Co-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli 4

Transcription

1 SUPPLEMENTARY INFORMATION ARTICLE NUMBER: DOI: /NMICROBIOL Co-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli Jian Sun a,b#, Run-Shi Yang a,b#, Qijing Zhang c, Youjun Feng d, Liang-Xing Fang a,b, Jing Xia a,b, Liang Li a,b, Xiao-Yue Lv a,b, Jia-Hong Duan a,b, Xiao-Ping Liao a,b* and Ya-Hong Liu a,b,e* a National Risk Assessment Laboratory for Antimicrobial Resistance of Animal Original Bacteria, South China Agricultural University, Guangzhou, P. R. China. b College of Veterinary Medicine, South China Agricultural University, Guangzhou, P. R. China. c Department of Veterinary Microbiology and Preventive Medicine, College of Veterinary Medicine, Iowa State University, USA. d Department of Medical Microbiology and Parasitology, Zhejiang University School of Medicine, Zhejiang , P. R. China. e Jiangsu Co-Innovation Centre for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou, Jiangsu, P. R. China. # These two authors contributed equally to this work. * Corresponding author: Xiao-Ping Liao, PH.D, National Risk Assessment Laboratory for Antimicrobial Resistance of Animal Original Bacteria, College of Veterinary Medicine, South China Agricultural University, Guangzhou, P. R. China. xpliao@scau.edu.cn. Tel: ; Fax: Ya-Hong Liu, PH.D, National Risk Assessment Laboratory for Antimicrobial Resistance of Animal Original Bacteria, College of Veterinary Medicine, South China Agricultural University, Guangzhou, P. R. China. lyh@scau.edu.cn. Tel: ; Fax: NATURE MICROBIOLOGY Macmillan Publishers Limited, part of Springer Nature. All rights reserved.

2 Supplementary Figure 1. Localization of bla NDM-5 and mcr-1 in E. coli CQ and CQ02-121T by S1-PFGE and Southern hybridization. (a) S1-PFGE gel of the original isolate E. coli CQ (Lanes 2 and 4) and its transconjugant CQ02-121T (Lanes 1 and 3). Lane M: XbaI-digested genomic DNA of reference Salmonella enterica serotype Braenderup, strain H9812 (sizes are given in Kb). The arrow indicates the location of plasmid pcq (b) and (c) Southern hybridization conducted with a probe specific for bla NDM and mcr-1, respectively. Lane 2 and 4: E. coli CQ02-121; Lane 1 and 3: transconjugant CQ02-121T. A representative result of three independent experiments is shown.

3 Supplementary Figure 2. Measurement of pcq stability in E. coli CQ and transconjugant CQ02-121T in liquid media (a) and on agar plates (b). In panel (a), data points and error bars represent means ± SD of three independent lineages.

4 Supplementary Figure 3. PCR verification of the recombination junctions of pcq in E. coli CQ and its transconjugant CQ02-121T. Five colonies from the original isolate or its transconjugant were randomly selected and tested by PCR. (a) The PCR results obtained by using primers hica-f and taxb-r that amplify the region from nucleotide 43,281 to 44,648. (b) The PCR results obtained by using primer tat-f and IS26ext-R that amplify a region from nucleotide 8,991 to 10,254. In both panels, Lanes 1-5: CQ02-121; Lanes 6-10: CQ02-121T; Lane P: positive control (template was plasmid DNA extracted from CQ02-121T); Lane N: negative control (template DNA from E. coli C600); Lane M: DL2000 marker. The corresponding locations of the PCR primers in pcq are shown in Figure 1b. A representative result of three independent experiments is shown.

5 Supplementary Table 1: Antibiotic resistance phenotypes of E. coli CQ02-121, E. coli C600, and transconjugant CQ02-121T. The MICs of various antimicrobial agents were determined by both agar dilution and broth dilution. The breakpoints for each antimicrobial were set as recommended by the Clinical and Laboratory Standards Institute, Veterinary CLSI and the European Committee on Antimicrobial Susceptibility Testing. Antibiotic MIC in µg/ml(interpretation) a E. coli CQ Transconjugant CQ02-121T E. coli C600 Cefoxitin >256(R) 128(R) 4(S) Ceftazidime >256(R) 128(R) 0.125(S) Cefotaxime 256(R) 128(R) 0.06(S) Ceftiofur b 256(R) 128(R) 0.5(S) Aztreonam 64(R) 1(S) 0.25(S) Meropenem 16(R) 4(R) 0.008(S) Imipenem 16(R) 8(R) 0.125(S) Ertapenem >64(R) 64(R) 0.008(S) Amikacin 4(S) 4(S) 4(S) Gentamicin 128(R) 2(S) 0.5(S) Tobramycin 32(R) 1(S) 0.5(S) Florfenicol b 256(R) 1(S) 1(S) Ciprofloxacin 256(R) 0.015(S) 0.03(S) Enrofloxacin b 256(R) 0.015(S) 0.03(S) Tetracycline >256(R) 1(S) 2(S) Tigecycline c 1(S) 0.25(S) 0.25(S) Colistin c 8(R) 4(R) 0.125(S) Fosfomycin d >256(R) 2(S) 2(S) Co-trimoxazole >320(R) 10(S) 10(S) MIC - minimal inhibitory concentration; R: resistant; S: susceptible; a According to Clinical and Laboratory Standards Institute (CLSI) criteria. b According to the veterinary CLSI criteria. c According to European Committee on Antimicrobial Susceptibility Testing (EUCAST) clinical breakpoints. d Agar dilution using agar media supplemented with 25 μg/ml of glucose-6-phosphate.

6 77 78 Supplementary Table 2: PCR primers used to amplify the genetic structure of plasmid pcq Primer Name Sequence (5'-3') Expected amplicon size (bp) Nucleotide positions Target Reference hica-f TGCTGAAATCAATCACACCA junction This study 1,368 43,281-44,648 between hica taxb-r TAAACGCCCATGATTACACC and taxb This study tat-f GGACAGGACGAAGACCTC junction This study 1,264 8,991-10,254 between tat IS26ext-R TAAAATGCAACAGCGACAGA and IS26 This study LNDM-F GCAGCACACTTCCTATCTCG upstream of This study ,224-12,816 IS26-R TTACATTTCAAAAACTCTGCTTACC bla NDM-5 This study ISAba125A TGTATATTTCTGTGACCCAC downstream Poirel et al ,597-14,538 bleo-r GGCGATGACAGCATCATCCG of bla NDM-5 Poirel et al pir-f ATGCGGCTTATCTTGCTT genetic This study ,181-7,257 environment para-r AAATGCCAGCCAAATACGTT around mcr-1 This study hica-ext-f TATTACGCAGATCAGATGCAA This study ,389-46,512 yaja-r AATGAAACCCGATAATACACC junction This study yaja-f TCCCTTTTGCAGAGCACGTA between hica This study ,294-47,712 dnaj-r GCACTGATGAACATGCACGA downstream This study dnaj-ext-f GCCAGGAACGACTATCCACA and dnaj This study , dnaj-ext-r ATGATTATTACCCGCAAGCTA This study