Introduction B. DIK 1 *, S. YAVRU 2, U. USLU 1, O. YAPICI 2, E. ESIN 2. that approximately 30 Culicoides species act as vectors of BTV worldwide.

Transcription

1 Determination of Culicoides species (Diptera: Ceratopogonidae) as suspect vectors of Epizootic Haemorrhagic Disease and Bluetongue viruses in southern and western Anatolia by RT-PCR B. DIK 1 *, S. YAVRU 2, U. USLU 1, O. YAPICI 2, E. ESIN 2 1 Department of Parasitology, Faculty of Veterinary Medicine, Selçuk University, Konya, TURKEY. 2 Department of Virology, Faculty of Veterinary Medicine, Selçuk University, Konya, TURKEY. *Corresponding author: bdik2004@yahoo.com SUMMARY This study was performed to detect genomes of the Epizootic Haemorrhagic Disease Virus (EHDV) and Bluetongue virus (BTV) in Culicoides species present in various areas from Anatolia. Culicoides samples were caught using Onderstepoort-type light traps in 18 districts from 7 Provinces (Antalya, Muğla, Aydın, İzmir, Manisa, Balıkesir and Çanakkale) and the presence of viral genomes was investigated by RT-PCR using specific primer pairs (EHDV/S3 and BTV/S7, respectively). Out of the 13 Culicoides species collected, C. imicola complex was predominant following by Culicoides sp, C. nubeculosus, C. schultzei, C. circumscriptus and C. longipennis. The BTV genome was not evidenced in any diptera species whereas the presence of EHDV was detected in 9 species (C. imicola, C. circumscriptus, C. festivipennis, C. gejgelensis, C. longipennis, C. nubeculosus, C. obsoletus, C. pulicaris and Culicoides sp.) depending for the localisation of the collecting centers. The viral genome was evidenced in C. pulicaris and C. imicola complexes, in C. festivipennis, C. gejgelensis, C. longipennis and Culicoides sp. caught in Mugla, in C. imicola, C. longipennis and C. nubeculosus caught in Izmir and in C. obsoletus and C. circumscriptus collected in the Çanakkale province. These results show that all of the Culicoides species, from which the viral genome was detected by RT-PCR for the first time in Turkey, were potential EHDV vectors. Keywords: Epizootic haemorrhagic disease virus, bluetongue virus, Culicoides, vector, viral genome, RT-PCR, southern and western Anatolia, Turkey. RÉSUMÉ Détermination des espèces de Culicoides (Diptères : Ceratopogonidae) potentiellement vecteurs des virus de l Epizootic Haemorrhagic Disease et de la Blue tongue en Anatolie du sud et de l ouest par RT-PCR Cette étude a été entreprise dans le but de détecter les génomes des virus de l epizootic haemorrhagic disease (EHDV) et de la blue tongue (BTV) dans les espèces de Culicoïdes présentes dans différentes zones d Anatolie. Les insectes ont été collectés dans des pièges lumineux de type Onderstepoort répartis sur 18 districts de 7 provinces différentes (Antalya, Muğla, Aydın, İzmir, Manisa, Balıkesir et Çanakkale) et la présence des ADNs viraux a été recherchée par RT-PCR en utilisant des paires d amorces spécifiques (respectivement EHDV/S3 et BTV/S7). Parmi les 13 espèces collectées, C. imicola était majoritaire suivie de Culicoides sp, C. nubeculosus, C. schultzei, C. circumscriptus et de C. longipennis. Le génome du BTV n a été détecté dans aucune des espèces de Culicoïdes alors que celui de l EHDV a été mis en évidence dans 9 espèces (C. imicola, C. circumscriptus, C. festivipennis, C. gejgelensis, C. longipennis, C. nubeculosus, C. obsoletus, C. pulicaris et Culicoides sp.) en fonction de la localisation des centres de collecte. Le génome viral a été retrouvé chez C. pulicaris, C. imicola, C. festivipennis, C. gejgelensis, C. longipennis et Culicoides sp. capturés dans la province de Mugla, chez C. imicola, C. longipennis et C. nubeculosus capturés dans la province d Izmir et chez C. obsoletus et C. circumscriptus issus de la province de Çanakkale. Ces résultats montrent que toutes les espèces de Culicoïdes dans lesquelles l EHDV a été détecté par RT-PCR pour la première fois en Turquie sont des vecteurs