United States
AAC Accepts, published online ahead of print on 19 September 2011 Antimicrob. Agents Chemother. doi:10.1128/aac.05545-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationPractical approach to Antimicrobial susceptibility testing (AST) and quality control
Practical approach to Antimicrobial susceptibility testing (AST) and quality control A/Professor John Ferguson, Microbiologist & Infectious Diseases Physician, Pathology North, University of Newcastle,
More informationMultidrug-Resistant Salmonella enterica in the Democratic Republic of the Congo (DRC)
Multidrug-Resistant Salmonella enterica in the Democratic Republic of the Congo (DRC) Octavie Lunguya 1, Veerle Lejon 2, Sophie Bertrand 3, Raymond Vanhoof 3, Jan Verhaegen 4, Anthony M. Smith 5, Benedikt
More informationPrevalence of Metallo-Beta-Lactamase Producing Pseudomonas aeruginosa and its antibiogram in a tertiary care centre
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 4 Number 9 (2015) pp. 952-956 http://www.ijcmas.com Original Research Article Prevalence of Metallo-Beta-Lactamase
More informationDetecting / Reporting Resistance in Nonfastidious GNR Part #2. Janet A. Hindler, MCLS MT(ASCP)
Detecting / Reporting Resistance in Nonfastidious GNR Part #2 Janet A. Hindler, MCLS MT(ASCP) Methods Described in CLSI M100-S21 for Testing non-enterobacteriaceae Organism Disk Diffusion MIC P. aeruginosa
More informationBulgarian Journal of Veterinary Medicine, 2014, 17, No 1, ISSN ; online at
Bulgarian Journal of Veterinary Medicine, 2014, 17, No 1, 25 31 ISSN 1311-1477; online at http://tru.uni-sz.bg/bjvm/bjvm.htm EVIDENCE OF gyra MUTATIONS IN NALIDIXIC ACID- RESISTANT SALMONELLA ENTERICA
More informationDR. BASHIRU BOI KIKIMOTO
OVERVIEW OF ANTIMICROBIAL RESISTANCE AND ANTIMICROBIAL USE IN GHANA PRESENTED BY : DR. BASHIRU BOI KIKIMOTO DVM. PhD VETERINARY PUBLIC HEALTH HEAD - PUBLIC HEALTH UNIT & FOOD SAFETY UNIT VENUE: SWATZILAND
More information2015 Antimicrobial Susceptibility Report
Gram negative Sepsis Outcome Programme (GNSOP) 2015 Antimicrobial Susceptibility Report Prepared by A/Professor Thomas Gottlieb Concord Hospital Sydney Jan Bell The University of Adelaide Adelaide On behalf
More informationlevofloxacin (LVFX) LVFX LVFX LVFX Key words: Levofloxacin Escherichia coli LVFX levofloxacin (LVFX) Vol. 18 No
2008 221 20 3 14 20 8 1 2001 1 2005 12 5 levofloxacin (LVFX) 5 811 125 27 LVFX (MIC: 4 mg/ml) LVFX LVFX Key words: Levofloxacin Escherichia coli 1) 2 5) 6) ( 203 0036) 2 1 2 TEL: 042 338 5111 2254 FAX:
More informationADC 2016 Report on Bacterial Resistance in Cultures from SEHOS and General Practitioners in Curaçao
ADC 216 Report on Bacterial Resistance in Cultures from SEHOS and General Practitioners in Curaçao Willemstad, November 217 Authors: Radjin Steingrover clinical microbiologist, head dpt. Microbiology ADC
More informationEpidemiological Characteristics and Drug Resistance Analysis of Multidrug-Resistant Acinetobacter baumannii in a China Hospital at a Certain Time
Polish Journal of Microbiology 2014, Vol. 63, No 3, 275 281 ORIGINAL PAPER Epidemiological Characteristics and Drug Resistance Analysis of Multidrug-Resistant Acinetobacter baumannii in a China Hospital
More informationUNDERSTANDING THE ANTIBIOGRAM
UNDERSTANDING THE ANTIBIOGRAM April Abbott, PhD, D(ABMM) Deaconess Health System Indiana University School of Medicine - Evansville Evansville, IN April.Abbott@Deaconess.com WHAT WE WILL COVER Describe
More informationAnaerobe bakterier og resistens. Ulrik Stenz Justesen Klinisk Mikrobiologisk Afdeling Odense Universitetshospital Odense, Denmark
Anaerobe bakterier og resistens Ulrik Stenz Justesen Klinisk Mikrobiologisk Afdeling Odense Universitetshospital Odense, Denmark Programme anaerobic bacteria Carbapenem and metronidazole resistance New
More informationThere are two international organisations that set up guidelines and interpretive breakpoints for bacteriology and susceptibility
ANTIMICROBIAL SUSCEPTIBILITY TESTING ON MILK SAMPLES Method and guidelines There are two international organisations that set up guidelines and interpretive breakpoints for bacteriology and susceptibility
More informationDrug resistance analysis of bacterial strains isolated from burn patients
Drug resistance analysis of bacterial strains isolated from burn patients L.F. Wang, J.L. Li, W.H. Ma and J.Y. Li Inner Mongolia Institute of Burn Research, The Third Affiliated Hospital of Inner Mongolia
More informationAntimicrobial susceptibility testing of Campylobacter jejuni and C. coli
Antimicrobial susceptibility testing of Campylobacter jejuni and C. coli CRL Campylobacter Workshop The 7th -8th of Oct. 2008 National Veterinary Institute Uppsala, Sweden Legislation The Commission has
More information