Acta Medica Okayama OCTOBER 2009

Size: px

Start display at page:

Download "Acta Medica Okayama OCTOBER 2009"

Deborah Pope
5 years ago
Views:

1 Acta Medica Okayama Volume 63, Issue Article 6 OCTOBER 2009 Experimental and Clinical Studies on Fluoroquinolone-insusceptible Escherichia coli Isolated from Patients with Urinary Tract Infections from 1994 to 2007 Koichiro Wada Reiko Kariyama Ritsuko Mitsuhata Shinya Uehara Toyohiko Watanabe Koichi Monden Hiromi Kumon Department of Urology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Department of Urology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, kariyama@md.okayama-u.ac.jp Department of Urology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Department of Urology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Department of Urology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Department of Urology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Department of Urology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Copyright c 1999 OKAYAMA UNIVERSITY MEDICAL SCHOOL. All rights reserved.

2 Experimental and Clinical Studies on Fluoroquinolone-insusceptible Escherichia coli Isolated from Patients with Urinary Tract Infections from 1994 to 2007 Koichiro Wada, Reiko Kariyama, Ritsuko Mitsuhata, Shinya Uehara, Toyohiko Watanabe, Koichi Monden, and Hiromi Kumon Abstract Urinary tract infections (UTIs) due to fluoroquinolone-insusceptible Escherichia coli have become increasingly common in recent years. We investigated the potential relationships between clinical measures to combat fluoroquinolone-insusceptible E. coli and experimental analyses on E. coli isolates. Over a 14-year period from 1994 through 2007, a total of 828 E. coli isolates were collected from patients (one isolate per patient) with UTI at the urology ward of Okayama University Hospital. We analyzed the mutations in quinolone resistance-determining regions of DNA gyrase (gyra) and topoisomerase IV (parc). The production of biofilm by these isolates was also examined and the associated medical records were retrospectively reviewed. Seven of 189 (3.7%) strains from uncomplicated UTIs and 82 of 639 (12.8%) strains from complicated UTIs were insusceptible to fluoroquinolones. Amino acid replacements of type II topoisomerases were frequently observed at positions 83 and 87 in GyrA and at positions 80 and 84 in ParC. No significant difference in the biofilm-forming capabilities was observed between fluoroquinolone-susceptible and -insusceptible E. coli. Our study suggests that biofilm formation of fluoroquinolone-insusceptible E. coli isolates is not a major mechanism of resistance in patients with UTI. KEYWORDS: fluoroquinolone, Escherichia coli, biofilm, MICs, QRDRs

3 Wada et al.: Experimental and Clinical Studies on Fluoroquinolone-insusceptibl Experimental and Clinical Studies on Fluoroquinoloneinsusceptible Escherichia coli Isolated from Patients with Urinary Tract Infections from 1994 to 2007 a a* a a a a,b a a b Produced by The Berkeley Electronic Press,

4 Acta Medica Okayama, Vol. 63 [2009], Iss. 5, Art ʼ 2

5 Wada et al.: Experimental and Clinical Studies on Fluoroquinolone-insusceptibl PCR primers and conditions used in the direct sequence method Primer specificity Primer sequences Product length bp Initial denaturation PCR conditions Cycling Cycle Final extension DNA gyrase A gene (gyra) Topoisomerase IV gene (parc) F: 5ʼ GAGGAAGAGCTGAAGAGCTCC 3ʼ 1st PCR min, 94 ; 1 min, 55 ; 1 min, min, 72 R: 5ʼ CGAGATCGGCCATCAGTTC 3ʼ 5 min, 94 2nd PCR F: 5ʼ GAGGAAGAGCTGAAGAGCTCC 3ʼ 30 sec, 95 ; 4 min, F: 5ʼ AAACCTGTTCAGCGCCGCATT 3ʼ 1st PCR min, 94 ; 1 min, 55 ; 1 min, min, 72 R: 5ʼ GTGGTGCCGTTAAGCAAA 3ʼ 5 min, 95 2nd PCR F: 5ʼ AAACCTGTTCAGCGCCGCATT 3ʼ 30 sec, 95 ; 4 min, Number of patients (%) (year) Annual changes in the incidence of UTI due to fluoroqui nolone insusceptible E. coli. lines: Number of patients with UTI due to fluoroquinolone insusceptible E. coli. Percentage of fluoroquinolone insuscep tible E. coli among the total isolated E. coli. Produced by The Berkeley Electronic Press,

