STUDIES ON MOLECULAR AND SEROLOGICAL ASSAYS FOR DIAGNOSIS OF BOVINE BRUCELLOSIS

Transcription

1 STUDIES ON MOLECULAR AND SEROLOGICAL ASSAYS FOR DIAGNOSIS OF BOVINE BRUCELLOSIS Dissertation Submitted to the Guru Angad Dev Veterinary and Animal Sciences University in partial fulfillment of the requirement for the degree of DOCTOR OF PHILOSOPHY in VETERINARY MICROBIOLOGY (Minor Subject: Animal Biotechnology) By Paviter Kaur (L-2011-V-17-D) Department of Veterinary Microbiology College of Veterinary Science GURU ANGAD DEV VETERINARY AND ANIMAL SCIENCES UNIVERSITY LUDHIANA

2 CERTIFICATE I This is to certify that the dissertation entitled, Studies on molecular and serological assays for diagnosis of bovine brucellosis submitted for the degree of Ph.D. in the subject of Veterinary Microbiology (Minor Subject: Animal Biotechnology) of the Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, is a bonafide research work carried out by Paviter Kaur (L-2011-V-17-D) under my supervision and that no part of this dissertation has been submitted for any other degree. The assistance and help received during the course of investigation have been fully acknowledged. Major Advisor (Dr. N.S. Sharma ) Senior Scientist-cum-Head Deptt. of Veterinary Microbiology Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana (Punjab)

3 CERTIFICATE II This is to certify that the dissertation entitled, Studies on Molecular and Serological Assays for Diagnosis of Bovine Brucellosis submitted by Paviter Kaur (L-2011-V-17-D), to the Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, in partial fulfillment of the requirements for the degree of Ph.D. in the subject of Veterinary Microbiology (Minor Subject: Animal Biotechnology) has been approved by the Student s Advisory Committee after an oral examination on the same, in collaboration with an external examiner. (Dr. N.S. Sharma) Major Advisor (Dr. Puran Chand) External Examiner Professor Emeritus Veterinary Microbiology, College Central Laboratory, College of Veterinary Sciences, LLRUVAS, Hisar Head of the Department (Dr. Simrat Sagar Singh) Dean, Postgraduate Studies

4 ACKNOWLEDGEMENT Foremost of all with great humility, I express my sincere indebtedness to The Almighty who blessed me with the wisdom, health and strength to complete this stupendous job and clear another chapter of my life successfully. At the bliss of this moment, words are not enough to express my deepest sense of gratitude and heartfelt regards for my major advisor Dr. N S Sharma, Professor, Department of Veterinary Microbiology for his sagacious guidance, ceaseless encouragement, constant moral support and a sense of forgiveness throughout my association with him. His meticulous supervision and kind advice helped me throughout my research and thesis writing. It was my proud privilege and honour to work and study under his guidance. A special word of thanks is due to Dr. A K Arora, Professor, Department of Veterinary Microbiology for letting me encroach upon his time and experiences freely in the form of technical help, meticulous suggestions, constructive criticism and immense scientific knowledge that helped me throughout the pursuance of this study. I express my deep sense of gratitude and sincere thanks to members of my advisory committee, Dr. P N Dwivedi (Nominee, Dean PGS) and Professor, Department of Veterinary Microbiology, Dr. T S Rai, Professor, Department of Veterinary Microbiology, Dr. Ramneek, Director, School of Animal Biotechnology for their moral support, cooperative attitude and ever willing help. Special thanks to Dr. (Mrs.) Deepti Narang, Scientist, Department of Veterinary Microbiology for the technical guidance, worthy suggestions and help rendered during this study. I wish to extend my thanks and venerations to the faculty members of my department Dr. H M Saxena, Professor and Dr. Mudit Chandra, Assistant Scientist for their help and support. The help rendered by my fellow colleague Dr. Gurpreet Kaur is acknowledged. I seize the opportunity to express my thanks to Dr. Deepak deka, Dr. Sunil, Dr. Pathak, Dr. Sikhtejinder, Dr. Ranjana Cheema, Dr. Shashi Nayyar and Dr. Jagdeep Khera for their cooperation and help during the course of this investigation. I am especially thankful to Dr. S K Jand, Principal, Khalsa Veterinary College, Amritsar for imbibing positive and noble thoughts especially of hard work in me that inspired me at every step leading to fruitification of my endeavours. I thank Dr. Rajnish Rana, Principal Scientist, Division of Bacteriology and Mycology, IVRI, Izatnagar, for providing DNA of Mycoplasma during my research work. My family is the greatest asset. I am thankful to my husband Dr. Tripatdeep Singh for his support. Words fail me while expressing my deepest love and gratitude for my son Mokshdeep Singh for the sacrifice, patience and perseverance shown by him at the time of his utmost need. Although he felt my emotional absence he never complained about it. I think I would have never made it to this point if it had not been for the blessings, unflagging love, selfless contributions, ceaseless inspiration, prayers and support shown by my parents. I am really thankful to my mother for shouldering my responsibility and for the pains taken in taking care of my kid. The true affection of my brother and bhabhi and their sons Nawaabjit Singh and Amitoz Singh who

5 always cared for my happiness and geared me up constantly during moments of despair can never be forgotten. A warm gratitude to PG students and Research fellows Dibyajyoti Hazarika, Yogeshwar Singh, Yanglem Pushpa, Mehul, Rajan, Binny and Sandeep for creating a healthy atmosphere during the work hours. Mere words will never match the quantum of love, affection and moral support that I received from my friends and fellow colleagues Dr. Gursimran Filia, Dr. Sabia Qureshi, Dr. Daljit, Dr. Paramjit, Dr. Kiranjit, Saloni, Raman and Ravneet who cheered me in the moments of despair and made things much smoother. Help rendered by the laboratory and non teaching staff is gratefully acknowledged. Special thanks are due to Mr. Gurdeep Singh (Alps) for making this manuscript presentable. I owe my heartfelt thanks to all those who supported this work directly or indirectly and helped me in making this dissertation possible. All may not be mentioned but none is forgotten. Needless to say, errors and omissions if any are mine. Ludhiana Dated: (Paviter Kaur)

6 Title of Dissertation : Studies on molecular and serological assays for diagnosis of bovine brucellosis Name of the Student : Paviter Kaur Admission No. : L-2011-V-17-D Major Subject : Veterinary Microbiology Minor Subject : Animal Biotechnology Name and Designation of the Major Advisor : Dr. N.S. Sharma Senior Scientist-cum-Head Degree to be Awarded : Ph.D. Year of award of Degree : 2015 Total pages in Thesis : VITA Name of University : Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana. ABSTRACT The present study was carried out for serological and molecular diagnosis of bovine brucellosis. A total of four isolates of B. abortus obtained from 100 clinical samples were characterized biochemically and by molecular assays. The isolates were confirmed as Brucella spp. by PCR using B4/B5 primer pair and as B. abortus by Bruce Ladder multiplex PCR. Amplicon size of 223 bp was obtained in all the four isolates by PCR using B4/B5 primer pairs. An amplified product size of 1682 bp, 794 bp, 587 bp, 450 bp and 152 bp was obtained by Bruce Ladder PCR for B. abortus. By Hinic Real-time PCR, all the four isolates were confirmed as Brucella spp. with C t values between On DNA extracted directly from 40 clinical samples of foetal stomach contents, vaginal mucus and uterine discharges, two samples were positive by PCR using B4/B5 primer pair and three samples were positive by Real-time PCR. Multiplex PCR was standardized for simultaneous detection of Brucella spp., Mycoplasma spp., Listeria spp. and Leptospira spp. Amplification bands of 331 bp for Leptospira spp., 270 bp for Mycoplasma spp, 456 bp for Listeria spp. and 223 bp for Brucella spp. were obtained. FPA was standardized for detection of Brucella specific antibodies in serum samples and a cut off value of 25mP gave maximum discrimination between positive and negative samples. In vaccinated animals (n=265), the sensitivity and specificity values of FPA, RBPT, I-ELISA and C- ELISA with respect to MAT were 54.55% and 99.18%; 72.73% and 97.94%; 77.27% and 92.18%; 50.00% and 99.18% respectively and of FPA with respect to C-ELISA were 100% and 99.60% respectively. In animals with unknown history of vaccination (n=273), the sensitivity and specificity values of FPA, RBPT, I-ELISA and C-ELISA with respect to MAT were 91.26% and 92.35%; 87.38% and 93.53%; 93.20% and 91.76%; 82.52% and 93.53% respectively. The sensitivity and specificity values of FPA, RBPT, I-ELISA and C-ELISA with respect to MAT in total cattle and buffaloes (n=538) were 84.80% and 96.38%; 84.8% and 96.13%; 90.40% and 92.01%; 76.80% and 96.86% respectively. Since no single test was able to detect all the positive samples, so a combination of serological and molecular tests for diagnosis of brucellosis is advisable. PNA-FISH was standardized for rapid detection of Brucella spp. directly from culture suspensions. Keywords: Brucella, cattle, buffaloes, foetal stomach contents, vaginal mucus, uterine discharge Signature of Major Advisor Signature of the Student

7 CONTENTS CHAPTER TOPIC PAGE NO. I INTRODUCTION 1 4 II REVIEW OF LITERATURE 5 41 III MATERIALS AND METHODS IV RESULTS AND DISCUSSION V SUMMARY AND CONCLUSIONS REFERENCES VITA

8 LIST OF TABLES S. No Title Page no 1 Isolation and identification of B. abortus 43 2 Sequence of primers used for detection of genus Brucella 48 3 Brucella PCR reaction mixture for B4/B5 primer pair 48 4 Brucella PCR program by using B4/B5 primer pair 49 5 Multiplex PCR (Bruce ladder) primer sequence 51 6 Multiplex PCR (Bruce ladder) reaction mixture 52 7 Multiplex PCR (Bruce ladder) program 52 8 Hinic Real-time PCR primer and probe sequence 54 9 Quantity and concentration of various components used in Realtime PCR based diagnosis of Brucellosis 10 Cycling conditions used in diagnosis of brucellosis by Real-time PCR using Taqman chemistry 11 Multiplex PCR primer sequence Brucella PCR reaction mixture PCR cycling conditions for Brucella Mycoplasma PCR reaction mixture PCR cycling conditions for Mycoplasma Listeria PCR reaction mixture PCR cycling conditions for Listeria Leptospira PCR reaction mixture PCR cycling conditions for Leptospira Multiplex PCR reaction mixture Multiplex PCR cycling conditions Sequence of probes used for PNA-FISH assay Isolation of B. abortus from different samples Isolation of B. abortus from cattle and buffaloes (n=100) Biochemical characterization of B. abortus Comparison of conventional serological tests for diagnosis of brucellosis

9 S. No Title Page no 27 Sensitivity and specificity analysis between RBPT, STAT and MAT 28 Comparison of isolation, PCR using B4/B5 primer pair, Bruce Ladder PCR and Hinic Real-time PCR on clinical samples 29 Results of multiplex PCR on clinical samples Detection of Brucella specific antibodies in B. abortus S19 vaccinated animals (n=265) by different serological tests 31 Detection of Brucella specific antibodies in animals (n=273) with unknown history of vaccination by different serological tests 32 Detection of Brucella specific antibodies in total animals (n=538) (vaccinated and in animals with unknown history of vaccination) by different serological tests 33 Sensitivity and specificity analysis between MAT, RBPT, I- ELISA, C-ELISA and FPA in S19 vaccinated animals (n=265) 34 Sensitivity and specificity analysis between C-ELISA and FPA in S19 vaccinated animals (n=265) 35 Sensitivity and specificity analysis between MAT, RBPT, I- ELISA, C-ELISA and FPA in animals with unknown history of vaccination (n=273) 36 Sensitivity and specificity analysis between RBPT, I-ELISA, C- ELISA and FPA in total animals [vaccinated animals + animals with unknown history of vaccination (n=538)]

10 LIST OF FIGURES S. No. Title 1 Gel electrophoresis of PCR amplified fragments from Brucella isolates by using B4/B5 primer pair 2 PCR amplified product of Brucella spp. using B4/B5 primer pair from clinical samples 3 Gel electrophoresis of PCR amplified fragments from Brucella spp. by Bruce Ladder Multiplex PCR assay 4 Real-time PCR on B. abortus isolates 5 Sensitivity evaluation of Real-time PCR 6 Sensitivity evaluation of primer probe for Real-time PCR 7 Amplified Real-time PCR product on 1% agarose gel 8 Specificity evaluation of Real-time PCR 9 Real-time PCR on DNA extracted directly from clinical samples 10 Gel electrophoresis of monoplex PCR amplified fragments from Brucella, Leptospira, Listeria and Mycoplasma 11 Optimisation of MgCl 2 for Multiplex PCR assay 12 Gel electrophoresis of multiplex PCR amplified fragments from Brucella, Leptospira, Listeria and Mycoplasma spp. 13 Specificity evaluation of multiplex PCR assay 14 Sensitivity evaluation of (a) multiplex PCR assay and (b&c) monoplex PCR assays of Brucella, Leptospira, Listeria and Mycoplasma spp. 15 Gel electrophoresis of multiplex PCR amplified fragments from DNA extracted directly from clinical samples 16 Dot-plot of the selected serum samples by using MedCal Software 17 Receiver operator characteristic (ROC) analysis of the selected serum samples 18 C-ELISA for detection of antibodies to B. abortus 19 I-ELISA for detection of antibodies to B. abortus 20 Percentage of positive animals by different serological tests in vaccinated animals (n=265) 21 Percentage of positive animals by different serological tests

11 S. No. Title in animals with unknown history of vaccination (n=273) 22 Percentage of positive animals by different serological tests in total animals (n=538) 23 PNA-FISH using labelled (40X) 24 PNA-FISH using labelled (40X) 25 PNA-FISH using labelled (40X) 26 PNA-FISH using labelled (100X) 27 PNA-FISH : Negative control 28 Specificity evaluation of PNA-FISH assay

12 ABBREVIATIONS USED BPAT : Buffered plate agglutination test C-ELISA : Competitive enzyme linked immunosorbant assay CFT : Complement fixation test DNA : Deoxyribonucleic acid FITC : Fluorescein isothiocyanate FISH : Fluorescence in situ hybridization FPA : Fluorescence polarization assay FSC : Foetal stomach content HF : Holstein Friesian I-ELISA : Indirect enzyme linked immunosorbant assay MAT : Micro agglutination test mpcr : Multiplex Polymerase chain reaction NSS : Normal saline solution OPS : O-polysaccharide PBS : Phosphate buffered saline PCR : Polymerase chain reaction PI : Percent inhibition PNA : Peptide nucleic acid PNA-FISH : Peptide nucleic acid - Fluorescence in situ hybridization RBPT : Rose Bengal plate test RBT : Rose Bengal test ROC : Receiver operator characteristic SAT : Serum agglutination test STAT : Standard tube agglutination test TBE : Tris borate Ethylenediaminetetraacetic acid TSI : Triple sugar iron

13 CHAPTER I INTRODUCTION Bovine brucellosis is an economically important disease with public health significance characterized by abortion and reduced fertility in bovines. The disease is usually caused by Brucella abortus, less frequently by B. melitensis and rarely by B. suis (Corbel and Brinley 1984). Brucella spps. are small, gram negative, non motile, non spore forming coccobacilli arranged singly or in pairs or short chains. Based upon the affinity for their specific natural hosts, the genus Brucella has been divided into six classical Brucella spps., namely B. abortus (cattle and buffaloes), B. melitensis (goats), B. suis (pigs), B. ovis (sheep), B. neotomae (desert wood rats) and B. canis (dogs) (Osterman and Moriyon 2006). B. abortus, B. melitensis and B. suis are highly pathogenic for humans. In addition, based on their preferential hosts viz. cetaceans and pinnipeds, the genus Brucella has recently been expanded to include marine isolates which have been divided into two species, B. ceti and B. pinnipedialis respectively (Foster et al 2007). Bovine brucellosis is widespread globally. Clinically, the disease is characterized by one or more of the following signs; abortion, retained placenta, orchitis, epididymitis and rarely, arthritis, with excretion of the organism in uterine discharges and in milk. Because of its immense economic and public health concerns, the disease needs to be rapidly diagnosed for prompt adoption of control strategies. Various workers have developed a number of biochemical, serological and molecular techniques for disease diagnosis and identification of Brucella. Isolation of the incriminating agent remains the gold standard in diagnosis of brucellosis and is the confirmative test (Godfroid et al 2010). Though it has the advantage of detecting

14 the organisms directly, but this classical method of identification and differentiation of Brucella based on a number of phenotypic traits is time consuming, is associated with a high risk of lab acquired infections, requires level 3 bio-containement facilities and highly skilled technicians for handling the samples (Hinic et al 2008). Also, it has reduced sensitivity in chronic infections and is unsuitable for use in large animal populations. In order to overcome these difficulties, nucleic acid based assays have been explored for the rapid detection. Fluorescence in situ hybridization (FISH) technique has been used to identify specific organism from cultures and it is mainly based upon 16S rrna as a target probe. The probes can be either deoxyribonucleic acid (DNA) oligo probes or Peptide nucleic acid (PNA) probes. PNA is a pseudopeptide that hybridizes to complementary nucleic acid targets obeying the Watson-Crick base pairing rules. Due to uncharged backbone of PNA, these probes have superior hybridization characteristics as compared to traditional DNA probes (Perry O Keefe et al 2001). Other serological test like the Fluorescence polarization assay (FPA) makes use of molecular rotational properties, measuring directly the binding of an antigen with antibody. The principle of the method relies on a fluorescent dye attached to a small antigen (or antibody fragment) that is excited by plane polarized light at the appropriate wave length. FPA is based upon the differences between a small soluble antigen molecule in solution (labelled with a flurochrome) and the antigen molecule complexed with its antibody. The rate of rotation of the antigen molecule is reduced when its molecular size is increased by its binding to antibody (or antigen) (Nielsen et al 1996). Vaccination is an important aspect of the control and eradication programmes for brucellosis and usually B. abortus strain 19 vaccine is used. Various serological 2

15 tests viz. serum agglutination test (SAT), complement fixation test (CFT) and Rose Bengal test (RBT) are there for detection of brucellosis, but none of these tests can distinguish between antibodies generated after vaccination and those due to infection. Competitive enzyme immunoassays are based on selecting a monoclonal antibody with higher affinity for the antigen as compared to vaccinal antibody. So C-ELISA is capable of eliminating problems due to residual antibodies produced in response to vaccination with B. abortus S19 and from cross reacting antibodies but with lower affinity than antibodies arising from infection (Nielsen et al 1995) Molecular diagnosis based on polymerase chain reaction (PCR) has been successfully described for detection of various agents associated with abortion in cattle. A number of genus- or species-specific conventional PCR assays using primers derived from different gene sequences from the Brucella genome, such as 16S rrna, the 16S-23S intergenic spacer region, omp2 and bcsp31 have been established. The introduction of Real-time PCR offers improved sensitivity, specificity and speed of performance as compared to conventional PCR. Real-time PCR assay based on Brucella spp. specific multiple insertion sequence IS711 has been described by Hinic et al (2009) for detection of Brucella spp. For the successful eradication and control of brucellosis, identification of different species of Brucella (B. melitensis, B. abortus, B. suis, B. ovis, B. canis, B. neotomae, B. ceti and B. pinnipedialis) is of great importance. Multiplex PCR assay is a kind of PCR technique where multiple target DNA sequences can be detected in a single reaction (Richtzenhain et al 2002). Therefore, by application of this assay we can easily do molecular typing of all Brucella spp. including the vaccine strains (Goni et al 2008). In addition to brucellosis, a number of other infectious agents like Campylobacter fetus, Chlamydophila abortus, Coxiella burnetti, Listeria 3

16 monocytogenes, Salmonella spp., Mycoplasma and Ureaplasma have been reported to cause abortions in bovines (Kirkbride 1992). Multiplex PCR has the potential for considerable saving of time and effort within the laboratory without compromising test utility. A few of the multiplex PCRs have been developed for detection of Brucella and Leptospira spp. from aborted bovine fetuses (Richtzenhain et al 2002), for detection and differentiation of Brucella, Leptospira and Campylobacter fetus (Tramuta et al 2011), for detection and differentiation of Brucella and Salmonella abortus ovis (Sharifzadeh et al 2008). So, aiming at improvement in the direct diagnosis, there is need to develop a multiplex PCR for the detection of various agents associated with abortions. Keeping in view all the above, the present study was conducted with the following objectives: Objectives 1. To develop Peptide nucleic acid fluorescence in situ hybridization (PNA-FISH) assay for detection of Brucella spp. 2. To standardize Fluorescence polarization assay (FPA) for detection of bovine brucellosis and its comparison with C-ELISA. 3. To develop multiplex PCR for simultaneous detection of organisms associated with bovine abortions. 4. Comparative evaluation of a multiplex PCR (Bruce ladder), Hinic Real-time PCR, PNA-FISH, FPA and C-ELISA used for diagnosis of bovine brucellosis. 4

17 CHAPTER II REVIEW OF LITERATURE 2.1 Bovine Brucellosis: Introduction Brucellosis has been recognized globally as an important emerging disease. The disease was first reported by Bruce and co-workers in 1887 when they isolated B. melitensis from the spleen of a patient who had died of fever in the island of Malta (Bruce 1887, 1893). In 1897, Danish veterinarian Bernhard Bang isolated B. abortus from aborting cattle and the additional name "Bang's disease" was assigned (Bang 1897) while B. suis was first described by Taum (1914). In cattle, the disease brucellosis, also known as "contagious abortion" and "infectious abortion" is usually caused by B. abortus, less frequently by B. melitensis and occasionally by B. suis. The popular name "undulant fever" originates from the characteristic undulance (or "wave-like" nature) of the fever, which rises and falls over weeks in untreated patients. Brucella species are small, Gram-negative, non-motile, non-capsulated, nonspore-forming, partially acid fast, rod-shaped (coccobacilli). They are oxidase, catalase, nitrate reductase and urease positive. The genus Brucella consists of nine recognized species: B. abortus, B. melitensis, B. suis, B. ovis, B. canis, B. neotomae and the strains recently discovered from marine mammals and common vole (Microtus arvalis) and published under the respective species names of B. ceti, B. pinnipedialis and B. microti (Foster et al 2007, Scholz et al 2008). Recently, a distinctive species, B. inopinata was recovered from a breast implant in human beings (De et al 2008). In spite of more than 94% similarity amongst the members of the genus (Delvecchio et al 2002), bacteria of the genus Brucella have different host