potentiels. Mots clés : Virus de l epizootic haemorrhagic disease, virus de la Blue tongue, Culicoïdes, vecteur, génome viral, RT-PCR, Anatolie du sud et de l ouest, Turquie. Introduction From time to time, Bluetongue virus (BTV), Akabane virus (AKAV), Ephemeral Fever virus (EFV) and Epizootic Haemorrhagic Disease Virus (EHDV) infections occur in Turkey, as in many other countries across the world. These diseases cause economic loss and mortality in sheep, goats and cattle [1, 5, 6, 19, 21, 22, 30-37, 39]. These diseases are transmitted by blood-sucking flies belonging to the genus Culicoides. The principal vector of BTV in Africa, the Middle East and Europe is C. imicola [18, 25, 26]. MEISWINKEL et al. [23] have reported that approximately 30 Culicoides species act as vectors of BTV worldwide. It was reported that, during the epidemic episode in 1999, the most commonly encountered Culicoides species belonged to the C. obsoletus complex, whilst C. imicola was not detected in Bulgaria, Serbia, Bosnia-Herzegovina, Kosovo, Croatia, Montenegro, northern Greece and the Thrace region of Turkey [25, 26]. The viral BTV RNA was detected in the C. pulicaris complex using nested RT-PCR, in an outbreak in Sicily. It was reported that, in the BTV outbreaks that occurred in Catalonia [10],

2 506 DIK (B.) AND COLLABORATORS Spain between the years , C. obsoletus and C. scoticus were the possible vectors of the disease [29]. Furthermore, in a study aimed at determining the vector Culicoides species involved in a BTV outbreak in Portugal, C. imicola and C. obsoletus were identified as the first two most commonly encountered species in southern and northern Portugal, respectively [9]. It was stated that among the 44 Culicoides species identified in France, the majority belonged to the C. obsoletus complex, whilst none belonged to the C. imicola complex [3]. Furthermore, in Switzerland, the most common species were determined to belong to the C. pulicaris and C. obsoletus complexes, whilst species belonging to the C. imicola complex, which are known as the main vectors of BTV, were rarely encountered [8]. In the BTV outbreaks, which occurred in northern Europe in 2006, both morbidity and mortality were observed at very low rates [11, 12, 24]. Two pools of C. dewulfi and C. chiopterus were determined to be PCR-positive for BTV serotype-8 [12, 24]. CARPENTER et al. [11] have also isolated BTV serotypes-8 and 9 from C. scoticus and C. obsoletus (s.s.). EHDV occurs in domestic and wild ruminants in northern, central and southern America, Africa, Southeast Asia, Japan and Australia [25]. BURGU et al. [6, 7] reported the presence of EHDV in cattle and sheep in southern Turkey at low rates. However, EHDV outbreaks occurred along the Aegean coast of Turkey in the summer of 2007 and several animals died from this disease [31]. Unfortunately, the EHDV vector species have not been studied enough worldwide. Nevertheless it has been reported that the main vector is C. imicola in Sudan and that the C. schultzei complex could also act as a vector [2]. To date, 57 Culicoides species have been identified in Turkey [13-18, 20, 32-35, 38]. The results of the studies conducted in Turkey demonstrated that the C. imicola and C. schultzei complexes existed in the Mediterranean and Aegean regions while the C. pulicaris and C. obsoletus complexes were found in central Anatolia and in other parts of Turkey [18]. Unfortunately, there are only a few studies aimed at the detection of vector Culicoides species, which transmit viral diseases, in Turkey. In a study conducted to detect the BTV vectors in central and mid-west Anatolia, 12 Culicoides species were identified among the specimens caught, of which none belonged to the C. imicola, C. obsoletus and C. schultzei complexes, and very few were of the C. pulicaris complex. However, the BTV viral genome was detected in C. circumscriptus, C. punctatus and C. kibunensis by one-step RT-PCR [37]. The EHDV vector Culicoides species have not been investigated in Turkey before. In this respect, the aim of the present study was to detect the viral BTV and EHDV genomes present in Culicoides species in Turkey. FIGURE 1: Culicoides collecting centres in the investigated 7 provinces (Antalya, Muğla, Aydın, İzmir, Manisa, Balıkesir and Çanakkale) from southern and western Turkey. Dalaman, Fethiye (Çaltıözü village), Milas (Kırcağız and Menteş villages) and Ortaca], Aydın [27:51E 37:51N in periphery of Germencik (Turanlar and Reis villages) and Söke (Gölbent village)], İzmir [27:09E 38:25 N in periphery of Bornova, Dikili (Bahçeli village) and Menderes (Çileme village)], Manisa [27:26E 38:36N Manisa city central], Balıkesir [27:53E 39:39N in periphery of Balya (Değirmendere village) and Burhaniye] and Çanakkale [26:24E 40:09N in periphery of Yenice (Çırpılar and Yenice villages)]. Onderstepoort-type light traps were used for the collection of Culicoides samples. The light traps were placed either in or nearby sheep and cattle pens at sunset and were maintained until the next morning, and they were emptied. Totally, 50 light traps were placed in July 2008 and in July- September 2009 (16 in Antalya, 13 in Muğla and İzmir, 3 in Balıkesir, 2 in Aydın and Manisa and 1 in Çanakkale) (Table I). The Culicoides specimens caught were identified, and Culicoides pools were established from each species with specimens at each collecting centre. Specimens were stored at - 80 C in a deep freezer until used for virological examination. All female Culicoides samples were investigated for the BTV and EHDV whereas male specimens were not evaluated in the study. Material and Methods GEOGRAPHIC AREA AND CULICOIDES TRAPPING This study was carried out in southern and western Turkey (Figure 1) between July 2008 and September 2009 in the provinces of Antalya [30:42E 36:53N, in periphery of Aksu, Elmalı (Kışla and Yuva villages), Kemer, Manavgat (Evrenseki village) and Serik], Muğla [38:22E 37:12N, in periphery of VIROLOGICAL ANALYSIS Culicoides samples were prepared for one-step RT-PCR as described by CARACAPPA et al. [10]. The pools of each Culicoides species caught at each collecting centre were centrifuged for 15 minutes at 5000g at +4 C. Pellets were resuspensed in 1 ml of phosphate-buffered saline (PBS) containing antibiotics. This suspension was kept at -80 C in a deep freezer until onestep reverse transcriptase polymerase chain reaction (RT-

3 CULICOÏDES SPECIES AS VECTORS OF DISEASES 507 Culicoides Antalya Muğla Aydın İzmir Total species ( ) Aksu Elmalı Kemer Manavgat Serik C. badooshensis C. circumscriptus C. festivipennis C. gejgelensis C. imicola C. longipennis C. nubeculosus C. obsoletus C. parroti C. pictipennis C. pulicaris C. schultzei Culicoides sp Total C. badooshensis and C. longipennis were also known as C. kurensis and C. sahariensis respectively. Dalaman Fethiye Milas Ortaca Germencik Söke Bornova Dikili Menderes Manisa Merkez Balıkesir Burhaniye Çanakkale Yenice TABLE I: Culicoides species caught at collecting centres in southern and western Turkey in July 2008 and in July-September PCR) was performed. Viral RNA products extracted from the samples were examined using a one-step RT-PCR (QIAGEN, ) commercial kit. The process was carried out according to the manufacturer s instructions available with the kit. Primers (Table II) were obtained from Metabion International AG, Martinsried/Deutschland. Each product obtained using one-step RT-PCR was submittted to electrophoresis. Samples were examined under a gel transilluminator (UVP Inc., Upland CA, USA), and starting with the virus control, the developing stripes in all samples were evaluated and photographed. As control, BTV-4 was used for BTV. For EHDV, a virus strain already isolated in sheep from the Aydin province was used as control. Results A total of 4584 female Culicoides specimens were collected in the present study, which were determined