Potential Impacts of Antibiotics in the Environment
|
|
- Rosemary Potter
- 6 years ago
- Views:
Transcription
1 Potential Impacts of Antibiotics in the Environment Amy Pruden Assistant Professor, Civil Engineering, Colorado State University R1 R D C R3 R B A H CNH 2 H H H
2 verview Agricultural Antibiotics verview of potential impacts Why study resistance genes? Poudre River Study Conclusions Recommendations
3 Agricultural Antibiotics More than ½ used in U.S. Animals Subtherapeutic use promotes weight gain. Animal waste > 130 x human waste (United States Senate Committee on Agriculture, 1997) Antibiotics can be excreted unaltered. Animal Waste Treatment??
4 Antibiotic Pathways Modified from
5 Antibiotics Used: Tetracyclines Chlortet., oxytet., tet... Sulfonamides Macrolides Tylosin, erythromycin.. Ionophores Monensin.. β-lactams Penicilillin H 3 C H H H 3 C H C H H CH 3 H H 3 C H N Erythromycin (Ery) H H 3 C R1 R D C R3 R B H H H C 2 H 3 H 6 17 N--CH 2 --CH 2 -CH 2 - H 3 C H H H 3 C H 5 A Tetracylcline (Tet) CH H H H 3 C N CH3 Tylosin (Tyl) C 4 1 H 3 CH 3 2 H H CNH 2 H 3 C H Roxithromycin (Rox) H H N
6 Public Concern
7 Potential Impacts Toxicity to Aquatic life (H. Ramsdell, CSU) Planaria, flathead minnow, and Hyalella Chlortetracycline, tylosin, sulfamethazine, metronidizine, monensin and lyolocid showed toxicity Monensin strong toxicity and widespread use LD 50 = 5 ppm in water for minnows LD 50 = 20 ppm in sediment for Planaria LD 50 = 1 ppm in water for Hyalella Sublethal effects?
8 Potential Impacts Sub-lethal impacts: Endocrine disruptors Micropollutants not removed by wastewater treatment May cause hermaphroditism Effects on frogs Fish in Chesapeake Bay Sower et al., Env. Health Perspect. 2000
9 Potential Impacts Plant Uptake Antibiotic uptake by plants from soil fertilized with animal manure- Kumara et al. U. Minn. J Environ Qual (2005) Greenhouse studies: corn, green onion, & cabbage Uptake of chlortetracycline, but not tylosin Low: 2 17 ng/g, but correlates with manure concentration Implications for allergic individuals
10 Antibiotic Resistance Genes (ARG) Spread of ARG one of most urgent human health issues according to WH Use of antibiotics selects for antibiotic resistant organisms Shea, 2003; Fedorka-Cray et al., 2002; Smith et al., 2002; Sørum and L Abée-Lund, 2002; Teuber, Can be spread across microbial populations and in the environment ARG as pollutants
11 Resistance Gene Transfer ASM News November, 2004
12 Antibiotic Resistance Genes If we can detect and quantify resistance genes, then we have an assay on the bioavailability/impact of the antibiotics.
13 Mechanisms of Resistance Alteration of the antibiotic or target site tetm tets tet tetw tetq tett tetbp Impaired uptake or enhanced efflux teta tetb tetc tetd tete tetg teth tetj tety tetz verproduce target so higher concentration of antibiotic needed sul genes (PABA overproduction to make folic acid) Degrade antibiotic β-lactams Resistance transfer: Plasmids can be exchanged within and between species
14 Methods Plate counting: R2A agar with antibiotics. Polymerase chain reaction (PCR) assays: Presence/absence of a resistance gene family. Quantitative real-time PCR (Q-PCR) Quantify resistance gene families. Goal: Indicator of Bioavailability/impact of Antibiotics
15 Study Site: Poudre River
16 Map of Study Sites
17 CFU at Sites: April 2004 CFU Per Gram of Sediment Chlortetracycline xytetracycline Mecolcycline Sulfamethoxazole Sulfamethazine Erythromycin Tylosin Monensin No Ab. site 1 site 2 site 3 site 4 site 5
18 CFU at Sites: February 2005 CFU Per Gram of Sediment Chlortetracycline xytetracycline Mecolcycline Sulfamethoxazole Sulfamethazine Erythromycin Tylosin Monensin No Ab. site 1 site 2 site 3 site 4 site 5
19 Pitfalls of Culture-Based Methods 99% of environmental organisms cannot be cultured on standard media (Amann et al., Pace et al.). 16S rrna gene as a target for detecting microorganisms in environmental samples (Woese et al.). Targeting of functional genes.
20 Molecular Biology Approach Polymerase Chain Reaction (PCR) Exponentially amplify target genes using primers specific to the target. Low detection limit. Provides a means of presence/absence detection.
