Investigating multidrug efflux pumps in relation to the antibiotic resistance pattern in Escherichia coli strains from patients in Iran.

Transcription

1 Biomdical Rsarch 2016; 27 (4): Invstigating multidrug fflux pumps in rlation to th antibiotic rsistanc pattrn in Eschrichia coli strains from patints in Iran. Farshid Kafilzadh 1*, Farnoosh Farsimadan 2 1 Dpartmnt of Biology, Jahrom Branch, Islamic Azad Univrsity, Jahrom, Iran 2 Dpartmnt of Biology, Kazroon Branch, Islamic Azad Univrsity, Kazroon, Iran ISSN X Abstract Objctiv: To invstigat antibiotic rsistanc pattrn of Eschrichia coli strains isolatd from patints admittd to th Shahid Mostafa Khomini hospital in Bhbahan city and survy its rlationship with th prsnc of fflux pumps. Mthods: In this study, 180 isolats of E. coli wr collctd from Shahid Mostafa Khomini hospital. Aftr confirmation of strains by standard culturing mthods and biochmical tsts, thir antibiotic rsistanc was valuatd with agar diffusion tst and CLSI standards guidlins. Th gns ncoding th AcrA-AcrB-TolC fflux pump wr idntifid with PCR. Rsults: Th prcntags of rsistanc of th E. coli isolats to som antibiotics wr as follow: novobiocin and rifampin, 68.9%; rythromycin, 52.8%; ttracyclin, 52.2% and nalidixic acid, 51.7%. Isolats wr snsitiv to amikacin, 89.4%; tobramycin, 85.6%; mropnm, 81.7%; chloramphnicol, 77.8% and pipracillin, 65.6%, rspctivly. 110 (61.1%) strains from 180 takn isolats wr found with multidrug- rsistanc (MDR) but no pandrug-rsistanc (PDR) was obsrvd. 51.1%, 75.0% and 69.4% of isolats had gns acra, acrb and tolc, rspctivly. Comparison of th rsults of antibiogram obtaind from PCR with th two-way corrlation tst showd that thr is a significant positiv corrlation btwn th prsnc of fflux pumps and rsistanc to antibiotics (xcluding carbnicillin, mropnm, chloramphnicol, cfotaxim, rifampin and novobiocin). Conclusion: Du to diffrncs in antibiotic rsistanc in diffrnt strains is rquird using antibiotic rsistanc pattrn for xprimntal and spcific tratmnt of patints. Kywords: Multi-drug rsistanc, E. coli, Antibiotic rsistanc, Efflux pumps, Bhbahan. Accptd on March 31, 2016 Introduction Significant incrass in prvalnc of rsistanc to antibiotics in diffrnt populations of humans and animals pathogns ar among of th most srious global public halth thrats. Ovrus of antibiotics is th most frqunt caus of antibiotic rsistanc in pathognic bactria. Th mrgnc of rsistant organisms to antibiotic tratmnt is a global problm in socitis and hospitals. Nowadays trnd of rspons to th standard thrapy of hospital infctions has changd and th prvalnc of antibiotic rsistanc in many hospitals rachd dangrous lvls. According to studis, about 50 to 60 prcnt of hospital infctions ar causd by antimicrobial-rsistant strains [1,2]. Antibiotics ar usd in mdicin to prvnt, trat or rducing th incidnc of infctious disass in farm animals and human populations. Eschrichia coli strains ar th main caus of svral common bactrial infctions. This bactrium is rod-shapd, Gram-ngativ and facultativ anarob that frquntly in larg numbrs ar th normal floras of humans gut. E. coli known as an opportunistic pathogn in patints with immun systm disordr, which can caus srious infctions in ths patints. This bactrium is agnt of urinary tract infction (UTI), rspiratory tract infctions mningitis, spticmia and gastrontritis. Most E. coli infctions xcpt nonatal mningitis and gastrontritis ar ndognous [3,4]. Today, drug rsistanc spcially among hospital patints has bcom th major clinical significanc of E.coli. In