18 preferences. Therefore, Brucella spp. are capable of causing disease in a variety of animal species that include cattle (B. abortus), goats and lesser extent in sheep (B. melitensis), pigs (B. suis), dogs (B. canis), sheep (B. ovis), cetaceans (B. ceti), seals (B. pinnipedialis), desert wood rat (B. neotomae) and common vole (B. microti). B. neotomae and B. microti have no zoonotic potential (Xavier et al 2010). B. abortus has seven different biovars, named 1, 2, 3, 4, 5, 6 and 9 of which biovar 1 is the most important and widespread (Megid et al 2010). 2.2 Samples for isolation of B. abortus De et al (1989) collected cervical mucus with sterile swabs for isolation of Brucella. Chatterjee et al (1995) collected vaginal mucus for isolation of B. abortus using a sterile cotton swab in one end of the wooden plunger, which was placed in a tube containing tryptose broth immediately after taking out of vagina. Jeyaprakash et al (1999) collected vaginal swabs for isolation of B. abortus by using a sterile cotton swab in one end of the wooden plunger that was placed in test tube containing serum dextrose broth immediately after taking out of vagina. Samples like placental cotyledons, vaginal discharge, foetal tissues or foetal abomasal contents may be used for isolation of B. abortus. Foetal stomach content is considered as one of the best sample for isolation of B. abortus (OIE 2009). 2.3 Media for isolation of B. abortus Morris (1956) described a selective medium for Brucella spp. which contained 5-nitrofurfurylmethyl ether, bacitracin, polymyxin and actidione. They found that the organisms normally encountered in culture from faeces or soils are completely suppressed on the medium while Brucella grew quantitatively within 65 hrs of incubation. 6

19 Farrell (1974) developed a selective medium incorporating bacitracin, polymyxin, nalidixic acid, vancomycin, cycloheximide and nystatin for the isolation of B. abortus from contaminated sources. The medium was shown to suppress the growth of contaminants effectively without inhibiting the more fastidious strains of B. abortus biotype 2. Hunter and Kearns (1977) did a comparative trial of three different media; Serum dextrose agar, Barrow and Peel s medium and Farrell s medium for the recovery of B. abortus from vaginal mucus samples. They found Farrell s medium to be most effective in the recovery of the organism and in the suppression of growth of contaminating organisms, although, in those instances where B. abortus grew on all three media, the colonies on Barrow and Peel s medium were larger and could be seen only after 3 days of incubation. Zaki et al (1979) successfully isolated B. abortus on bacto tryptose medium. Basal media, such as serum dextrose agar (SDA) or glycerol dextrose agar can be used for isolation of Brucella organisms (Alton et al 1988). De et al (1989) cultured milk, vaginal discharge and cervical swabs from 47 cows suffering from abortions on tryptose agar containing crystal violet 1:500,000, brilliant green 1:250,000 and cycloheximide for isolation of Brucella organisms. No Brucella organism could be isolated from these samples, even though the 10 cows from 47 were seropositive. Terzolo et al (1991) used Skirrow agar to isolate B. abortus biotype-1 from contaminated samples such as bovine vaginal exudates and foetal stomach contents and thus was found to be the standard procedure for the isolation of Brucella. Ramanatha and Gopal (1992) used tryptose agar plates containing crystal violet for isolation of B. abortus. 7

20 Batra et al (1995) carried out isolation of Brucella from foetal stomach contents using tryptic soya agar (TSA) containing 5% inactivated horse serum. Jeyaprakash et al (1999) processed 64 milk samples from cows having symptoms of abortions and retained placenta for isolation of Brucella by using SDA and found that 10 (15.62%) samples were positive for brucellosis. Hornsby et al (2000) developed rifampin brucellae medium (RBM) and malachite green brucellae medium (MAB) for growth and recovery of B. abortus strain RB51 and compared these with five different selective media for isolation of Brucella, with four commercial media for isolation of gram negative bacteria and with tryptose agar supplemented with 5% bovine serum. They found that four of the five media used for isolation of Brucella and two of the four media used for other gram negative bacteria did not support growth of RB51. They concluded that RBM and MAB in combination with trypticase soya agar enhanced the ability to recover RB51 from tissue samples. Many varieties of suitable media such as serum dextrose agar, trypticase soya agar and blood agar supplemented with bacitracin, natamycin, polymyxin B and vancomycin may be used for isolation of B. abortus (OIE 2009). Anonymous (2006) used tryptose soya agar for isolation of Brucella from five semen samples and all were found to be negative. However, one sample from stomach content of aborted foetus yielded Brucella organism. All the basal media can be used for the preparation of selective media by adding appropriate antibiotics to suppress the growth of organisms other than Brucella. The most widely used selective medium is the Farrell s medium (FM) and modified Thayer-Martin s (mtm) medium. A new selective medium (CITA) containing vancomycin, colistin, nystatin, nitrofurantoin and amphotericin B were 8

21 tested for isolation of Brucella species including B. suis and it was found that the CITA medium was more sensitive than both mtm and FM for isolating all Brucella species from field samples. Addition of serum to basal media, such as blood agar base or Columbia agar gives excellent results for isolation (OIE 2009). Miguel et al (2011) suggested that isolation of Brucella can be done on both Farrell medium (FM) and modified Thayer-Martin medium (mtm). However FM inhibits the growth of B. ovis, B. melitensis and B. abortus strains. Though mtm is adequate for growth of all Brucella species, but it is partially inhibitory for contaminants. For isolation of B. suis both the medium were compared and it was proved that FM significantly inhibits B. suis growth. 2.4 Isolation and Identification of Brucella In India, Polding (1942) first reported the recovery of 46 isolates of Brucella from cattle, buffalo, goat, horse and man. Luchsinger et al (1973) and Harrington and Brown (1976) reported, respectively, B. abortus biotype 1: 76% and 86.4%; biotype 2: 8% and 4.6%; biotype 4: 11% and 2.1% and strain 19: 5% and 6.4% among isolates from cattle in many areas of the United States. Bacteriological examination was carried out on the membranes of aborted foetuses and Brucella biotype 3 was identified by Plagemann (1974). Ewalt and Harrington (1979) successfully isolated B. abortus strain 19 and B. abortus biotype 1 from tissues of cows. Zaki et al (1979) reported the concomittant isolation of B. abortus and C. fetus from an aborted bovine foetus. They isolated B. abortus in pure culture from the stomach contents in tryptose agar whereas the heart blood yielded a mixed culture of B. abortus and C. fetus. 9

22 Bale and Kumi (1981) successfully isolated B. abortus biotype 1 and 3 from two samples of abomasal contents from cows which had recently aborted. Thomas et al (1981) recovered 34 isolates of Brucella from material of bovine origin and identified them as B. abortus strain 19. All the isolates had the properties of CO 2 independence. B. abortus biotype 1 strains were inhibited by penicillin G and thionin blue at standard concentration. Das et al (1990) isolated B. abortus biovar 1 from 21 of 55 (38.2%) aborting cows and 18 of 126 (14.3%) aborting buffaloes. Ramanatha and Gopal (1992) isolated, identified and biotyped Brucella isolates from foetal membranes, foetal stomach contents and placenta from an aborted cow as B. abortus biotype 1. B. abortus strain RB51 isolate was biotyped as a typical rough B. abortus biovar 1 by Jensen et al (1996). Ilhan et al (1999) cultured 46 vaginal mucus samples and found that five (10%) samples were positive for B. abortus. All the isolated strains were found to belong to B. abortus biotype 3. Jeyaprakash et al (1999) cultured vaginal mucus samples from cows showing symptoms of abortion and retained placenta and found that of the 56 cows that showed symptoms of abortion, ten cows (17.85%) were positive for Brucella infection. Among 24 cows with retained placenta, 2 cows (8.33%) had brucellosis and in vaginal swabs taken from 16 cows that had abortion and retained placenta, two vaginal mucus samples (12.5%) were positive for Brucella infection. They further carried out identification of Brucella spp. by specific biochemical tests like catalase, oxidase, urease, methyl red, H 2 S test, CO 2 requirement test and dye sensitivity test. Shome et al (1999) was successful in isolation and characterisation of B. abortus by serological and biochemical tests from stomach contents of aborted bovine 10

23 foetus and bovine placental cotyledons in Andamans. They characterised B. abortus by characteristic colonies and biochemical tests like catalase, oxidase, growth in dyes (basic fuchsin and thionin), urease test, citrate, H 2 S production, methyl red, vogues proskauer, indole production, litmus milk test and requirement of CO 2 for growth. Brucella can be recovered from foetal membranes, vaginal secretions, milk, semen, arthritis or hygroma fluids, the stomach content, spleen and lungs from aborted foetuses. From the carcasses, the bacteria could sometimes be isolated from the lymph nodes, spleen, uterus, udder, testes, epididymitis, joint exudates, abscesses and other tissues (Alton et al 1988, Quinn et al 1999). Bustamante et al (2000) studied 100 samples of vaginal exudate of HF cows and identified 10 isolated strains as B. abortus biotype 1. Verma et al (2000) collected a total of 431 samples comprising of 51 abortions, 80 repeaters, 277 endometritis, 8 cervicitis and 15 vaginitis cases from 43 buffaloes, 110 cows, 115 does and 163 ewes suffering from various reproductive disorders and successfully isolated B. abortus biotype 3 from 2 of 7 aborted cows. Langoni et al (2000) analyzed 49 milk samples from seropositive animals for brucellosis. Of the 49 analyzed samples, 15 (30.61%) contained B. abortus. The isolates were identified on the basis of Gram s staining, CO 2 requirement, H 2 S production, urease activity and growth in the presence of thionin and basic fuchsin. B. abortus could be presumptively identified on the basis of morphology and positive agglutination with a Brucella specific antiserum. Additional identification should be done by using either oxidative metabolism tests, PCR or phage lysis tests to identify the species. Identification to biovar level depends on examination for growth in the presence of basic fuchsin and thionin at final concentration of 20 g/ml, production of H 2 S, requirement of CO 2 for growth and agglutination pattern with A-, 11

24 M- or R- specific antisera. Vaccine strain B. abortus S19 could be identified on the basis of lack of requirement for CO 2, inhibition of growth by benzylpenicillin, thionin blue and i-erythritol, high utilization of L-glutamate and a low residual virulence for guinea pigs (OIE 2009). Fosgate et al (2002) successfully isolated B. abortus from six out of eight cattle and one out of 17 water buffaloes serologically positive for Brucella infections and opined that successful isolation of Brucellae was 3.4 times more likely in cattle as compared to water buffaloes. Rathore et al (2002) processed 82 samples of aborted foetuses (79 cattle and 3 buffaloes) comprising of foetal stomach contents, lungs, liver etc. for isolation of Brucella. Of the 79 cattle samples processed, 32 (40.05%) samples yielded Brucella organisms where as none sample was positive from buffaloes. They identified Brucella up to genus level by biochemical tests such as catalase, oxidase, nitrate, indole, urease activity, CO 2 requirement and H 2 S production. Chahota et al (2003) collected samples of placentas, vaginal swabs from five aborted cows and samples from aborted foetus including abomasal contents, heart blood and peritoneal cavity fluid. B. abortus biotype 1 was isolated from the morbid material from all cows. Joshi et al (2005) carried out Modified cold ZN staining on the broth cultures for early presumptive identification of Brucella. Acid-fast coccobacilli were seen in Brucella positive broth smears stained with modified cold ZN stain, thus providing presumptive identification of Brucella growth and concluded that modified cold ZN staining method was simple, reliable and reproducible. Kaur et al (2006) inoculated 61 samples comprising of nine vaginal mucus samples, 15 foetal membranes and 37 foetal stomach content from aborted cattle and buffaloes on selective medium consisting of BHI agar with 7-10% defibrinated sheep 12

25 blood and antimicrobial agents for isolation of B. abortus. They recovered 17 (27.86%) isolates of B. abortus. Kanani (2007) recovered eight isolates of Brucella from 101 semen samples collected from five AI Centres of Gujarat state. Out of these, 6 were from cattle bulls while two were from buffalo bulls. All the eight isolates were identified as Brucella organisms by cultural, morphological, serum agglutination and biochemical characteristics and the isolates were further confirmed by PCR using different genus specific primer pairs. Ghodasara et al (2010) collected samples of deep vaginal swabs, placenta, foetal abomasal contents and spleen from 248 cases (107 from cows, 73 from buffaloes, 51 from goats and 17 from bitches) of recently aborted animals and animals suffering from reproductive disorders for isolation of Brucellae from villages of Anand, Gujarat, India. Samples were inoculated on Brucella agar medium in duplicate. One plate was incubated aerobically in an incubator at 37 C (without CO 2 ), and the other incubated at 37 C aerobically in an atmosphere of 5% CO 2 and were observed for growth at every 24 hrs for up to 15 days. The suspected colonies were identified as Brucella spp. by morphological, cultural and biochemical properties such as oxidase, H 2 S production, urease, CO 2 requirement and dye inhibition test. Eight isolates of Brucella from abortion cases (two from cows, one from buffalo, four from goats and one from a bitch) and two isolates of Brucella from reproductive disorder cases (one from a cow and one from a buffalo) were recovered. Priyantha (2011) collected milk, vaginal swabs, placental contents and aborted foetus from 18 aborted herds of cattle and buffaloes and cultured these samples by conventional bacteriological methods. The detection of biovars of the B. abortus were based on growth in thionin and basic fuschin, CO 2 requirement, H 2 S production, 13

26 serum agglutination with Brucella negative, A, M and R reference antiserum. B. abortus was isolated from 8 individuals from six herds and identified as B. abortus biovar 3. Seven isolates of Brucella from aborted cows and 3 from aborted buffalos were isolated and identified from aborted foetuses, vaginal discharge and milk samples by Al-Saadi et al (2012). Ica et al (2012) examined aborted materials from cattle (61), sheep (64) and human blood samples (50). A total of 29 Brucella spp., 17 (27.9%) from cattle and 12 (18.7%) from sheep specimens were isolated. Out of the 84 samples of vaginal mucus (35), foetal stomach contents (31), foetal membranes (11) and uterine discharges (7), collected from aborted cattle (29) and buffaloes (55), 9 (10.7%) were positive by isolation for B. abortus. Of these 9 isolates, one isolate was typed as biotype 2, one as biotype 3 and seven as biotype 1 ( Jain et al 2013). Sanjrani et al (2013) investigated milk, blood, vaginal swab and placenta from the aborted dams along with liver, lungs and stomach contents from aborted foetus from animals in Hyderabad. The organisms identified in abortion included B. abortus (16.3%), Trichomonas fetus (2.14%) and Listeria monocytogenes (1.82%). In case of mixed infections, B. abortus along with Salmonella spp. occurred in highest frequency (7.5%), followed by B. abortus along with Staphylococcus aureus (7.34%) and Proteus vulgaris along with Escherichia coli (3.4%). They concluded that B. abortus was a major single causal agent causing abortion in buffaloes. Shahzad et al (2014) collected seropositive milk samples, aborted fetuses, and vaginal swabs of cattle and buffaloes from the Potohar Plateau, Pakistan. Isolation of Brucellae was done on modified Farrell's serum dextrose agar. A total of 30 isolates 14

27 were recovered from milk (n=5), aborted fetuses (n=13), and vaginal swabs (n=12). Most isolates were from cattle (56.7%). All of them were identified as B. abortus biovar 1 based on conventional biotyping methods and genus and species-specific PCR. 2.5 Detection of antibodies to Brucella spp. by different serological tests The seroprevalence of brucellosis in buffaloes and cows around Faisalabad by RBPT and STAT was found to be 12.98% and 2.40% respectively (Lodhi et al 1995). National survey performed till so far in India, confirmed the widespread prevalence of Brucella antibodies in 19 out of 23 States. The overall incidence in cattle and buffaloes was 1.9% and 1.8% respectively. The STAT results revealed antibody titres ranging from 40 to 5,120 IU (Isloor et al 1998). Houten et al (2003) used 7 groups of Elk sera representing various B. abortus exposure histories to validate the C-ELISA test for Elks. The C-ELISA differentiated strain 19 vaccinated elk from elk that were challenged with pathogenic lab strain viz. B. abortus strain The specificity and sensitivity of C-ELISA for elk vaccinated with strain 19 and samples collected between 6 months and 2 years post vaccination was 96.8% and 100% respectively. They concluded that the C-ELISA was helpful in evaluating elk sera in vaccinated and brucellosis endemic herds in Greater Yellowstone area in USA. Overall prevalence rate of brucellosis in cattle farms in Haryana, Uttar Pradesh and Madhya Pradesh was found to be 26.50% by ELISA, 20.47% by RBPT and 18.89% by STAT (Chand and Sharma 2004). Gall et al (2006) developed a simple, rapid, field adapted enzyme linked immunoassay (FldELISA) for the detection of antibodies to B. abortus in whole blood and serum. The test could be performed in approximately 15 min. or less. By using 15

28 defined positive and negative sera, the sensitivity and specificity of the FldELISA was 100% and 94.25% respectively. They suggested, that as a model, this test could be readily extended to other disease applications that use lipopolysaccharide or other stable antigens for the detection of antibodies, such as to those of Salmonella spp., E.coli or Yersinia spp. Sharma et al (2007) screened 2988 animals in 62 dairy farms/gaushalas of Punjab for brucellosis and 540 (18.07%) animals were found positive by STAT. Chachra et al (2009) evaluated the comparative efficacy of RBPT, STAT and Dot ELISA in detecting anti-brucella antibodies on a total of 28 serum samples which included 18 serum samples from brucellosis suspected and 10 serum samples from normal healthy cattle. They found Dot-ELISA to be the most sensitive of all the three tests used, but however, based upon their findings, suggested, that in order to get a fool proof diagnosis of Brucella infection, a combination of RBPT and Dot-ELISA should be used, especially in case of samples found negative by either RBPT or STAT used alone or in combination. Mekonnen et al (2009) screened 1120 cattle sera from semi-intensive production system and 848 cattle sera from extensive system by using Rose Bengal Plate Test (RBPT). Positive samples were then confirmed by Complement Fixation Test (CFT). Seroprevalence rate of 7.7% and 63.6% was found at individual and herdlevel respectively in the semi-intensive system and 1.2% and 3.3% respectively in the extensive system. Ghodasara et al (2010) screened 180 serum samples (107 cows, 73 buffaloes) from cases of abortion and various reproductive disorders for detection of Brucella antibodes by RBPT, STAT and I-ELISA. The overall prevalence of brucellosis by RBPT, STAT and I-ELISA were 11.21%, 16.00% and 24.30% in cows and 9.59%, 12.33% and 26.03% in buffaloes, respectively. 16

29 246 indigenous and 409 crossbred cattle from 105 small holder dairy farms and 25 traditionally managed herds were screened in Tanzania for Brucella antibodies using RBPT. The overall seroprevalence of Brucella antibodies in the small holder dairy farms and traditionally managed cattle was 4.1% and 7.3%, respectively. The corresponding overall herd prevalence was 10.5% and 20%, respectively (Swai and Schoonman 2010). Ahmed et al (2011) evaluated four serological tests (RBT, SAT, I-IELISA and C-ELISA) by screening 108 serum samples from goats and 60 serum samples from cattle. The sensitivity and specificity of these serological tests in goats were RBT: 100% and 93.4%; SAT: 100% and 96.2%; I-ELISA: 66.6% and 92.3%; C-ELISA 100% respectively and in cattle RBT: 100% and 94.9%; SAT: 100% and 96.6%; I- ELISA: 50% and 93.1%; C-ELISA: 100% respectively. Degefa et al (2011) tested 370 serum samples from indigenous cattle of both sexes and different ages for brucellosis by RBPT. RBPT positive serum samples were further subjected to Complement Fixation Test (CFT) for confirmation of brucellosis positivity. RBPT detected 2 (0.05%) of the 370 samples. The 2 RBPT positive serum samples were also confirmed to be positive (0.05%) by CFT. Londhe et al (2011) tested 35 cattle and 64 buffaloes with history of abortion and repeat breeding belonging to five dairy intensive districts in Maharashtra for brucellosis. They revealed that the incidence of brucellosis in bovines was 40.4%. Buffaloes had higher (P 0.05) incidence of the disease (42.18%) than cattle (37.14%). Mohammed et al (2011) selected cattle (570) of different ages and sexes from 20 herds in the Jigawa state of Nigeria for detection of brucellosis by using RBPT and competitive enzyme immunoassay. 23 cattle (4.04%) were positive by RBPT while 22 (3.86%) were positive with competitive enzyme immunoassay. 17