6 Acta Medica Okayama, Vol. 63 [2009], Iss. 5, Art Cumulative percentages of fluoroquinolone insusceptible E. coli strains at MICs (µg ml) of several antibiotics except fluoro quinolones. The MIC 90 values of ampicillin, cefazoline, cefozo pran, imipenem, minocycline and gentamycin were 64, 8, 0.5, 0.5, 32 and 32µg ml, respectively. lines: ampicillin cefazolin cefozopran imipenem minocycline gentamycin A D Correlations between MICs (μg ml) of ofloxacin (horizontal) and other fluoroquinolones (vertical) for fluoroquinolone insusceptible E. coli strains (n 79). A, norfloxacin; B, levofloxacin; C, sparfloxacin; D, ciprofloxacin; E, tosufloxacin; F, sitafloxacin. MICs of tosufloxacin ( 64 µg ml) could not be measured due to insolubility. B E C F 4

7 Wada et al.: Experimental and Clinical Studies on Fluoroquinolone-insusceptibl Backgrounds of the patients with UTI due to fluoroqui nolone insusceptible E. coli (n 89) Sex: male female Age: median SD (range) (8 to 86) Outpatient Inpatient Catheterization (29.2%) Self catheterization (15.7%) Repeated UTI: yes no (unclear: 1) Underlying diseases of the patients with complicated UTI (n 82) Neurogenic bladder 32 (39.0%) Malignancy 22 (26.8%) Fistula (vagina, rectum) 11 (13.4%) Others 17 (20.7%) Administration of the antimicrobial agent before bacterial isolation Prescribed for the last 2 years (76.4%) Prescription of fluoroquinolones (70.6%) Just before isolation (for last 2 weeks) (29.2%) Prescription of fluoroquinolones (76.9%) No prescription (23.6%) Number of patients A B C D E F G H I Decisive treatments and outcomes. A, cephems; B, fluoroquinolones; C, penicillins; D, penems; E, carbapenems; F, minocycline; G, sulfamethoxazole trimethoprim; H, aminoglyco sides; I; none. bars: cure, light symptom, no change, naturally disappeared, unclear. Produced by The Berkeley Electronic Press,

8 Acta Medica Okayama, Vol. 63 [2009], Iss. 5, Art Backgrounds of the patients with UTI due to fluoroquinolone insusceptible E. coli Year Sex Age Underlying diseases Biofilm OD570 Major amino acid replacements MIC (µg ml) GyrA ParC Ofloxacin Sitafloxacin Levofloxacin A 2002 F 77 Neurogenic bladder 0 S83L, D87G S80R F 71 None S83L, D87N S80I B 1998 F 18 Urethral stricture S83L M 70 Bladder stone S83L, D87N S80I, E84V A: Two strains of E. coli which MIC of sitafloxacin was 2µg ml. B: Two strains of E. coli with strong capabilities of biofilm formation. 6

9 Wada et al.: Experimental and Clinical Studies on Fluoroquinolone-insusceptibl Correlations between amino acid replacements and MICs of ofloxacin GyrA (83, 87) ParC (80, 84) MICs of ofloxacin (μg ml) Susceptible Insusceptible (, ) (, ) (, ) (, ) (, ) (, ) (, ) (, ) (, ) (, ) (, ) (, ) (, ) (, ) Total number of strain Biofilm forming capabilities of E. coli strains. A, Group I is fluoroquinolone insusceptible E. coli (mean SD: ). Group II is fluoroquinolone susceptible E. coli (mean SD: ). The p value was 0.19; B, Group III is fluoroquinolone insus ceptible E. coli strains for which the MICs of sitafloxacin were 0.5µg ml (mean SD: ). Group IV is fluoroquinolone insus ceptible E. coli strains for which the MICs of sitafloxacin were over 1µg ml (mean SD: ). The p value was Produced by The Berkeley Electronic Press,

