Introduction B. DIK 1 *, S. YAVRU 2, U. USLU 1, O. YAPICI 2, E. ESIN 2. that approximately 30 Culicoides species act as vectors of BTV worldwide.
|
|
- Annabelle Logan
- 5 years ago
- Views:
Transcription
1 Determination of Culicoides species (Diptera: Ceratopogonidae) as suspect vectors of Epizootic Haemorrhagic Disease and Bluetongue viruses in southern and western Anatolia by RT-PCR B. DIK 1 *, S. YAVRU 2, U. USLU 1, O. YAPICI 2, E. ESIN 2 1 Department of Parasitology, Faculty of Veterinary Medicine, Selçuk University, Konya, TURKEY. 2 Department of Virology, Faculty of Veterinary Medicine, Selçuk University, Konya, TURKEY. *Corresponding author: bdik2004@yahoo.com SUMMARY This study was performed to detect genomes of the Epizootic Haemorrhagic Disease Virus (EHDV) and Bluetongue virus (BTV) in Culicoides species present in various areas from Anatolia. Culicoides samples were caught using Onderstepoort-type light traps in 18 districts from 7 Provinces (Antalya, Muğla, Aydın, İzmir, Manisa, Balıkesir and Çanakkale) and the presence of viral genomes was investigated by RT-PCR using specific primer pairs (EHDV/S3 and BTV/S7, respectively). Out of the 13 Culicoides species collected, C. imicola complex was predominant following by Culicoides sp, C. nubeculosus, C. schultzei, C. circumscriptus and C. longipennis. The BTV genome was not evidenced in any diptera species whereas the presence of EHDV was detected in 9 species (C. imicola, C. circumscriptus, C. festivipennis, C. gejgelensis, C. longipennis, C. nubeculosus, C. obsoletus, C. pulicaris and Culicoides sp.) depending for the localisation of the collecting centers. The viral genome was evidenced in C. pulicaris and C. imicola complexes, in C. festivipennis, C. gejgelensis, C. longipennis and Culicoides sp. caught in Mugla, in C. imicola, C. longipennis and C. nubeculosus caught in Izmir and in C. obsoletus and C. circumscriptus collected in the Çanakkale province. These results show that all of the Culicoides species, from which the viral genome was detected by RT-PCR for the first time in Turkey, were potential EHDV vectors. Keywords: Epizootic haemorrhagic disease virus, bluetongue virus, Culicoides, vector, viral genome, RT-PCR, southern and western Anatolia, Turkey. RÉSUMÉ Détermination des espèces de Culicoides (Diptères : Ceratopogonidae) potentiellement vecteurs des virus de l Epizootic Haemorrhagic Disease et de la Blue tongue en Anatolie du sud et de l ouest par RT-PCR Cette étude a été entreprise dans le but de détecter les génomes des virus de l epizootic haemorrhagic disease (EHDV) et de la blue tongue (BTV) dans les espèces de Culicoïdes présentes dans différentes zones d Anatolie. Les insectes ont été collectés dans des pièges lumineux de type Onderstepoort répartis sur 18 districts de 7 provinces différentes (Antalya, Muğla, Aydın, İzmir, Manisa, Balıkesir et Çanakkale) et la présence des ADNs viraux a été recherchée par RT-PCR en utilisant des paires d amorces spécifiques (respectivement EHDV/S3 et BTV/S7). Parmi les 13 espèces collectées, C. imicola était majoritaire suivie de Culicoides sp, C. nubeculosus, C. schultzei, C. circumscriptus et de C. longipennis. Le génome du BTV n a été détecté dans aucune des espèces de Culicoïdes alors que celui de l EHDV a été mis en évidence dans 9 espèces (C. imicola, C. circumscriptus, C. festivipennis, C. gejgelensis, C. longipennis, C. nubeculosus, C. obsoletus, C. pulicaris et Culicoides sp.) en fonction de la localisation des centres de collecte. Le génome viral a été retrouvé chez C. pulicaris, C. imicola, C. festivipennis, C. gejgelensis, C. longipennis et Culicoides sp. capturés dans la province de Mugla, chez C. imicola, C. longipennis et C. nubeculosus capturés dans la province d Izmir et chez C. obsoletus et C. circumscriptus issus de la province de Çanakkale. Ces résultats montrent que toutes les espèces de Culicoïdes dans lesquelles l EHDV a été détecté par RT-PCR pour la première fois en Turquie sont des vecteurs potentiels. Mots clés : Virus de l epizootic haemorrhagic disease, virus de la Blue tongue, Culicoïdes, vecteur, génome viral, RT-PCR, Anatolie du sud et de l ouest, Turquie. Introduction From time to time, Bluetongue virus (BTV), Akabane virus (AKAV), Ephemeral Fever virus (EFV) and Epizootic Haemorrhagic Disease Virus (EHDV) infections occur in Turkey, as in many other countries across the world. These diseases cause economic loss and mortality in sheep, goats and cattle [1, 5, 6, 19, 21, 22, 30-37, 39]. These diseases are transmitted by blood-sucking flies belonging to the genus Culicoides. The principal vector of BTV in Africa, the Middle East and Europe is C. imicola [18, 25, 26]. MEISWINKEL et al. [23] have reported that approximately 30 Culicoides species act as vectors of BTV worldwide. It was reported that, during the epidemic episode in 1999, the most commonly encountered Culicoides species belonged to the C. obsoletus complex, whilst C. imicola was not detected in Bulgaria, Serbia, Bosnia-Herzegovina, Kosovo, Croatia, Montenegro, northern Greece and the Thrace region of Turkey [25, 26]. The viral BTV RNA was detected in the C. pulicaris complex using nested RT-PCR, in an outbreak in Sicily. It was reported that, in the BTV outbreaks that occurred in Catalonia [10],
2 506 DIK (B.) AND COLLABORATORS Spain between the years , C. obsoletus and C. scoticus were the possible vectors of the disease [29]. Furthermore, in a study aimed at determining the vector Culicoides species involved in a BTV outbreak in Portugal, C. imicola and C. obsoletus were identified as the first two most commonly encountered species in southern and northern Portugal, respectively [9]. It was stated that among the 44 Culicoides species identified in France, the majority belonged to the C. obsoletus complex, whilst none belonged to the C. imicola complex [3]. Furthermore, in Switzerland, the most common species were determined to belong to the C. pulicaris and C. obsoletus complexes, whilst species belonging to the C. imicola complex, which are known as the main vectors of BTV, were rarely encountered [8]. In the BTV outbreaks, which occurred in northern Europe in 2006, both morbidity and mortality were observed at very low rates [11, 12, 24]. Two pools of C. dewulfi and C. chiopterus were determined to be PCR-positive for BTV serotype-8 [12, 24]. CARPENTER et al. [11] have also isolated BTV serotypes-8 and 9 from C. scoticus and C. obsoletus (s.s.). EHDV occurs in domestic and wild ruminants in northern, central and southern America, Africa, Southeast Asia, Japan and Australia [25]. BURGU et al. [6, 7] reported the presence of EHDV in cattle and sheep in southern Turkey at low rates. However, EHDV outbreaks occurred along the Aegean coast of Turkey in the summer of 2007 and several animals died from this disease [31]. Unfortunately, the EHDV vector species have not been studied enough worldwide. Nevertheless it has been reported that the main vector is C. imicola in Sudan and that the C. schultzei complex could also act as a vector [2]. To date, 57 Culicoides species have been identified in Turkey [13-18, 20, 32-35, 38]. The results of the studies conducted in Turkey demonstrated that the C. imicola and C. schultzei complexes existed in the Mediterranean and Aegean regions while the C. pulicaris and C. obsoletus complexes were found in central Anatolia and in other parts of Turkey [18]. Unfortunately, there are only a few studies aimed at the detection of vector Culicoides species, which transmit viral diseases, in Turkey. In a study conducted to detect the BTV vectors in central and mid-west Anatolia, 12 Culicoides species were identified among the specimens caught, of which none belonged to the C. imicola, C. obsoletus and C. schultzei complexes, and very few were of the C. pulicaris complex. However, the BTV viral genome was detected in C. circumscriptus, C. punctatus and C. kibunensis by one-step RT-PCR [37]. The EHDV vector Culicoides species have not been investigated in Turkey before. In this respect, the aim of the present study was to detect the viral BTV and EHDV genomes present in Culicoides species in Turkey. FIGURE 1: Culicoides collecting centres in the investigated 7 provinces (Antalya, Muğla, Aydın, İzmir, Manisa, Balıkesir and Çanakkale) from southern and western Turkey. Dalaman, Fethiye (Çaltıözü village), Milas (Kırcağız and Menteş villages) and Ortaca], Aydın [27:51E 37:51N in periphery of Germencik (Turanlar and Reis villages) and Söke (Gölbent village)], İzmir [27:09E 38:25 N in periphery of Bornova, Dikili (Bahçeli village) and Menderes (Çileme village)], Manisa [27:26E 38:36N Manisa city central], Balıkesir [27:53E 39:39N in periphery of Balya (Değirmendere village) and Burhaniye] and Çanakkale [26:24E 40:09N in periphery of Yenice (Çırpılar and Yenice villages)]. Onderstepoort-type light traps were used for the collection of Culicoides samples. The light traps were placed either in or nearby sheep and cattle pens at sunset and were maintained until the next morning, and they were emptied. Totally, 50 light traps were placed in July 2008 and in July- September 2009 (16 in Antalya, 13 in Muğla and İzmir, 3 in Balıkesir, 2 in Aydın and Manisa and 1 in Çanakkale) (Table I). The Culicoides specimens caught were identified, and Culicoides pools were established from each species with specimens at each collecting centre. Specimens were stored at - 80 C in a deep freezer until used for virological examination. All female Culicoides samples were investigated for the BTV and EHDV whereas male specimens were not evaluated in the study. Material and Methods GEOGRAPHIC AREA AND CULICOIDES TRAPPING This study was carried out in southern and western Turkey (Figure 1) between July 2008 and September 2009 in the provinces of Antalya [30:42E 36:53N, in periphery of Aksu, Elmalı (Kışla and Yuva villages), Kemer, Manavgat (Evrenseki village) and Serik], Muğla [38:22E 37:12N, in periphery of VIROLOGICAL ANALYSIS Culicoides samples were prepared for one-step RT-PCR as described by CARACAPPA et al. [10]. The pools of each Culicoides species caught at each collecting centre were centrifuged for 15 minutes at 5000g at +4 C. Pellets were resuspensed in 1 ml of phosphate-buffered saline (PBS) containing antibiotics. This suspension was kept at -80 C in a deep freezer until onestep reverse transcriptase polymerase chain reaction (RT-