30 Agasthya et al (2012) screened 652 serum samples from brucellosis suspected cases for the presence of Brucella antibodies by RBPT and STAT. Subsequent testing of serum samples by indigenous developed I-ELISA detected 20 (3.65%) samples positive and I-ELISA was found to be more sensitive than RBPT and STAT. Senein and Abdelgadir (2012) used Rose Bengal Plate Test (RBPT), Serum Agglutination Test (SAT) and Competitive Enzyme Linked Immuno Sorbent Assay (C-ELISA) for the diagnosis of the brucellosis. The number of samples positive by RBPT, SAT and C-ELISA were 21 (8.4%), 50 (20%) and 5 (2%), respectively. Islam et al (2013) tested 178 blood samples from buffaloes by I-ELISA, RBPT, MAT, mmat and PCR to detect the most suitable test for diagnosis of bovine brucellosis. I-ELISA detected the maximum number of positive samples (102) followed by MAT (85), RBPT (81), mmat (79) and PCR (68). They concluded that I-ELISA can be used for routine serodiagnosis of Brucella infection in buffaloes and that PCR can be used in combination with I-ELISA to complement the serological diagnosis especially in the initial phase when immune response of the animal is not detectable. Jagapur et al (2013) screened 1005 serum samples by I-ELISA to compare the prevalence of brucellosis at organized and unorganized farms in Karnataka, Uttar Pradesh and Uttarakhand during the period from 2011 to Of the whole, 319 (31.74%) animals were found positive for brucellosis among the three states which included 138 from cattle and 181 from buffaloes. They found that Brucella infections were widely prevalent in organized and unorganized dairy farms in investigated states of India. Senthil and Narayanan (2013) collected 210 serum samples from a slaughter house and subjected these to three serological tests viz, RBPT, STAT and I-ELISA. 18

31 Of these, 11 (5.23%), 7 (3.3%) and 24 (11.4%) samples were positive by RBPT, STAT and I-ELISA respectively. They compared the diagnostic tests to assess the sensitivity and specificity of I-ELISA with RBPT and STAT respectively and it was found to be 91.65% and 93.4% when compared to with RBPT whereas it became 100% and 91.6% when compared with STAT. 2.6 Polymerase chain reaction (PCR) for detection of Brucella spp. Numerous PCR based assays have been developed and evaluated for the identification of Brucella species to improve the diagnostic capabilities (Baily et al 1992, Herman and De Ridder 1992, Halling et al 1993, Romero et al 1995, Da Costa et al 1996, Casanas et al 2001). Romero et al (1995) examined milk samples from 56 Brucella milk culturepositive cattle and from 37 cattle from Brucella-free herds for detection of Brucella by PCR and for detection of Brucella specific antibodies by an indirect enzyme-linked immunosorbant assay (I-ELISA). The milk samples from 49 infected cattle were positive by PCR (87.5% sensitivity), and 55 samples were positive by I-ELISA (98.2% sensitivity). A PCR-positive sample was negative by I-ELISA and 7 I-ELISA positive samples were PCR negative, yielding an observed proportion of agreement of 0.91 for the two tests. Fox et al (1998) carried out PCR amplification of a highly conserved region of genus Brucella, 16S-23S ribosomal DNA interspace for species-specific polymorphism. Identical PCR interspace profiles were seen in B. abortus, B. melitensis, B. suis and B. canis. However, these PCR products were unique to Brucellae which can be readily distinguished from other gram-negative bacteria (including Bartonella spp. and Agrobacterium spp.). They concluded that PCR of the rrna interspace region was useful in identification of the genus. 19

32 Ocampo-Sosa et al (2005) analysed Brucella field strains isolates by AMOS- ERY PCR assay and Southern blot hybridisation with a probe from insertion sequence IS711. Most of the field isolates produced only the ery band in the AMOS-ERY assay and showed a hybridisation pattern identical to reference strains of biovars 5, 6 and 9 of B. abortus, but different from strain Tulya, belonging to biovar 3 of B. abortus. Cloning and nucleotide sequencing of a DNA fragment containing an IS711 copy exclusive of the B. abortus field strains from biovar 3b and reference strains from biovars 5, 6 and 9 revealed the existence of a 5.4 kb deletion close to an IS711 copy. New primer based on this data along with the IS711 AMOS primer produced a PCR fragment of 1.7 kb only from the isolates of biovars 3b, 5, 6 and 9 of B. abortus where as no amplification products were produced with these primers from strains of the rest of species and biovars of Brucella and from bacteria phylogenetically close to Brucella. Leary et al (2006) applied PCR assay for detection of B. abortus in blood, milk and lymph tissues by using different primers that amplify various regions of the Brucella genome, IS711 genetic element, 31 kda outer membrane protein and 16S rrna. They found that there was no amplification when PCR assays were applied to the blood samples, but amplification was detected in a proportion of the culture positive milk (44%) and lymph tissue samples by the same methods. Rijpens et al (2006) suggested that PCR is a promising alternative for problematic culturing and identification of Brucella spp. by conventional techniques. Kanani (2007) compared three pairs of primers amplifying three different fragments, a gene encoding a 31 kda B. abortus antigen (primer B4/B5), a sequence 16S rrna of B. abortus (primer F4/R2) and a gene encoding an omp2 (primer JPF/JPR) by testing 101 semen samples from breeding bulls of AI Centres of Gujarat. 20

33 They found that B4/B5 primer was more sensitive followed by F4/R2 primer and JPF/JPR primer. Marianelli et al (2008) compared serologically positive and serologically negative milk of water buffaloes by molecular and bacteriological test results. Milk samples from 53 Brucella seropositive buffaloes were positive by ELISA, 37 were positive by culture, 33 were positive by PCR and 35 were positive by real-time PCR. Thus, although overall culture showed greater sensitivity than PCR, but, some animals were found positive by serological methods and PCR which were negative by culture methods. Kazemi et al (2008) processed 104 blood samples for detection of Brucella by using peripheral blood PCR and compared them with culture and serological methods. PCR reaction was performed using Nested PCR: Nest 1 primers amplified 1100 bp and Nest 2 primers amplified 958 bp of Brucella 16S rrna gene. Seventy three cases were positive by PCR method, 15 cases by culture and 84 cases by serological methods. They concluded that PCR method was sensitive and specific for diagnosis of Brucella from peripheral blood in suspected cases. Al-Mariri et al (2009) compared milk ring test and three different polymerase chain reaction techniques (direct DNA extraction by column purification system, alkaline DNA extraction, and filtrated milk) to identify B. abortus infection in bovine milk. Sensitivity and specificity of milk ring test were 72% and 80%, respectively. While specificity of the three polymerase chain reaction techniques was 100%, sensitivity was 92%, 88% and 100%, respectively. Sahar et al (2009) examined 30 blood samples of RBPT positive animals by PCR using primer pair to amplify a 223 bp region within a gene coding for 31-kDa Brucella antigen, ELISA and culture. Five aborted foetus samples were examined by 21

34 PCR using the same pair of primers and culture. Out of 20 RBPT positive blood samples, 13 samples and 7 samples were positive by PCR and ELISA, respectively representing 65% and 35% sensitivity and none of the sample was positive by culture. The overall agreement between PCR and ELISA and between PCR and culture were 73.33% and 56.66% respectively. From the five aborted foetuses, 4 were positive for Brucella infection by PCR and 3 of the 4 aborted fetuses were also positive by culture, 1 was negative by both. The overall agreement between PCR and culture reached 80%. Ghodasara et al (2010) compared three primers, B4/B5 primer pair amplifying a 223 bp, F4/R2 primer pairs amplifying a 905 bp and JPF/JPR primer pair amplifying a 193 bp fragment for the detection of Brucella species from 10 samples from vaginal swab, aborted foetus and placenta (cattle, buffaloes, goats). B4/B5 was found to be more sensitive as it detected 10 Brucella isolates whereas the other two primer pairs, F4/R2 and JPF/JPR, detected eight samples positive for Brucella organisms. The isolates identified as Brucella were subjected to species differentiation by using four pairs of primers targeting the gene encoding cell surface protein (bcsp31) and outer membrane protein (omp2b, omp2a and omp31). Out of 10 isolates of Brucella, five isolates from cattle and buffaloes could be identified as B. abortus when fragments of bcsp31 and omp2b/2a were amplified by B. abortus-specific primers, whereas isolates from goats could be identified as B. melitensis by the amplification of fragments of bcsp31, omp2b/2a and omp31 using primer B4/B5, JPF/JPR and omp31. Presence of anti-brucella antibodies and Brucella DNA in the cow milk was comparatively determined by ELISA and erycd gene-targeted PCR. B. abortus DNA was determined by amplification of alkb genes. Out of 70 milk samples,15 samples (21.4%) were found positive for anti-brucella LPS antibody in ELISA and 5 milk samples (7.1%) were determined as positive by erycd gene-targeted PCR. All of the 22

35 erycd positive samples gave an amplicon of 904 bp thus indicating the presence of wild-type Brucella DNA but not B. abortus S19 vaccine strain since it gives an amplicon of 202 bp. Amplification of the alkb gene demonstrated the presence of B. abortus DNA in 5 erycd positive samples. These results suggest that use of both ELISA and PCR methods could lead to more reliable diagnosis of brucellosis from bovine milk samples (Goknur et al 2010). Moussa et al (2011) applied different PCR assays either singly or in a multiplex format that enabled to detect and differentiate most of Brucella species. The obtained results recommended the PCR assay as a valuable, rapid, very specific, highly sensitive and safe laboratory diagnostic test that can be used not only for detection of Brucella antigen either in culture or in clinical samples but also in differentiating most of the virulent and vaccinal strains. Al-saadi et al (2012) isolated and identified 11 Brucella organisms from aborted foetuses, vaginal discharge and milk samples from aborted cows and buffalos. Brucella isolates revealed amplification of a 223 bp fragment with B4 and B5 primers. 2.7 Detection of Brucella spp. by Bruce ladder multiplex PCR Multiplex PCR assay is a kind of PCR technique where multiple target DNA sequences can be detected in a single reaction. Therefore, by application of this assay we can easily do identification and molecular typing of all Brucella spp. (B. melitensis, B. abortus, B. suis, B. ovis, B. canis, B. neotomae, B. ceti and B. pinnipedialis) including the vaccine strains. Different multiplex PCR assays have been described for identification of Brucella spp. by various workers. Bricker (2002) developed a PCR assay for identification of Brucella to improve diagnostics capabilities including several strategies to differentiate among 23

36 Brucella spp. and strains including locus specific multiplexing e.g AMOS PCR based on IS711, PCR-RFLP based on omp 2 locus, arbitrary primed PCR and ERIC PCR. Bricker et al (2003) in a blind test, analysed 344 samples representing 80 bacterial isolates by the B. abortus species specific polymerase chain reaction (BaSS PCR) assay for the identification and discrimination of B. abortus field strains (wildtype biovars 1, 2, and 4) from B. abortus vaccine strains, other Brucella species, and non-brucella bacteria. The results showed that the BaSS PCR assay had the potential to be a very reliable screening tool for B. abortus identification. Goni et al (2008) evaluated a multiplex PCR Assay (Bruce-ladder) for molecular typing of all Brucella species, including the vaccine strains. They found that the assay can differentiate in a single step all the classical Brucella species, including those found in marine mammals and the S19, RB51, and Rev.1 vaccine strains. Kang et al (2011) introduced two new primer sets of 766 bp and 344 bp fragment into the conventional Bruce-ladder PCR assay and showed that this novel multiplex PCR assay rapidly and concisely discriminates B. canis and B. microti from B. suis strains and also may differentiate all of the 10 Brucella species. Mirnejad et al (2012) developed a combinatorial PCR capable of simultaneous detection and differentiation of B. abortus and B. melitensis in clinical samples. Differentiation of species was based on the resulting bands; therefore the band 494- bp for B. abortus and 733 bp for B. melitensis were obtained. They concluded that without routine diagnostic methods such as culture and serology tests, using the molecular method of combinatorial PCR, important species of Brucella can be simultaneously identified and differentiated in clinical samples. Nagalingam et al (2012) used Bruce Ladder PCR and AMOS- PCR assays to characterize 47 Brucella isolates. Out of them, 28, 14 and 5 isolates were found to be 24

37 B. abortus, B. melitensis and B. suis, respectively. By AMOS-PCR, they identified that all the B. abortus isolates belonged to any one of the biovar 1, 2 or 4; of the five B. suis isolates, three belonged to biovar1 and two belonged to any one of the biovar 2, 3, 4 or Detection of Brucella by Real-time PCR assay using IS711 specific primers and Taqman probe chemistry Real-time polymerase chain reaction is a molecular biology laboratory technique based on the polymerase chain reaction (PCR), which is used to amplify and simultaneously detect or quantify a targeted DNA molecule. The procedure follows the general principle of polymerase chain reaction; its key feature is that the amplified DNA is detected as the reaction progresses in "real time." Redkar et al (2001) developed a Real-time PCR-based assay for detection of B. abortus, B. melitensis and B. suis. The assay utilized an upstream primer that is derived from 3 end of the genetic element IS711, whereas the downstream primers and probes were designed from signature sequences specific to a species or a biovar of Brucella. The PCR reactions were monitored for fluorescence resonance energy transfer by including two adjacent labelled probes that hybridize to the amplicons as they are formed. They opined that the specificity, sensitivity, speed and real-time detection make these assays attractive for use in epidemiological and ecological studies. Probert et al (2004) described a Real-time PCR assay for confirmation of presumptive Brucella isolates. The assay was designed in a multiplex format that allow the rapid identification of Brucella spp., B. abortus, and B. melitensis in a single test. The inclusion of a genus-specific primer-probe set assisted in the identification of infrequently isolated Brucella species and the recognition of atypical Brucella strains. 25

38 They concluded that the Real-time PCR greatly reduces the risk of laboratoryacquired infection with Brucella and multiplex format of the assay will reduce reagent cost and staff time required to perform testing for brucellosis. Hinic et al (2008) developed a novel PCR assay for the rapid identification and differentiation of B. melitensis, B. abortus, B. suis, B. ovis, B. canis, and B. neotomae. The assay has proven to be highly specific with the additional advantage of being suitable for use with both conventional and Real-time PCR. Bounaadja et al (2009) designed Real-time PCR assay using TaqMan probes targeting three specific genes: the insertion sequence IS711, bcsp31 and per genes for the detection of Brucella at genus level. The genus-specificity was evaluated on 26 Brucella strains, including all species and biovars, analytical specificity was evaluated on a collection of 68 clinically relevant, phylogenetically related or serologically cross-reacting micro-organisms and analytical sensitivity was assessed using decreasing DNA quantities of B. ovis, B. melitensis bv. 1, B. abortus bv. 1 and B. canis reference strains. They found that the Real-time PCR assay targeting IS711 presented an identical or a greater sensitivity than the two other tests and concluded that the IS711-based real-time PCR assay is specific and highly sensitive and appears as an efficient and reproducible method for the rapid and safe detection of the genus Brucella. Hinic et al (2009) established Real-time PCR assay based on the Brucellaspecific insertion sequence IS711. Results from IS711 real-time PCR were compared to those obtained by bacterial isolation, Rose Bengal Plate Test, competitive ELISA and indirect ELISA. In the first group of animals, IS711 real-time PCR detected infection in 11.1% (16/144) of wild boars that were serologically negative and in the second group of animals, the IS711 real-time PCR detected infection in 26% of 26

39 animals. They concluded that IS711 real-time PCR assay is a specific and sensitive tool for detection of Brucella spp. infections in wild boars and proposed the employment of IS711 real-time PCR as a complementary tool in brucellosis screening programs and for confirmation of diagnosis in doubtful cases. Surucuoglu et al (2009) tested TaqMan Real-time PCR and compared it with conventional methods using serum samples from patients with different clinical forms of brucellosis and reported that there is high sensitivity and specificity of Real-time PCR method. They further stated that it is a useful tool for diagnosis of brucellosis with different clinical manifestations. Doosti and Ghasemi (2011) for the first time identified and differentiated B. abortus and B. melitensis using Real-time PCR. Dehkordi et al (2012) carried out Real-time PCR for detection and segregation of B. abortus and B. melitensis in aborted bovine, ovine, caprine, buffalo and camel fetuses. Real-time PCR by primers specific for B. abortus and B. melitensis was performed. A TaqMan analysis was carried out in total 3710 DNA of abomasal contents of aborted fetuses. 45/281 and 231/281, 169/224 and49/224, 194/219 and 22/219, 57/199 and 137/199 and finally 51/201 and 143/201 specimens were positive for B.melitensis and B. abortus in aborted bovine, ovine, caprine, buffalo and camel fetuses by Real-time PCR, respectively. The sensitivity and specificity of Real-time PCR was 100% and 100%. The C t values obtained from Real-time PCR had significant differences between aborted bovine, ovine, caprine, buffalo and camel fetuses for presence of B. abortus and B. melitensis. They showed that the Real-time PCR is considerably faster than current standard methods for isolation and segregation of Brucella. 27

40 2.9 Multiplex PCR assay for detection of various agents associated with bovine abortions Multiplex PCR is a widespread molecular biology technique for amplification of multiple targets in a single PCR experiment. In a multiplexing assay, more than one target sequence can be amplified by using multiple primer pairs in a reaction mixture. Multiplex PCR requires that primers lead to amplification of unique regions of DNA, both in individual pairs and in combinations of many primers, under a single set of reaction conditions. As an extension to the practical use of PCR, this technique has the potential to produce considerable savings in time and effort within the laboratory without compromising on the utility of the experiment. Moshkelani et al (2011) developed a multiplex PCR for detection of Brucella spp. and Leptospira spp. in aborted fetuses of bovine, ovine and caprine herds in Iran. They found that of the 276 specimens of stomach contents of aborted fetuses, 40 (14.4%) and 25 (9.0%) were identified positive for Brucella spp. and Leptospira spp. respectively. They concluded that the convenience and possibility of detection of both bacteria at the same time, strongly support the use of this assay for routine diagnostics. Tramuta et al (2011) developed a set of 5 multiplex polymerase chain reaction (mpcr) assays for the simultaneous detection of abortive infectious agents in bovine fetal tissues, including Brucella spp., Leptospira spp., and Campylobacter fetus (mpcr1); Hammondia heydorni, Neospora caninum, and Toxoplasma gondii (mpcr2); Coxiella burnetii and Chlamydophila psittaci (mpcr3); Mycoplasma bovis, Mycoplasma bovigenitalium, and Ureaplasma diversum (mpcr4); and Bovine viral diarrhea virus (BVDV) and Bovine herpesvirus-1 (BoHV-1; mpcr5). They 28

41 showed that out of the 50 fetuses, 7 (14%, mpcr2) were PCR-positive for N. caninum, 4 (8%, mpcr5) were PCR-positive for BVDV, and 2 (4%, mpcr4) were PCR-positive for U. diversum. The results obtained by using each multiplex PCR were 100% concordant with those obtained by using the respective PCR assays targeting single genes on the same specimens. Hence, they found that the multiplex PCR assays were suitable for the simultaneous detection of the main infectious agents responsible for bovine abortion. Dehkordi and Taghizadeh (2012) tested a total of 91, 88, 82, 50 and 35 aborted bovine, ovine, caprine, buffalo and camel fetuses respectively for the presence of Brucella spp. and Leptospira spp. From the total of 697 animal herds, 24 out of 220 bovine (56.36%), 102 out of 190 ovine (53.68%), 96 out of 165 caprine (58.18%), 48 out of 73 buffalo (65.75%) and finally 31 out of 49 camel (63.26%) dairy herds were infected by both Brucella spp. and Leptospira spp. In total, 69 (19.94%) and 107 (30.92%) out of 346 aborted fetuses were positive for Brucella spp. and Leptospira spp. by culture methods. For the detection of Brucella and Leptospira species, the DNA was detected by multiplex PCR from 79 (22.83%) and 120 (34.68%) out of 346 aborted fetuses, respectively. Also, 32 (9.24%) aborted fetuses were diagnosed positive for presences of both Brucella and Leptospira species by multiplex PCR. The results indicated that all of the 69 Brucella and 107 Leptospira culture-positive samples were also positive by multiplex PCR. In addition to this, the multiplex PCR detected Brucella spp. in 10 samples and Leptospira spp. in 8 samples. The sensitivity and specificity of multiplex PCR assay was 93% and 100% respectively. They concluded that the multiplex PCR assay was an accurate, sensitive, fast, safe and specific method for the detection of Brucella spp. and Leptospira spp. in aborted fetuses. 29

42 Sharma et al (2013) developed a multiplex PCR for simultaneous detection of infectious causes of bovine abortion including BHV-1, Brucella spp. and Leptospira spp. Three set of primers were designed based on the ge gene of BHV-1, omp25 gene of Brucella spp. and Lipl32 gene of Leptospira spp. and could amplify a product size of 332 bp, 233 bp and 166 bp, from BHV-1, Brucella spp. and Leptospira spp respectively. The newly developed multiplex PCR (mpcr) assay could detect BHV- 1, Brucella spp. and Leptospira spp. simultaneously in a single reaction with high sensitivity and specificity. The mpcr assay could efficiently detect the target organisms in the field samples indicating its diagnostic potential for determining the infectious causes of abortion Fluorescence Polarisation assay for serological diagnosis of Brucellosis The fluorescence polarisation assay (FPA) is a simple technique measuring antigen antibody interaction. The FPA has many methodological advantages over older, more established tests and can be performed in a fraction of the time. It is a homogenous assay in which analytes are not separated and therefore it is very rapid. The mechanism of the assay is based on the random rotation of molecules in solution. Molecular size of the molecule is inversely proportional to the rotation. If a molecule is labelled with a fluorochrome, the time of rotation can be determined by measuring polarized light intensity in vertical and horizontal planes. A large molecule emits more light in a single plane (more polarized) than a small molecule rotating faster and emitting more depolarized light. Nielsen et al (1996) developed a homogenous fluorescence polarization assay (FPA) for detection of antibody in bovine sera to B. abortus. The assay used O- polysaccharide prepared from B. abortus lipopolysaccharide in the molecular weight range of kda which was conjugated with fluorescein isothiocyanate and used as 30