addition E. coli is intrinsically rsistant to particular antibiotics; this bactrium asily bcoms drug rsistant during tratmnt and this aris difficultis in th tratmnt of patints [5]. Nowadays th activ fflux pumps hav bn considrd as on of th most important intrinsic and acquird antibiotics rsistanc mchanisms in bactria. Efflux pump not only incrass th Minimum Inhibitory Concntration (MIC) against antibiotics but also crats mutant strains of antibiotics rsistant bactria with dcras in drug concntration insid th microbial clls. E. coli has bn found to possss a varity of inducibl tripartit drug fflux complxs such as AcrAB-TolC [6,7]. Nikaido and Zgurskaya dmonstratd that th AcrB systm of E. coli is a RND family multidrug fflux systm that pumps out many amphiphilic and lipophilic inhibitors through th TolC outr mmbran channl. AcrA, an longatd protin, Biomd Rs- India 2016 Volum 27 Issu

2 Kafilzadh/Farsimadan brings both th innr and th outr mmbran closr togthr. This protin acts as a trimmr and is in contrast to AcrB [8]. Antimicrobial rsistanc in E. coli hav bn rportd around th world [9-11] and th incrasing rat of rsistanc in this bactria has stablishd a lot of concrn in dvlopd and dvloping countris and thrfor in ordr to avoid tratmnt failur and infction control antibiogram analysis should b prformd bfor prscription of antibiotics to prvnt th indiscriminat us. Givn th lack of knowldg about th infction prvalnc and antibiotic suscptibility pattrns of E. coli in th Bhbahan city, this study was carrid out to dtrmin th prvalnc of infctions and antibiotic suscptibility pattrns of E. coli in Shahid Mostafa Khomini Hospital and dsignat th rlationship btwn prsnc of fflux pumps in E. coli and rsistanc to antibiotics and it is hopd that th rsults can b usd in propr choic of ffctiv and appropriat antibiotics for typical patints with infctions. Matrials and Mthods Sampls collction In this study, a larg numbr of diffrnt sampls (wound, urin, blood) that was probably contaminatd with E. coli wr collctd from admittd patints to Shahid Mostafa Khomini Hospital, in Bhbahan city within four months from Fbruary untill May, Th writtn consnt and authorization of th rsarch thics committ ( ) and writtn informd consnt of th patints wr obtaind in a qustionnair and thn taking th sampls was prformd. Obtaind sampls wr transportd to th laboratory in th shortst possibl tim and bactrial cultur was don. Finally, 180 sampls wr found contaminatd with E.coli. Idntification of isolats Th isolats wr idntifid by Gram staining and biochmical tsts including oxidas, catalas, Simmons citrat agar, tripl sugar iron (TSI) agar, Phnylalanin Daminas (PD), blood agar, Eosin Mthyln Blu (EMB) agar, MacConky agar, Oxidation Frmntation (OF), Sulfid Indol Motility (SIM) mdium and Mthyl Rd-Vogs-Proskaur (MR-VP) broth (all chmicals wr purchasd from Mrck, Grmany). Antibiogram tsts To dtrmin th snsitivity of th isolatd E. coli bactria against antibiotics, antibiotic rsistanc pattrns of clinical sampls of patints with hospital acquird infction wr dtrmind by disc diffusion mthod, according to CLSI standards. For this purpos, singl colonis of microbial isolats from a 24 h cultur wr transfrrd to physiological srum with stril inoculating loop. Aftr vortx mixing, turbidity of th solutions was compard visually with 0.5 McFarland turbidity. With raching this turbidity lvl, sampls wr sprad on th surfac of Mullr-Hinton agar with sprad plat mthod by stril swabs. Aftr a fw minuts, disks wr placd at an appropriat distanc and finally th plats