21 sul D sul BC sul Bcr sul A sul III sul I sul II Phylogenetics of Sul Sul Genes
22 New Sul Primers Primer Sul I-FW a SulI-RV Sul II-FW Sul II-RV Sul III-FW Sul III-RV Sul A-FW Sul A-RV Sul BC-FW Sul BC-RV Sul Bcr-FW Sul Bcr-RV Sul D-FW Sul D-RV Class targeted Sul I Sul II Sul III Sul A Sul BC Sul Bcr Sul D Sequences cgcaccggaaacatcgctgcac tgaagttccgccgcaaggctcg tccggtggaggccggtatctgg cgggaatgccatctgccttgag tccgttcagcgaattggtgcag ttcgttcacgccttacaccagc tcttgagcaagcactccagcag tccagccttagcaaccacatgg acaaggtcgcttccagactagc agctcggtatctggcatggctc atagctcccattgcgggttctc tttcaggaacgatgaacacagc agagtccagtgtcttagcgacg agtcttgtgctggtagccaggt Q-PCR annealing temp (ºC) Amplicon Size (bp) Specificity verified by cloning and sequencing the inserts.
23 Detection of PCR Product
24 PCR Presence / Absence Assay Gene ID Site 1 April 2004 high-flow spring Site 2 Site 3 Site 4 Site 5 Site 1 February 2005 low-flow winter Site 2 Site 3 Site 4 Site 5 + control tetb(p) tet() tet(s) tet(t) tet(w) sul(i) sul(ii) sul(iii) sul(a)
25 Real-time PCR Fluorescence Number of Cycles
26 Log Copy of sul I Genes per Reaction Sul I Gene Calibration y = x r 2 = Threshold Cycle (CT) Value
27 April, 2004: Spring High-Flow Copy of ARG / Copy of 16S Genes 10-2 sul(i) 10-3 sul(ii) 10-4 tet(w) tet() site 1 site 2 site 3 site 4 site 5
28 Feb, 2005: Winter Low-Flow Copy of ARG / Copy of 16S genes 10-2 sul(i) 10-3 sul(ii) 10-4 tet(w) tet() site 1 site 2 site 3 site 4 site 5
29 Aug, 2005: Summer Low-Flow Copy of ARG / Copy of 16S genes 10-2 sul(i) 10-3 sul(ii) 10-4 tet(w) tet() site 1 site 2 site 3 site 4 site 5
30 Conclusions Resistance genes in Poudre sediments correlate with human and agricultural activity No direct correlation with antibiotics High sulfonamide resistance compared to tet resistance Fate of antibiotics vs fate of genes? High-flow versus low-flow? Implications for transport?
31 Recommendations Need further studies into the origin of the antibiotic resistance genes and their fate Human vs agricultural Do genes persist longer than antibiotics? Investigate and apply treatment strategies for mitigating risk.
32 Composting Field Study
33 Biodegradation of ARG
34 Students!!!
35 Thank You!! Thank you to USDA NRI and to the CSU Agricultural Research Station for supporting this research!! Ken Carlson & Sung-chul Kim Jessica Davis & Kathy Doesken Questions??
A Unique Approach to Managing the Problem of Antibiotic Resistance
A Unique Approach to Managing the Problem of Antibiotic Resistance By: Heather Storteboom and Sung-Chul Kim Department of Civil and Environmental Engineering Colorado State University A Quick Review The
More informationAMR dissemination in the environment Professor Liz Wellington
AMR dissemination in the environment Professor Liz Wellington The connectivity of potential sources of antibioticresistant bacteria Antibiotic resistance in the environment: soil, sediments, water bodies
More informationTransport of antibiotic resistant bacteria into tile drainage systems
11 th Annual Drainage Research Forum Owatonna, Minnesota November 23 rd, 21 Transport of antibiotic resistant bacteria into tile drainage systems Michelle Soupir Agricultural & Biosystems Engineering,
More informationDrug Use on the Farm & Antibiotic Resistance in Raw, Stored, & Treated Manures
Drug Use on the Farm & Antibiotic Resistance in Raw, Stored, & Treated Manures Jason Oliver, PhD Cornell PRO-DAIRY Dairy Environmental Systems Dairy Practices Council Annual Conference Buffalo, NY Nov.
More informationAntibiotics & Resistance
What are antibiotics? Antibiotics & esistance Antibiotics are molecules that stop bacteria from growing or kill them Antibiotics, agents against life - either natural or synthetic chemicals - designed
More informationAntibiotic Resistance Genes and their Association in Dairy Cattle
Antibiotic Resistance Genes and their Association in Dairy Cattle Brittany Willing Virginia Tech February 23, 2013 Overview Antibiotic resistance genes (ARGs) What are they? Linked? Multiple resistance?