43 a tracer. Fluorescence polarization was measured with a FPM-1 fluorescence polarization analyzer. Of the 250 serum samples from vaccinated cattle, 248 were negative giving a point specificity value of 99.2%. Nielsen et al (1998) evaluated the fluorescence polarization assay (FPA) for diagnosis of bovine brucellosis on 118 serum samples from cattle which were culture positive for B. abortus, 1751 serum samples from cattle from premises containing cattle infected with B. abortus, 1222 serum samples from cattle vaccinated with B. abortus strain 19 and 1199 serum samples from cattle with no evidence of brucellosis. Initial determination of serological positivity and negativity was based upon reactivity in the Rose Bengal or the buffered plate antigen test, followed by the complement fixation test. Sensitivity of the (FPA) ranged from 87.5% to 100%. Serological positivity of cattle from infected premises ranged from 65.5% to 99.0% while the percent negative cattle in herds without evidence of brucellosis was between 94.9% and 100%. Of B. abortus S19 vaccinated cattle which were positive by atleast one serological test, 88.2% were negative in the FPA. Samartino et al (1999) validated a homogenous fluorescence polarization assay (FPIA) for detection of bovine antibody to B. abortus in Argentina sera based on their reactivity in the buffered antigen plate agglutination test (BPAT) and the competitive enzyme immunoassay (C-ELISA). Serum samples negative in these tests were collected from farms without evidence of brucellosis (n=733). Serum samples positive in the two tests were collected from cattle on farms from which B. abortus was isolated from at least one animal (n=1039). Serum samples from cattle vaccinated 26, 89, 240 and 272 days previously with B. abortus strain 19 were collected and tested. A cut-off value of 87 mp was determined for the FPIA, resulting in relative sensitivity and specificity values of 98.1% and 99.6%. The specificity for B. abortus 31

44 strain 19 vaccinated cattle was 64.9% (26 days post vaccination, DPV), 92.1% (89 DPV), 98.6% (242 DPV) and 97.1% (272 DPV). These values were compared to those obtained with the BPAT, the C-ELISA, the indirect ELISA, the complement fixation test and the 2-mercaptoethanol agglutination test. Serum samples from 18 cattle which were vaccinated and revaccinated with B. abortus strain 19 were also tested by the same assays and the FPIA was found to be 100% specific. Gall et al (2000) compared a number of serological tests for the detection of antibodies to B. abortus in Bison. The sensitivity and specificity of FPA in the preliminary evaluation were 92.1% and 99.4% respectively. The sensitivity and specificity in a subsequent blind study were 96.3% and 97.6% respectively. In a double blind study conducted on Bison vaccinated with B. abortus strain 19, the data suggested that the FPA could differentiate Bison infected with B. abortus from Bison vaccinated with B.abortus strain 19. They found that both the I-ELISA and C-ELISA performed nearly as well as FPA but the BPAT and CFT did not perform as well as FPA, C-ELISA or I-ELISA in both studies. Gall et al (2001) evaluated the complement fixation test (CFT), competitive enzyme immunoassay (C-ELISA), indirect enzyme immunoassay (I-ELISA) and fluorescence polarization assay (FPA) for the detection of antibodies to B. abortus and B. suis biotype 4 in caribou, elk, red deer and reindeer. When combining the data, FPA and the C-ELISA were determined to be the most suitable tests for the serodiagnosis of Cervidae. The overall actual sensitivity of the CFT and I-ELISA was 100% whereas the sensitivity for C-ELISA and FPA was 99%. The overall relative specificity of CFT, C-ELISA, I-ELISA and the FPA were 65%, 93%, 99%, 99% and 99%, respectively. The specificities of the BPAT, CFT, C-ELISA, FPA and I-ELISA for 55 elk vaccinatd with B. abortus S19 and tested 4 months post vaccination were 32

45 14%, 31%, 51%, 84% and 2%, respectively. They concluded that the FPA is the diagnostic test of choice because it has sensitivity and specificity values comparable to the C-ELISA; it has the capability to distinguish vaccinal antibody and antibody resulting from exposure to cross reacting organism such as Yersinia enterocolitica 0:9 from antibody to Brucella spp. in most cases; it is technically simple to do; it is adaptable to field use and it is relatively inexpensive. Nielsen et al (2001) used fluorescence polarization assay (FPA) to test whole blood samples prepared by mixing blood cells from cattle without exposure to B. abortus with sera from animals with confirmed (bacteriologically) infection. Relative sensitivity and specificity values for the FPA performed in the field, based on buffered antigen plate agglutination test and competitive enzyme immunoassay results were 95.3% and 97.3%, respectively whereas the relative sensitivity and specificity values of the FPA when testing stored whole blood samples were 100% each. Lucero et al (2003) assessed fluorescence polarization immunoassay (FPA) in comparison to a competitive enzyme immunoassay (C-ELISA) and conventional serological tests for the diagnosis of brucellosis on a total of 587 human sera. They found that on 340 sera from asymptomatic blood donors with no evidence of brucellosis, the specificity of the FPA was 97.9% using a cut-off value of 72 mp. Sera from Brucella-infected patients (11 B. melitensis, 32 B. abortus, 32 B. suis and one Brucella spp.) yielded a sensitivity estimate of 96.1%. In tests on 84 sera from suspected brucellosis patients, FPA detected 80 cases. Of 87 sera from patients with probable infection, 15 were detected by both C-ELISA and FPA, three by C-ELISA only and four by FPA only. McGiven et al (2003) tested serum samples from 146 confirmed (by culture) Brucella-infected cattle in conjunction with serum samples from 1947 noninfected cattle. The competitive ELISA (C-ELISA) was validated using these positive 33

46 reference samples and 1440 negative samples, while data for the indirect ELISA (I- ELISA) was generated from 6957 negative samples plus the positive sera. They used the published diagnostic specificity (DSp) data for the complement fixation test (CFT) and serum agglutination test (SAT) in conjunction with the test results on the positive sera to obtain diagnostic specificity plus diagnostic sensitivity (DSn). After selection of a cutoff for the FPA and C-ELISA, the diagnostic specificity and sensitivity total for each test were compared. The results, with 95% confidence intervals, were: FPA (195.7±.79), I-ELISA (195.0±.70), C-ELISA (194.9±.48), CFT (191.7±.45), and SAT (180.4±.33). Pfeiffer et al (2007) compared the Mexican and Canadian OIE tests viz. Rose Bengal test (RBT), the buffered plate agglutination test (BPAT), and the confirmatory complement fixation test (CFT) with the fluorescence polarization assay (FPA), alone or in combination, using indirect and competitive enzyme-linked immunosorbant assays as classification variables for goat sera obtained from an area of high prevalence and widespread vaccination. The relative sensitivities and specificities were, respectively, 99.7% and 32.5% for RBT3 (3% cell concentration), 92.8% and 68.8% for RBT8 ( 8% cell concentration), 98.4% and 84.8% for Canadian CFT, 83.7% and 65.5% for Mexican CFT, and 78.1% and 89.3% for FPA. The use of FPA as the confirmatory test in combination with other tests significantly increased the final specificities of the screening tests alone; BPAT, RBT3, and RBT8 plus FPA resulted in final specificities of 90%, 91.2%, and 91.3%, respectively, whereas for the combinations RBT3 plus Mexican CFT, RBT8 plus Mexican CFT, and BPAT plus Canadian CFT, specificities were 65.5%, 63.2%, and 91.7%, respectively. They suggested that the FPA may be routinely applied as an adaptable screening test for diagnosis of goat brucellosis and as a confirmatory test for screening test series. 34

47 Nicola et al (2010) compared the FPA results with those of the Buffered Antigen Plate Agglutination test (BPAT) confirmed by Seroagglutination in tube (SAT), the competitive enzyme-linked immunosorbant assay (C-ELISA) and the indirect enzyme-linked immunosorbant assay (I-ELISA). Serum samples from 554 goats free from brucellosis were tested with the BPAT, SAT, C-ELISA and I-ELISA to determine its specificity. The sensitivity and specificity of FPA was 98.1% (CI ) and 92.8% (CI ). The relative sensitivity compared with I-ELISA and C-ELISA was 97% and 92.9% respectively. The relative specificity compared with I-ELISA and C-ELISA was 97.5% and 98% respectively. They concluded that the high correlation between FPA results and other serological methods with serum samples of goats is indicative of the excellent performance of FPA technique in diagnosis of caprine brucellosis. Silva et al (2012) compared the performance of three serological tests for diagnosis of B. abortus infections in buffaloes (Bubalus bubalis). Serum samples collected from 696 adult females were submitted to the competitive enzyme-linked immunosorbant assay (C-ELISA), (I-ELISA), fluorescence polarization test (FPA), 2- mercaptoethanol test (2-ME) and complement fixation test (CFT). The best combinations of relative sensitivity (SEr) and relative specificity (SPr) and Kappa were given by C-ELISA (96.9%, 99.1%, and 0.932, respectively) and FPA (92.2%, 97.6% and 0.836%, respectively). They suggested C-ELISA and FPA as the most promising confirmatory tests for the serological diagnosis of brucellosis in buffaloes. Weiner et al (2013) evaluated the fluorescence polarisation assay (FPA) in the diagnosis of porcine brucellosis in comparison with Rose Bengal test (RBT), serum agglutination test (SAT), complement fixation test (CFT), 2-mercaptoethanol test, and ELISA. 817 serum samples from pigs, including 612 serum samples from healthy 35

48 animals, seven serum samples from B. suis bv 2 culture positive animals, and 198 serum samples classified as false positive, originated from confirmatory investigations, were used. All serum samples from healthy animals, negative in RBT, SAT, CFT and ELISA were also negative in FPA. All serum samples positive in serological examination, originated from Brucella infected animals, were also positive in FPA. Among sera classified as false positive, almost half of the samples tested (49.49%) reacted positively in FPA. They concluded the usefulness of FPA in diagnosis of porcine brucellosis, but it does not allow resolving the problem of discrimination cross-reacting from specific antibodies Detection of Brucella by PNA-FISH assay Stender et al (1999) described fluorescence in situ hybridization (FISH) method using peptide nucleic acid (PNA) probes for differentiation between species of the Mycobacterium tuberculosis complex (MTC) and nontuberculous mycobacteria (NTM) in acid-fast bacillus-positive (AFB+) cultures. The test was based on fluorescein-labelled PNA probes that target the rrna of MTC or NTM species when applied to smears of AFB+ cultures for microscopic examination. When evaluated with 30 AFB1 cultures from Denmark and 42 AFB1 cultures from Thailand, the MTC-specific PNA probe showed diagnostic sensitivities of 84% and 97%, respectively, and a diagnostic specificity of 100% in both studies, whereas the NTMspecific PNA probe showed diagnostic sensitivities of 91% and 64%, respectively, and a diagnostic specificity of 100% in both studies. They found that the low sensitivity of the NTM-specific PNA probe in the Thai study was due to a relatively high prevalence of Mycobacterium fortuitum, which is not identified by the probe. In total, 63 (87%) of the cultures were correctly identified as MTC (n 5 46) or NTM (n 5 17), whereas the remaining 9 were negative with both probes and thus the results were 36

49 inconclusive. None of the samples were incorrectly identified as MTC or NTM; thus, the predictive value of a valid test result obtained with TB PNA-FISH was 100%. Lago et al (2000) developed a whole cell hybridization assay with fluorescent oligonucleotide probes derived from the 16S rrna sequence of B. abortus in combination with flow cytometry. With the three fluorescent probes selected, a positive signal was observed with all the representative strains of the species and biovars of Brucella and with a total of nine different Brucella clinical isolates. No fluorescence signals were detected with any of the bacteria showing serological cross reactions with Brucella spp. and with a total of 17 clinical isolates not belonging to the genus Brucella. They suggested that the 16S rrna whole cell hybridization technique could be a valuable diagnostic tool for the detection and identification of Brucella spp. Hongmanee et al (2001) evaluated a new fluorescence in situ hybridization assay based on peptide nucleic acid probes (MTB and NTM probes targeting tuberculous and nontuberculous species, respectively) for the identification of Mycobacterium tuberculosis complex and differentiation between tuberculous and nontuberculous mycobacteria (NTM) using Lowenstein-Jensen (LJ) solid cultures from 100 consecutive sputum samples and 50 acid-fast bacillus (AFB)-positive sputum samples as well as Mycobacteria Growth Indicator Tube (MGIT) liquid cultures from 80 AFB-positive sputum samples. Mycobacterium species could be identified from a total of 53 LJ cultures and 77 MGIT cultures. The diagnostic specificities of the MTB and NTM probes were 100% for both cultures. The diagnostic sensitivities of the MTB probe for the LJ and MGIT cultures were 98% and 99%, respectively, whereas the sensitivities of the NTM probe were 57% and 100%, 37

50 respectively. They concluded that the relatively low sensitivity of the NTM probe was due to a high proportion of M. fortuitum, which was not identified by the probe. Perry-O'Keefe et al (2001) developed a fluorescence in situ hybridization (FISH) method using Peptide Nucleic Acid (PNA) probes for analysis of gramnegative and gram-positive bacteria, as well as yeast. Fluorescent labeled PNA probes targeting specific rrna sequences of Escherichia coli, Pseudomonas aeruginosa, Staphyloccocus aureus, Salmonella as well as PNA probes targeting Eubacteria and Eucarya were designed. Four color images using differently labeled PNA probes showed simultaneous identification of E. coli, P. aeruginosa, S. aureus and Salmonella, thereby demonstrating the potential of multiplex FISH for various diagnostic applications. Oliveira et al (2002) described fluorescence in situ hybridization (FISH) method with peptide nucleic acid (PNA) probes that target 16S rrna for identification of Staphylococcus aureus directly from positive blood culture bottles. Evaluations with 17 reference strains and 48 clinical isolates, including methicillinresistant and methicillin-susceptible S. aureus species, coagulase-negative Staphylococcus species and other clinically relevant and phylogenetically related bacteria and yeast species, showed that the assay had 100% sensitivity and 96% specificity. Rigby et al (2002) described C. albicans PNA-FISH method based on a fluorescein-labeled PNA probe that targets C. albicans 26S rrna. The specificity of the method was confirmed with 23 reference strains representing phylogenetically related yeast species and 148 clinical isolates covering the clinically most significant yeast species, including C. albicans (n-72), C. dubliniensis (n-58), C. glabrata (n-5), C. krusei (n-2), C.parapsilosis (n-4), and C. tropicalis (n-3). The performance of the 38

51 C. albicans PNA-FISH method as a diagnostic test was evaluated with 33 routine and 25 simulated yeast-positive blood culture bottles and showed 100% sensitivity and 100% specificity. They concluded that this 2.5hr method for the definitive identification of C. albicans directly from yeast-positive blood culture bottles provided important information for optimal antifungal therapy and patient management. Wellinghausen et al (2006) described a new 16S rrna-based fluorescence in situ hybridization assay that facilitates rapid and specific detection of all human pathogenic species of Brucella and that can be applied directly to positive blood cultures. Søgaard et al (2007) evaluated a novel peptide nucleic acid (PNA) probe targeting a region of the 23S rrna gene of Klebsiella pneumoniae by fluorescence in situ hybridization (FISH). The probe was found to be specific for the K. pneumoniae complex (K. pneumoniae including Klebsiella ozaenae and Klebsiella variicola). When the diagnostic accuracy was evaluated with 264 blood cultures containing Gram-negative rods, sensitivity was found to be 98.8%, specificity 99.5%, positive predictive value 98.8% and negative predictive value 99.5%. They concluded that the K. pneumoniae probe provided an accurate diagnosis within 3 hr and may supplement other methods for direct identification of Gram-negative bacteria. Llacsahuanga et al (2010) evaluated the applicability of the PNA-FISH method for detection of Streptococcus agalactiae [group B streptococci (GBS)] for all different serotypes as well as for different haemolytic and non-haemolytic isolates from swab samples. Cerqueira et al (2011) developed PNA-FISH as a new diagnostic method for the determination of clarithromycin resistance of Helicobacter pylori. The set of 39

52 probes targeting the point mutations responsible for clarithromycin resistance was applied to H. pylori suspensions and showed 100% sensitivity and specificity (95% CI, and 95% CI, respectively). The optimized PNA-FISH based diagnostic method to detect H. pylori clarithromycin resistance was shown to be a very sensitive and specific method for the detection of clarithromycin resistance in the H. pylori smears and also proved to be a reliable method for the diagnosis of this pathogen in clinical samples and an alternative to existing plating methods. Harris and Hata (2013) carried out rapid identification of bacteria and Candida using PNA-FISH from blood and peritoneal fluid cultures. Excellent accuracy of PNA-FISH in blood and peritoneal fluids with reduced time to identification was observed as compared to conventional culture based techniques. They concluded that species level identification based on PNA-FISH could contribute to notable cost savings due to adjustments in empiric antimicrobial or antifungal therapy as appropriate to the pathogen identified. Machado et al (2013) developed and optimized a novel Peptide Nucleic Acid (PNA) Fluorescence in situ Hybridization assay (PNA-FISH) for the detection of Lactobacillus spp. and G. vaginalis in mixed samples. They evaluated and validated two specific PNA probes by using 36 representative Lactobacillus strains, 22 representative G. vaginalis strains and 27 other taxonomically related or pathogenic bacterial strains commonly found in vaginal samples. The probes were also tested at different concentrations of G. vaginalis and Lactobacillus species in vitro, in the presence of a HeLa cell line. Specificity and sensitivity of the PNA probes were found to be 98.0% (95% confidence interval (CI), from 87.8 to 99.9%) and 100% (95% CI, from 88.0 to 100.0%), for Lactobacillus spp.; and 100% (95% CI, from 92.8 to 100%) 40

53 and 100% (95% CI, from 81.5 to 100.0%) for G. vaginalis. Moreover, the probes were evaluated in mixed samples mimicking women with BV or normal vaginal microflora, demonstrating efficiency and applicability of the PNA-FISH. They concluded that the method accurately detects Lactobacillus spp. and G. vaginalis species in mixed samples, thus enabling efficient evaluation of the two bacterial groups, most frequently encountered in the vagina. 41

54 CHAPTER III MATERIALS AND METHODS The present study on isolation, molecular and serological detection of B. abortus was carried out in the Department of Veterinary Microbiology, Guru Angad Dev Veterinary and Animal Sciences, Ludhiana with an aim to develop PNA-FISH assay for detection of Brucella spp., to standardize FPA for detection of bovine brucellosis and its comparison with C-ELISA, to develop a multiplex PCR for simultaneous detection of organisms associated with bovine abortions and for comparative evaluation of a multiplex PCR (Bruce ladder), Hinic Real-time PCR, PNA-FISH, FPA and C-ELISA used for diagnosis of bovine brucellosis. 3.1 Collection of samples Samples for isolation and serological detection of B. abortus were collected from apparently healthy and brucellosis suspected cattle and buffaloes brought to the Veterinary Clinical Complex and Dairy farm, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana; from areas in and around Ludhiana in Punjab state from June 2013 to November A total of 100 samples consisting of vaginal mucus, uterine discharges, placental and foetal cotyledons and foetal stomach contents were collected from cattle and buffaloes suffering from abortions and reproductive problems for isolation of B. abortus. Details of samples collected for isolation of B. abortus are shown in Table1. In addition, 630 serum samples were collected from cattle and buffaloes for serological detection of antibodies to Brucella spp.