to belong to 13 Culicoides species (Table I). As reported, the C. imicola complex was the most common species whereas C. nubeculosus, C. schultzei complex, C. circumscriptus and C. longipennis were sometimes found (prevalences between 2.8% and 4.9%), C. pulicaris complex and C. gejgelensis were scarcely recorded (0.7% and 0.4%, respectively) and C. festivipennis, C. badooshensis, C. obsoletus, C. parroti and C. pictipennis were exceptionally evidenced (prevalences lower than 0.15%). The majority of the specimens were caught in the districts Dikili (Izmir) and Fethiye (Muğla). However, no Culicoides samples were collected in some collecting centers. Primers Target segment Primer sequence Amplicon size (bp) and references BTV/S7 Forward GTTAAAAATCTATAGAGATG 1156 Segment 7 Reverse GTAAGTGTAATCTAAGAGA BREARD et al. [4] EHDV/S3 Forward CAGCGCYWTATWCGATATTG 533 Segment 3 Reverse TCCGGAGATACCTCCATTAC OHASHI et al. [27] TABLE II: Primers used for sequencing BTV /S7 and EHDV/S3 genomes by RT-PCR in Culicoides species (BTV: Bluetongue virus and EHDV: Epizootic Haemorrhagic Disease Virus).

4 508 DIK (B.) AND COLLABORATORS The one-step RT-PCR revealed that EHDV genome was detected in 9 Culicoides species (C. circumscriptus, C. festivipennis, C. gejgelensis, C. imicola, C. longipennis, C. nubeculosus, C. obsoletus, C. pulicaris and Culicoides sp.) caught by light traps set in the provinces investigated in the present study, but the virus was not detected in C. badooshensis, C. pictipennis, C. schultzei and C. parroti (Table III). However, the virus detection in the various Culicoides species has greatly varied according to the geographic areas. In the Mugla province, C. festivipennis, C. gejgelensis and C. longipennis (C. sahariensis?) specimens caught in Ortaca were found to be PCR-positive for the EHDV genome whereas the same species, even more abundant in the Fethiye district from the same province, were negative and the virus genome was evidenced only in the C. pulicaris complex and Culicoides sp specimens collected in Çaltıözü village (Fethiye, Muğla). On the other hand, the Culicoides species (C. circumscriptus and C. obsoletus) caught only in Çırpılar village (Yenice, Çanakkale) were positive for EHDV. In the Izmir province, EHDV was evidenced by RT-PCR in the C. longipennis and C. nubeculosus specimens collected only in Çileme village (Menderes) and not in the other districts (Bornova and Dikili). The pools of C. imicola complex caught in Bahçeli village (Dikili, İzmir) and in Çaltıözü village (Fethiye, Muğla) were also PCR-positive for the EHDV genome. No EHDV positive species was found in the Antalya province. In addition, all of the Culicoides samples were negative for the BTV-genome. Discussion Some viral diseases, including those caused by BTV, EHDV, AKAV and EFV, which are transmitted by Culicoides species, occur in different parts of Turkey. AKAV, BTV and EHDV have been detected in sheep and cattle, particularly in the Aegean region and occasionally in other regions of Turkey [1, 21, 22, 30, 37, 39]. Although EHDV was detected rarely in the past [6], outbreaks occurred in Muğla and in other provinces in western Anatolia in 2007 and 2008 [19, 31]. BURGU et al. [6] reported that, according to serological results, the presence of EHDV in cattle and sheep was rare in the southern part of Turkey but several sheep and cattle died due to EHDV outbreaks in [31]. It has been reported that the principal vector of EHDV in northern America is C. variipennis [25] and C. lahillei could also be a possible vector. The EHDV was isolated from the C. schultzei complex in Africa and from C. brevitarsis in Australia [25]. Nevertheless, all the Culicoides species acting as EHDV vectors are not yet identified in Central and South America, Japan and South-eastern Asia [25]. ROSENSTOCK et al. [28] stated that the principal vector of EHDV in North America was C. sonorensis, and that C. mohave could be a possible