wr incubatd at 37 C. Th rsults wr obtaind by masuring th diamtr of th zons of inhibition and comparing with th last availabl tabls aftr 18 hours. Usd antibiotics in this study, wr includ: cfuroxim (30 µg), amikacin (30 µg), tobramycin (10 µg), rifampin (5 µg), nalidixic acid (30 µg), ciprofloxacin (5 µg), carbnicillin (100 µg), cftazidim (30 µg), ticarcillin (75 µg), cfotaxim (30 µg), pipracillin (100 µg), cfpim (30 µg), rythromycin (15 µg), ttracyclin (30 µg), chloramphnicol (30 µg), cloxacillin (1 µg), norfloxacin (10 µg) and mropnm (10 µg). All antibiotics wr prpard from Patan-Tb Company, Iran. In this study, th rfrnc strain E. coli (ATCC 25922) was usd as a positiv control to confirm th rsults of antibiotic suscptibility tsting. PCR tst Th prsnc of fflux pump gns in isolatd sampls was invstigatd using Polymras Chain Raction (PCR) assay. In th first stp, boiling mthods was usd to xtract gnomic DNA. Prolifration of acrab and tolc gns in isolatd E. coli was prformd with thr sparat primr pairs (Tabl 1). Tabl 1. Th primrs usd for PCR. acra acrb tolc F R F R F R 5 - CTCTCAGGCAGCTTAGCCCTAA 5 -TGCAGAGGTTCAGTTTTGACTGTT 5 - GGTCGATTCCGTTCTCCGTTA 5 - CTACCTGGAAGTAAACGTCATTGGT 5 - AAGCCGAAAAACGCAACCT 5 - CAGAGTCGGTAAGTGACCATC Extractd DNA containing acrab gns from bactrium (ATCC 25922) wr usd as a positiv control in PCR assay. PCR conditions wr as follows: 1 μl (10 mm) dntps mix, 1.5 μl (50 mm) MgCl 2 solution, 5 μl DNA and 2.5 units of Taq DNA Polymras (matrials wr purchasd from CinnaGn Company, Iran), 20 pmol of ach forward and rvrs primrs in a final volum of 50 μl. Prolifration of targt gn was conductd with hot-start at 94 C for 5 minuts, thn 35 cycls of 94 C for 30 s, 56 C for 30 s, 72 C for 1 min and 72 C for 5 min. PCR products wr finally analyzd by lctrophorsis on 1% agaros gl [12,13]. In th nd, th rlationships btwn variabls wr analyzd with chi-squar tst at significanc lvl of 5%. All analyzs wr don with SPSS vrsion 18 (IBM SPSS Statistics). Rsults In this study a total of 180 sampls of urin, blood and wounds contaminatd with th E.coli wr collctd from patints admittd to th Shahid Mostafa Khomini Hospital in Bhbahan city. Isolatd E.coli wr vrifid with pink colonis on MacConky agar and dark blu-black colonis with mtallic grn shn on EMB agar and biochmical vrification tsts. In this study th prsnc of fflux pump gns wr invstigatd 1131 Biomd Rs- India 2016 Volum 27 Issu 4

3 Invstigating multidrug fflux pumps in rlation to th antibiotic rsistanc pattrn in Eschrichia coli strains from patints in Iran using thr sparat primr pairs. Rsults ar shown in Tabl 2 and Figurs 1-3. Tabl 2. Rsults of prsnc of acra, acrb and tolc gns in E. coli isolats. Gn typ absolut Gn prsnc Positiv Ngativ Total Rlativ prcntag absolut Rlativ prcntag absolut acra acrb tolc Total Rlativ prcntag 17 with primrs of acra gn. 1,12-50 bp DNA laddr. 2- Sampl 5 with primrs of acrb gn (positiv). 3- Standard rfrnc strain of E. coli with primrs of acrb gn. 4, 5- Sampls with No. 169 and 102 with primrs of acrb (ngativ). 6- Sampl 32 (ngativ and snsitiv to all usd antibiotics). 7, 8, 9, 10 and 11- Sampls with No. 2, 8, 171, 134 and 26 with primrs of acrb gn (positiv). Figur 3. Rsults of th prsnc of tolc gn of E.coli isolats. Figur 1. Rsults of th prsnc of acra gn of E.coli isolats. Figur 2. Rsults of th prsnc of acrb gn of E.coli isolats bp DNA laddr. 2- Sampls with No. 47 and 148 with primrs of acra gn (positiv). 3- Sampl 32 with primrs of acra gn (ngativ and snsitiv to all usd antibiotics). 