55 Table 1: Isolation and identification of B. abortus Type of Sample Cattle No. of samples processed Buffaloes No. of samples processed Foetal stomach content Uterine discharge Vaginal mucus Placenta Total Foetal stomach contents The abdomen of the aborted foetus was incised by a scalpel blade and then stomach was taken to the exterior followed by aspiration of stomach contents in a sterile disposable syringe. The samples were then transported on ice to the laboratory for processing Vaginal mucus and Uterine discharges Cervico vaginal mucus and uterine discharges from cattle and buffaloes were collected with sterilized cotton swabs. The swabs containing thick vaginal mucus and uterine discharges were suspended in test tube containing phosphate buffered saline (PBS) and then transported on ice to the laboratory for processing. 3.2 Equipments and Reagents required for the collection of samples Vaginal mucus and Uterine discharges 1. Test tubes (15 ml) 2. Sterile swabs 3. Sterile phosphate buffered saline (ph 7.2) Foetal Stomach Contents 1. Sterile disposable syringes (5 ml) 2. Scalpel Blade 43

56 3. 18G Needles 4. Spirit Swabs 5. Disposable Gloves Composition of Phosphate buffered saline (PBS) for sample collection Solution A: 0.2M sodium dihydrogen phosphate Solution B: 0.2M disodium hydrogen phosphate 31.2g/lt 28.39g/lt The working solution of PBS was prepared by mixing 140ml of solution A with 360ml of solution B and it was diluted to 1000ml with distilled water and then 8g of NaCl was added to it. The solution was sterilized by autoclaving at 121 C at 15lbs pressure for 15 min. and then stored at 4 C till further use. 3.3 Media used Brucella agar base (4.3g) (Himedia) was dissolved in 100ml of distilled water and the solution was sterilized by autoclaving at 121 C at 15lbs pressure for 15min. The medium was cooled to 50 C and then 2ml working solution of Brucella selective supplement containing polymyxin B sulphate (2200 IU), bacitracin (12,500 IU), nystatin (50,000 IU), cycloheximide (50.0 mg), nalidixic acid (2.5 mg) and vancomycin (10.0mg) was added into the Brucella agar base and mixed gently. Working solution of Brucella selective supplement was prepared by adding 10 ml of 50% methanol in a vial that can be used for 500ml of media. The media were then poured in sterile petri plates and allowed to solidify and then stored at 4 C till further use. 3.4 Processing of samples Samples of foetal stomach contents, vaginal mucus and uterine discharges were directly inoculated on plates containing Brucella selective medium. The samples of placenta and cotyledons were washed in PBS, flamed to sterilize the surface and then homogenised in pestle and mortar. The homogenised samples were then 44

57 inoculated on the selective media for isolation purpose. The inoculated plates were incubated at 37 C under microaerophilic environment in candle jar for 3-5 days and were examined daily for the growth of Brucella. 3.5 Observations The plates were examined after 3-5 days for the presence of colonies typical of B. abortus Identification Smears were prepared from the suspected colonies and stained with Brucella Differential Staining (modified Ziehl Nielsen s stain) method. The smears were then examined under oil immersion lens. The isolates demonstrating small gram negative coccobacilli in addition to positive catalase and oxidase test were subjected to purification prior to performing confirmatory tests Purification Colonies typical of Brucella spp. were subcultured onto fresh selective Brucella agar base plates and incubated at 37 C under microaerophilic environment in candle jar for 3-5 days. After 5 days, the culture was maintained by keeping the culture plates in refrigerator at 4 C followed by regular subculturing onto fresh medium plates Confirmatory tests The following tests were carried out on the cultures for confirmation of the isolates Rapid slide agglutination test A dense suspension of the test Brucella was prepared in normal saline on glass slide. A drop of the suspension was added to loopful of antiserum and mixed. Agglutination within one minute indicated positive result. 45

58 Oxidase test Standard oxidase discs (HiMedia) were used to perform the test. A loopful culture from single colony was touched on the disc with the help of a wooden stick. Immediate development of blue colour was considered as a positive test Catalase test This test was performed by taking 2-3 drops of 3% H 2 O 2 on a clean grease-free glass slide and single colony from Brucella selective medium plate was mixed with the help of an inoculation loop. Immediate formation of gas bubbles was considered as positive test Nitrate reduction Nitrate broth was inoculated with the test bacterium and incubated at 37 C for 24 hrs. Five drops of each reagent (Reagent A- 5g alpha naphthylamine in 1 litre 5N acetic acid and Reagent B- 8g sulphanilic acid in 1 litre 5N acetic acid) were added to the nitrate broth. The test tube was shaken and results were read after 1-2 minutes. Colourless reaction indicated that no nitrite was present in the broth. Red colouration meant that the nitrate in the test broth was reduced to nitrite and test was positive (Quinn et al 1994) Urease test Christensen s urea slope was inoculated with a loopfull of the culture. The test tube was incubated at room temperature and examined at half hour intervals. Positive reaction was when slope turned pink within half to two hours. The test was regarded as negative if there was no reaction after 24 hours (Quinn et al 1994) Indole test Brucella was grown on trypticase soya agar slant with the test strip suspended over the slant. The strip was examined daily for 4 days and change in the colour of the strip from yellow to pink indicated positive test. 46

59 Production of H 2 S Brucella isolate was grown on triple sugar iron (TSI) agar slant with lead acetate strip suspended on the slant. The strip was examined daily for 4 days and blackening of the strip indicated a positive test Growth in the presence of dyes The test was carried out as per Quinn et al (1994) by incorporating the dyes thionin (blue) and basic fuchsin (red) separately in typticase soya agar at the concentration of 20 g/ml. This medium was prepared by heating a 0.1% solution of either dye in a boiling water bath for 20 min and then adding it to the required amount of autoclaved agar. The dye was mixed with the agar and poured into petri dishes. A sterile swab was used to inoculate dye media with a suspension of the test strain. The inoculated plates were incubated at 37 C under microaerophilic environment in candle jar for 3-4 days and then examined for growth. 3.6 Standard/ reference strains B. abortus S19 and B. abortus S99 available in the Department of Veterinary Microbiology, GADVASU, Ludhiana were used as reference strains for molecular work. These were maintained by regular sub-culturing after every 15 days on Brucella selective medium (BSM) plates. 3.7 Genus specific Polymerase chain reaction (PCR) for detection of Brucella Confirmation of the Brucella isolates was done by genus specific PCR primers B4/B5 (Baily et al 1992) Extraction of genomic DNA Genomic DNA of B. abortus S19 and clinical isolates of B. abortus was extracted by using HipPurA bacterial genomic DNA purification kit (Himedia) as per the manufacturer s instructions. 47

60 3.7.2 Primer sequence The PCR assay was carried out using primers B4/B5 (Baily et al 1992). These primers are derived from bcsp31 gene of B. abortus (Table 2). Table 2: Sequence of primers used for detection of genus Brucella Name of the primers Gene Sequence (5-3 ) Size of the amplified product Reference B4 (F) B5 (R) bcsp31 TGG CTC GGT TGC CAA TAT CAA CGC GCT TGC CTT TCA GGT CTG 223 bp Baily et al (1992) PCR protocol (B4/B5) Amplification reaction mixture (for one reaction) was prepared in a volume of 25µl containing 1X PCR buffer, 20pmol/µl of each primer, 1.5mM MgCl 2, 1U of Taq DNA polymerase, 200µM of dntps and 5µl of template DNA (Table 3). PCR cycling conditions are depicted in Table 4 and consisted of initial denaturation at 94 C for 5 min, followed by 35 cycles each of 94 C for 1 min (denaturation), 65 C for 1 min (annealing) and 72 C for 1 min (extension), and a final extension of 72 C for 10 min. Table 3: Brucella PCR reaction mixture for B4/B5 primer pair S. No. PCR components Required concentration Amount (µl) 1 H 2 O (PCR grade) Up to 25 µl PCR Buffer (10X) 1X MgCl 2 (25 mm) 1.5 mm dntps (10 mm) 200µM Primers each) (40pmol/µl 20 pmol each Taq (5U/µl) 1 U DNA template ~100 ng Total volume 25 48

61 Table 4: Brucella PCR program by using B4/B5 primer pair Stage Step Temperature ( C) Duration No. of cycles 1 Initial denaturation 94 5 min 1 2 Denaturation 94 60s Annealing 65 60s 35 3 Extension 72 60s Final extension min Application of PCR assay using B4/B5 primer pair on clinical samples A total of 40 clinical samples of uterine discharges (22), vaginal mucus (10) and foetal stomach contents (8) were collected from repeat breeding cattle and buffaloes and from cases of abortion. DNA was extracted directly from the clinical samples by bacterial genomic DNA purification kit (Himedia) and used for PCR. PCR ingredients and conditions were same as described in section Analysis of PCR product The amplified products were analysed by electrophoresis at 79V for 1 hour in 1.0% agarose gel in 1X TBE buffer containing ethidium bromide and visualised under Alpha Imager 3400HP Gel Documentation System (Alpha Innotech) and photographed Preparation of solution/buffers 1. Stock solution of Tris borate Ethylenediaminetetraacetic acid (10X TBE) Tris base Boric acid 108 g 55 g 0.5 M EDTA (ph 8.0) g DW to make 1000 ml 49

62 2. Working TBE buffer (1X TBE) 10X TBE Sterile distilled water 100 ml 900 ml 3. Agarose gel (1%) 1X TBE buffer Agarose 100 ml 1 g 4. Ethidium bromide stock (50X) Ethidium bromide DW 10 mg 1 ml Incorporated into the mixture of agarose and electrophoresis buffer at a concentration of 0.5µg/ml. 3.8 Detection of Brucella isolates by Bruce Ladder multiplex PCR assay Extraction of genomic DNA Genomic DNA was extracted from the pure cultures by heat lysis of the cultures. About 1-2 bacterial colonies were suspended in 200µl of normal saline solution (NSS) and incubated in a hot dry bath for 10 min and then immediately kept on ice. The material was centrifuged for 5 min at 12,000g and supernatant was used as a template DNA for PCR Bruce Ladder Multiplex PCR Multiplex PCR was carried out by using eight pair primer cocktail as per Garcia Yoldi et al (2006) (Table 5). 50

63 Table 5: Multiplex PCR (Bruce ladder) primer sequence Primer Target Gene Sequence (5-3 ) Size of the amplified product (bp) Source of genetic differences BMEI0998f wboa ATC CTA TTG CCC CGATAA GG 1,682 IS711 insertion in BMEI0998 in BMEI0997r GCT TCG CAT TTT CAC TGT AGC B. abortus RB51 and deletion of 15,079 bp in BMEI0993 BMEI1012 in B. ovis BMEI0535f bp26 GCG CAT TCT TCG GTT ATG AA 450 IS711 insertion in BMEI0535 BMEI0536r CGC AGG CGA AAA CAG CTA TAA BMEI0536 in Brucella strains isolated from marine mammals BMEII0843f omp31 TTT ACA CAG GCA ATC CAG CA 1,071 Deletion of 25,061 bp in BMEII0844r GCG TCC AGT TGT TGT TGA TG BMEII826 BMEII0850 in B. abortus BMEI1436f BMEI1435r Polysaccharide Deacetylase ACG CAG ACG ACC TTC GGT AT 794 Deletion of 976 bp in BMEI1435 TTT ATC CAT CGC CCT GTC AC in B. canis BMEII0428f eryc GCC GCT ATT ATG TGG ACT GG 587 Deletion of 702 bp in BMEII0428r AAT GAC TTC ACG GTC GTT CG BMEII0427 BMEII0428 in B. abortus S19 BR0953f BR0953r ABC transporter binding Protein BMEI0752f Ribosomal protein S12, BMEI0752r gene rpsl BMEII0987f BMEII0987r Transcriptional regulator, CRP family GGA ACA CTA CGC CAC CTT GT 272 Deletion of 2,653 bp in BR0951 GAT GGA GCA AAC GCT GAA G BR0955 in B. melitensis and B. abortus CAG GCA AAC CCT CAG AAG C 218 Point mutation in BMEI0752 in GAT GTG GTA ACG CAC ACC AA B. melitensis Rev.1 CGC AGA CAG TGA CCA TCA AA 152 Deletion of 2,203 bp in GTA TTC AGC CCC CGT TAC CT BMEII0986 BMEII0988 in B. neotomae 51

64 PCR was carried out in a 96 well thermocycler (Applied Biosystems). The reaction mixture for the PCR is shown in Table 6 and consisted of total 25µl volume containing 1X PCR buffer, 0.4mM dntps, 1.5mM MgCl 2, primer cocktail containing 6.25pmol/µl of each primer, 2µl of template DNA, 1.5U of Taq DNA polymerase and PCR grade water to make volume upto 25µl. PCR amplification conditions are depicted in Table 7 and consisted of an initial denaturation at 95 C for 7 min followed by denaturation at 95 C for 35 sec, primer annealing at 65 C for 45 sec, extension at 72 C for 3 min for a total of 25 cycles and final extension at 72 C for 6 min. Table 6: Multiplex PCR (Bruce ladder) reaction mixture S. No. PCR components Required concentration Amount (µl) 1 PCR Buffer (10X) 1X MgCl 2 (25mM) 1.5mM dntps (10mM) 400 µm each one Primers 6.25 pmol each 2 5 Taq (5U/µl) 1.5 U DNA template ~100ng H 2 O (PCR grade) Upto 25µl Total volume 25 Table 7: Multiplex PCR (Bruce ladder) program Stage Step Temperature ( C) Duration No. of cycles 1 Initial denaturation 95 7 min 1 2 Denaturation 95 35s Annealing 65 45s 25 3 Extension 72 3 min Final extension 72 6 min Analysis of PCR product The amplified products were analysed by electrophoresis at 79V for 1 hour in 1.5% agarose gel in 1X TBE buffer containing ethidium bromide and visualised under 52

65 Alpha Imager 3400HP Gel Documentation System (Alpha Innotech) and photographed Application of Bruce Ladder multiplex PCR assay on clinical samples A total of 40 clinical samples of uterine discharges (22), vaginal mucus (10) and foetal stomach contents (8) were collected from repeat breeding cattle and buffaloes and from cases of abortion. DNA was extracted directly from the clinical samples by bacterial genomic DNA purification kit (Himedia) and used for Bruce Ladder multiplex PCR. PCR ingredients and cycling conditions were same as described in section Genus specific Hinic Real-time PCR using IS711 specific primers and Taqman probe chemistry for identification of Brucella Hinic Real-time PCR using IS711 primers and Taqman probe chemistry was employed for the detection of Brucella isolates as per Hinic et al (2009) Extraction of genomic DNA Genomic DNA of B. abortus S19 and clinical isolates of Brucella spp. was extracted by using bacterial genomic DNA purification kit (Himedia) as per the manufacturers instructions Concentration and purity of DNA The concentration and purity of the extracted DNA was determined using spectrophotometer (Nanodrop, ThermoScientific). 1µl of deionised water was first loaded on the nanodrop pedestal for calibration, followed by 1µl of elution buffer (used for reconstitution of DNA) as blank. Finally 1µl of DNA sample was loaded. The optical density (OD) was taken at 260 nm and 280 nm wavelength of the UV spectrum. The purity of the extracted DNA was determined by the ratio of OD values at 260:280 nm wavelengths. Values of approx. 1.8 indicated that the DNA sample was pure. 53

66 3.9.3 Primer and probe sequence Primer and probe sequence of Hinic Real-time PCR is given in Table 8. The fluorophore used was FAM and TAMRA was used as the quencher Optimization of primer and probe concentrations The optimal concentration of target gene primer pair and probe used in this study was evaluated through Real-time PCR by using them in decreasing concentrations viz., 1.0µl, 0.9µl, 0.8µl, 0.7µl, 0.6µl, 0.5µl, 0.4µl, 0.3µl, 0.2µl and 0.1µl from 40X stock solution of primer probe for Brucella spp. The minimum concentration at which appropriate amplification was observed was taken for further relative quantification. The cycling conditions, quantity and concentration of various components used in Real-time PCR for confirmation of B. abortus S19 DNA, optimization of primer and probe concentrations and annealing temperatures are depicted in Table 9 and 10 respectively. Table 8: Hinic Real-time PCR primer and probe sequence PCR Target Sequence IS711 Probe (5 Fluorophore 3 Quencher) Forward primer/reverse primer (5 3 ) GCTTGAAGCTTGCGGACAGT/G GCCTACCGCTGCGAAT FAM- AAGCCAACACCCGGCCATTATGGT TAMRA Table 9: Quantity and concentration of various components used in Real-time PCR based diagnosis of Brucellosis S. No. PCR components Amount (µl) 1 Master mix (2X) 10 2 Primer probe (40X) DNA ~100ng 2 4 Nuclease free water Total 20 54

67 Table 10: Cycling conditions used in diagnosis of brucellosis by Real-time PCR using Taqman chemistry Stage Step Temperature C Duration No. of Cycles 1 Initial Denaturation min 1 2 Denaturation 95 15s Annealing and extension 60 1 min Sensitivity evaluation of Real-time PCR assay Initial genomic DNA concentration of B. abortus S19 was measured using Nanodrop. Ten fold serial dilutions of genomic DNA of B. abortus S19 were made using nuclease free water. After that each dilution was used for Real-time PCR in the standardized reaction volume and cycling condition as described above in Table 9 and Table 10 and C t value was recorded for each dilution Specificity evaluation of the Real-time PCR assay Real-time PCR was evaluated for specificity by screening some commonly available bacteria like E.coli, Salmonella, Staphylococcus, Proteus, Streptococcus, Pseudomonas, Klebsiella and Pasteurella with standard B. abortus S19. The cycling conditions and reaction mixture were same as described above in Table 9 and Table 10 respectively Application of Real-time PCR on DNA extracted from clinical samples A total of 40 clinical samples comprising of uterine discharges (22), vaginal mucus (10) and foetal stomach contents (8) were collected from repeat breeding cattle and buffaloes and from cases of abortion. DNA was extracted directly from the clinical samples by bacterial genomic DNA purification kit (Himedia) and used for the Real-time PCR assay. The cycling conditions and reaction mixture were same as described above in Table 9 and 10 respectively. 55

68 3.10 Multiplex PCR (mpcr) for detection of various agents associated with bovine abortions Bacterial strains The standard reference bacterial strains B. abortus S99, Mycoplasma spp., Listeria monocytogenes, and Leptospira spp. were used. In addition, a number of other commonly available and cross reacting bacteria like Salmonella, E.coli, Proteus, Mycobacterium, Pasteurella, Staphylococcus, Streptococcus, Campylobacter fetus, Pasteurella and Pseudomonas were also taken for evaluation of specificity DNA extraction Genomic DNA from all the organisms except Mycoplasma and Leptospira was extracted by Hipur bacterial genomic DNA purification kit (Himedia) as per the manufacturers instructions. DNA of Mycoplasma and Leptospira were obtained from IVRI, Izatnagar (India) Concentration and purity of DNA The concentration and purity of the extracted DNA was determined using spectrophotometer (Nanodrop, Thermo). 1µl of deionised water was first loaded on the nanodrop pedestal for calibration, followed by 1µl of elution buffer (used for reconstitution of DNA) as blank. Finally 1µl of DNA sample was loaded. The optical density (OD) was taken at 260 nm and 280 nm wavelength of the UV spectrum. The purity of the extracted DNA was determined by the ratio of OD values at 260:280 nm wavelengths. Values of approx. 1.8 indicated that the DNA sample was pure Integrity of DNA 10 µl of purified genomic DNA was mixed with 2 µl of 6X loading dye (MBI- Fermantas) and loaded on 1% agarose gel containing ethidium bromide. Gel was run 56

69 at 80V for min in an electrophoresis unit (Biorad) containing 1X TBE buffer. The agarose gel was determined by the presence or absence of smearing along the length of the gel. Intact heavy molecular weight DNA remain stagnant in the agarose wells even after running the gel under the influence of electric current Multiplex PCR primer sequence After carefully studying the genes and primers which have been used so far for detection, oligonucleotide primers specific for Brucella spp., Leptospira spp., Mycoplasma spp. and Listeria spp. target genes were selected from the literature. Before selection, specificty of the primers and their analysis with BLAST software was also taken into consideration. The multiplex PCR assay (mpcr) developed utilised the primers targeting Brucella 31kDa MEM protein, Leptospira 16S rrna gene, Listeria hlya gene and Mycoplasma 16S rdna. The sequence of primers is depicted in Table 11. Table 11: Multiplex PCR primer sequence Organism Target gene Primer sequence References Brucella 31 kda MEM protein 5 -TGGCTCGGTTGCCAATATCAA-3 5 -CGCGCTTGCCTTTCAGGTCTG-3 Tramuta et al 2011 Leptospira 16S rrna gene 5 -GGCGGCGCGTCTTAAACATG-3 5 -TTCCCCCCATTGAAGCAAGATT-3 Tramuta et al 2011 Listeria hlya gene 5'-GCA GTT GCA AGC GCT TGG AGT GAA-3 5 -GCA ACG TAT CCT CCA GAG TGA TCG-3' Paziak- Domanska et al 1999 Mycoplasma 16S rdna 5 -TGCACCATCTGTCACTCTGTTAACCTC-3 5 -GGGAGCAAACAGGATTAGATACCCT-3 Marois et al

70 Multiplex PCR assay The primers chosen for developing mpcr were initially tested in monoplex PCRs. The reaction mixture and cycling conditions for monoplex PCR for Brucella are shown in Table 12 and 13. Amplification reaction mixture (for one reaction) was prepared in a volume of 25µl containing 1X PCR buffer, 20 pmol/µl of each primer, 1.5mM MgCl 2, 1U of Taq DNA polymerase, 200µM of dntps and 5µl of template DNA. PCR cycling conditions consisted of initial denaturation at 94 C for 5 min, followed by 35 cycles each of 94 C for 1 min (denaturation), 65 C for 1 min (annealing) and 72 C for 1 min (extension), and a final extension of 72 C for 10 min. The reaction mixture and cycling conditions for monoplex PCR for Mycoplasma are shown in Table 14 and 15. The reaction mixture consisted of total 25µl volume containing 1X PCR buffer, 100µM dntps, 0.5mM MgCl 2, 20pmol/µl of primers, 5µl of template DNA, 1U of Taq DNA polymerase and PCR grade water to make volume upto 25µl. PCR amplification conditions consisted of an initial denaturation at 90 C for 1 min followed by denaturation at 95 C for 15 sec, primer annealing at 58 C for 20 sec, extension at 75 C for 20 sec for a total of 40 cycles and a final cycle comprising of denaturation at 95 C for 15 sec, annealing at 58 C for 45 sec and final extension at 72 C for 10 min. The reaction mixture and cycling conditions for monoplex PCR for Listeria are shown in Table 16 and 17. The reaction mixture consisted of total 50µl volume containing 1X PCR buffer, 0.8mM dntps, 2mM MgCl 2, 8.0pmol/µl of each primer, 2µl of template DNA, 1U of Taq DNA polymerase and PCR grade water to make volume upto 25µl. PCR amplification conditions consisted of an initial denaturation at 94 C for 2 min followed by denaturation at 94 C for 30 sec, primer annealing at 65 C 58

71 for 1 min, extension at 72 C for 2 min for a total of 25 cycles and final extension at 72 C for 10 min. The reaction mixture and cycling conditions for monoplex PCR for Leptospira are shown in Table 18 and 19. The reaction mixture consisted of total 25µl volume containing 1X PCR buffer, 200 M dntps, 1.5mM MgCl 2, 10pmol/µl of each primer, 2µl of template DNA, 1U of Taq DNA polymerase and PCR grade water to make volume upto 25µl. PCR amplification conditions consisted of an initial denaturation at 94 C for 5 min followed by denaturation at 94 C for 60 sec, primer annealing at 58 C for 60 sec, extension at 72 C for 1 min for a total of 30 cycles and final extension at 72 C for 5 min. Table 12: Brucella PCR reaction mixture S. No. PCR components Required concentration Amount (µl) 1 H 2 O (PCR grade) Up to 25µl PCR Buffer (10X) 1X MgCl 2 (25 mm) 1.5mM dntps (10 mm) 200µM Primers (40pM/µl each) 20pmol/µl each Taq (5U/µl) 1U DNA template ~100ng Total volume 25 Table 13: PCR cycling conditions for Brucella Stage Step Temperature ( ο C) Duration No. of cycles 1 Initial denaturation 94 5 min 1 2 Denaturation 94 60s Annealing 65 60s 35 Extension 72 60s 3 Final extension min 1 59