More informationFramework for monitoring antibiotic content and antibiotic resistance in the Danube Delta - the EnviroAMR project -
Framework for monitoring antibiotic content and antibiotic resistance in the Danube Delta - the EnviroAMR project - Dr. Cristian COMAN Institute of Biological Research Cluj-Napoca November 18 th November
More informationFate and Transport of Hormones & Antimicrobials
Fate and Transport of Hormones & Antimicrobials Linda S. Lee Purdue University Dept. of Agronomy April 25, 2008 1 Basic Properties & Source Concentrations Fate Processes Transport Processes 2 Hormones:
More informationFrom Wastewater to Your Tap Water: The Vicious Cycle of Antibiotic Resistance
Victoria Sullivan BioTAP March 23, 2015 From Wastewater to Your Tap Water: The Vicious Cycle of Antibiotic Resistance Multi-drug resistant pathogens pose a great challenge to the treatment of infectious
More informationAgriculture & Agri-Food Canada, Research Centre, Lethbridge, AB. Environment Canada, Saskatoon, Saskatchewan
The Fate of Antimicrobial Residues during Composting and Stockpiling of Manure Srinivas Sura 1,2, Tim A. McAllister 1, Francis J. Larney 1, Allan J. Cessna 2, Inoka D. Amarakoon 3, Lisa D. Tymensen 4,
More informationManureTracker: On the Trail of Hormones, Antimicrobials and Antimicrobial Resistance Genes
ManureTracker: On the Trail of Hormones, Antimicrobials and Antimicrobial Resistance Genes Francis J. Larney 1, Srinivas Sura 2, Shanwei Xu 1, Edward Topp 2, and Tim A. McAllister 1 1 Agriculture & Agri-Food
More informationAre Veterinary Medicines Causing Environmental Risks?
Are Veterinary Medicines Causing Environmental Risks? Nine species of vultures in the wild numbered 40 million birds in the early 1980s. Today, only about 60,000 birds are left (Vibhu Prakash, Bombay
More informationAntimicrobial resistance: a global problem
Antimicrobial resistance: a global problem The connectivity of potential sources of antibioticresistant bacteria Wellington et al. Lancet Infect Dis 13, 155-65 2013 Studying the environmental gene pool:
More informationAntimicrobial Resistance: Do we know everything? Dr. Sid Thakur Assistant Professor Swine Health & Production CVM, NCSU
Antimicrobial Resistance: Do we know everything? Dr. Sid Thakur Assistant Professor Swine Health & Production CVM, NCSU Research Focus Antimicrobial Resistance On farm, Slaughter, Retail, Human Sample
More informationConsequences of Antimicrobial Resistant Bacteria. Antimicrobial Resistance. Molecular Genetics of Antimicrobial Resistance. Topics to be Covered
Antimicrobial Resistance Consequences of Antimicrobial Resistant Bacteria Change in the approach to the administration of empiric antimicrobial therapy Increased number of hospitalizations Increased length
More informationMID 23. Antimicrobial Resistance. Consequences of Antimicrobial Resistant Bacteria. Molecular Genetics of Antimicrobial Resistance
Antimicrobial Resistance Molecular Genetics of Antimicrobial Resistance Micro evolutionary change - point mutations Beta-lactamase mutation extends spectrum of the enzyme rpob gene (RNA polymerase) mutation
More informationDetermination, Confirmation and Quantitation of Multi-Class Antibiotic Residues in Milk by UHPLC MS/MS
APPLICATION NOTE Liquid Chromatography/ Mass Spectrometry Authors: Avinash Dalmia PerkinElmer, Inc. Shelton, CT Determination, Confirmation and Quantitation of Multi-Class Antibiotic Residues in Milk by
More informationAntimicrobial Resistance
Antimicrobial Resistance Consequences of Antimicrobial Resistant Bacteria Change in the approach to the administration of empiric antimicrobial therapy Increased number of hospitalizations Increased length
More informationAntimicrobial Resistance Acquisition of Foreign DNA
Antimicrobial Resistance Acquisition of Foreign DNA Levy, Scientific American Horizontal gene transfer is common, even between Gram positive and negative bacteria Plasmid - transfer of single or multiple
More informationObjectives. Antibiotics uses in food animals 3/25/2018. California Dairy Productions. Antimicrobial Resistance in the Animal Production Environment
Antimicrobial Resistance in the Animal Production Environment Xunde Li Western Institute for Food Safety and Security Department of Population Health and Reproduction University of California Davis Objectives
More informationEnvironment and Natural Resources Trust Fund (ENRTF) M.L Work Plan
Environment and Natural Resources Trust Fund (ENRTF) M.L. 2013 Wk Plan Date of Status Update Rept: October 2, 2012 Date of Next Status Update Rept: January 31, 2014 Date of Wk Plan Approval: Project Completion
More informationSelective toxicity. Antimicrobial Drugs. Alexander Fleming 10/17/2016
Selective toxicity Antimicrobial Drugs Chapter 20 BIO 220 Drugs must work inside the host and harm the infective pathogens, but not the host Antibiotics are compounds produced by fungi or bacteria that
More informationWhat is antimicrobial resistance?