4,5- Standard rfrnc strain of E. coli with primrs of acra gn. 6,7 and 8- Sampls with No. 71, 63 and 54 with primrs of acra gn (ngativ). 9, 10- Sampls with No. 80 and 112 with primrs of acra gn. 11- Sampl 98 with primrs of acra gn (ngativ). 12, 13 and 14- Sampls with No. 112, 49 and 1-50 bp DNA laddr. 2,3- Sampls with No. 9 and 148 with primrs of tolc gn (ngativ). 4-Standard rfrnc strain of E. coli with primrs of tolc gn. 5, 6- Sampls with No. 134 and 177 with primrs of tolc gn (positiv). 7- Sampl 32 with primrs of tolc gn (ngativ and snsitiv to all usd antibiotics). 8, 9, 10, 11 and 12- Sampls with No. 31, 4, 121, 101 and 100 with primrs of tolc gn (positiv). In th following, th rsults of antibiotic suscptibility tst showd that th highst snsitivity against amikacin (89.4%), tobramycin (85.6%), mropnm (81.7%), chloramphnicol (77.8%), pipracillin (65.6%), cfpim (66.1%), norfloxacin (63.3%), ciprofloxacin (59.4%) ticarcillin (57.8%), carbnicillin (52.8%), cftazidim (54.4%), cfotaxim (52.2%), ticarcillin and nalidixic acid (46.7%), cfuroxim (36.1%), rythromycin (35.6%), novobiocin and rifampin (31.1%). Th highst rsistanc wr obsrvd against novobiocin and rifampin (68.9 %), rythromycin (52.8%), ttracyclin (52.2%), nalidixic acid (51.7%), cfuroxim (47.8%), carbnicillin (42.8%), cfotaxim (42.2%), ticarcillin (40.6%), cftazidim (38.9%), norfloxacin (32.2%), ciprofloxacin (31.1%), cfpim (30.6%), pipracillin (17.2%), chloramphnicol (14.4%), mropnm (12.2%), tobramycin (10.6%) and amikacin (8.7%), rspctivly (Tabl 3). 110 (61.1 %) of isolats wr simultanously rsistant to at last thr diffrnt antibiotics and 70 (38.9%) of thm wr rsistant to lss than two antibiotics. According to th rsults no sampls wr rsistant to all antibiotics. Th rsults of antibiogram tsts and prsnc of acra gn invstigation showd that th highst antibiotic rsistancs among th strains with th acra gn wr against pipracillin and rifampin (64.1%), novobiocin (63.0%), ttracyclin (48.9%), nalidixic acid and rythromycin (46.7%), cfuroxim (42.4%), carbnicillin (40.2%), cfotaxim (39.1%), cftazidim Biomd Rs- India 2016 Volum 27 Issu

4 Kafilzadh/Farsimadan (38.4%), ticarcillin (35.9%), norfloxacin (31.5%), Ciprofloxacin (30.4%), Cfpim (29.3%), tobramycin (12.0%), chloramphnicol (13.0%), mropnm (7.3%) and amikacin (6.5%) rspctivly. Tabl 3. Rsults of antibiogram tsts and th isolats rsistanc. Antibiotic Rsistant (R) Snsitiv (S) Rlativ snsitivity (I) Ticarcillin(tic) 73 (40.6%) 104 (57.8%) 3 (1.7%) Pipracillin (pip) 31 (17.2%) 118 (65.6%) 31 (17.2%) Carbnicillin (cb) 77 (42.8%) 95 (52.8%) 8 (4.4%) Mropnm (m) 22 (12.2%) 147 (81.8%) 11 (6.1%) Ttracyclin (t) 94 (52.2%) 84 (46.7%) 2 (1.1%) Erythromycin() 95 (52.8%) 64 (35.6%) 21 (11.7%) Chloramphnicol (c) 26 (14.4%) 140 (77.8%) 14 (7.8%) Amikacin (am) 14 (7.8%) 161 (89.4%) 5 (2.8%) Tobramycin (tob) 19 (10.6%) 154 (85.6%) 7 (0.6%) Novobiocin (nb) 123 (68.3%) 56 (31.1%) 1 (1.7%) Nalidixic acid (na) 93 (51.7%) 84 (46.7%) 3 (1.7%) Rifampin (ra) 124 (68.9%) 56 (31.1%) 0 (0.0%) Cftazidim (caz) 70 (38.9%) 98 (54.4%) 12 (6.7%) Cfotaxim (ctx) 76 (42.2%) 94 (52.2%) 10 (5.6%) Cfpim (fp) 55 (30.6%) 119 (66.1%) 6 (3.3%) Cfuroxim (xm) 86 (47.8%) 65 (36.1%) 29 (16.1%) Ciprofloxacin (cp) 56 (31.1%) 107 (59.4%) 17 (9.4%) Norfloxacin (nor) 58 (32.2%) 114 (63.3%) 8 (4.4%) Likwis ths rsults indicatd that among th strains with th acrb gn th highst antibiotic rsistanc wr against novobiocin and rifampin (66.6%), ttracyclin (52.6%), nalidixic acid and rythromycin (51.9%), cfuroxim (43.0%), carbnicillin (41.5%), cfotaxim (40.7 %), ticarcillin and cftazidim (37.8%), norfloxacin (33.3%), cfpim (31.1%), ciprofloxacin (30.4%), chloramphnicol (15.6%), pipracillin (14.8%), mropnm (13.3 %), tobramycin (12.6%) and amikacin (9/6%). According to th rsults of antibiogram tsts and prsnc of tolc gn, th isolats with th tolc gn had th most antibiotic rsistancs to rifampin (69.6%), novobiocin (68.8%), ttracyclin (54.4%), rythromycin (53.6%), nalidixic acid (52.0%), cfuroxim (47.2%), cfotaxim (40.8%), carbnicillin (40.0%), cfotaxim (39.2%), ticarcillin (38.4%), norfloxacin (32.8%), ciprofloxacin (31.2%), cfpim (30.4%), chloramphnicol (16.0%), pipracillin (15.5%), mropnm (14.4%), tobramycin (10.4%) and amikacin (7.2%). Comparison of antibiogram tsts rsults with On-way and two-way ANOVA tsts to assss th significanc of th rlationship btwn antibiotic rsistanc and th prsnc of fflux pump gns rvald that thr was a significant corrlation (p<0.05) btwn th prsnc of acra gn and rsistanc to antibiotics (xcpt carbnicillin and mropnm). Thr was a significant corrlation btwn th acrb gn and rsistanc to all antibiotics xcpt carbnicillin (p<0.05). Morovr thr was a significant corrlation btwn th tolc gn and rsistanc to all antibiotics xcpt chloramphnicol and cfotaxim (p<0.05). Th rsults indicat isolats had th most rsistanc to rifampin and novobiocin. Ths antibiotics ar transfrrd by th othr path apart from fflux pump, so this pump is inffctiv in promoting thir rsistanc. Th rsults indicat thr was a significant corrlation (p<0.05) btwn th prsnc of fflux pump and rsistanc to usd antibiotics but thr wr no corrlation btwn th prsnc of this pump and carbnicillin, mropnm, chloramphnicol and ramphnicol, cfotaxim, rifampin and novobiocin (p>0.05). Discussion Antibiotic rsistanc in E. coli has bn rportd worldwid and incrass in rsistanc rats in this bactrium hav raisd concrns in both dvloping and dvlopd countris. Thrfor in ordr to avoid tratmnt failur and control th infctions antibiogram tsting should b prformd prior to prscribing antibiotics and th indiscriminat us of antibiotics should b avoidd. According to rsults of antibiotic rsistanc pattrn in this study, it was found that amikacin (89.4%), tobramycin (85.6%), mropnm (81.7%), chloramphnicol (77.8%) and in th nxt lvls pipracillin (65.6%), cfpim (66.1%), norfloxacin (63.3%) rmain ffctiv at trating E coli. High rsistanc of Gram-ngativ bactria to most xamind antibiotics in this study was compatibl with th findings of th prvious study and it can b considrd as a warning alarm for incras in commonly prscribd antibiotics rsistanc in clinical practic. Various studis in diffrnt parts of Iran indicat high rsistanc against diffrnt antibiotics in E. coli isolatd from patints. Farshad t al. invstigatd antibiotic rsistanc pattrn in E. coli isolatd from urinary tract infctions and found that th rsistanc of sampls to ttracyclin, gntamicin, ciprofloxacin and amikacin wr 70.8 %, 15.6 %, 8.3% and 3.0% rspctivly [14]. In th currnt study, multidrug -rsistanc (MDR) was obsrvd in mor than 80 prcnt of sampls. MDR dfin as rsistanc to at last on antibiotic out of thr or mor antimicrobial catgoris usd for tratmnt [15]. Widsprad misus of various antibiotics imposs dirct prssur on th mrgnc of rsistant strains. Svral studis hav documntd prsnc of MDR E. coli. Anvarinjad t al. prformd a study on 90 E. coli strains isolatd from th childrn agd from 1 month to 14 yars with urinary tract infction. Rsults showd 77% of th isolats wr rsistant to thr or mor antibiotics. Th prdominant pattrn among ths strains (14.4%) includd rsistanc to ampicillin, cotrimoxazol and ttracyclin which rpatd among 13 strains [16]. Wagnr t al. charactrizd MDR E. coli isolats from urinary tract infctions in dogs [17]. Rzwuska t al. dtrmind th antimicrobial suscptibility of E. coli isolats associatd with various typs of infctions in dogs and cats Biomd Rs- India 2016 Volum 27 Issu 4