3 CULICOÏDES SPECIES AS VECTORS OF DISEASES 507 Culicoides Antalya Muğla Aydın İzmir Total species ( ) Aksu Elmalı Kemer Manavgat Serik C. badooshensis C. circumscriptus C. festivipennis C. gejgelensis C. imicola C. longipennis C. nubeculosus C. obsoletus C. parroti C. pictipennis C. pulicaris C. schultzei Culicoides sp Total C. badooshensis and C. longipennis were also known as C. kurensis and C. sahariensis respectively. Dalaman Fethiye Milas Ortaca Germencik Söke Bornova Dikili Menderes Manisa Merkez Balıkesir Burhaniye Çanakkale Yenice TABLE I: Culicoides species caught at collecting centres in southern and western Turkey in July 2008 and in July-September PCR) was performed. Viral RNA products extracted from the samples were examined using a one-step RT-PCR (QIAGEN, ) commercial kit. The process was carried out according to the manufacturer s instructions available with the kit. Primers (Table II) were obtained from Metabion International AG, Martinsried/Deutschland. Each product obtained using one-step RT-PCR was submittted to electrophoresis. Samples were examined under a gel transilluminator (UVP Inc., Upland CA, USA), and starting with the virus control, the developing stripes in all samples were evaluated and photographed. As control, BTV-4 was used for BTV. For EHDV, a virus strain already isolated in sheep from the Aydin province was used as control. Results A total of 4584 female Culicoides specimens were collected in the present study, which were determined to belong to 13 Culicoides species (Table I). As reported, the C. imicola complex was the most common species whereas C. nubeculosus, C. schultzei complex, C. circumscriptus and C. longipennis were sometimes found (prevalences between 2.8% and 4.9%), C. pulicaris complex and C. gejgelensis were scarcely recorded (0.7% and 0.4%, respectively) and C. festivipennis, C. badooshensis, C. obsoletus, C. parroti and C. pictipennis were exceptionally evidenced (prevalences lower than 0.15%). The majority of the specimens were caught in the districts Dikili (Izmir) and Fethiye (Muğla). However, no Culicoides samples were collected in some collecting centers. Primers Target segment Primer sequence Amplicon size (bp) and references BTV/S7 Forward GTTAAAAATCTATAGAGATG 1156 Segment 7 Reverse GTAAGTGTAATCTAAGAGA BREARD et al. [4] EHDV/S3 Forward CAGCGCYWTATWCGATATTG 533 Segment 3 Reverse TCCGGAGATACCTCCATTAC OHASHI et al. [27] TABLE II: Primers used for sequencing BTV /S7 and EHDV/S3 genomes by RT-PCR in Culicoides species (BTV: Bluetongue virus and EHDV: Epizootic Haemorrhagic Disease Virus).
4 508 DIK (B.) AND COLLABORATORS The one-step RT-PCR revealed that EHDV genome was detected in 9 Culicoides species (C. circumscriptus, C. festivipennis, C. gejgelensis, C. imicola, C. longipennis, C. nubeculosus, C. obsoletus, C. pulicaris and Culicoides sp.) caught by light traps set in the provinces investigated in the present study, but the virus was not detected in C. badooshensis, C. pictipennis, C. schultzei and C. parroti (Table III). However, the virus detection in the various Culicoides species has greatly varied according to the geographic areas. In the Mugla province, C. festivipennis, C. gejgelensis and C. longipennis (C. sahariensis?) specimens caught in Ortaca were found to be PCR-positive for the EHDV genome whereas the same species, even more abundant in the Fethiye district from the same province, were negative and the virus genome was evidenced only in the C. pulicaris complex and Culicoides sp specimens collected in Çaltıözü village (Fethiye, Muğla). On the other hand, the Culicoides species (C. circumscriptus and C. obsoletus) caught only in Çırpılar village (Yenice, Çanakkale) were positive for EHDV. In the Izmir province, EHDV was evidenced by RT-PCR in the C. longipennis and C. nubeculosus specimens collected only in Çileme village (Menderes) and not in the other districts (Bornova and Dikili). The pools of C. imicola complex caught in Bahçeli village (Dikili, İzmir) and in Çaltıözü village (Fethiye, Muğla) were also PCR-positive for the EHDV genome. No EHDV positive species was found in the Antalya province. In addition, all of the Culicoides samples were negative for the BTV-genome. Discussion Some viral diseases, including those caused by BTV, EHDV, AKAV and EFV, which are transmitted by Culicoides species, occur in different parts of Turkey. AKAV, BTV and EHDV have been detected in sheep and cattle, particularly in the Aegean region and occasionally in other regions of Turkey [1, 21, 22, 30, 37, 39]. Although EHDV was detected rarely in the past [6], outbreaks occurred in Muğla and in other provinces in western Anatolia in 2007 and 2008 [19, 31]. BURGU et al. [6] reported that, according to serological results, the presence of EHDV in cattle and sheep was rare in the southern part of Turkey but several sheep and cattle died due to EHDV outbreaks in [31]. It has been reported that the principal vector of EHDV in northern America is C. variipennis [25] and C. lahillei could also be a possible vector. The EHDV was isolated from the C. schultzei complex in Africa and from C. brevitarsis in Australia [25]. Nevertheless, all the Culicoides species acting as EHDV vectors are not yet identified in Central and South America, Japan and South-eastern Asia [25]. ROSENSTOCK et al. [28] stated that the principal vector of EHDV in North America was C. sonorensis, and that C. mohave could be a possible vector. It has been reported that the principal vector of EHDV is C. imicola in Sudan, and that C. schultzei could also serve as vector [2]. This virus has been isolated from approximately 30 Culicoides species worldwide, of which some have been confirmed as the vectors of the virus and some remain suspect vectors [19]. EHDV was also isolated from Anopheles vagus mosquito specimens collected in Bali, Indonesia. However, there was no evidence that any mosquito species could act as a biological vector of EHDV or BTV [19]. DIK [13, 14] reported the presence of several Culicoides species in the Mediterranean and Aegean regions of Turkey, which were new records for the country. However, which species are involved in the transmission of BTV, EHDV and AKAV in Turkey, remains unknown. Of the biological EHDV vectors, the C. imicola and C. schultzei complexes, as well as C. obsoletus and C. punctatus have been detected in previous studies. As EHDV was detected in cattle kept in barns in Çaltıözü village and Bahçeli village in June 2007 [31], light traps were set in the present study in barns in both villages, and several Culicoides specimens were caught between the months of August and September Three pools of the C. imicola complex caught in Çaltıözü and Bahçeli villages were found to be PCR-positive for EHDV. In addition, one pool of the C. pulicaris complex and one pool of Culicoides sp collected in Çaltıözü village were also found to be EHDV positive. Although EHDV was also reported to be transmitted by the C. schultzei complex and C. punctatus [19], among specimens belonging to the C. pulicaris complex, only one, which was identified as C. punctatus and which had been caught in Çaltıözü village, was found to be EHDV positive in the present Antalya Muğla İzmir Çanakkale Aksu Manavgat Serik Fethiye Ortaca Bornova Dikili Menderes Yenice C. circumscriptus N N N N N P C. festivipennis N P C. gejgelensis N P N N C. imicola N P N P C. longipennis N N N P N N P C. nubeculosus N N P C. obsoletus P C. pulicaris P N N Culicoides sp. N N N P N N N: PCR negative; P: PCR positive. TABLE III: Detection of the EHDV/S3 viral genome by one step RT-PCR in Culicoides species trapped in southern and western Turkey in July 2008 and in July-September 2009.