What is antimicrobial resistance? Gérard MOULIN gerard.moulin@anses.fr French agency for food, environmental and occupationnal safety National agency for veterinary Medicinal Products BP 90203-35302 FOUGERES
More informationANTIBIOTICS AND ANTIMICROBIAL RESISTANCE: CAUSES AND POSSIBLE SOLUTIONS
10TH EUROPEAN CONFERENCE ON PESTICIDES AND RELATED ORGANIC MICROPOLLUTANTS IN THE ENVIRONMENT & 16TH SYMPOSIUM ON CHEMISTRY AND FATE OF MODERN PESTICIDES joined to 10TH MGPR INTERNATIONAL SYMPOSIUM OF
More informationChanging Practices to Reduce Antibiotic Resistance
Changing Practices to Reduce Antibiotic Resistance Jean E. McLain, Research Scientist and Assistant Dean University of Arizona College of Agriculture and Life Sciences and Department of Soil, Water and
More informationMechanisms and Pathways of AMR in the environment
FMM/RAS/298: Strengthening capacities, policies and national action plans on prudent and responsible use of antimicrobials in fisheries Final Workshop in cooperation with AVA Singapore and INFOFISH 12-14
More informationANTIBIOTIC POLLUTION FROM MANUFACTURING
ANTIBIOTIC POLLUTION FROM MANUFACTURING JOHAN BENGTSSON-PALME JOHAN BENGTSSON-PALME Patancheru, India Patancheru* Active ingredient Type of drug Range (µg/l) Ciprofloxacin antibiotic-fluoroquinolone 28,000-31,000
More informationDraft agreed by the Environmental Risk Assessment Working Party (ERAWP) 30 April 2018
1 2 3 8 November 2018 EMA/CVMP/ERA/632109/2014 Committee for Medicinal Products for Veterinary Use (CVMP) 4 5 6 7 Reflection paper on antimicrobial resistance in the environment: considerations for current
More informationOverview of NARMS Program and Detecting Emerging/Novel Antimicrobial Resistance Genes Using WGS
Overview of NARMS Program and Detecting Emerging/Novel Antimicrobial Resistance Genes Using WGS Shaohua Zhao DVM, MPVM, PhD U.S. Food and Drug Administration Center for Veterinary Medicine Office of Research
More informationPreventing Sulfa Residues in Pork
1 of 7 4/29/2010 8:43 AM University of Missouri Extension G2358, Reviewed October 1993 Preventing Sulfa Residues in Pork John C. Rea Department of Animal Sciences Sulfa products and other antibiotics have
More informationEffect of Subtherapeutic Administration of Antibiotics on the Prevalence of Antibiotic-Resistant Escherichia coli Bacteria in Feedlot Cattle
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, July 2008, p. 4405 4416 Vol. 74, No. 14 0099-2240/08/$08.00 0 doi:10.1128/aem.00489-08 Copyright 2008, American Society for Microbiology. All Rights Reserved. Effect
More information2017 NAMI Meat Industry Summit, San Diego, CA April 3-5, Keith E. Belk
2017 NAMI Meat Industry Summit, San Diego, CA April 3-5, 2017 Keith E. Belk Professor & Monfort Chair Center for Meat Safety & Quality Department of Animal Sciences Colorado State University Fort Collins
More informationMartin Chénier, Ph.D. Microbiology. Antibiotics in Animal Production: Resistance and Alternative Solutions
Faculty of Agricultural and Environmental Sciences Department of Food Science, Department of Animal Science Martin Chénier, Ph.D. Microbiology Antibiotics in Animal Production: Resistance and Alternative
More informationAntibiotic Residues in Animal Waste: Occurrence and Degradation in Conventional Agricultural Waste Management Practices
Curr Pollution Rep (2016) 2:135 155 DOI 10.1007/s40726-016-0037-1 WATER POLLUTION (S SENGUPTA, SECTION EDITOR) Antibiotic Residues in Animal Waste: Occurrence and Degradation in Conventional Agricultural
More informationCAT LITTER and DOG FECES: COMPOST or WASTE?