5 Invstigating multidrug fflux pumps in rlation to th antibiotic rsistanc pattrn in Eschrichia coli strains from patints in Iran According to thir rsults th frquncy of MDR E. coli isolation (66.8% of isolats) is alarming [18]. Ths rsults similar to rsults of th prsnt study show MDR E. coli ar bcoming a global public halth concrn. Ths findings rais a warning about th incrasd prvalnc of antibiotic rsistanc. Dsign of nw drugs rquirs bttr idntification and undrstanding th intrinsic mchanisms of rsistanc such as fflux pumps. Thrfor in this study gns acra, acrb and tolc wr slctd for invstigation bcaus of thir importanc in th incidnc of antibiotic-rsistanc. In this study, 51.1%, 75.0% and 69.4% of isolats had gns acra, acrb and tolc rspctivly. In a study conductd by Swick t al. thy masurd acra, acrb, tolc, mdfa, and nore xprssion in E. coli clinical isolats by using ral-tim PCR. Thir findings suggst acrab ovrxprssion is an indicator of multidrug rsistanc [19]. Tikhonova and Zgurskaya analyzd intractions btwn th innr and outr mmbran componnts of th tri-partit multidrug fflux pump AcrAB- TolC from E. coli. Rsults showd that antibiotics, th substrats of AcrAB-TolC, stabiliz intractions within th complx [20]. Thr was a significant corrlation btwn th prsnc of fflux pumps and rsistanc to usd antibiotics in this study (xcpt carbnicillin, mropnm, chloramphnicol, cfotaxim, rifampin and novobiocin). Among th usd antibiotics in this rsarch, rsistanc to mropnm, and chloramphnicol was minimum (with 12.2% and 14.4% rsistanc) that mayb bcaus fflux pumps hav no rol in th dvlopmnt of rsistanc to ths antibiotics. Strains had th mid-rsistanc to carbnicillin and cfotaxim (42.8% and 42.2% rsistanc rspctivly). According to th rsults which indicat disaffiliation btwn th prsnc of rsistanc to this antibiotic and fflux pump, it can b concludd that this amount of rsistanc to ths antibiotics is du to othr ways of rsistanc dvlopmnt. During comparing th rsults of diffrnt prcntag of antibiogram tst with similar xprimnts, it should b notd that rgional diffrncs in diffrnt parts of th world, or vn a country, provids diffrnt thraputic rspons to antimicrobial drugs. Th origin of ths diffrncs can b attributd to gntic variation btwn humans or strains in various rgions. So rgular and continuing studis should b conductd worldwid. According to th obtaind rsults, it can b conclud that svral factors such as frqunt and irrational us of antibiotics, nzymatic mutations as wll as transfr rsistanc through plasmids dcrasd ffctivnss of antibiotics in trating common infctions. Th rsults suggsting that incrasing rat of rsistanc to antibiotics hav bcom a major challng for trating patints and widsprad occurrnc of highly rsistant E. coli in dvloping countris, including Iran, in rcnt yars, has bcom a major concrn for public halth and human socitis. Rfrncs 1. Odonkor ST, Addo KK. Bactria rsistanc to antibiotics: rcnt trnds and challngs. Int J Biol Md Rs 2011; 2: Hulschr ME, Grol RP, van dr Mr JW. Antibiotic prscribing in hospitals: a social and bhavioural scintific approach. Lanct Infct Dis 2010; 10: Schippa S, Cont MP. Dysbiotic vnts in gut microbiota: impact on human halth. Nutrints 