5 CULICOÏDES SPECIES AS VECTORS OF DISEASES 509 study. Viral genome presence was not detected in the other species caught in Çaltıözü village. These results suggest that the C. imicola and C. pulicaris complexes and Culicoides sp could be suspect EHDV vectors in this village. These results are in support of the statements of ARADAIB and ALI [2] indicating that the C. imicola complex could be the principal vector of EHDV in Turkey. On the other hand, the C. schultzei complex, which is one of the vectors of EHDV in Africa, was the second dominant species in the study. However, none of them were PCR-positive for the EHDV genome. In addition, C. circumscriptus and C. obsoletus complex specimens caught in Çırpılar village (Yenice, Çanakkale), C. longipennis (C. sahariensis?) and C. nubeculosus complex specimens caught in Çileme village (Menderes, İzmir), and C. festivipennis, C. gejgelensis and C. longipennis (C. sahariensis?) specimens collected in Ortaca district (Muğla) were also found positive for EHDV genome. To date, except for the C. imicola complex and C. pulicaris complex (C. punctatus), the isolation of EHDV has not been reported from other Culicoides species. The present results are relatively new findings in Turkey, indicating that various Culicoides species may be involved as EHDV vectors. In addition, this is the first study showing the presence of EHDV genome in Culicoides by one step RT-PCR in Turkey. In a previous study performed to determine the prevalence of BTV and its vector Culicoides species in central and midwest Anatolia, the C. imicola, C. obsoletus and C. schultzei complexes were not detected as positive while the C. pulicaris complex was rarely encountered. However, the specimens of C. circumscriptus, C. punctatus and C. kibunensis were found to be PCR-positive for BTV genome by one-step RT-PCR [37]. Nevertheless, BTV was not detected either from the C. imicola complex, which is the principal BTV vector, or from the C. schultzei complex, which is a possible vector or from the other Culicoides species identified in the present study. BTV activity is not at present reported in ruminants in Turkey, while it had been recorded until a few years ago. As a conclusion, although C. obsoletus and C. nubeculosus complexes are not undoubtedly considered as vectors in transmission of EHDV according to the EFSA [19], the present study demonstrate that EHDV genome is detected by one step RT-PCR in these Culicoides species and in others such as the C. imicola complex and C. circumscriptus, C. longipennis (C. sahariensis?), C. festivipennis and C. gejgelensis in some areas of the southern and western Turkey. Therefore, all these species can be considered as potential EHDV vectors. By contrast, in agreement with the low prevalence of BTV in Turkey at present, the BTV genome was not detected in any Culicoides species in the present study. Acknowledgement This study was funded by the Scientific Research Projects Unit (BAP) of Selçuk University (BAP Project No: ). We would like to thank the official veterinarians who kindly assisted us in provinces and districts. We would also like to thank Geomatic Engineer Dr. İlkay Buğdaycı for preparing the map presented in the paper. References 1. - ALBAYRAK H., ÖZAN E.: Orta Karadeniz bölgesinde ruminant ve tek tırnaklılarda kan emici sineklerle nakledilen bazı arboviral enfeksiyonların seroprevalansı. Kafkas Univ. Vet. Fac. J., 2010, 16, ARADAIB I., ALI N.: Current status and future prospects of epizootic haemorrhagic disease of deer-a review. Vet. Archiv., 2004, 74, BALDET T., DELECOLLE J.C., MATHİEU B., ROCQUE S., ROGER F.: Entomological surveillance of bluetongue in France in Vet. Italy., 2004, 40, BREARD E., SAILLEAU C., COUPİER H., RAVAUD K.M., HAM- MOUMI S., GICQUEL B., HAMBLIN C., DUBOURGET P., ZIEN- TARA S.: Molecular epidemiological analysis of genome segments 2, 7 and 10 of bluetongue virus in Corsica, and differentiation between field isolates and the vaccine strain by RT-PCR. Virus Res., 2003, 34, BULUT O., YAVRU S., YAPKIÇ O., SIMSEK A., KALE M., AVCI O.: Serological investigation of bluetongue virus infection by serum neutralization test and ELISA in sheep and goats. Bull. Vet. Inst. Pulawy., 2006, 50, BURGU I., AKCA Y., HAMBLIN C., KITCHING P.: Epizootic Haemorrhagic Disease virus antibodies in Turkey. Trop. Anim. Health Produc., 1991, 23, BURGU İ., URMAN H.K., AKCA Y., YONGUÇ A., MELLOR P.S., HAMBLIN C.: Serologic survey and vector surveillance for bluetongue in southern Turkey. In: Bluetongue, African Horse Sickness and related arboviruses, Walton T.E. and Ousburn B.I. (eds), Boca Raton, CRC Press, Florida, 1992, pp.: CAGIENARD A., GRIOT C., MELLOR P.S., DENISON E., STARK K.D.C.: Bluetongue vector species of Culicoides in Switzerland. Med. Vet. Entomol., 2006, 20, CAPELA R., PURSE B.V., PENA I., WITTMAN E.J., MARGARITA Y., CAPELA M., ROMAO L., MELLOR P.S., BAYLIS M.: Spatial distribution of Culicoides species in Portugal in relation to the transmission of African horse sickness and bluetongue viruses. Med. Vet. Entomol., 2003, 17, CARACAPPA S., TORINA A., GUERCIO A., VITALE F., CALABRO A., PURPARI G., FERRANTELLI V., VITALE M., MELLOR P.S.: Identification of novel a bluetongue virus vector species of Culicoides in Sicily. Vet. Rec., 2003, 19, CARPENTER S., Mc ARTHUR C., SELBY R., WARD R., NOLAN D.V., MORDUE LUNTZ A.J., DALLAS J.F., TRIPET F., MELLOR P.S.: Experimental infection studies of UK Culicoides species midges with bluetongue virus serotypes 8 and 9. Vet. Rec., 2008, 163, DIJKSTRA E., VAN DER VEN I.J.K., MEISWENKEL R., HÖLZEL D.R., VAN RIJN P.A., MEISWENKEL R.: Culicoides chiopterus as a potential vector of bluetongue virus in Europe. Vet. Rec., 2008, 162, DIK B.: Adana, İçel ve Antalya yörelerinde bulunan Culicoides Latreille, 1908 (Diptera: Cerato pogonidae) türlerinin tespiti, [Turkish]. Türk Vet. Hek. Derg., 1993, 5, DIK B.: Ege Bölgesi Culicoides (Diptera: Ceratopogonidae) Türlerinin Tespiti, [Turkish]. Parazitol. Derg., 1996, 20, DIK B., DINCER Ş.: Studies on Culicoides (Diptera: Ceratopogonidae) species around Konya (Turkey). [Turkish]. Doğa-Tr. J. Vet. Anim. Sci., 1992, 16, DIK B., KARATEPE M., KARATEPE B., YAGCI Ş.: Culicoides Latr, 1809 (Diptera: Ceratopogonidae) species in the Niğde province. Turk. Soc. Parasitol., 2006, 30, DIK B., KURT M., AYDIN I.: Karadeniz bölgesi Culicoides (Diptera: Ceratopogonidae) türleri üzerine bir araştırma. Bornova Vet. Kont. Araş. Enst. Derg., 2008, 30, DIK B., YAGCI Ş., LINTON Y.M.: A review of species diversity and distribution of Culicoides Latreille, 1809 (Diptera.Ceratopogonidae) in Turkey. J. Nat. Hist., 2006, 40, EFSA (European Food Safety Authority) 2009: Scientific opinion of Epizootic Hemorrhagic Disease, EFSA panel on Animal Health and Welfare (AHAW). EFSA J., 2009, 1418, EREN H., YAGCI Ş., DINCER Ş.: Ankara'da bulunan Culicoides (Diptera: Ceratopogonidae) türleri. Ankara Üniv. Vet. Fak. Derg., 1995, 42,