CAT LITTER and DOG FECES: COMPOST or WASTE? Some Background Nova Scotia has set a solid waste disposal rate goal of 300 kg per person per year by 2015. > 500 kg in 1997 350 kg in 2000 ~ 500 kg in 2006
More informationBurton's Microbiology for the Health Sciences. Chapter 9. Controlling Microbial Growth in Vivo Using Antimicrobial Agents
Burton's Microbiology for the Health Sciences Chapter 9. Controlling Microbial Growth in Vivo Using Antimicrobial Agents Chapter 9 Outline Introduction Characteristics of an Ideal Antimicrobial Agent How
More informationOne Analysis, One Column, Less than 9 Minutes for Over 60 Multiclass Antibiotics
Featured Application: Multiclass Veterinary Antibiotics on Raptor C8 by LC- One Analysis, One Column, Less than 9 Minutes for Over 0 Multiclass Antibiotics Highly efficient peak separation and fast analysis
More informationProject Summary. Impact of Feeding Neomycin on the Emergence of Antibiotic Resistance in E. coli O157:H7 and Commensal Organisms
Project Summary Impact of Feeding Neomycin on the Emergence of Antibiotic Resistance in E. coli O157:H7 and Commensal Organisms Principal Investigators: Mindy Brashears, Ph.D., Texas Tech University Guy
More informationAntimicrobial Resistance
Antimicrobial Resistance Consequences of Antimicrobial Resistant Bacteria Change in the approach to the administration of Change in the approach to the administration of empiric antimicrobial therapy Increased
More informationAntibiotics. Antimicrobial Drugs. Alexander Fleming 10/18/2017
Antibiotics Antimicrobial Drugs Chapter 20 BIO 220 Antibiotics are compounds produced by fungi or bacteria that inhibit or kill competing microbial species Antimicrobial drugs must display selective toxicity,
More informationThe Microbiome of Food Animals and the Effects of Antimicrobial Drugs
Microbial Ecology Group The Microbiome of Food Animals and the Effects of Antimicrobial Drugs Paul S. Morley DVM, PhD, DACVIM Professor of Epidemiology and Infection Control / Colorado State University
More informationAn#bio#cs and challenges in the wake of superbugs
An#bio#cs and challenges in the wake of superbugs www.biochemj.org/bj/330/0581/bj3300581.htm ciss.blog.olemiss.edu Dr. Vassie Ware Bioscience in the 21 st Century November 14, 2014 Who said this and what
More informationOccurrence of Antibiotics in Drinking Water
Occurrence of Antibiotics in Drinking Water Zhengqi Ye, Howard S. Weinberg Michael T. Meyer U. S. Geological Survey, Kansas Abstract The occurrence of antibiotics in the aquatic environment has raised
More informationKey Lecture: Entry, occurrence, behavior and effects of pharmaceuticals in the environment
Workshop Pharmaceuticals in Soil, Sludge and Slurry (Dessau, 18 th June to 19 th June 2013) Key Lecture: Entry, occurrence, behavior and effects of pharmaceuticals in the environment Gerd Hamscher Faculty
More informationAabo, Søren; Ricci, Antonia; Denis, Martine; Bengtsson, Björn; Dalsgaard, Anders; Rychlik, Ivan; Jensen, Annette Nygaard
Downloaded from orbit.dtu.dk on: Sep 04, 2018 SafeOrganic - Restrictive use of antibiotics in organic animal farming a potential for safer, high quality products with less antibiotic resistant bacteria
More informationAntibiotic Residues in Meat and Meat Products, Implications on Human Health
Antibiotic Residues in Meat and Meat Products, Implications on Human Health Loinda Rugay Baldrias, DVM, MVS, PhD Dean, Professor College of Veterinary Medicine University of the Philippines Los Banos National
More informationMicrobiology : antimicrobial drugs. Sheet 11. Ali abualhija
Microbiology : antimicrobial drugs Sheet 11 Ali abualhija return to our topic antimicrobial drugs, we have finished major group of antimicrobial drugs which associated with inhibition of protein synthesis
More informationAntibiotic resistance a mechanistic overview Neil Woodford
Antibiotic Resistance a Mechanistic verview BSc PhD FRCPath Consultant Clinical Scientist 1 Polymyxin Colistin Daptomycin Mechanisms of antibiotic action Quinolones Mupirocin Nitrofurans Nitroimidazoles
More informationIntroduction to Chemotherapeutic Agents. Munir Gharaibeh MD, PhD, MHPE School of Medicine, The university of Jordan November 2018
Introduction to Chemotherapeutic Agents Munir Gharaibeh MD, PhD, MHPE School of Medicine, The university of Jordan November 2018 Antimicrobial Agents Substances that kill bacteria without harming the host.