72 Table 14: Mycoplasma PCR reaction mixture S. No. PCR components Required concentration Amount (µl) 1 H 2 O Up to 25µl PCR Buffer (10X) 1X MgCl 2 (25 mm) 0.5mM dntps (10 mm) 100µM Primers (40pmol/µl each) 20 pmol/µl each Taq (5U/µl) 1U 1 7 DNA template ~100ng Total volume 25 Table 15 PCR cycling conditions for Mycoplasma Stage Step Temperature ο C Duration No. of cycles 1 Initial denaturation 90 1 min 1 Denaturation 95 15s 2 3 Annealing 58 20s Extension 75 20s Denaturation 95 15s Annealing Final extension min 40 1 Table 16 Listeria PCR reaction mixture S. No. PCR components Required concentration Amount (µl) 1 H 2 O Up to 50µl PCR Buffer (10X) 1X 5 3 MgCl 2 (25 mm) 2mM 4 4 dntps (10 mm) 0.8mM 4 5 Primers (8pmol/µl each) 8pmol/µl each 6 Taq (5U/µl) 1U DNA template ~100 ng Total volume

73 Table 17: PCR cycling conditions for Listeria Stage Step Temperature ( ο C) Duration No. of cycles 1 Initial denaturation 94 2 min 1 Denaturation 94 30s 2 Annealing 65 60s Extension 72 1min 60s 35 3 Final extension min 1 Table 18: Leptospira PCR reaction mixture S. No. PCR components Required concentration Amount (µl) 1 H 2 O Up to 25µl PCR Buffer (10X) 1X MgCl 2 (25 mm) 1.5mM dntps (10 mm) 200µM Primers each) (20pmol/µl 10 pmol/µl each Taq (5U/µl) 1U DNA template ~100ng Total volume 25 Table 19: PCR cycling conditions for Leptospira Stage Step Temperature ( ο C) Duration No. of cycles 1 Initial denaturation 94 5 min 1 Denaturation 94 60s 2 Annealing 58 60s Extension 72 60s 30 3 Final extension 72 5 min 1 61

74 Before the final standardised protocol was defined, multiplex PCR was performed several times. In each phase, concentration of primers in the cocktail, annealing temperatures, concentration of Taq polymerase and MgCl 2 was optimised. Gradient PCR was carried out with annealing temperatures ranging from 59 C-61 C keeping in view the Tm values of each individual primer. The primer cocktail for multiplex assay consisted of concentration of 20pmol/μl each for Leptospira and Listeria and 12pmol/μl each for Brucella and Mycoplasma. mpcr reaction mixture is depicted in Table 20 and was performed in 25μl reaction volume consisting of 1X PCR buffer, 400µM dntp mix, 1.5mM MgCl 2, primer cocktail, 2U of Taq polymerase, 5μL of DNA template and nuclease free water to make final volume 25μl. Cycling parameters are shown in Table 21 and consisted of initial denaturation at 94 C for 5 min, followed by 30 cycles each of 94 C for 1 min (denaturation), 61 C for 1 min (annealing) and 72 C for 1 min (extension) and a final extension of 72 C for 5 min. Table 20: Multiplex PCR reaction mixture S. No. PCR components Required concentration Amount (µl) 1 PCR Buffer (10X) 1X MgCl 2 (25mM) 1.5mM dntps (10mM) 400µM Primer cocktail 20pmol/µl each for Leptospira and Listeria; 12pmol/µl each for Brucella and Mycoplasma 5 Taq (2U/µl) 2U 1 6 DNA template ~100ng H 2 O (PCR grade) Upto 25µl Total volume

75 Table 21: Multiplex PCR cycling conditions Stage Step Temperature ( ο C) Duration No. of cycles 1 Initial denaturation 94 5 min 1 cycle 2 Denaturation 94 1 min Annealing 61 1 min Extension 72 1 min 30 cycles 3 Final extension 72 5min 1 cycle Analysis of PCR products PCR amplified products were separated using electrophoresis in 1.8% agarose gel containing ethidium bromide for 1.5hr at 80V and visualised under gel documentation system and photographed Specificity evaluation of multiplex PCR assay The standardised mpcr was assessed for its specificity by screening some commonly available and cross reacting bacterial species with the primers used in this study. Specificity was determined against field isolates/ DNA of Salmonella, E.coli, Proteus, Mycobacterium, Staphylococcus, Streptococcus, Campylobacter fetus, Pasteurella and Pseudomonas. PCR ingredients and conditions were same as described in Table 20 and Sensitivity evaluation of multiplex PCR assay DNA from Brucella, Leptospira, Listeria and Mycoplasma was quantified in nanodrop (Thermo scientific) and cocktail was made containing equal quantities of DNA of each organism. Serial tenfold dilutions of pooled DNA were carried out to determine the detection limit of multiplex PCR assay. PCR ingredients and conditions were same as described in Table 20 and

76 Application of multiplex PCR assay on clinical samples A total of 30 clinical samples of uterine discharges (22) and foetal stomach contents (8) were collected from repeat breeding cattle and buffaloes and from cases of abortion. DNA was extracted directly from the clinical samples by bacterial genomic DNA purification kit (Himedia) and used for mpcr. PCR ingredients and conditions were same as described in Table 20 and Serological detection of antibodies to Brucella spp Collection of serum samples Blood samples (n=630) were collected from the jugular vein of cattle and buffaloes from Dairy farm, GADVASU and from various other organised and unorganised farms of different districts of Punjab after obtaining the consent of the farmers. There was history of vaccination of the animals from Dairy farm, GADVASU whereas the status of vaccination was unknown for samples collected from other organized and unorganized farms. Serum was separated from the blood samples and stored at -20 C till use. Serum samples were then subjected to various serological tests for screening of brucellosis Rose Bengal Plate Agglutination Test (RBPT) RBPT Antigen The RBPT Antigen obtained from Punjab Veterinary Vaccine Institute was used for the test Test Procedure Serum samples and RBPT antigen were brought to the room temperature and then one drop (0.03 ml) of serum was taken on a clean, dry and non greasy glass slide. The antigen bottle was shaken well to ensure homogenous suspension and then one 64

77 drop (0.03 ml) of the antigen was added. The antigen and serum were mixed thoroughly for 4 min and were then analyzed for clumping/agglutination Interpretation of results Definite clumping/agglutination was considered as positive reaction, whereas no clumping/agglutination was considered as negative. In each test, a positive and a negative control was run using known positive and known negative serum Standard tube agglutination test (STAT) Brucella Antigen B. abortus S99 plain antigen (IVRI, Izatnagar) was used as per the method of Alton et al (1975) Test Procedure Two fold serial dilutions of the serum samples were prepared in phenol saline and equal quantity (0.5ml) of the antigen was added in each tube. The tubes were then incubated at 37 C for 24 hrs Interpretation of results A titer of 1:40 or above was considered as a positive reaction and the results were compared with the antigen control tube showing 50% agglutination Microagglutination test (MAT) Antigen for MAT B. abortus S99 plain antigen was procured from IVRI, Izatnagar Test Procedure MAT was performed on 96 well microtitre plate. 80µl of phenol saline was taken in the first well and 50µl in rest of the wells. 20µl of serum sample was added in the first well, mixed well and 50µl of diluted serum was transferred to the second well. The process was continued up to the 12 th well. After mixing, 50µl of antigen 65

78 was added to each well, mixed thoroughly and the microtiter plate was incubated at 37ºC for 20 hrs Interpretation of results The degree of agglutination was judged by opacity of the supernatant fluid. The highest serum dilution showing 50% or more agglutination (50% clearing) was considered as the titre of the serum Indirect Enzyme linked immunosorbant assay (I-ELISA) I-ELISA was performed using commercially available kit (IDEXX CHEKIT- BRUCELLOSE SERUM- B. abortus antibody test kit- Netherlands) as per the manufacturers instructions. The samples were analysed in relation to the positive and negative controls as per the formula. Value (%) = OD samples - OD negative control OD positive control - OD negative control x 100 Samples scoring less than 80% were assigned negative and greater than or equal to 80% as positive Competitive ELISA (C-ELISA) C-ELISA was performed using commercially available kit (Brucella antibody C-ELISA; SVANOVIR; Sweden) as per the manufacturers instructions. The samples were analysed in relation to the conjugate control as per the formula: (Mean OD samples/control) PI (Percent Inhibition) = 100 x 100 Mean OD conjugate control Samples scoring less than 30% were assigned negative and greater than or equal to 30% as positive Fluorescence polarisation assay (FPA) The FPA was performed as per the method carried out by Nielsen et al (1996). 66

79 Extraction of O-Polysaccharide (OPS) from B. abortus strain S99 OPS from 50g wet weight of B. abortus S99 were prepared by adding 400ml of 2% (v/v) acetic acid. The suspension was autoclaved at 121 C for 15 min. This was followed by centrifugation at 10,000g for 10 min at 4 C to remove cellular debris and the supernatant was collected. The supernatant was then treated with 20g of trichloroacetic acid (TCA). The precipitate was removed by centrifugation at 10,000g for 10 min at 4 C. Supernatant was collected and then dialysed against atleast 100 volumes of distilled water and freeze dried Conjugation OPS (3 mg) was dissolved in 0.6 ml of 0.1M sodium hydroxide and incubated for 1 hr at 37 C. Conjugation was accomplished by adding 300µl of freshly prepared Fluorescein isothiocyanate (FITC) (isomer I, Sigma) dissolved in dimethyl sulfoxide at a concentration of 100mg/ml. The mixture was incubated at 37 C for 1 hr Extraction of conjugated Antigen The conjugated mixture was applied to a Diethyaminoethyl (DEAE)-Sephadex A25 column (1x10cm) and equilibrated with 0.01M phosphate buffer, ph 7.4. The same buffer was used for eluting the column. The first fraction (10-15 ml) was buffer and the second, a bright green fluorescent fraction, was contained in the next 7ml. The buffer was changed to 0.1M phosphate buffer, ph 7.4 and two further fractions were collected. The initial 10ml was buffer, followed by 25ml of bright green fluorescent material. The latter fraction was used as the tracer for the study. The conjugated antigen was stored as a liquid at 4 C in a dark bottle Test procedure and conditions for FPA 20µl of test serum was mixed with 180µl of tris buffer in a 96 well flat bottom black plate (Nunc) and incubated for 2 min. 1 st reading was obtained on multi mode reader (Tecan) (number of flashes per well 25, settle time 100ms, gain optimal and 67

80 filters of 485 nm for excitation and 535 nm for emission). 10µl of the predetermined tracer was added to each well and mixed well. 2 nd reading was obtained after incubation for 2 min. at ambient temperature. The latter reading indicated the amount of antibody in the serum sample. Data from this assay were expressed as millipolarisation units (mp). Positive and negative controls were also included in the study Composition of solutions and buffers used for FPA 1. Sodium hydroxide (0.1M): This was prepared by taking 4g sodium hydroxide that was dissolved in distilled water to make final volume 1lt. The solution was sterilized by autoclaving at 121 C at 15lbs pressure for 15 min. and then stored at 4 C till further use. 2. Phosphate buffer (0.01M) (ph: 7.4) Solution A: 0.02M disodium hydrogen phosphate Solution B: 0.02M sodium dihydrogen phosphate 2.84g/lt 3.12g/lt The working solution of phosphate buffer was prepared by mixing 81ml of solution A with 19ml of solution B, ph was adjusted to 7.4 and it was then diluted to 200ml with distilled water. The solution was sterilized by autoclaving at 121 C at 15lbs pressure for 15 min. and then stored at 4 C till further use. 3. Phosphate buffer (0.1M) (ph: 7.4) Solution A: 0.2M disodium hydrogen phosphate Solution B: 0.2M sodium dihydrogen phosphate 28.39g/lt 31.20g/lt The working solution of phosphate buffer was prepared by mixing 81ml of solution A with 19ml of solution B, ph was adjusted to 7.4 and it was then diluted to 68

81 200ml with distilled water. The solution was sterilized by autoclaving at 121 C at 15lbs pressure for 15 min. and then stored at 4 C till further use Statistical analysis Cutoff value between MAT positive and MAT negative reactions for FPA was established by analyzing the data using MedCalc software. Initially, a dot plot was prepared followed by receiver operator characteristic analysis (ROC). The ROC calculates the most suitable cutoff value, estimated by comparing the range of sensitivity and specificity values. In addition, ROC analysis provides area under the ROC curve, which is an indication of the accuracy of the test. In the second approach, the sensitivity and specificity values were calculated for RBPT, I-ELISA, C-ELISA and FPA using MAT as the reference test. The sensitivity and specificity values were calculated using MedCalc online diagnostic test calculator by using the formula: Sensitivity = Specificity = a a + c d b + d Where, a = True positive; b = False positive; c = False negative; d = True negative 3.12 Peptide nucleic acid fluorescence in situ hybridization (PNA-FISH) Reference strains and clinical isolates B. abortus reference strain S99 and B. abortus isolates isolated from the clinical samples were used in the present study Preparation of smears For each smear, one drop of phosphate-buffered saline with 1% (vol/vol) Triton X-100 (Amresco) was placed in a well (diameter, 14 mm) of a coated microscopic slide (Tekdon Inc, USA) and a small drop of resuspended culture was gently mixed in. The slide was then placed at 55 C to 60 C for 20 min. Subsequently, 69

82 the smears were disinfected by immersion into 96% (vol/vol) ethanol for 10 min and air dried Selection of probe sequence The fluorescently labeled probe sequence selected was based on nucleotide sequence of 16S rrna of B. abortus and were synthesized from PNA Bios (PNA Inc. USA). Sequence of the probes was 5'-Flu-OO- labelled where Flu=5,6 carboxyfluorescein and O=8-amino-3,6-dioxaoctanoic acid. Sequence of probes is depicted in Table 22. Table 22: Sequence of probes used for PNA-FISH assay S.No Organism Target gene Probe sequence 1 B. abortus 16S rrna Flu-OO-gcc gct cac cct tgc Optimisation of PNA probe for PNA-FISH assay PNA-FISH probe was prepared in the concentration of 50nm/20µl of hybridization buffer, 200nm/20µl of hybridization buffer and 500nm/20µl of hybridization buffer. Each concentration of probe was tested in PNA-FISH method and the concentration where maximum fluorescence was obtained was chosen as the standard concentration for PNA-FISH assay Brucella PNA-FISH Method The B. abortus PNA-FISH method was performed as per the method of Rigby et al (2002). Fixed smears were covered with approximately 20µl of hybridization solution containing 10% (wt/vol) dextran sulfate (Sigma), 10 mm NaCl (Merck), 30% (vol/vol) formamide (MP Biomedicals), 0.1% (wt/vol) sodium pyrophosphate (MP Biomedicals), 0.2% (wt/vol) polyvinylpyrrolidone (MP Biomedicals), 0.2% (wt/vol) Ficoll (MP Biomedicals), 5 mm disodium EDTA (Himedia), 1% (vol/vol) Triton X- 100 (Amresco), 50M Tris-HCl (ph 7.5), and 500nM fluorescein-labeled PNA probe 70

83 targeting B. abortus 16S rrna. Coverslips were placed on the smears to ensure even coverage with hybridization solution and the slides were subsequently incubated in a humidity chamber for 90 min at 55 C. Following hybridization, the coverslips were removed by submerging each slide in approximately 20 ml of prewarmed 5 mm Tris (ph 10), 15 mm NaCl (Merck), and 0.1% (vol/vol) Triton X-100 (Amresco) in a water bath at 55 C; the slides were then washed for 30 min. Each smear was finally mounted with 1 drop of imagen mounting fluid and a coverslip was applied. Microscopic examination was conducted under 40X and 100X of a fluorescent microscope. B. abortus cells were identified as bright green fluorescent cells in multiple fields of view. Images were obtained with a camera connected to a computer system Determination of PNA probe specificity The PNA-FISH probe was evaluated for specificity by screening some commonly available bacteria (Staphylococcus, Streptococcus, E.coli, Salmonella, Enterococccus, Pseudomonas, Listeria and Bacillus). PNA-FISH method used for specificity evaluation was as described earlier under section and

84 CHAPTER IV RESULTS AND DISCUSSION 4.1 Isolation of B. abortus A total of 100 samples (68 from cattle and 32 from buffaloes) were processed for isolation of B. abortus. The organism could be isolated from four of these samples (one from vaginal mucus, one from uterine discharge and two from foetal stomach contents). Foetal stomach content was found to be the best sample for isolation of B. abortus. Aborted foetus is one of the best samples to isolate Brucella from cattle and buffaloes (Nielsen and Duncan 1990). The details of isolation of B. abortus from different animals are given in Table 23 and 24. All the isolates were obtained from animals suffering from abortions and reproductive disorders. Isolation of B. abortus from different animals has been reported by various other researchers (Chahota et al 2003, Kanani 2007, Kaur et al 2006, Ghodasra et al 2010, Priyantha 2011, Al Saadi et al 2012, Ica et al 2012, Jain et al 2013, Sanjrani et al 2013 and Shahzad et al 2014). Table 23: Isolation of B. abortus from different samples Cattle Buffaloes Type of Sample No. of samples processed No. of samples positive for isolation No. of samples processed No. of samples positive for isolation Foetal stomach content (20.00) (25.00) Uterine discharge (6.25) Vaginal mucus and Vaginal discharge (2.94) 10 - Placenta Total (2.94) (6.25) Figures in parenthesis indicate percentage

85 Table 24: Isolation of B. abortus from cattle and buffaloes (n=100) S. No. Sample No. Animal Cattle/ Buffalo Age (yrs.) Breed Month of abortion Type of sample 1 P-1 Cow 4 HF - Placenta - 2 P-2 Buffalo 7 Murrah 7 FSC - 3 P-3 Cow 5 HF - Uterine discharge - 4 P-4 Cow 4 Crossbred - Placenta - 5 P-5 Cow 5 HF 6 ½ Vaginal mucus - 6 P-6 Buffalo 6 Murrah 7 Uterine discharge - 7 P-7 Cow 4 HF Vaginal mucus - 8 P-8 Buffalo 8 Murrah 6 ½ Uterine discharge - 9 P-9 Cow 5 Indigenous - Uterine discharge - 10 P-10 Cow 5 Crossbred - Vaginal mucus - 11 P-11 Cow 6 HF 6 FSC + 12 P-12 Cow 6 HF 6 ½ Vaginal mucus - 13 P-13 Buffalo 5 Murrah - Vaginal mucus - 14 P-14 Cow 4 Indigenous - Vaginal mucus - 15 P-15 Cow 7 HF 7 Placenta - 16 P-16 Cow 4 HF - Uterine discharge - 17 P-17 Cow 7 HF - Uterine discharge - 18 P-18 Cow 8 HF - Uterine discharge - 19 P-19 Cow 5 Indigenous 6 FSC - 20 P-20 Cow 7 Crossbred - Vaginal mucus - Isolation 73

86 S. No. Sample No. Animal Cattle/ Buffalo Age (yrs.) Breed Month of abortion Type of sample 21 P-21 Buffalo 5 Mixed 7 FSC - 22 P-22 Buffalo 4 Murrah 6 FSC - 23 P-23 Cow 4 HF 6 FSC - 24 P-24 Buffalo 7 Mixed - Uterine discharge - 25 P-25 Cow 4 Indigenous 4 Vaginal mucus - 26 P-26 Cow 5 HF 6 Uterine discharge - 27 P-27 Cow 6 HF 7 Uterine discharge - 28 P-28 Cow 6 HF - Uterine discharge - 29 P-29 Cow 5 HF 8 FSC - 30 P-30 Buffalo 4 Murrah 5 Vaginal mucus - 31 P-31 Buffalo 4 Murrah - Uterine discharge - 32 P-32 Cow 8 Indigenous 6 Placenta - 33 P-33 Cow 7 Crossbred - Vaginal mucus - 34 P-34 Buffalo 7 Mixed 6 Uterine discharge - 35 P-35 Buffalo 8 Mixed 7 Uterine discharge - 36 P-36 Cow 4 Indigenous - Vaginal mucus - 37 P-37 Cow 5 HF - Vaginal mucus - 38 P-38 Cow 6 Crossbred 8 Uterine discharge - 39 P-39 Buffalo 4 Murrah - Placenta - 40 P-40 Buffalo 5 Murrah - Vaginal mucus - 41 P-41 Cow 5 Indigenous - Vaginal mucus - 42 P-42 Cow 7 HF 6 FSC - Isolation 74

87 S. No. Sample No. Animal Cattle/ Buffalo Age (yrs.) Breed Month of abortion Type of sample 43 P-43 Cow 8 HF 6 Vaginal mucus - 44 P-44 Buffalo 4 Mixed - Vaginal mucus - 45 P-45 Buffalo 5 Murrah 7 Uterine discharge + 46 P-46 Cow 5 HF 7 Vaginal mucus - 47 P-47 Buffalo 6 Murrah - Vaginal mucus - 48 P-48 Cow 5 Indigenous 5 Uterine discharge - 49 P-49 Buffalo 5 Murrah 7 FSC + 50 P-50 Cow 6 HF - Vaginal mucus - 51 P-51 Buffalo 4 Mixed 6 Vaginal mucus - 52 P-52 Cow 7 Indigenous - Vaginal mucus - 53 P-53 Cow 6 HF 7 Vaginal mucus - 54 P-54 Cow 6 HF 6 Vaginal mucus - 55 P-55 Cow 8 Crossbred - Vaginal mucus - 56 P-56 Cow 4 Indigenous - Uterine discharge - 57 P-57 Cow 8 Crossbred - Vaginal mucus - 58 P-58 Cow 6 HF - Vaginal mucus - 59 P-59 Cow 5 Indigenous - Vaginal mucus - 60 P-60 Cow 4 Indigenous - Uterine discharge - 61 P-61 Cow 6 HF - Placenta - 62 P-62 Buffalo 5 Mixed 6 Vaginal mucus - 63 P-63 Cow 6 Indigenous - Uterine discharge - Isolation 75