6 510 DIK (B.) AND COLLABORATORS GURTURK S., BURGU I., TOKER A.: Türkiye de sığırlarda Mavi Dil (Blue Tongue) enfeksiyonu üzerine araştrımalar. Ankara Univ. Vet. Fak. Derg., 1980, 27, JENNINGS M., BOORMAN J.P.T., ERGUN H.: Culicoides from western Turkey in relation to bluetongue disease of sheep and cattle. Rev. Elev. Méd. Vét. Pays Trop., 1983, 36, MEISWINKEL R., GOMULSKI L.M., DELECOLLE J.C., GOFFREDO M., GASPERI G.: The taxonomy of Culicoides vector complexesunfinished business. Vet. Italy., 2004, 40, MEISWINKEL R., VAN RIJN P., LEIJS P., GOFFREDO M.: Potential new Culicoides vector of bluetongue virus in northern Europe. Vet. Rec., 2007, 161, MELLOR P.S., BOORMAN J., BAYLIS M.: Culicoides biting midges: their role as arbovirus vectors. Ann. Rev. Entomol., 2000, 45, MELLOR P.S., WITTMANN E.J.: Bluetongue virus in the mediterranean basin Vet. J., 2002, 164, OHASHI S., YOSHIDA K., YANASE T., KATO T., TSUDA T.: Simultaneous detection of bovine arboviruses using single-tube multiplex reverse transcription-polymerase chain reaction. J. Virol. Method., 2004, 120, ROSENSTOCK S.S., RAMBERG F., COLLINS J.K., RABE M.J.: Culicoides mohave (Diptera: Ceratopogonidae): New occurrence records and potential role in transmission of Haemorrhagic disease. J. Med. Entomol., 2003, 40, SARTO I., MONTEYS V., SAIZ-ARDANAZ M.: Culicoides midges in Catalonia (Spain), with special reference to likely bluetongue virus vectors. Med. Vet. Entomol., 2003, 17, SELLERS R.F., PEDGLEY D.E.: Possible windborne spread to Western Turkey of Bluetongue virus in 1977 and of Akabane virus in J. Hyg. Cambridge., 1985, 95, TEMIZEL E.M., YESILBAG K., BATTEN C., SENTURK S., MAAN N.S., MERTENS P.P.C., BATMAZ H.: Epizootic Hemorrhagic Disease in cattle, Western Turkey. Emerg. Inf. Dis., 2009, 15, USLU U., DIK B.: Seasonal distribution of species Culicoides (Diptera: Ceratopogonidae) in Konya province. J. Vet. Sci., 2004, 20, USLU U., DIK B.: Vertical distribution of Culicoides larvae and pupae. Med. Vet. Entomol., 2006, 20, USLU U., DIK B.: Description of breeding sites of Culicoides species (Diptera: Ceratopogonidae) in Turkey. Bull. Soc. Fr. Parasitol., 2007, 14, USLU U., DIK B.: Chemical characteristics of breeding sites of Culicoides species (Diptera: Ceratopogonidae). Vet. Parasitol., 2010, 169, USLU U., DIK B.: Seasonal distribution of immature stages of Culicoides (Diptera: Ceratopogonidae) species. Euras. J. Vet. Sci., 2011, 27, YAVRU S., DIK B., BULUT O., USLU U., YAPICI O., KALE M., AVCI O.: İç ve İç Batı Anadolu da Koyunlarda Mavi Dil Virus (MDV) Enfeksiyonu nun Serolojik ve Virolojik Olarak Araştırılması ve Vektör Culicoides Türlerinin Belirlenmesi, 2009, (Tübitak Project No: 106O456) YILMAZ H.: Elazığ Yöresinde Bulunan Culicoides (Diptera: Ceratopogonidae) Türleri Üzerine Araştırmalar, Doktora Tezi, Fırat Üniversitesi Sağlık Bilimleri Enstitüsü, Elazığ, 1994, 109 sayfa YONGUÇ A.D., TAYLOR W.P., CSONTOS L., WORRALL E.: Bluetongue in Western Turkey. Vet. Rec., 1982, 14,
Entomological surveillance of bluetongue in France in 2002
Vet. Ital., (3), 226-23 Entomological surveillance of bluetongue in France in 22 T. Baldet (), J.-C. Delécolle (2), B. Mathieu (3), S. de La Rocque () & F. Roger () () CIRAD-EMVT, TA 3 E, Campus International
More informationArticle available at or USLU U.* & DIK B.**
Article available at http://www.parasite-journal.org or http://dx.doi.org/10.1051/parasite/2007142173 DESCRIPTION OF BREEDING SITES OF CULICOIDES SPECIES (DIPTERA: CERATOPOGONIDAE) IN TURKEY USLU U.* &
More informationCulicoides and the global epidemiology of bluetongue virus infection
Vet. Ital., 40 (3), 145-150 Epidemiology and vectors Culicoides and the global epidemiology of bluetongue virus infection W.J. Tabachnick Florida Medical Entomology Laboratory, Department of Entomology
More informationEpidemiological analysis of the 2006 bluetongue virus serotype 8 epidemic in north-western Europe. Within herd distribution of infection
Epidemiological analysis of the 26 bluetongue virus serotype 8 epidemic in north-western Europe Within herd distribution of infection A.R.W. Elbers 1, K. Mintiens 2, G. Gerbier 3, A.N. van der Spek 4,
More informationSome New Records of Culicoides Species (Diptera: Ceratopogonidae) from Iran
Original Article Some New Records of Culicoides Species (Diptera: Ceratopogonidae) from Iran *Mohammad Abdigoudarzi Department of Parasitology, Razi Vaccine and Serum Research Institute, Alborz, Iran (Received
More information* * *Determine Culicoides spp. present in the Southeast, including at
Stacey Vigil, Joseph L. Corn, Mark G. Ruder, and David K. Stallknecht svigil@uga.edu Southeast Cooperative Wildlife Disease Study, College of Veterinary Medicine, University of Georgia United States Animal
More informationTicks and tick-borne pathogens Jordi Tarrés-Call, Scientific Officer of the AHAW unit
Ticks and tick-borne pathogens Jordi Tarrés-Call, Scientific Officer of the AHAW unit Antwerp, June 2 nd 2010 1 The role of EFSA! To assess and communicate all risks associated with the food chain! We
More informationCharacterizing the species composition of European Culicoides vectors by means of the Köppen-Geiger climate classification
Brugger and Rubel Parasites & Vectors 2013, 6:333 SHORT REPORT Open Access Characterizing the species composition of European Culicoides vectors by means of the Köppen-Geiger climate classification Katharina
More informationWAGENINGEN UNIVERSITY LABORATORY OF ENTOMOLOGY
WAGENINGEN UNIVERSITY LABORATORY OF ENTOMOLOGY The overwintering behaviour of adult Culicoides species on livestock farms in the Netherlands and the effect of indoor insecticidal treatment on Culicoides
More informationEXTERNAL SCIENTIFIC REPORT
EXTERNAL SCIENTIFIC REPORT APPROVED: 8 February 2017 doi:10.2903/sp.efsa.2017.en-1182 A first estimation of Culicoides imicola and Culicoides obsoletus/culicoides scoticus seasonality and abundance in