More informationAntibiotic resistance and the environment there and back again
Science & Society Antibiotic resistance and the environment there and back again Science & Society series on Science and Drugs Silvia Berkner, Sabine Konradi & Jens Schönfeld Today, it is difficult to
More informationRisk analysis of antimicrobial use in aquaculture Peter Smith
FMM/RAS/298: Strengthening capacities, policies and national action plans on prudent and responsible use of antimicrobials in fisheries Risk analysis of antimicrobial use in aquaculture Peter Smith peter.smith@nuigalway.ie
More informationAgricultural Research Division, American Cyanamid Company, Princeton, NJ 08540
1 Antibiotics Use in Agriculture: An Overview Richard H. Gustafson Downloaded via 148.251.232.83 on October 16, 2018 at 00:12:00 (UTC). See https://pubs.acs.org/sharingguidelines for options on how to
More informationThe role of the environment in the selection and spread of antimicrobial resistance
Priority Topic E - Environment The role of the environment in the selection and spread of antimicrobial resistance The overarching goal of this priority topic is to investigate the role of the environment
More informationAlejandro H. Buschmann Centro i-mar & CeBiB Universidad de Los Lagos Puerto Montt - Chile
Alejandro H. Buschmann Centro i-mar & CeBiB Universidad de Los Lagos Puerto Montt - Chile Seafood Summit- New Orleans - 2015 Antibiotic use context Antibiotic use and their environmental consequences Conclusions
More informationCombating Antimicrobial Resistance: A Manufacturing Perspective
Combating Antimicrobial Resistance: A Manufacturing Perspective Steve Brooks VP, EHS Pfizer Inc & Chair, Environmental Work Group of the AMR Industry Alliance June 20 th 2017 AMR - Environmental Matters
More informationRisk management approaches to antimicrobial resistance in the U.S. and abroad
Risk management approaches to antimicrobial resistance in the U.S. and abroad Expectations, results and conundrums H. Morgan Scott DVM, PhD E.J. Frick Professor of Veterinary Medicine Department of Diagnostic
More informationChapter 12. Antimicrobial Therapy. Antibiotics 3/31/2010. Spectrum of antibiotics and targets
Chapter 12 Topics: - Antimicrobial Therapy - Selective Toxicity - Survey of Antimicrobial Drug - Microbial Drug Resistance - Drug and Host Interaction Antimicrobial Therapy Ehrlich (1900 s) compound 606
More informationAntimicrobials & Resistance
Antimicrobials & Resistance History 1908, Paul Ehrlich - Arsenic compound Arsphenamine 1929, Alexander Fleming - Discovery of Penicillin 1935, Gerhard Domag - Discovery of the red dye Prontosil (sulfonamide)
More informationESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED
ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED Caroline Pissetti 1, Jalusa Deon Kich 2, Heather K. Allen 3, Claudia Navarrete
More informationMedically Important Antibiotics in Animal Agriculture
Medically Important Antibiotics in Animal Agriculture Craig Lewis, DVM MPH Office of the Director Center for Veterinary Medicine Farm Foundation Antimicrobial Stewardship Workshop Davis, California October,
More informationAvoiding residues and an FDA Inspection
Avoiding residues and an FDA Inspection James D. McKean, DVM, JD Extension Veterinarian Associate Director, Iowa Pork Industry Center Iowa State University x2mckean@iastate.edu USDA FSIS Residue Testing
More informationAntibacterial therapy 1. د. حامد الزعبي Dr Hamed Al-Zoubi
Antibacterial therapy 1 د. حامد الزعبي Dr Hamed Al-Zoubi ILOs Principles and terms Different categories of antibiotics Spectrum of activity and mechanism of action Resistancs Antibacterial therapy What
More informationDr. Amy Pruden, Ph.D. W. Thomas Rice Professor Department of Civil and Environmental Engineering. Global Change Center Virginia Tech
March 15, 2018 Dr. Jennifer McQuiston, DVM, MS, (CAPT, USPHS) Deputy Director of the Division of High Consequence Pathogens and Pathology National Center for Emerging and Zoonotic Infectious Diseases Centers
More informationPolicy Brief and Recommendations #4 Misuse of Antibiotics in Food Animal Production. Antibiotic Misuse in Food Animals Time for Change
Policy Brief and Recommendations #4 Misuse of Antibiotics in Food Animal Production Antibiotic Misuse in Food Animals Time for Change POLICY BRIEF AND RECOMMENDATIONS #4 MISUSE OF ANTIBIOTICS IN FOOD ANIMAL
More informationAntimicrobial Therapy
Chapter 12 The Elements of Chemotherapy Topics - Antimicrobial Therapy - Selective Toxicity - Survey of Antimicrobial Drug - Microbial Drug Resistance - Drug and Host Interaction Antimicrobial Therapy
More informationTable 2 Structures and properties of the study compounds with full citations < (ectoparasiticide)
1 Table 2 tructures and properties of the study compounds with full citations Compound CA Molecular Log Kow pka Log Koc 1 oil DT50 1 tructure weight (l/kg) (days) Amoxicillin 26787-78-0 365.4 0.87 2 2.8,
More informationIN VIVO TRANSFER OF ANTIBIOTIC RESISTANCE GENES BETWEEN THE RESIDENT INTESTINAL MICROFLORA OF BROILER CHICKENS AND SALMONELLA TYPHIMURIUM