88 S. No. Sample No. Animal Cattle/ Buffalo Age (yrs.) Breed Month of abortion Type of sample 64 P-64 Buffalo 6 Murrah - Uterine discharge - 65 P-65 Buffalo 7 Murrah - Vaginal mucus - 66 P-66 Cow 5 HF - Uterine discharge - 67 P-67 Buffalo 7 Murrah 5 Vaginal mucus - 68 P-68 Cow 4 Indigenous - Vaginal mucus - 69 P-69 Cow 5 HF - Uterine discharge - 70 P-70 Cow 8 HF - Uterine discharge - 71 P-71 Cow 6 HF - Uterine discharge - 72 P-72 Cow 4 Indigenous - Vaginal mucus - 73 P-73 Cow 7 Crossbred - Vaginal mucus - 74 P-74 Cow 4 Indigenous - Vaginal mucus - 75 P-75 Cow 4 HF 6 Vaginal mucus + 76 P-76 Cow 6 HF - Vaginal mucus - 77 P-77 Cow 5 HF 7 Uterine discharge - 78 P-78 Buffalo 5 Murrah - Vaginal mucus - 79 P-79 Cow 6 HF 7 Vaginal mucus - 80 P-80 Cow 4 Crossbred 6 Uterine discharge - 81 P-81 Cow 7 Indigenous 5 Uterine discharge - 82 P-82 Cow 5 HF - Vaginal mucus - 83 P-83 Buffalo 8 Mixed 7 Placenta - 84 P-84 Cow 5 Indigenous - Vaginal mucus - 85 P-85 Buffalo 4 Murrah - Uterine discharge - Isolation 76

89 S. No. Sample No. Animal Cattle/ Buffalo Age (yrs.) Breed Month of abortion Type of sample 86 P-86 Cow 6 HF - Vaginal mucus - 87 P-87 Cow 7 HF 6 Vaginal mucus - 88 P-88 Buffalo 5 Murrah - Uterine discharge - 89 P-89 Cow 5 Crossbred 7 Vaginal mucus - 90 P-90 Buffalo 4 Mixed - Uterine discharge - 91 P-91 Cow 5 HF - Vaginal mucus - 92 P-92 Buffalo 7 Mixed 6 Uterine discharge - 93 P-93 Cow 5 HF - Placenta - 94 P-94 Cow 8 Indigenous - Uterine discharge - 95 P-95 Buffalo 4 Murrah 7 Uterine discharge - 96 P-96 Buffalo 5 Mixed - Uterine discharge - 97 P-97 Cow 4 HF 7 Uterine discharge - 98 P-98 Buffalo 5 Murrah - Uterine discharge - 99 P-99 Buffalo 6 Murrah - Uterine discharge P-100 Cow 4 HF - Placenta - HF-Holstein Friesian, FSC-Foetal stomach contents Isolation 77

90 4.2 Biochemical characterization The isolates were identified on the basis of morphological and cultural characteristics. After 3-5 days of incubation, pinpoint, smooth, glistening, bluish, translucent colonies were seen which became opaque upon ageing. The observations are in accordance with the observations of Shareef (2006) and Abbas and Talei (2010). All the isolates were Gram negative, coccobacilli, Modified Ziehl Nielsen s stain positive, non motile and failed to grow on McConkey s lactose agar (MLA). The suspected cultures were subjected to different biochemical tests like H 2 S, urease, nitrate reduction and indole (Table 25). Many workers (Ramanatha and Gopal 1992, Batra et al 1995, Chatterjee et al 1995, Jeyaprakash et al 1999, Shareef 2006, Gift et al 2009) identified B. abortus biochemically showing typical characteristics of B. abortus. All the isolates were oxidase, catalase, nitrate and urease positive. Similar observations have been reported by Shome et al (1999), Shareef (2006), Abbas and Talei (2010) and Jabbar et al (2012) whereas Piccininno et al (1978) examined one B. abortus isolate and found that it was negative for oxidase. Corbel and Hendry (1985) found that a substantial proportion of strains of B. abortus hydrolyzed urea as rapidly as within 15 minutes. Piccininno et al (1978) examined one B. abortus strain which was negative for nitrate reduction. All the isolates produced H 2 S and the reaction of all isolates was alkaline on triple sugar iron (TSI) medium. All the isolates were found negative for indole. Similar observations have been reported by Shareef (2006), Abbas and Talei (2010) and Jabbar et al (2012). Slide agglutination test was performed with the standard antiserum obtained from IVRI. All the isolates were agglutinated by the B. abortus antiserum. All the four isolates of B. abortus grew in the presence of basic fuchsin (20 g/ml) but not in the presence of thionin (20 g/ml ) and were thus biotyped as biotype 1. 78

91 Table 25: Biochemical characterization of B. abortus S. No Isolate no. Oxidase Catalase H 2 S (TSI) Urease Nitrate reduction Indole Agglutination with antiserum Growth in the presence of dyes Thionin 20µg/ml Basic fuschin 20µg/ml Biotype 1 P _ + _ P _ + _ P _ + _ P

92 The results are in accordance with the findings of Shahzad et al (2014) who recovered a total of 30 isolates of B. abortus from milk, aborted fetuses, and vaginal swabs mostly from cattle and all of them were identified as B. abortus biovar 1. On the contrary, Verma et al (2000) isolated B. abortus biotype 3 from two of seven aborted cows whereas Jain et al (2013) reported one isolate each of B. abortus biotype 2 and three and seven isolates of biotype 1 from a total of 84 samples of vaginal mucus, foetal stomach content, foetal membranes and uterine discharges collected from aborted cattle and buffaloes. Megid et al (2005) successfully isolated B. abortus biotype 1, biotype 2 and biotype 3 from aborted cattle and buffalo fetuses. Ocholi et al (2004) identified 25 isolates of B. abortus from aborted materials and all of them were typed as B. abortus biotype 1 whereas Rathore et al (2002) identified 96.9% isolates as B. abortus biotype 1. B. abortus biovar 3 was reported by Priyantha (2011). Eleven and two of the 13 B. abortus isolates were identified to be biovars 1 and 2, respectively (Gift et al 2009). 4.3 Confirmation of Brucella isolates by PCR using B4/B5 primer pair DNA was extracted from reference B. abortus S19 and from the suspected Brucella isolates. The extracted DNA was subjected to PCR using Brucella genus specific primer pair B4/B5 targeting bcsp31 gene (Baily et al 1992). Amplicon size of 223 bp was obtained in positive control as well as in all the four isolates (Fig. 1) Detection of Brucella spp. from clinical samples by PCR using B4/B5 primer pair DNA was extracted directly from 40 clinical samples of foetal stomach contents, vaginal mucus and uterine discharges and was subjected to PCR assay using B4/B5 primer pair. Out of 40 samples, only two samples comprising of foetal stomach contents were positive by PCR whereas one out of 40 samples was culture positive 80

93 Fig. 1: Gel electrophoresis of PCR amplified fragments from Brucella isolates by using B4/B5 primer pair Lane 1 : 100 bp plus DNA ladder Lane 2 : B. abortus S19 (positive control) Lane 3, 4, 5, 6 : B. abortus field isolates Lane 7 : negative control

94 Fig. 2: PCR amplified product of Brucella spp. using B4/B5 primer pair from clinical samples Lane 1 Lane 2 : 100 bp plus DNA ladder : B. abortus S19 Lane 3 and 4 : Positive samples Lane 5 : negative control

95 (Fig. 2). Kanani (2007) compared three pairs of primers amplifying three different fragments, a gene encoding a 31 kda B. abortus antigen (primer B4/B5), a sequence 16S rrna of B. abortus (primer F4/R2) and a gene encoding an omp2 (primer JPF/JPR) by testing 101 semen samples from breeding bulls of AI Centres of Gujarat and found that B4/B5 primer pair was more sensitive followed by F4/R2 primer and JPF/JPR primer pair. Similarly, Baddour et al (2008) evaluated three polymerase chain reaction techniques for detection of Brucella DNA in peripheral human blood. They used 3 sets of primers and 3 different PCR protocols amplifying 3 different regions of the Brucella genome namely a gene encoding 31 kda B. abortus antigen (B4/B5), 16S rrna sequence of B. abortus (F4/R2) and a gene encoding an outer membrane protein (omp-2) (JPF/JPR). Among the 147 samples, 144 samples were positive by B4/B5 primers (98% sensitivity), 130 were positive by JPF/JPR primers (88.4% sensitivity) and only 78 were positive by F4/R2 primers (53.1% sensitivity). Similarly, Ghodasara et al (2010) compared three primers, B4/B5 primer pair amplifying a 223 bp fragment, F4/R2 primer pairs amplifying a 905 bp fragment and JPF/JPR primer pair amplifying a 193 bp fragment for the detection of Brucella species from 10 samples from vaginal swabs, aborted foetus and placenta (cattle, buffaloes, goats). They found that B4/B5 primer pair was more sensitive than F4/R2 and JPF/JPR. Seven isolates of Brucella were isolated and identified from aborted foetuses, vaginal discharge and milk samples obtained from aborted cows and 3 from aborted buffaloes and these isolates revealed a amplification of 223 bp fragment with B4 and B5 primers (Al-saadi et al 2012). 4.4 Evaluation of conventional serological tests for the diagnosis of antibodies against Brucella spp. A total of 92 serum samples (75 samples from cattle and 17 from buffaloes) were processed for preliminary screening of brucellosis and 35 (38.04%) samples 81

96 were positive by RBPT, 45 (48.9%) by STAT, 42 (45.6%) by MAT and 53 (57.6%) samples were positive by I-ELISA. The results are shown in Table 26 and summarized in Table 27. I-ELISA was found to have 97.4% specificity and 64.15% sensitivity when compared to RBPT. However, I-ELISA exhibited 92.3% and 94.87% specificity in comparison to STAT and MAT respectively, whereas sensitivity was found to be 79.25% and 75.47% for STAT and MAT respectively. In the present study, I-ELISA failed to detect antibodies to Brucella in serum samples which were otherwise positive by RBPT, STAT and MAT, respectively. The titre of samples that were negative by RBPT and positive by one or the other serological tests in the present study was high in MAT and/or STAT and the corresponding OD values in I- ELISA were also high. This discrepancy could be due to false negative reactions in RBPT against high antibody titres observed due to prozone phenomenon (OIE 2009). Several agglutination based tests such as RBPT, MAT, STAT and ELISA in combination have been used for the detection of Brucella specific antibody response in livestock as no single test can detect all positive reactors (Radulescu et al 2007, Junaidu et al 2008). In the present study, I-ELISA detected maximum number of positive samples (57.6%) followed by STAT, MAT and RBPT. The results are in accordance with findings of many other workers who have reported I-ELISA to be a highly sensitive and specific diagnostic assay with minimal false positive samples (Chachra et al 2009, Islam et al 2013, Senthil and Narayanan 2013). Out of a total of 92 serum samples, STAT detected 45 positive samples whereas RBPT detected 35 positive samples in the present study. Similar findings have been reported by Otlu et al (2008) who reported 32.9% and 34.65% samples positive by RBPT and STAT, respectively. However, in contrast, Chakraborthy et al (2000) observed that RBPT had higher sensitivity in comparison to STAT as it detected more number of samples as positive. 82

97 Table 26: Comparison of conventional serological tests for diagnosis of brucellosis S. No. Sample No. RBPT MAT STAT I-ELISA 1 C C C C B B B B B B B C C C C C C C C C C C C C C C C C C

98 S. No. Sample No. RBPT MAT STAT I-ELISA 30 C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C C

99 S. No. Sample No. RBPT MAT STAT I-ELISA 62 C C C C C C C C C C C C B C B B B C C C C C C C B B C B B B B (38.04) 42 (45.65) 45 (48.91) 53 (57.61) Figures in parenthesis indicates percentage 85

100 Table 27: Sensitivity and specificity analysis between RBPT, STAT and MAT I-ELISA Positive (53) Negative (39) Total (92) RBPT STAT MAT Positive Negative Positive Negative Positive Negative Detection of Brucella spp. by Bruce Ladder multiplex PCR assay Vaccine strain B. abortus S19, standard B. melitensis and standard B. suis strains were procured from IVRI, Izatnagar. DNA was extracted from all the four field isolates and from the vaccine strain B. abortus S19, standard B. melitensis and standard B. suis strains and was subjected to Bruce Ladder multiplex PCR using 8 primer pair cocktail as per Garcia Yoldi et al (2006). The results confirmed that all the isolates isolated from cattle and buffaloes were that of B. abortus with amplified product size of 1682 bp, 794 bp, 587 bp, 450 bp and 152 bp. With B. melitensis DNA, an additional 1,071 bp amplified fragment was obtained along with amplified product sizes of 1682 bp, 794 bp, 587 bp, 450 bp and 152 bp obtained in B. abortus. B. suis was confirmed by the presence of 1682 bp, 1,071 bp, 794 bp, 587 bp, 450 bp, 272 bp and 152 bp fragment. However, PCR with B. abortus S19 DNA did not produce the 587 bp fragment (Fig. 3). The results are in accordance with Garcia-Yoldi et al (2006) who opined that Bruce ladder PCR is capable of detecting almost all the species and vaccine strains of Brucella. A number of genus and species specific conventional PCR assays have been described and reviewed by Yu and Nielsen (2010). AMOS 86

101 bp 1071 bp 794 bp 587 bp 450 bp 272 bp 152 bp Fig. 3: Gel electrophoresis of PCR amplified fragments from Brucella spp. by Bruce Ladder Multiplex PCR assay Lane 1 : 100 bp plus DNA ladder Lane 2 : B. abortus S19 Lane 3, 4, 5, 6: B. abortus field isolates Lane 7 : B. suis (standard positive) Lane 8 : B. melitensis (standard positive)

102 PCR for differentiation of B. abortus bv 1, 2 and 4, B. melitensis, B. ovis bv 1 and B. suis bv 1 using five primers was developed by Bricker and Halling (1994). This PCR assay was modified by the addition of 3 primer pairs and the modified AMOS-PCR was able to differentiate Brucella field strain isolates and the vaccine strains, S19 and RB51 (Bricker and Halling 1994, Ewalt and Bricker 2000). However, AMOS PCR is unable to detect B. canis, B. neotomae, B. pinnipedialis, and B. ceti and some biovars of B. abortus and B. suis. Recently, advancement of multiplex PCR, which could detect B. microti has also been reported (Mayer-Scholl et al 2010). With Bruce Ladder multiplex PCR, some B. canis strains and B. microti, isolated from common voles and foxes can be identified erroneously as B. suis (Lopez-Goni et al 2008 and Scholz et al 2008). Sung et al (2011) introduced two new primer sets of a 766 bp and a 344 bp fragment into the conventional Bruce-ladder PCR assay and concluded that the novel multiplex PCR assay could rapidly and concisely discriminate B. canis and B. microti from B. suis strains and may also differentiate all of the ten Brucella species. Lopez-Goni et al (2011) described a new multiplex PCR assay, Suis-ladder, for fast and accurate identification of B. suis at the biovar level and for the differentiation of B. suis, B. canis and B. microti. In general, Bruce-ladder performs excellent and has been recommended by the OIE as a rapid and simple one-step molecular test for identification and typing of Brucella species (OIE 2009). Bruce ladder PCR is capable of detecting almost all the species and vaccine strains of Brucella (Garcia-Yoldi et al 2006) and has been evaluated in seven different laboratories for detection and differentiation of Brucella strains from different geographical origin (Lopez-Goni et al 2008). DNA was extracted directly from 40 clinical samples of foetal stomach contents and uterine discharges and was subjected to Bruce Ladder multiplex PCR assay and none of the samples was found to be 87

103 positive although one foetal stomach content sample from 40 samples was culture positive for B. abortus and two samples were positive by PCR using B4/B5 primer pairs. Few studies have been performed with field samples to evaluate multiplex PCR as a diagnostic method for brucellosis (Guler et al 2003). Contrary to the results obtained in the present study, Cortez et al (2001) detected four positive samples using simple PCR in 54 samples classified as negative by classic isolation and Fekete et al (1992) obtained two positive samples in 52 negatives for microbiologic cultivation. Negative results obtained in the multiplex PCR could be due to a lower diagnostic sensitivity of multiplex PCR than culture methods (Mirnejad et al 2013). DNA extraction protocol also influences the sensitivity of the PCR (Matrone et al 2009). Another possible reason could be that the number of bacteria in foetal stomach content and uterine discharges was too low to be detected by multiplex PCR. It is also relevant to mention that the PCR performance with the Brucella DNA extracted from clinical samples is very often compromised by the presence of PCR inhibitors and further complicated because Brucella is an intracellular pathogen (Leal et al 1995). 4.6 Detection of Brucella spp. by Real-Time PCR using IS711 specific primers and Taqman probe chemistry By Real-time PCR, all the four isolates showed C t values between thus confirming the isolates to be that of Brucella spp. (Fig. 4). Real time PCR using Taqman probe chemistry has been evaluated by other researchers (Probert et al 2004, Bounaadja et al 2009, Hinic et al 2009, Surucuoglu et al 2009, Doosti and Dehkordi 2011). In the present study, the sensitivity evaluation of Real-time PCR was performed using the genomic DNA of standard B. abortus S19 and it was found that Real-time PCR could detect upto 0.35fg of DNA of Brucella (Fig. 5). Similarly, Bounaadja et al (2009) reported that Real-time PCR assay is always more sensitive 88

104 Fig. 4: Real-time PCR on B. abortus isolates Fig. 5: Sensitivity evaluation of Real-time PCR

105 than conventional PCR assay. The detection limit of primer probe set in the real time format was 0.8µl (40X) of primer probe mixture (Fig. 6). The amplified Real-time PCR product was also run on 1% agarose gel and visualized under a UV transilluminator (Fig. 7). The specificity evaluation of Real-time PCR was carried out by screening some commonly available spp. of bacteria (E.coli, Salmonella, Staphylococcus, Proteus, Streptococcus, Pseudomonas, Klebsiella and Pasteurella) and no amplification was observed (Fig. 8). Similar results have been reported by Bounaadja et al (2009) who designed Real-time PCR assay using TaqMan probes targeting three specific genes: the insertion sequence IS711, bcsp31 and per genes for the detection of Brucella at genus level. They carried out the specificity evaluation on 68 clinically relevant, phylogenetically related or serologically cross-reacting microorganisms and no cross reactivity was observed. Hinic et al (2009) and Bounaddja et al (2009) found that the IS711 based Real-time PCR assay was highly sensitive and appeared as an efficient and reproducible method for the rapid and safe detection of the genus Brucella. A total of 40 clinical samples of uterine discharges (22), vaginal mucus (10) and foetal stomach contents (8) were collected from cattle and buffaloes suffering from reproductive disorders and/or cases of abortion and three samples (two foetal stomach contents and one uterine discharge) were found positive for Brucella spp. by Real-time PCR whereas by culture only one sample of foetal stomach content was positive. Two samples were positive for Brucella spp. by PCR using B4/B5 primer pairs whereas by Bruce Ladder PCR, none of the samples were found positive. The results are shown in Table 28 and Fig. 9. Higher sensitivity of Real-time PCR as compared to culture methods has been reported by various other researchers (Surucuoglu et al 2009, Hinic et al 2009, Doosti and Dehkordi 2011). 89

106 Fig. 6: Sensitivity evaluation of primer probe for Real-time PCR Fig. 7: Amplified Real-time PCR product on 1% agarose gel

107 Fig. 8: Specificity evaluation of Real-time PCR Fig. 9: Real-time PCR on DNA extracted directly from clinical samples

108 Table 28: Comparison of isolation, PCR using B4/B5 primer pair, Bruce Ladder PCR and Hinic Real-time PCR on clinical samples S. No Sample No Isolation PCR using B4/B5 primer pairs Bruce Ladder PCR Hinic Real time PCR 1 P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P

109 4.7 Multiplex PCR for detection of Brucella, Leptospira, Listeria and Mycoplasma spp. Before proceeding with the multiplex PCR assay, monoplex PCR assay was carried out for detection of Brucella, Listeria, Leptospira and Mycoplasma. The OD ratio of genomic DNA of all the four organisms was ~ 1.8 indicating the purity of the preparation. DNA from Brucella, Listeria, Leptospira and Mycoplasma were observed by gel electrophoresis on 0.85% agarose gel prepared in 0.5X TBE and they produced an intact band without shearing. Primers specific for Brucella, Mycoplasma, Leptospira and Listeria produced single amplification bands 223 bp, 270 bp, 331 bp and 456 bp when detected on a 1% agarose gel individually (Fig. 10). The optimization of the multiplex PCR assay was done, where the annealing temperature and the PCR components were optimized at different ranges. Gradient annealing temperature studies revealed satisfactory amplification for all the primers at 59 C, 60 C and 61 C but at 59 C and 60 C some non specific reactions were obtained and Leptospira was weakly amplified at 59 C. Hence, for the multiplex PCR, 61 C was chosen as the optimum temperature for annealing. The concentration of primers for multiplex assay was optimized after changing the concentration of individual primers in the cocktail. Different concentrations of primers from 10pmol/µl to 25pmol/µl were tested. Finally, in the standardised protocol, the primers for Listeria and Leptospira gave optimum amplification at 20pmol/µl whereas the primers for Mycoplasma and Brucella gave amplification at concentration of 12pmol/µl. The concentration of MgCl 2 (25mM) was also optimised (1.5mM, 2mM and 2.5mM) and best results were obtained at 1.5mM of MgCl 2 (Fig. 11). The multiplex assay was capable of detecting Brucella spp., Mycoplasma spp., Listeria spp. and Leptospira spp. simultaneously from genomic bacterial DNA 91