More informationRole of different Culicoides vectors (Diptera: Ceratopogonidae) in bluetongue virus transmission and overwintering in Sardinia (Italy)
Foxi et al. Parasites & Vectors (2016) 9:440 DOI 10.1186/s13071-016-1733-9 RESEARCH Open Access Role of different Culicoides vectors (Diptera: Ceratopogonidae) in bluetongue virus transmission and overwintering
More informationInvestigation of Culicoides spp. preference for light colour and source using light emitting diodes and fluorescent light
514 Investigation of Culicoides spp. preference for light colour and source using light emitting diodes and fluorescent light A.B. Jenkins and M.B. Young # Animal and Poultry Science, School of Agricultural
More informationBluetongue in Albania. Ardian XINXO Deputy Director of Food Safety and Veterinary Institute - MARDWA
Bluetongue in Albania Ardian XINXO Deputy Director of Food Safety and Veterinary Institute - MARDWA Veterinary Service & Stakeholders The Veterinary Service (Competent Authority) is composed by: Veterinary
More informationEpidemiology and vectors Vet. Ital., 40 (3), & R. Meiswinkel
Vet. Ital., 40 (3), 260-265 Entomological surveillance of bluetongue in Italy: methods of capture, catch analysis and identification of Culicoides biting midges M. Goffredo (1) (1, 2) & R. Meiswinkel (1)
More informationTransmission of the virus (SBV) Stéphan Zientara UMR 1161 ANSES/INRA/ENVA
Transmission of the virus (SBV) Stéphan Zientara UMR 1161 ANSES/INRA/ENVA April 2, 2012 Transmission routes Direct transmission Vertical transmission Insect transmission Detection of Schmallenberg virus
More informationSystematics and taxonomy of the genus Culicoides what is coming next?
Systematics and taxonomy of the genus Culicoides what is coming next? Claire Garros 1, Bruno Mathieu 2, Thomas Balenghien 1, Jean-Claude Delécolle 2 1 CIRAD, Montpellier, France 2 IPPTS, Strasbourg, France
More informationJ. Med. Entomol. 44(6): 1019Ð1025 (2007)
VECTOR CONTROL, PEST MANAGEMENT, RESISTANCE, REPELLENTS Molecular Identification of Western European Species of Obsoletus Complex (Diptera: Ceratopogonidae) by an Internal Transcribed Spacer-1 rdna Multiplex
More informationCulicoides DISEASE TRANSMISSION. Arthropod vectors Culicoides
Culicoides Author: Dr. Gert Venter Licensed under a Creative Commons Attribution license. DISEASE TRANSMISSION In 1943 Du Toit conducted the first successful transmission of BTV from infected Culicoides
More informationDanish Culicoides species of the Obsoletus group identified by morphological methods
Danish Culicoides species of the Obsoletus group identified by morphological methods Søren Achim Nielsen Dept of Environmental, Social and Spatial Change Roskilde University Denmark Michael Kristensen
More informationCharacterizing the epidemiology of bluetongue virus serotype one in south Louisiana
Louisiana State University LSU Digital Commons LSU Master's Theses Graduate School 2008 Characterizing the epidemiology of bluetongue virus serotype one in south Louisiana Michael Edward Becker Louisiana
More informationThe phenology and population dynamics of Culicoides spp. in different ecosystems in The Netherlands
Available online at www.sciencedirect.com Preventive Veterinary Medicine 87 (2008) 41 54 www.elsevier.com/locate/prevetmed The phenology and population dynamics of Culicoides spp. in different ecosystems
More informationDetecting new diseases such as Schmallenberg Virus infections (SBV) Guda van der Burgt, Veterinary Investigation Officer AHVLA Luddington
Detecting new diseases such as Schmallenberg Virus infections (SBV) Guda van der Burgt, Veterinary Investigation Officer AHVLA Luddington 1 SURVEILLANCE WHAT DOES IT NEED TO DO? Detect at an early stage
More informationIndoor and outdoor winter activity of Culicoides biting midges, vectors of bluetongue virus, in Italy
Medical and Veterinary Entomology (2018) 32, 70 77 doi: 10.1111/mve.12260 Indoor and outdoor winter activity of Culicoides biting midges, vectors of bluetongue virus, in Italy A. MAGLIANO 1, P. SCARAMOZZINO
More informationVeterinary Parasitology
Veterinary Parasitology 184 (2012) 258 266 Contents lists available at SciVerse ScienceDirect Veterinary Parasitology jou rn al h om epa ge: www.elsevier.com/locate/vetpar Molecular characterization of
More informationA comparison of commercial light-emitting diode baited suction traps for surveillance of Culicoides in northern Europe
Hope et al. Parasites & Vectors (2015) 8:239 DOI 10.1186/s13071-015-0846-x RESEARCH Open Access A comparison of commercial light-emitting diode baited suction traps for surveillance of Culicoides in northern
More informationRISK ASSESSMENT WORKPACKAGE 5 BTV OVERWINTERING BY HORIZONTAL TRANSMISSION IN VECTORS, RUMINANTS OR IN BOTH
WORKPACKAGE 5 RISK ASSESSMENT S. Napp A. Alba I. García A. Allepuz J. Casal BTV OVERWINTERING BY HORIZONTAL TRANSMISSION IN VECTORS, RUMINANTS OR IN BOTH P. Calistri A. Giovannini S. Gubbins INTRODUCTION
More informationRegional research activities and state of the art of Vmerge Project: Emerging viralvector
Regional research activities and state of the art of Vmerge Project: Emerging viralvector borne diseases Joint permanent committee 4th November 2014 Cirad Key features of Vmerge Cirad - F Borne Objectives
More informationSEROPREVALENCE OF BLUETONGUE VIRUS INFECTION IN SHEEP IN TEKAB AREA IN IRAN
SEROPREVALENCE OF BLUETONGUE VIRUS INFECTION IN SHEEP IN TEKAB AREA IN IRAN *Hasanpour A. 1, Najafi M.S. 2 and Khakpour M. 3 1 Department of Clinical Sciences, College of Veterinary Medicine, Tabriz Branch,
More informationProgress and knowledge gaps in Culicoides genetics, genomics and population modelling: 2003 to 2014
Progress and knowledge gaps in Culicoides genetics, genomics and population modelling: 2003 to 2014 Simon Carpenter Vector borne Disease Programme, The Pirbright Institute, United Kingdom Corresponding
More informationBLUETONGUE The Netherlands 2006
BLUETONGUE The Netherlands 06 Latitude: North 50 56 29 GD Deventer GD Deventer GD Deventer SCFCAH 28 August 06 Till: 27-08-06, 12:00 hrs 0 Agenda Infected area / holdings Laboratory results Lessons learned
More informationSCWDS HD Surveillance 11/8/2016. Update on SCWDS Culicoides Surveys in the Southeast. Common Culicoides species in the Southeast U.S.