2014; 6: Chow J, L SM, Shn Y, Khosravi A, Mazmanian SK. Host-bactrial symbiosis in halth and disas. Adv Immunol 2010; 107: Morira MAS, Odrigus PCF, Tomaz RS, Moras CA. Multidrug fflux systms in Eschrchia coli and ntrobactr cloaca obtaind from wholsom broilr carcasss. Braz J Microbiol 2009; 40: Rosnr JL, Martin RG. Rduction of cllular Strss by TolC-dpndnt fflux pumps in Eschrichia coli indicatd by BaSR and CpxARP activation of spy in fflux mutants. J Bactriol 2013; 195: Liu JH, Pan YS, Yuan V, Wu H, Hu GZ, Chn YX. Gntic variations in th activ fflux pump gns acra/b and tolc in diffrnt drug-inducd strains of Eschrichia coli CVCC Gnt Mol Rs 2013; 12: Nikaido H, Zgurskaya H. AcrAB and rlatd multidrug fflux pumps of Eschrichia coli. J Mol Microbiol Biotchnol 2001; 3: Borlin P, Travis R, Gyls CL, Smith RR, Lim NJH, Nicholson V, McEwn SA, Frindship R, Archambault M. Antimicrobial rsistanc and virulnc gns of Eschrichia coli isolats from swin in Ontario. Appl Environ Microbiol 2005; 71: Schrodr CM, Zhao C, DbRoy C, Torcolini J, Zhao S, Whit DG, Wagnr DD, McDrmott PF, Walkr RD, Mng J. Antimicrobial rsistanc of Eschrichia coli O157 isolatd from humans, cattl, swin, and food. Appl Environ Microbiol 2002; 68: Tadss DA, Zhao S, Tong E, Ayrs S, Singh A, Bartholomw MJ, McDrmott PF. Antimicrobial drug rsistanc in Eschrichia coli from humans and food animals, Unitd Stats, Emrg Infct Dis 2012; 18: Hojati Z, Salhi Z, Motovali-Bashi M, Korbkandi H, Jami S. Molcular analysis of th clavulanic acid rgulatory gn isolatd from an Iranian strain of Strptomycs clavuligrus, PTCC Cll J 2011; 13: Plichart C, Schan Y, Davis N, Lgrand AM. PCR and dissction as tools to monitor filarial infction of Ads polynsinsis mosquitos in Frnch Polynsia. Filaria J 2006; 5: Farshad S, Ranjbar R, Anvarinjad M, Shahidi M, Hossini M. Emrgnc of multidrug rsistant strains of Eschtichia coli isolatd from urinary tract infction. Opn Conf Proc J 2010; 1: Biomd Rs- India 2016 Volum 27 Issu

6 Kafilzadh/Farsimadan 15. Magiorakos AP, Srinivasan A, Cary RB, Carmli Y, Falagas ME, Gisk CG, Harbarth S, Hindlr JF, Kahlmtr G, Olsson-Liljquist B, Patrson DL, Ric LB, Stlling J, Strulns MJ, Vatopoulos A, Wbr JT, Monnt DL. Multidrug-rsistant, xtnsivly drug-rsistant and pandrug-rsistant bactria: an intrnational xprt proposal for intrim standard dfinitions for acquird rsistanc. Clin Microbiol Infct 2012; 18: Anvarinjad M, Farshad Sh, Emamghorishi F, Hosini M. Invstigating th frquncy of multi-drug rsistant strains of Eschrichia coli isolatd from urinary tract infction in childrn. Pars Journal of Mdical Scincs 2012; 9: Wagnr S, Gally DL, Argyl SA. Multidrug-rsistant Eschrichia coli from canin urinary tract infctions tnd to hav commnsal phylotyps, lowr prvalnc of virulnc dtrminants and ampc-rplicons. Vt Microbiol 2014; 169: Rzwuska M, Czopowicz M, Kizrwttr-Swida M, Chrobak D, Błaszczak B, Bink M. Multidrug rsistanc in Eschrichia coli strains isolatd from infctions in dogs and cats in Poland ( ). SCI World J 2015; 2015: Swick MC, Morgan-Linnll SK, Carlson KM, Zchidrich L. Exprssion of multidrug fflux pump gns acrab-tolc, mdfa, and nore in Eschrichia coli clinical isolats as a function of fluoroquinolon and multidrug rsistanc. Antimicrob Agnts Chmothr 2011; 55: Tikhonova EB1, Zgurskaya HI. AcrA, AcrB, and TolC of Eschrichia coli form a stabl intrmmbran multidrug fflux complx. J Biol Chm 2004; 279: * Corrspondnc to: Farshid Kafilzadh Dpartmnt of Biology Jahrom Branch Islamic Azad Univrsity Jahrom, Iran 1135 Biomd Rs- India 2016 Volum 27 Issu 4