IN VIVO TRANSFER OF ANTIBIOTIC RESISTANCE GENES BETWEEN THE RESIDENT INTESTINAL MICROFLORA OF BROILER CHICKENS AND SALMONELLA TYPHIMURIUM by TAMEKA NICOLE BUFFINGTON (Under the Direction of John Maurer)
More informationEurEau s Contribution to the European Commission s Strategic Approach on Veterinary Pharmaceuticals in the Environment
EurEau s Contribution to the European Commission s Strategic Approach on Veterinary Pharmaceuticals in the Environment Summary Globally, pharmaceutical products are regularly administered to both livestock
More informationExamining antibiotic resistance in the feedlot cattle industry using real-time, quantitative PCR (qpcr) and enterococci as an indicator bacterium
Examining antibiotic resistance in the feedlot cattle industry using real-time, quantitative PCR (qpcr) and enterococci as an indicator bacterium Alicia Grace Beukers A thesis submitted in fulfilment of
More informationIsolation and molecular identification of Moraxella ovis and Moraxella spp. from IKC in sheep in India
Isolation and molecular identification of Moraxella ovis and Moraxella spp. from IKC in sheep in India R K Vaid*, T Anand, B C Bera, B N Shukla, D K Nagar, Gagandeep Singh, N Virmani, S Barua, B K Singh
More informationAbundance of Antibiotic Resistance Genes in Feces Following Prophylactic and. Therapeutic Intramammary Antibiotic Infusion in Dairy Cattle
Abundance of Antibiotic Resistance Genes in Feces Following Prophylactic and Therapeutic Intramammary Antibiotic Infusion in Dairy Cattle Brittany Faith Willing Thesis submitted to the faculty of the Virginia
More informationSUMMARY OF PRODUCT CHARACTERISTICS. Vetmulin 450 mg/g granules for use in drinking water for pigs. (All MS except FR)
SUMMARY OF PRODUCT CHARACTERISTICS 1. NAME OF THE VETERINARY MEDICINAL PRODUCT Vetmulin 450 mg/g granules for use in drinking water for pigs. (All MS except FR) Vetmulin 364 mg/g granules for use in drinking
More informationThe effects of ceftiofur and chlortetracycline treatment on antibiotic resistant Salmonella populations in feedlot cattle
The effects of ceftiofur and chlortetracycline treatment on antibiotic resistant Salmonella populations in feedlot cattle Naomi Ohta Department of Veterinary Pathobiology, College of Veterinary Medicine
More informationAnimal Antibiotic Use and Public Health
A data table from Nov 2017 Animal Antibiotic Use and Public Health The selected studies below were excerpted from Pew s peer-reviewed 2017 article Antimicrobial Drug Use in Food-Producing Animals and Associated
More informationVeterinary Feed Directive
Veterinary Feed Directive Medically Important Antibiotics in Animal Agriculture Outline Questions to Be Addressed What changes are being made and why? What drugs are affected, which ones are not? What
More informationمادة االدوية المرحلة الثالثة م. غدير حاتم محمد
م. مادة االدوية المرحلة الثالثة م. غدير حاتم محمد 2017-2016 ANTIMICROBIAL DRUGS Antimicrobial drugs Lecture 1 Antimicrobial Drugs Chemotherapy: The use of drugs to treat a disease. Antimicrobial drugs:
More informationAntibiotic resistance of bacteria along the food chain: A global challenge for food safety
GREASE Annual Scientific Seminar. NIVR, 17-18th March 2014. Hanoi-Vietnam Antibiotic resistance of bacteria along the food chain: A global challenge for food safety Samira SARTER CIRAD-UMR Qualisud Le
More informationAMR risk assessment project
AMR risk assessment project Project team: Colorado State University - Keith Belk & Paul Morley Kansas State University - Mike Apley & Katie Hope University of Nebraska-Lincoln - Bing Wang & Sapna Chitlapilly
More informationNova Journal of Medical and Biological Sciences Page: 1
Nova Explore Publications Nova Journal of Medical and Biological Sciences Vol. 3(1), 2014:1-5 PII: S2292793X1400003-3 www.novaexplore.com Multidrug resistance of Enterobacter Aerogenes isolated from bovine
More informationAntibiotic and Disinfectant Resistant Bacteria in Rivers of the United States
Abstract Antibiotic and Disinfectant Resistant Bacteria in Rivers of the United States Ronald J. Ash and Jamey L. Iverson Department of Biology, Washburn University,Topeka, KS We examined natural water
More informationOrigins of Resistance and Resistance Transfer: Food-Producing Animals.
Origins of Resistance and Resistance Transfer: Food-Producing Animals. Chris Teale, AHVLA. Origins of Resistance. Mutation Brachyspira hyodysenteriae and macrolide and pleuromutilin resistance. Campylobacter
More informationAntimicrobial use in poultry: Emerging public health problem
Antimicrobial use in poultry: Emerging public health problem Eric S. Mitema, BVM, MS, PhD CPD- Diagnosis and Treatment of Poultry Diseases FVM, CAVS, 6 th. August, 2014 AMR cont Antibiotics - Natural or
More informationChemical Residue Testing and the Role of Proficiency Testing Material at the Centre for Veterinary Drug Residues
2014/SCSC/WKSP2/003 Session: 5.1 Chemical Residue Testing and the Role of Proficiency Testing Material at the Centre for Veterinary Drug Residues Submitted by: Canada Food Safety Cooperation Forum Partnership
More informationDISSERTATION THE EPIDEMIOLOGY AND ECOLOGY OF ANTIMICROBIAL USE AND RESISTANCE IN NORTH AMERICAN BEEF PRODUCTION SYSTEMS.