/8/0 Update on SCWDS Culicoides Surveys in the Southeast >00 sites >7,500 trap-nights WMAs, parks, etc July September CDC light traps Stacey Vigil, Mark Ruder, and Joseph L. Corn Southeastern Cooperative
More informationCulicoides midges (Diptera: Ceratopogonidae) as vectors of orbiviruses in Slovakia
Culicoides midges (Diptera: Ceratopogonidae) as vectors of orbiviruses in Slovakia Adela Sarvašová 1, Maria Goffredo 2, Igor Sopoliga 3, Giovanni Savini 2 & Alica Kočišová 1* 1 University of Veterinary
More informationPCR detection of Leptospira in. stray cat and
PCR detection of Leptospira in 1 Department of Pathology, School of Veterinary Medicine, Islamic Azad University, Shahrekord Branch, Shahrekord, Iran 2 Department of Microbiology, School of Veterinary
More informationOIE Collaborating Centre for Training in. Integrated Livestock and Wildlife Health and Management, Onderstepoort. Development of the Centre
OIE Collaborating Centre for Training in Integrated Livestock and Wildlife Health and Management, Onderstepoort Development of the Centre Consortium Partner Institutions Proposal - OIE Collaboration Centre
More informationRSPCA International- Europe, Turkey and Central Asia. Alexandra Hammond Seaman
RSPCA International- Europe, Turkey and Central Asia Alexandra Hammond Seaman The RSPCA will, by all lawful means, prevent cruelty, promote kindness to and alleviate suffering of all animals Founded in
More informationMöhlmann et al. Parasites & Vectors (2018) 11:217
Möhlmann et al. Parasites & Vectors (2018) 11:217 https://doi.org/10.1186/s13071-018-2792-x RESEARCH Open Access Community analysis of the abundance and diversity of biting midge species (Diptera: Ceratopogonidae)
More informationAn update of the Culicoides (Diptera: Ceratopogonidae) checklist for the Balkans
Pudar et al. Parasites & Vectors (2018) 11:462 https://doi.org/10.1186/s13071-018-3051-x RESEARCH Open Access An update of the Culicoides (Diptera: Ceratopogonidae) checklist for the Balkans Dubravka Pudar
More informationG. Kluiters 1*, N. Pagès 2,7, S. Carpenter 3, L. Gardès 4,5, H. Guis 4,5, M. Baylis 1,6 and C. Garros 4,5
Kluiters et al. Parasites & Vectors (2016) 9:262 DOI 10.1186/s13071-016-1520-7 RESEARCH Open Access Morphometric discrimination of two sympatric sibling species in the Palaearctic region, Culicoides obsoletus
More informationOIE Reference Laboratory Reports Activities
OIE Reference Laboratory Reports Activities Activities in 2015 This report has been submitted : 2016-02-03 11:54:54 Name of disease (or topic) for which you are a designated OIE Reference Laboratory: Enzootic
More informationCulicoides species composition and abundance on Irish cattle farms: implications for arboviral disease transmission
Collins et al. Parasites & Vectors (2018) 11:472 https://doi.org/10.1186/s13071-018-3010-6 RESEARCH Culicoides species composition and abundance on Irish cattle farms: implications for arboviral disease
More informationCulicoides species from the subgenus Culicoides in Catalonia (NE Spain)
Culicoides species from the subgenus Culicoides in Catalonia (NE Spain) Pagès, N., Muñoz-Muñoz, F., Talavera, S., Sarto, V., Lorca, C. and Nuñez, J.I. Identification Background Identification of Culicoides
More informationMedical entomology network MediLabSecure
Medical entomology network MediLabSecure Presentation of the working group dedicated to medical and veterinary entomology (WP4) Medilabsecure "Heads of Lab" meeting 14 / 01 / 2015 Vincent ROBERT / Marie
More informationAfrican horse sickness: The potential for an outbreak in disease-free regions and current disease control and elimination techniques
African horse sickness: The potential for an outbreak in disease-free regions and current disease control and elimination techniques M. ROBIN 1 *, P. PAGE 2, D. ARCHER 1 and M. BAYLIS 1,3 1 Department
More informationFinal Technical Report on the Proposal PGTF- INT/11/K07, PROG/2011/172.
Final Technical Report on the Proposal PGTF- INT/11/K07, PROG/2011/172. PROJECT code: 0007927 A Proposal to Enhance the Capacity Building/Development on the Effect of Climate Change on Animal Health Issues
More informationImplicating Culicoides Biting Midges as Vectors of Schmallenberg Virus Using Semi-Quantitative RT-PCR
Implicating Culicoides Biting Midges as Vectors of Schmallenberg Virus Using Semi-Quantitative RT-PCR Eva Veronesi 1, Mark Henstock 1, Simon Gubbins 1, Carrie Batten 1, Robyn Manley 1, James Barber 1,
More informationFeeding behaviour of Culicoides spp. (Diptera: Ceratopogonidae) on cattle and sheep in northeast Germany
Ayllón et al. Parasites & Vectors 2014, 7:34 RESEARCH Open Access Feeding behaviour of Culicoides spp. (Diptera: Ceratopogonidae) on cattle and sheep in northeast Germany Tania Ayllón 1, Ard M Nijhof 1,
More informationEncephalomyelitis. Synopsis. Armando Angel Biology 490 May 14, What is it?
Encephalomyelitis Armando Angel Biology 490 May 14, 2009 Synopsis What is it? Taxonomy Etiology Types- Infectious and Autoimmune Epidemiology Transmission Symptoms/Treatments Prevention What is it? Inflammation
More informationHyalomma impeltatum (Acari: Ixodidae) as a potential vector of malignant theileriosis in sheep in Saudi Arabia
Veterinary Parasitology 99 (2001) 305 309 Hyalomma impeltatum (Acari: Ixodidae) as a potential vector of malignant theileriosis in sheep in Saudi Arabia O.M.E. El-Azazy a,, T.M. El-Metenawy b, H.Y. Wassef
More informationChristian Kaufmann *, Irene C Steinmann, Daniel Hegglin, Francis Schaffner and Alexander Mathis
Kaufmann et al. Parasites & Vectors 22, 5:246 RESEARCH Open Access Spatio-temporal occurrence of Culicoides biting midges in the climatic regions of Switzerland, along with large scale species identification
More informationIdentification of field-caught Culicoides biting midges using matrix-assisted laser desorption/ionization time of flight mass spectrometry
Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2012 Identification of field-caught Culicoides biting midges using matrix-assisted
More informationRabies in Georgia National Center for Disease Control & Public Health (NCDC) Georgia Paata Imnadze, M.D. Ph.D
Rabies in Georgia National Center for Disease Control & Public Health (NCDC) Georgia Paata Imnadze, M.D. Ph.D The 3rd MEEREB meeting, Lyon, France 7-9 April, 2015 Introduction Rabies data have been registered
More informationBluetongue virus serotype 8 in sheep and cattle: a clinical update
F a r m a n i m a l p r a c t i c e Veterinary surgeons and their farming clients should all be on alert for bluetongue Bluetongue virus serotype 8 in sheep and cattle: a clinical update Daan DERcKSEN