110 bp 331 bp 270 bp 223 bp Fig. 10: Gel electrophoresis of monoplex PCR amplified fragments from Brucella, Leptospira, Listeria and Mycoplasma Lane 1 : 100 bp plus DNA ladder Lane 2 : Brucella Lane 3 : Leptospira Lane 4 : Listeria Lane 5 : Mycoplasma

111 cocktail in a single tube PCR reaction. Each primer pair amplified DNA fragments of the predicted size, and amplifications were specific for the corresponding gene (331 bp for Leptospira spp., 270 bp for Mycoplasma spp., 456 bp for Listeria spp. and 223 bp for Brucella spp.) (Fig. 12). The sharpness and intensity of the amplicons was more in monoplex PCR assay as compared to that obtained in multiplex PCR. This is because in single gene targeted monoplex PCR, we can use the optimal conc. of MgCl 2, Taq, annealing temperature according to the specific primer, but, in case of multiplex, the ingredients as well as PCR conditions should suit all primer pairs and target genes and so may not be optimal for each individual pair of primers. Similar observations have been reported by Moustacas et al (2013). DNA extracted from different bacterial cultures of Salmonella, E.coli, Proteus, Mycobacterium, Pasteurella, Staphylococcus, Streptococcus, Campylobacter fetus, Pasteurella and Pseudomonas were used as templates for the multiplex PCR assay alongwith the four target microorganisms and it was found that none of the selected bacterial cultures could be detected. The results were positive only for Brucella, Leptospira, Listeria and Mycoplasma thereby indicating the specificity of the mpcr (Fig. 13). When applied on ten fold serially diluted pooled DNA samples, the sensitivity of the assay was 116pg for Brucella, Leptospira, Listeria and Mycoplasma (Fig. 14). Multiplex PCR assays for detection of different agents associated with genital tract infections in cattle and buffaloes have been developed by various researchers. A multiplex PCR based assay has been developed by Hinic et al (2008) to differentiate all six classical Brucella spp. (B. melitensis, B. abortus, B. suis, B. ovis, B. canis and B. neotonae) and the developed assay was also useful for Real-time PCR based 92

112 bp 331 bp 270bp 223 bp Fig. 11: Optimisation of MgCl 2 for Multiplex PCR assay Lane1 : 100 bp plus DNA ladder Lane 2, 4 & 6 : MgCl 2 (1.5 mm, 2mM and 2.5 mm) bp 331 bp 270bp 223 bp Fig. 12: Gel electrophoresis of multiplex PCR amplified fragments from Brucella, Leptospira, Listeria and Mycoplasma spp. Lane 1 Lane 2 : 100 bp plus DNA ladder : Brucella, Mycoplasma, Leptospira and Listeria

113 bp 331 bp 270bp 223 bp Fig. 13: Specificity evaluation of multiplex PCR assay Lane1: 100 bp DNA Ladder Lane 2: Positive control Lane 3: Salmonella spp Lane 4: E.coli Lane 5: Proteus Lane 6: Mycobacterium Lane 7: Pasteurella Lane 8: Staphylococcus Lane 9: Streptococcus Lane 10: Campylobacter fetus Lane 11: Pasteurella Lane 12: Pseudomonas Lane 13: Known negative

114 456 bp 331 bp 270bp 223 bp 331 bp Fig. 14a Fig. 14b 456 bp 270bp 223 bp Fig. 14c Fig. 14: Sensitivity evaluation of (a) multiplex PCR assay and (b&c) monoplex PCR assays of Brucella, Leptospira, Listeria and Mycoplasma spp.

115 quantitation. Tramuta et al (2011) developed a set of five multiplex polymerase chain reaction (mpcr) assays for the simultaneous detection of abortive infectious agents in bovine foetal tissues, including Brucella spp., Leptospira spp., and Campylobacter fetus (mpcr1); Hammondia heydorni, Neospora caninum, and Toxoplasma gondii (mpcr2); Coxiella burnetii and Chlamydophila psittaci (mpcr3); Mycoplasma bovis, Mycoplasma bovigenitalium, and Ureaplasma diversum (mpcr4) and Bovine viral diarrhea virus (BVDV) and Bovine herpesvirus-1 (BoHV-1; mpcr5). They showed that out of the 50 fetuses, 7 (14%, mpcr2) were PCR-positive for N. caninum, 4 (8%, mpcr5) were PCR-positive for BVDV, and 2 (4%, mpcr4) were PCR-positive for U. diversum. The results obtained by using each multiplex PCR were 100% concordant with those obtained by using the respective PCR assays targeting single genes on the same specimens. The developed mpcr assay was applied for direct detection of these four organisms in clinical samples of uterine discharges and foetal stomach contents. Out of a total of 30 samples of foetal stomach contents and uterine discharges, 9 samples of uterine discharges were positive for Mycoplasma (Fig. 15 and Table 29). Numerous studies have demonstrated the presence of Mycoplasma in genital tracts of healthy and diseased cows (Langford 1975, Nakamura et al 1977, Petit et al 2008). The presence of Mycoplasma bovigenitalium in 43% of males, in cervico vaginal mucus of 47% of females, 25% of foetuses and 11% of placentas in cattle has been demonstrated (Trichard and Jacobsz 1985). Mycoplasma has been found in cows with low fertility in which no other cause of infertility was identified (Kirkbride 1987). 93

116 bp 331 bp 270bp 223 bp Fig. 15: Gel electrophoresis of multiplex PCR amplified fragments from DNA extracted directly from clinical samples Lane 1 100bp DNA Ladder Lane 2, 4, 5, 6, 8, 9, 10, 12, 13- Mycoplasma Lane 7-Brucella,Mycoplasma and Leptospira Lane 3-negative control Lane11 and Lane 14- negative sample Lane 15- positive control

117 Table 29: Results of multiplex PCR on clinical samples S.No Sample No Multiplex PCR Brucella Leptospira Listeria Mycoplasma 1 P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P

118 Higher isolation rates of Mycoplasma from infertile cows have been reported (Panangala et al 1978). Mohamed et al (2013) detected M. bovigenitalium in the uterus of postpartum cows with an incidence of 7.4% and suggested that it might be associated with cytological endometritis in postpartum dairy cows. In the present study, one sample of foetal stomach content was positive for Brucella, Leptospira as well as Mycoplasma by mpcr. Infection by both Brucella and Leptospira spp. has earlier been reported in 7 out of a total of 11 aborted fetuses of bovine by multiplex PCR (Dehkordi and Taghizadeh 2012). Moshkelani et al (2011) developed a multiplex PCR for detection of Brucella spp. and Leptospira spp. in aborted fetuses of bovine, ovine and caprine herds and found that in total of the 276 specimens of stomach contents of aborted fetuses, 40 (14.4%) and 25 ( 9.0%) were identified positive for Brucella spp. and Leptospira spp. respectively. 4.8 Fluorescence polarization assay (FPA) for detection of antibodies to Brucella spp. and its comparison to RBPT, MAT, I-ELISA and C-ELISA. Serum samples from a total of 538 animals (cattle and buffaloes) comprising of B. abortus S19 vaccinated (n=265) and animals with unknown history of vaccination (n=273) were tested for the presence of antibodies against Brucella spp. by fluorescence polarization assay. FPA test is based on the detection of antibodies to the LPS antigen of smooth Brucella strains. The immunodominant epitope of the LPS is the O-chain that is a homopolymer of 1,2 linked N-acetylated 4-amino-4, 6- dideoxy-α-d-mannopyrranosyl residues (Caroff et al 1984). Fluorescence polarization measures the excitation by plane polarized light of a fluorescent molecule (Perrin 1926). Measurement of returned photons in the planes parallel and perpendicular to the excitation plane allows for the assessment of the rotation of the fluorophore. Other 95

119 factors being constant, then the rate of rotation of this molecule is inversely proportional to its size (Nasir and Jolley 1999). Thus, the rotation of a fluorescent molecule (fluorophore) conjugated to, in this case, Brucella O-chain, will be slow if bound by anti-brucella LPS antibodies. The assay, in the present study, used O- polysaccharide prepared from B. abortus lipopolysaccharide in the molecular weight of 20-30kDa which was conjugated with fluorescein isothiocyanate and used as a tracer. Cut off value for FPA was determined by taking selected MAT positive and MAT negative reactions (n=200) and cut off was established by analyzing the data using MedCalc software. Initially, a dot plot was prepared followed by receiver operator characteristic analysis (ROC). The ROC analysis provides optimum sensitivity and specificity values at a given cut-off. The dot plot and the ROC analysis for cattle and buffalo sera tested by the FPA is presented in Fig. 16 and Fig. 17 respectively. From the figure and from ROC analysis, it is clear that a cut off value of 25mP gave maximum discrimination between positive and negative samples. Using this cut off value, the data was sorted into positive and negative samples. ROC can also determine the area under the curve (AUC). Area under the curve in the present study was AUC of 0.97 indicates that a randomly selected individual from a positive population will have a test value greater than a randomly selected individual animal from a negative population 97% of the time. If the area under the curve is 1.0, then it indicates a perfectly accurate test while an area of 0.50 is indicative of the result being obtained by chance. In case of C-ELISA, samples scoring less than 30% inhibition were assigned negative and greater than or equal to 30% inhibition as positive (Fig. 18) whereas in 96

120 Sensitivity 1000 fpa mat >25 Sens: 93.1 Spec: 99.0 Fig. 16: Dot-plot of the selected serum samples by using MedCal Software 100 fpa 80 Sensitivity: 93.1 Specificity: 99.0 Criterion : > Specificity Fig. 17: Receiver operator characteristic (ROC) analysis of the selected serum samples

121 case of I-ELISA, samples scoring less than 80% inhibition were assigned negative and greater than or equal to 80% inhibition as positive (Fig. 19). The percentage of animals positive by different serological tests is depicted in Table 30, 31 and 32 and Fig. 20, 21 and 22. In B. abortus strain 19 vaccinated animals, the percentage of animals positive by RBPT, MAT, I-ELISA, C-ELISA and FPA were 7.92%, 8.30%, 13.58%, 4.9% and 5.28% respectively; in animals with unknown history of vaccination the corresponding values were 36.99%, 37.72%, 40.29%, 35.16%, 39.19% respectively. Overall, from total cattle and buffaloes (vaccinated + unknown history of vaccination) the corresponding values were 22.67%, 23.23%, 27.13%, 20.26% and 22.49% respectively. Table 30: Detection of Brucella specific antibodies in B. abortus S19 vaccinated animals (n=265) by different serological tests RBPT MAT I-ELISA C-ELISA FPA Positive 21 (7.92) 22 (8.30) 36 (13.58) 13 (4.90) 14 (5.28) Negative 244 (92.08) 243 (91.70) 229 (86.42) 252 (95.10) 251 (94.72) Total Figures in parenthesis indicates percentage Table 31: Detection of Brucella specific antibodies in animals (n=273) with unknown history of vaccination by different serological tests RBPT MAT I-ELISA C-ELISA FPA Positive 101 (36.99) 103 (37.72) 110 (40.29) 96 (35.16) 107 (39.19) Negative 172 (63.01) 170 (62.28) 163 (59.71) 177 (64.84) 166 (60.81) Total Figures in parenthesis indicates percentage 97

122 +ve Weak +ve -ve Conjugate Fig. 18: C-ELISA for detection of antibodies to B. abortus -ve +ve Fig. 19: I-ELISA for detection of antibodies to B. abortus

123 Fig. 20: Percentage of positive animals by different serological tests in vaccinated animals (n=265) Fig. 21: Percentage of positive animals by different serological tests in animals with unknown history of vaccination (n=273) Fig. 22: Percentage of positive animals by different serological tests in total animals (n=538)

124 Table 32: Detection of Brucella specific antibodies in total animals (n=538) (vaccinated and in animals with unknown history of vaccination) by different serological tests RBPT MAT I-ELISA C-ELISA FPA Positive 122 (22.67) 125 (23.23) 146 (27.13) 109 (20.26) Negative 416 (77.33) 413 (76.77) 392 (14.36) 429 (79.74) 121 (22.49) 417 (77.51) Total Figures in parenthesis indicates percentage The sensitivity and specificity values of FPA by using MAT as the reference test were calculated using MedCalc online diagnostic test calculator. The sensitivity and specificity values of FPA with respect to MAT in vaccinated animals were 54.55% and 99.18% respectively. The sensitivity and specificity values of the other serological tests viz. RBPT, I-ELISA and C-ELISA by using MAT as the reference test were also calculated using MedCalc online diagnostic test calculator and values of all the tests were then compared with each other. The sensitivity and specificity values of RBPT, I-ELISA and C-ELISA with respect to MAT were 72.73% and 97.94%; 77.27% and 92.18%; 50.00% and 99.18% respectively in vaccinated animals. The sensitivity and specificity values for FPA with respect to C-ELISA were 100% and 99.6% respectively. The results are presented in Table 33 and 34. Table 33: Sensitivity and specificity analysis between MAT, RBPT, I-ELISA, C- ELISA and FPA in S19 vaccinated animals (n=265) MAT RBPT I-ELISA C-ELISA FPA Positive Negative Positive Negative Positive Negative Positive Negative Positive Negative Total

125 Table 34: Sensitivity and specificity analysis between C-ELISA and FPA in S19 vaccinated animals (n=265) Test Result C-ELISA FPA Negative Positive Positive 0 13 Negative Total The sensitivity and specificity values of FPA by using MAT as the reference test in animals with unknown history of vaccination were 91.26% and 92.35% respectively. The sensitivity and specificity values of RBPT, I-ELISA and C-ELISA with respect to MAT in animals with unknown history of vaccination were 87.38% and 93.53%; 93.20% and 91.76%; 82.52% and 93.53% respectively. The results are presented in Table 35. Table 35: Sensitivity and specificity analysis between MAT, RBPT, I-ELISA, C- ELISA and FPA in animals with unknown history of vaccination (n=273) MAT RBPT I-ELISA C-ELISA FPA Positive Negative Positive Negative Positive Negative Positive Negative Positive Negative Total The sensitivity and specificity values of FPA by using MAT as the reference test in total cattle and buffaloes were 84.80% and 96.38% respectively. The sensitivity and specificity values of RBPT, I-ELISA and C-ELISA with respect to MAT in total (n=538) cattle and buffaloes were 84.8% and 96.13%; 90.40% and 92.01%; 76.80% and 96.86% respectively. The results are shown in Table

126 Table 36: Sensitivity and specificity analysis between RBPT, I-ELISA, C-ELISA and FPA in total animals [vaccinated animals + animals with unknown history of vaccination (n=538)] MAT RBPT I-ELISA C-ELISA FPA Positive Negative Positive Negative Positive Negative Positive Negative Positive Negative Total In case of S19 vaccinated animals and animals with unknown history of vaccination, sensitivity of I-ELISA was maximum for both groups whereas in S19 vaccinated animals, the specificity values were highest for C-ELISA and FPA. In the present study, C-ELISA had lower sensitivity as compared to FPA and almost comparable specificity when testing serum samples from vaccinated animals. The specificity values of FPA and C-ELISA in case of vaccinated animals were highest in comparison to I-ELISA and RBPT thus indicating the potential of these two tests to distinguish strain 19 vaccinated animals from infected animals. In vaccinated animals, lower sensitivity of C-ELISA and FPA in comparison to I-ELISA and RBPT might be due to the fact that the results were analysed using MAT positive and negative samples. The number of positive samples detected by MAT is more in comparison to FPA and C-ELISA as MAT detects both vaccinal antibody as well as antibody generated due to infection with Brucella spp. Nielsen et al (1996) tested 250 serum samples from vaccinated cattle by FPA and 248 were negative giving specificity of 99.2% whereas Nielsen et al (1998) reported that 88.2% of B. abortus S19 were negative in the FPA. Lucero et al (2003) assessed FPA in comparison to C- ELISA and conventional serological tests and reported a specificity of 97.9% when 100

127 testing serum samples from asymptomatic blood donors with no evidence of brucellosis and a sensitivity estimate of 96.1% when testing serum samples from Brucella infected patients. However, Gall et al (2001) reported that the specificities of the BPAT, CFT, C-ELISA, FPA and I-ELISA for 55 elk vaccinatd with B. abortus S19 and tested 4 months post vaccination were 14%, 31%, 51%, 84% and 2%, respectively. Nicola et al (2010) reported that the relative sensitivity of FPA compared with I-ELISA and C-ELISA was 97% and 92.9% respectively and the relative specificity compared with I-ELISA and C-ELISA was 97.5% and 98% respectively when testing serum samples from non vaccinated brucellosis free animals. In the present study however, when FPA was compared with C-ELISA, sensitivity and specificity values for FPA by using C-ELISA as the reference test were 100% and 99.6% respectively. In addition, the false positive results obtained for FPA in the present study could be attributed to the poor quality of some contaminated serum samples. Serological tests such as I-ELISA are unable to distinguish vaccinal antibodies from those induced due to field infection whereas the C-ELISA and FPA are capable of this differentiation in most cases (Nielsen et al 1996 and Samartino et al 1999). The mechanism by which the C-ELISA and FPA discriminate vaccinal antibodies from antibodies generated due to infection with B. abortus is not known. However, in case of C-ELISA, it has been mentioned that serum samples from B. abortus strain 19 vaccinated cattle do not compete with the monoclonal antibody that is specific for an epitope on the O-polysaccharide portion of the smooth lipopolysaccharide (S-LPS) antigen because of their specificity and lower affinity leading to a negative reaction. However, in some cases samples taken before 6 months post vaccination may react 101

128 positively. In case of FPA, the ability to differentiate serum of strain 19 vaccinated cattle from serum of Brucella infected cattle, is different, and may result from low antibody affinity and production of less reactive isotypes. The increase in specificity with time after vaccination is probably a result of declining total antibody levels (Samartino et al 1999). 4.9 Peptide Nucleic acid Fluorescence in situ Hybridisation (PNA-FISH) for Brucella Fluorescence in situ hybridization using peptide nucleic acid probes (PNA- FISH) is a novel diagnostic technique combining the simplicity of traditional staining procedures with the unique performance of PNA probes to provide rapid and accurate diagnosis of infectious diseases. PNA molecules are DNA mimics that have the negatively charged sugar-phosphate backbone replaced by an achiral, neutral polyamide backbone formed by repetitive N-(2-aminoethyl) glycine units. Although PNA lacks pentoses, specific hybridization between the PNA sequences and nucleic acid complementary sequences still occur according to the Watson-Crick rules. The neutral characteristic of PNA molecule is responsible for a higher thermal stability (high Tm) between PNA/DNA or PNA/RNA bonding, compared with the traditional DNA probes. Due to this high affinity, PNA probes normally have sequences relatively smaller (13-18 nucleotides) than DNA sequences (at least 18 nucleotides). Due to uncharged backbone of PNA, these probes have superior hybridization characteristics as compared to traditional DNA probes (Perry O Keefe 2001). Moreover, the PNA molecules present more resistance to nucleases and proteases than DNA molecules. PNA-FISH technique has been used to identify specific organisms from cultures and it is mainly based upon 16S rrna as a target probe. When PNA probes 102

129 are attached to a fluorochrome dye, they can be detected by epifluorescence microscopy or flow cytometry using the fluorescence in situ hybridization (FISH) method. B. abortus strain S99 was used as the reference strain for standardization of PNA-FISH assay for detection of Brucella spp. The smear of B. abortus S99 was prepared by standard smear preparation technique as mentioned earlier in section Detergent Triton-X 100 (1%) was added to both the PBS used for smear preparation and to the hybridization buffer. Yellow green fluorescent coccobacilli were seen when the smear was observed under the 40X and 100X magnification of fluorescent microscope indicating that the PNA probe hybridized with B. abortus (Fig ) and no fluorescence was seen in the negative control (Fig. 27). Different concentrations of PNA probe prepared in hybridization buffer (50nm/20µl, 200nm/20µl and 500nm/20µl) were tested for hybridization with the standard culture of B. abortus S99 and optimum reaction was obtained at 500nm/20µl probe concentration. Hence probe concentration of 500nm/20µl was used for PNA- FISH assay for detection of Brucella. Probe concentration of 500nm/20µl for detection of Staphylococcus aureus and 250nm/20µl for Candida albicans has been earlier reported by Oliviera et al (2002) and Rigby et al (2002), respectively. PNA probes are known to have an overall superior performance as compared to DNA probes when used in the FISH format, including greater specificity (Wilks and Keevil, 2006). The results are in corroboration with previous studies targeting other microbial pathogens (Oliviera et al 2002, Rigby et al 2002, Søgaard et al 2007). The PNA probe was evaluated for specificity by testing some commonly available bacteria (E. coli, Enterococcus, Salmonella, Staphylococus and Streptococcus). No positive fluorescence signals were observed with the different 103

130 bacteria tested (Fig. 28a, b, c, d, e) indicating that the PNA probe was specific for Brucella spp. 104

131 Fig. 23: PNA-FISH using labelled (40X) Fig. 24: PNA-FISH using labelled (40X)

132 Fig. 25: PNA-FISH using labelled (40X) Fig. 26: PNA-FISH using labelled (100X)

133 Fig. 27: PNA-FISH : Negative control (40X) Fig. 28a: E. coli Fig. 28b: Enterococcus Fig. 28c: Staphylococcus Fig. 28d: Streptococcus Fig. 28e: Salmonella Fig. 28: Specificity evaluation of PNA-FISH assay (40X)