DISSERTATION THE EPIDEMIOLOGY AND ECOLOGY OF ANTIMICROBIAL USE AND RESISTANCE IN NORTH AMERICAN BEEF PRODUCTION SYSTEMS Submitted by Noelle Robertson Noyes Department of Clinical Sciences In partial fulfillment
More informationImpact of Antimicrobial Usage on Antimicrobial Resistance in Commensal Escherichia coli Strains Colonizing Broiler Chickens
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Mar. 2007, p. 1404 1414 Vol. 73, No. 5 0099-2240/07/$08.00 0 doi:10.1128/aem.01193-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Impact
More informationReceived 15 May 2007/Accepted 14 August 2007
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2007, p. 6566 6576 Vol. 73, No. 20 0099-2240/07/$08.00 0 doi:10.1128/aem.01086-07 Impact of Feed Supplementation with Antimicrobial Agents on Growth Performance
More informationOccurrence of Pharmaceuticals, Hormones, and Organic Wastewater Compounds in Pennsylvania Waters
Occurrence of Pharmaceuticals, Hormones, and Organic Wastewater Compounds in Pennsylvania Waters U.S. Geological Survey Scientific Investigations Report 2012-5106 Background Pharmaceuticals, Hormones,
More informationMethods development to detect antibiotic activity in water samples
Methods development to detect antibiotic activity in water samples Stefan Kools (Grontmij AquaSense) Marta Wilgosz (Grontmij AquaSense, WUR) Evertjan van de Brandhof (RIVM) Gerard Stroomberg (Waterdienst)
More informationOUR BAY AND RIVERS ON DRUGS pharmaceuticals and illicit drugs as agents of ecological change
OUR BAY AND RIVERS ON DRUGS pharmaceuticals and illicit drugs as agents of ecological change Emma J. Rosi, Senior Scientist and Director Baltimore Ecosystem Study LTER Baltimore Ecosystem Study Pharmaceuticals
More informationANTIMICROBIAL USAGE IN AQUACULTURE
FMM/RAS/298: Strengthening capacities, policies and national action plans on prudent and responsible use of antimicrobials in fisheries ANTIMICROBIAL USAGE IN AQUACULTURE Review of AMU in aquaculture based
More informationProtect your trees in the ground: What s new on the antimicrobial front?
June 12-14, 2013 Ninth Annual Florida Citrus Industry Annual Conference Protect your trees in the ground: What s new on the antimicrobial front? Hyatt Regency Coconut Point, Bonita Springs June 12-14,
More informationImpact of pharmaceuticals discharges on the receiving environment: a two years monitoring results
Impact of pharmaceuticals discharges on the receiving environment: a two years monitoring results www.isa-lyon.fr TRACES Group Technology and Research in Analytical Chemistry for Environment, health and
More informationApproach to pediatric Antibiotics
Approach to pediatric Antibiotics Gassem Gohal FAAP FRCPC Assistant professor of Pediatrics objectives To be familiar with common pediatric antibiotics o Classification o Action o Adverse effect To discus
More informationANTIBIOTIC SENSITIVITY PATTERN OF YERSINIA ENTEROCOLITICA ISOLATED FROM MILK AND DAIRY PRODUCTS*
Short Communication ANTIBIOTIC SENSITIVITY PATTERN OF YERSINIA ENTEROCOLITICA ISOLATED FROM MILK AND DAIRY PRODUCTS* T.R.Pugazhenthi 1, A. Elango 2, C. Naresh Kumar 3, B. Dhanalakshmi 4 and A. Bharathidhasan
More informationnumber Done by Corrected by Doctor Dr Hamed Al-Zoubi
number 8 Done by Corrected by Doctor Dr Hamed Al-Zoubi 25 10/10/2017 Antibacterial therapy 2 د. حامد الزعبي Dr Hamed Al-Zoubi Antibacterial therapy Figure 2/ Antibiotics target Inhibition of microbial
More informationAntibiotics and antibiotic resistance from animal manures to soil: a review
European Journal of Soil Science, January 2018, 69, 181 195 doi: 10.1111/ejss.12494 Special issue article Antibiotics and antibiotic resistance from animal manures to soil: a review W.-Y. Xie, Q. Shen
More informationUrban Water Security Research Alliance
Urban Water Security Research Alliance Antibiotic Resistant Bacteria in Hospital Wastewaters and Sewage Treatment Plants Mohammad Katouli Hospital Wastewater Science Forum, 19-20 June 2012 Antibiotic resistance
More informationPharmaceutical Compounds, Antibiotics, Hormones, and Wastewater Compounds in Pennsylvania Waters
Pharmaceutical Compounds, Antibiotics, Hormones, and Wastewater Compounds in Pennsylvania Waters Kent Crawford U.S. Geological Survey Pennsylvania Water Science Center PaDEP Emerging Contaminant Forum
More informationAntimicrobial agents
Bacteriology Antimicrobial agents Learning Outcomes: At the end of this lecture, the students should be able to: Identify mechanisms of action of antimicrobial Drugs Know and understand key concepts about
More informationPCR detection of Leptospira in. stray cat and
PCR detection of Leptospira in 1 Department of Pathology, School of Veterinary Medicine, Islamic Azad University, Shahrekord Branch, Shahrekord, Iran 2 Department of Microbiology, School of Veterinary
More information