More informationDETECTION OF BLUETONGUE VIRUS VECTOR AND ITS CHARACTERISTICS IN JHARKHAND
Indian J. Anim. Hlth. (2015), 54(1) : 9-16 Research Article DETECTION OF BLUETONGUE VIRUS VECTOR AND ITS CHARACTERISTICS IN JHARKHAND P.TIGGA, S.N. JOARDAR*, D. BANERJEE 1, I. SAMANTA, D.P. ISORE, K. BATABYAL
More informationSome Characteristics of Milk Yield in Awassi Ewes Maintained at Village Conditions
Journal of Advanced Agricultural Technologies Vol. 1, No. 1, June 2014 Some Characteristics of Milk Yield in Awassi Ewes Maintained at Village Conditions Gönül Gürsu and Turgut Aygün Yüzüncü Yıl University,
More informationPresentation Outline. Commercial RVF vaccines. RVF Clone 13 performance in the field. Candidate RVF vaccines in the pipeline
Presentation Outline Commercial RVF vaccines Old Smithburn, inactivated New Clone 13 RVF Clone 13 performance in the field Candidate RVF vaccines in the pipeline 2 Onderstepoort Biological Products November
More informationStanding Group of Experts on Lumpy Skin Disease in Europe under the GF-TADs umbrella
Standing Group of Experts on Lumpy Skin Disease in Europe under the GF-TADs umbrella First meeting (LSD1) Brussels, Belgium, 4-5 July 2016 CROATIA Ministry of Agriculture Veterinary and Food Safety Directorate
More informationOIE Reference Laboratory Reports Activities
OIE Reference Laboratory Reports Activities Activities in 2017 This report has been submitted : 2018-01-24 10:31:11 Name of disease (or topic) for which you are a designated OIE Reference Laboratory: Classical
More informationComparative investigation of border disease virus infection in sheep flocks with abortion problems in Konya province
Science Research 2014; 2(5): 119-124 Published online October 30, 2014 (http://www.sciencepublishinggroup.com/j/sr) doi: 10.11648/j.sr.20140205.17 ISSN: 2329-0935 (Print); ISSN: 2329-0927 (Online) Comparative
More informationGENERAL ARTICLE. K. Ilango
Bluetongue virus outbreak in Tamil Nadu, southern India: Need to study the Indian biting midge vectors, Culicoides Latreille (Diptera: Ceratopogonidae) K. Ilango Bluetongue (BT) is a viral disease causing
More informationGLOBAL WARMING AND ANIMAL DISEASE
GLOBAL WARMING AND ANIMAL DISEASE A.J. Wilsmore Eight of the warmest years on record have occurred during the last decade, thereby, superficially at least, seeming to support the concept of imminent climate
More informationEpidemiological survey and pathological studies on Caprine arthritis-encephalitis (CAE) in Japan
Epidemiological survey and pathological studies on Caprine arthritis-encephalitis (CAE) in Japan Misako KONISHI 1), Makoto HARITANI 2), Kumiko KIMURA 2), Takamitsu TSUBOI 3), Hiroshi SENTSUI 4) & Kenji
More informationCulicoides midges (Ceratopogonidae) in some localities of Saudi Arabia and their veterinary significance
VETERINARSKI ARHIV 73 (5), 285-294, 2003 Culicoides midges (Ceratopogonidae) in some localities of Saudi Arabia and their Musaad Hilali 1, EL Tayb Abu-Elzein 1 *, Adel Al-Afaleq 1, Philip Mellor 2, John
More informationImport Health Standard. For. Bovine Semen
Import Health Standard For Bovine Semen Short Name: bovsemid.gen MAF Biosecurity New Zealand Ministry of Agriculture and Forestry P.O Box 2526 Wellington 6011 New Zealand BOVSEMID.GEN 27 June 2011 Page
More informationEUROPEAN COMMISSION HEALTH & CONSUMERS DIRECTORATE-GENERAL. Unit G5 - Veterinary Programmes
EUROPEAN COMMISSION HEALTH & CONSUMERS DIRECTORATE-GENERAL Unit G5 - Veterinary Programmes SANCO/10813/2012 Programmes for the eradication, control and monitoring of certain animal diseases and zoonoses
More informationEradication and monitoring programme for Bluetongue
EUROPEAN COMMISSION HEALTH AND CONSUMERS DIRECTORATE-GENERAL Director General SANCO/10204/2013 Programmes for the eradication, control and monitoring of certain animal diseases and zoonoses Eradication
More informationWorldwide distribution of the major Culicoides vectors.
Arthropod vectors Culicoides Culicoides Author: Dr. Gert Venter Licensed under a Creative Commons Attribution license. DISTRIBUTION With the exception of Antarctica and New Zealand, Culicoides midges are
More informationJean-Yves Zimmer a *, Bertrand Losson b, Claude Saegerman c, Eric Haubruge a & Frédéric Francis a
Annales de la Société entomologique de France (N.S.), 2013 Vol. 49, No. 3, 335 344, http://dx.doi.org/10.1080/00379271.2013.854100 Breeding sites and species association of the main Bluetongue and Schmallenberg
More informationA LOCAL LIVESTOCK PROTECTION DOG TYPE RAISED IN COKELEZ MOUNTAIN REGION IN DENIZLI PROVINCE OF TURKEY
A LOCAL LIVESTOCK PROTECTION DOG TYPE RAISED IN COKELEZ MOUNTAIN REGION IN DENIZLI PROVINCE OF TURKEY Orhan Yilmaz 1, Mehmet Ertugrul 2 1 Ardahan University, Vocational High School of Technical Sciences,
More informationThe influence of temperature and humidity on the flight activity of Culicoides imicola both under laboratory and field conditions
Venter et al. Parasites & Vectors (2019) 12:4 https://doi.org/10.1186/s13071-018-3272-z RESEARCH The influence of temperature and humidity on the flight activity of Culicoides imicola both under laboratory
More informationPESTE DES PETITS RUMINANTS (PPR) IN SAIGA ANTELOPE IN MONGOLIA
PESTE DES PETITS RUMINANTS (PPR) IN SAIGA ANTELOPE IN MONGOLIA BODISAIKHAN.Kh State Central Veterinary Laboratory, Mongolia bodisaikhan@scvl.gov.mn Bali, Indonesia. 2017.07.04-06 CONTENT About Saiga antelope
More informationIdentity and diversity of blood meal hosts of biting midges (Diptera: Ceratopogonidae: Culicoides Latreille) in Denmark
Lassen et al. Parasites & Vectors 2012, 5:143 RESEARCH Identity and diversity of blood meal hosts of biting midges (Diptera: Ceratopogonidae: Culicoides Latreille) in Denmark Sandra B Lassen 1, Søren Achim
More informationSurveillance of animal brucellosis
Surveillance of animal brucellosis Assoc.Prof.Dr. Theera Rukkwamsuk Department of large Animal and Wildlife Clinical Science Faculty of Veterinary Medicine Kasetsart University Review of the epidemiology
More informationANNEX. to the COMMISSION IMPLEMENTING DECISION
EUROPEAN COMMISSION Brussels, 30.4.2015 C(2015) 3024 final ANNEX 1 ANNEX to the COMMISSION IMPLEMENTING DECISION on the adoption of the multiannual work programme for 2016-2017 for the implementation of
More informationSchmallenberg Virus Infections in Ruminants
Schmallenberg Virus Infections in Ruminants F. J. Conraths, B. Hoffmann, D. Höper, M. Scheuch, R. Jungblut, M. Holsteg, H. Schirrmeier, M. Eschbaumer, K. Goller, K. Wernike, M. Fischer, A. Breithaupt,
More informationCSF Position on Blue Tongue and Anaplasmosis Import Regulations with respect to U.S. trade.