10 Acta Medica Okayama, Vol. 63 [2009], Iss. 5, Art

11 Wada et al.: Experimental and Clinical Studies on Fluoroquinolone-insusceptibl Eom JS, Hwang BY, Sohn JW, Kim WJ, Kim MJ, Park SC and Cheong HJ: Clinical and molecular epidemiology of quinolone insusceptible Escherichia coli isolated from urinary tract infection. Microb Drug Resist (2002) 8: Kahlmeter G: Prevalence and antimicrobial susceptibility of patho gens in uncomplicated cystitis in Europe. The ECO.SENS study. Int J Antimicrob Agents (2003) Suppl 2: The WHO Western Pacific Gonococcal Antimicrobial Surveillance Programme: Surveillance of antibiotic resistance in Neisseria gon orrhoeae in the WHO Western Pacific Region, Commun Dis Intell (2006) 30: Japanese Journal of Sexual Transmitted Diseases: Diagnosis and treatment guidelines Nippon Seikansenshou Gakkaishi (Jpn J STD) (2008) 19: Suppl (in Japanese). 5. Hooper DC: Emerging mechanisms of fluoroquinolone resistance. Emerg Infect Dis (2001) 7: Hopkins KL, Davies RH and EJ Threlfall EJ: Mechanisms of qui nolone resistance in Escherichia coli and Salmonella: recent developments. Int J Antimicrob Agents (2005) 25: Clinical and Laboratory Standards Institute: Methods for dilution antimicrobial susceptibility tests for bacteria that grow aero bically; approved standard seventh edition Document M7 A7. Clinical and Laboratory Standards Institute, Wayne (2006). 8. Clinical and Laboratory Standards Institute: Performance stan dards for antimicrobial susceptibility testing; seventeenth informa tional supplement M100 S17. Clinical and Laboratory Standards Institute, Wayne (2007) pp Minuth JN, Musher DM and Thorsteinsson SB: Inhibition of the antibacterial activity of gentamicin by urine. J Infect Dis (1976) 133: Engberg J, Aarestrup FM, Taylor DE, Gerner Smidt P and Nachamkin I: Quinolone and macrolide resistance in Campylo bacter jejuni and C. coli: resistance mechanisms and trends in human isolates. Emerg Infect Dis (2001) 7: Ginsburg AS, Grosset JH and Bishai WR: Fluoroquinolones, tuberculosis, and resistance. Lancet Infect Dis (2003) 3: Hooper DC and Wolfson JS: Mechanisms of fluoroquinolone action and bacterial killing. In Quinolone Antimicrobial Agents, 2nd Ed. Hooper DC, Wolfson JS eds, American Society for Microbiology, Washington DC (1993) pp Wang JC: DNA topoisomerases. Annu Rev Biochem (1996) 65: Adams DE, Shekhtman EM, Zechiedrich EL, Schmid MB and Cozzarelli NR: The role of topoisomerase IV in partitioning bacte rial replicons and the structure of catenated intermediates in DNA replication. Cell (1992) 71: Heisig P: Genetic evidence for a role of parc mutations in devel opment of high level fluoroquinolone resistance in Escherichia coli. Antimicrob Agents Chemother (1996) 40: Bagel S, Hüllen V, Wiedemann B and Heisig P: Impact of gyra and parc mutations on quinolone resistance, doubling time, and supercoiling degree of Escherichia coli. Antimicrob Agents Che mother (1999) 43: Komp Lindgren P, Karlsson A and Hughes D: Mutation rate and Produced by The Berkeley Electronic Press,

12 Acta Medica Okayama, Vol. 63 [2009], Iss. 5, Art evolution of fluoroquinolone resistance in Escherichia coli isolates from patients with urinary tract infections. Antimicrob Agents Chemother (2003) 47: Fralick JA: Evidence that TolC is required for functioning of the Mar AcrAB efflux pump of Escherichia coli. J Bacteriol (1996) 178: Okusu H, Ma D and Nikaido H: AcrAB efflux pump plays a major role in the antibiotic resistance phenotype of Escherichia coli mul tiple antibiotic resistance (Mar) mutants. J Bacteriol (1996) 178: Alekshun MN and Levy SB: Regulation of chromosomally medi ated multiple antibiotic resistance: the mar regulon. Antimicrob Agents Chemother (1997) 41: Robicsek A, Jacoby GA and Hooper DC: The worldwide emer gence of plasmid mediated quinolone resistance. Lancet Infect Dis (2006) 6: Yamane K, Wachino J, Suzuki S, Kimura K, Shibata N, Kato H, Shibayama K, Konda T and Arakawa Y: New plasmid mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob Agents Chemother (2007) 51: Wang A, Yang Y, Lu Q, Wang Y, Chen Y, Deng L, Ding H, Deng Q, Zhang H, Wang C, Liu L, Xu X, Wang L and Shen X: Presence of qnr gene in Escherichia coli and Klebsiella pneu moniae insusceptible to ciprofloxacin isolated from pediatric patients in China. BMC Infect Dis (2008) 8: Onodera Y, Okuda J, Tanaka M and Sato K: Inhibitory activities of quinolones against DNA gyrase and topoisomerase IV of Enterococcus faecalis. Antimicrob Agents Chemother (2002) 46: Nakashima M, Uematsu T, Kosuge K, Umemura K, Hakusui H and Tanaka M: Pharmacokinetics and tolerance of DU 6859a, a new fluoroquinolone, after single and multiple oral doses in healthy volunteers. Antimicrob Agents Chemother (1995) 39: Kumon H: Management of biofilm infection in the urinary tract. World J Surg (2000) 24:

A retrospective analysis of urine culture results issued by the microbiology department, Teaching Hospital, Karapitiya

A retrospective analysis of urine culture results issued by the microbiology department, Teaching Hospital, Karapitiya LU Edirisinghe 1, D Vidanagama 2 1 Senior Registrar in Medicine, 2 Consultant Microbiologist,