CSF Position on Blue Tongue and Anaplasmosis Import Regulations with respect to U.S. trade. At the Canadian Sheep Federation s 2004 Annual General Meeting the motion was carried to endorse the current
More informationVeterinary Diagnostics Portfolio Overview. Complete solutions for veterinary testing and pathogen research
Veterinary Diagnostics Portfolio Overview Complete solutions for veterinary testing and pathogen research Sample preparation products Cat. no. (number of preps) Target analyte Product Short description
More informationSeroprevalence of antibodies to Schmallenberg virus in livestock
Seroprevalence of antibodies to Schmallenberg virus in livestock Armin R.W. Elbers Dept. Epidemiology, Crisis organisation and Diagnostics Central Veterinary Institute (CVI) part of Wageningen UR armin.elbers@wur.nl
More informationSeasonal Abundance of Biting Midges, Culicoides spp. (Diptera: Ceratopogonidae), Collected at Cowsheds in the Southern Part of the Republic of Korea
ISSN (Print) 0023-4001 ISSN (Online) 1738-0006 Korean J Parasitol Vol. 50, No. 2: 127-131, June 2012 http://dx.doi.org/10.3347/kjp.2012.50.2.127 Seasonal Abundance of Biting Midges, Culicoides spp. (Diptera:
More informationHEALTH REGULATIONS RELATED TO ANIMALS ADMISSION TO THE EUROPEAN HOLSTEIN CHAMPIONSHIP IN COLMAR, FRANCE, FROM 14 TO 19 JUNE 2016
20 th January 2016 HEALTH REGULATIONS RELATED TO ANIMALS ADMISSION TO THE EUROPEAN HOLSTEIN CHAMPIONSHIP IN COLMAR, FRANCE, FROM 14 TO 19 JUNE 2016 The health regulations can change or be adapted depending
More informationVector-Borne Diseases, Surveillance, Prevention
Vector-Borne Diseases, Surveillance, Prevention Journal of Medical Entomology, 53(2), 2016, 416 424 doi: 10.1093/jme/tjv197 Advance Access Publication Date: 22 December 2015 Research article Seasonal Dynamics,
More informationCross-sectional serosurvey and associated factors of bluetongue virus antibodies presence in small ruminants of Nepal
Gaire et al. BMC Research Notes 2014, 7:691 RESEARCH ARTICLE Open Access Cross-sectional serosurvey and associated factors of bluetongue virus antibodies presence in small ruminants of Nepal Tara Nath
More informationMilk yield measured by oxytocin plus hand milking and weigh-suckle-weigh methods in ewes originating from local crossbred in Turkey
Milk yield measured by oxytocin plus hand milking and weigh-suckle-weigh methods in ewes originating from local crossbred in Turkey N. ÜNAL *, F. ATASOY, H. AKÇAPINAR, S. KOÇAK, A. YAKAN, H. EROL and M.
More informationEuropean poultry industry trends
European poultry industry trends November 5 th 2014, County Monaghan Dr. Aline Veauthier & Prof. Dr. H.-W. Windhorst (WING, University of Vechta) 1 Agenda The European Chicken Meat Market - The global
More informationMATTILSYNET NORWEGIAN FOOD SAFETY AUTHORITY
MATTILSYNET NWEGIAN FOOD SAFETY AUTHITY Referencenumber: N O - COUNTRY: 1.Consignor (Exporter): Name: Address: 2. Certificate reference number: 3. Veterinary Authority: 4. Import permit number: 5. Consignee
More informationProtorhoe of Turkey, with notes on their distribution and zoogeography (Lepidoptera, Geometridae, Larentiinae), with a new record
Linzer biol. Beitr. 41/1 747-751 30.8.2009 Protorhoe of Turkey, with notes on their distribution and zoogeography (Lepidoptera, Geometridae, Larentiinae), with a new record Z. OKYAR A b s t r a c t : Two
More informationGlobal Perspective of Rabies. Alexander I. Wandeler CFIA Scientist Emeritus
Global Perspective of Rabies Alexander I. Wandeler CFIA Scientist Emeritus Topics general review of global situation of rabies general problems and basic epidemiology of rabies why do we need to focus
More informationMATTILSYNET THE NORWEGIAN FOOD SAFETY AUTHORITY
MATTILSYNET THE NWEGIAN FOOD SAFETY AUTHITY SANITARY CERTIFICATE For export of bovine semen from Norway to New Zealand COUNTRY: 1.Consignor (Exporter): Name: Address: Reference number: 2. Certificate reference
More informationRICKETTSIA SPECIES AMONG TICKS IN AN AREA OF JAPAN ENDEMIC FOR JAPANESE SPOTTED FEVER
RICKETTSIA SPECIES AMONG TICKS IN AN AREA OF JAPAN ENDEMIC FOR JAPANESE SPOTTED FEVER Makoto Kondo 1, Katsuhiko Ando 2, Keiichi Yamanaka 1 and Hitoshi Mizutani 1 1 Department of Dermatology, 2 Department
More informationSheep breed and shearing influences attraction and blood-feeding behaviour of Culicoides (Diptera: Ceratopogonidae) on a UK farm
Hope et al. Parasites & Vectors (2018) 11:473 https://doi.org/10.1186/s13071-018-3003-5 RESEARCH Open Access Sheep breed and shearing influences attraction and blood-feeding behaviour of Culicoides (Diptera:
More informationEnvironmental Drivers of Culicoides Phenology: How Important Is Species-Specific Variation When Determining Disease Policy?
Environmental Drivers of Culicoides Phenology: How Important Is Species-Specific Variation When Determining Disease Policy? Kate R. Searle 1 *, James Barber 2, Francesca Stubbins 2, Karien Labuschagne
More informationDiarra et al. Parasites & Vectors 2014, 7:147
Diarra et al. Parasites & Vectors 2014, 7:147 RESEARCH Open Access Seasonal dynamics of Culicoides (Diptera: Ceratopogonidae) biting midges, potential vectors of African horse sickness and bluetongue viruses
More informationJOURNAL OF INTERNATIONAL ACADEMIC RESEARCH FOR MULTIDISCIPLINARY Impact Factor 2.417, ISSN: , Volume 4, Issue 2, March 2016
EPIDEMIOLOGY OF TOXOPLASMA GONDII INFECTION OF CATS IN SOUTHWEST OF ALBANIA SHEMSHO LAMAJ 1 GERTA DHAMO 2 ILIR DOVA 2 1 Regional Agricultural Directory of Gjirokastra 2 Faculty of Veterinary Medicine,
More informationDepartment of Public Health, Pharmacology and Toxicology, Faculty of Veterinary Medicine, University of Nairobi 2
Bull. Anim. Hlth. Prod. Afr (2012) 60. 393-397 393 THE EFFICACY OF ALBENDAZOLE AND MOXIDECTIN IN THE CONTROL OF NEMATODE INFECTION IN DAIRY CATTLE 1 *, Kitala P M 1, Gitau G K 2, Maingi N 3 4 1 Department
More informationANNEX I SUMMARY OF PRODUCT CHARACTERISTICS
ANNEX I SUMMARY OF PRODUCT CHARACTERISTICS 1 1. NAME OF THE VETERINARY MEDICINAL PRODUCT BLUEVAC BTV8 suspension for injection for cattle and sheep 2. QUALITATIVE AND QUANTITATIVE COMPOSITION Each ml of
More informationThe Culicoides obsoletus group in Italy: relative abundance, geographic range, and role as vector for Bluetongue virus
The Culicoides obsoletus group in Italy: relative abundance, geographic range, and role as vector for Bluetongue virus Maria Goffredo 1*, Rudy Meiswinkel, Valentina Federici 1, Francesca Di Nicola 1, Giuseppe
More informationPeste des Petits Ruminants. Articles of the OIE Terrestrial Manual and Terrestrial Code related to PPR. Joseph Domenech, OIE
Peste des Petits Ruminants Articles of the OIE Terrestrial Manual and Terrestrial Code related to PPR Joseph Domenech, OIE 5 th meeting of the GF TADs Regional Steering Committee for Europe October 8 th
More informationHERITABILITY ESTIMATES OF HATCHING
HERITABILITY ESTIMATES OF HATCHING TIME IN THE FAYOUMI CHICKENS F. H. ABDOU H. AYOUB* Animal Production Department, Shebin El-Kom, Tanta Univ. Faculty of Agric., * Faculty of Agric., Ain Shams Univ., Cairo
More informationReview on status of babesiosis in humans and animals in Iran
Review on status of babesiosis in humans and animals in Iran Mousa Tavassoli, Sepideh Rajabi Department of Pathobiology, Faculty of Veterinary Medicine, Urmia University, Urmia, Iran Babesiosis is a zoonotic
More informationEFSA Scientific Opinion on canine leishmaniosis
EFSA Scientific Opinion on canine leishmaniosis Andrea Gervelmeyer Animal Health and Welfare Team Animal and Plant Health Unit AHAC meeting 19 June 2015 PRESENTATION OUTLINE Outline Background ToR Approach
More informationAssignment 13.1: Proofreading Bovine Spongiform Encephalopathy
Technical Editing, A 13.1, Proofreading Technical Editing Assignment 13.1: Proofreading Bovine Spongiform Encephalopathy The context This document is now set in type as it will appear in print unless corrected.
More information