vector. It has been reported that the principal vector of EHDV is C. imicola in Sudan, and that C. schultzei could also serve as vector [2]. This virus has been isolated from approximately 30 Culicoides species worldwide, of which some have been confirmed as the vectors of the virus and some remain suspect vectors [19]. EHDV was also isolated from Anopheles vagus mosquito specimens collected in Bali, Indonesia. However, there was no evidence that any mosquito species could act as a biological vector of EHDV or BTV [19]. DIK [13, 14] reported the presence of several Culicoides species in the Mediterranean and Aegean regions of Turkey, which were new records for the country. However, which species are involved in the transmission of BTV, EHDV and AKAV in Turkey, remains unknown. Of the biological EHDV vectors, the C. imicola and C. schultzei complexes, as well as C. obsoletus and C. punctatus have been detected in previous studies. As EHDV was detected in cattle kept in barns in Çaltıözü village and Bahçeli village in June 2007 [31], light traps were set in the present study in barns in both villages, and several Culicoides specimens were caught between the months of August and September Three pools of the C. imicola complex caught in Çaltıözü and Bahçeli villages were found to be PCR-positive for EHDV. In addition, one pool of the C. pulicaris complex and one pool of Culicoides sp collected in Çaltıözü village were also found to be EHDV positive. Although EHDV was also reported to be transmitted by the C. schultzei complex and C. punctatus [19], among specimens belonging to the C. pulicaris complex, only one, which was identified as C. punctatus and which had been caught in Çaltıözü village, was found to be EHDV positive in the present Antalya Muğla İzmir Çanakkale Aksu Manavgat Serik Fethiye Ortaca Bornova Dikili Menderes Yenice C. circumscriptus N N N N N P C. festivipennis N P C. gejgelensis N P N N C. imicola N P N P C. longipennis N N N P N N P C. nubeculosus N N P C. obsoletus P C. pulicaris P N N Culicoides sp. N N N P N N N: PCR negative; P: PCR positive. TABLE III: Detection of the EHDV/S3 viral genome by one step RT-PCR in Culicoides species trapped in southern and western Turkey in July 2008 and in July-September 2009.

5 CULICOÏDES SPECIES AS VECTORS OF DISEASES 509 study. Viral genome presence was not detected in the other species caught in Çaltıözü village. These results suggest that the C. imicola and C. pulicaris complexes and Culicoides sp could be suspect EHDV vectors in this village. These results are in support of the statements of ARADAIB and ALI [2] indicating that the C. imicola complex could be the principal vector of EHDV in Turkey. On the other hand, the C. schultzei complex, which is one of the vectors of EHDV in Africa, was the second dominant species in the study. However, none of them were PCR-positive for the EHDV genome. In addition, C. circumscriptus and C. obsoletus complex specimens caught in Çırpılar village (Yenice, Çanakkale), C. longipennis (C. sahariensis?) and C. nubeculosus complex specimens caught in Çileme village (Menderes, İzmir), and C. festivipennis, C. gejgelensis and C. longipennis (C. sahariensis?) specimens collected in Ortaca district (Muğla) were also found positive for EHDV genome. To date, except for the C. imicola complex and C. pulicaris complex (C. punctatus), the isolation of EHDV has not been reported from other Culicoides species. The present results are relatively new findings in Turkey, indicating that various Culicoides species may be involved as EHDV vectors. In addition, this is the first study showing the presence of EHDV genome in Culicoides by one step RT-PCR in Turkey. In a previous study performed to determine the prevalence of BTV and its vector Culicoides species in central and midwest Anatolia, the C. imicola, C. obsoletus and C. schultzei complexes were not detected as positive while the C. pulicaris complex was rarely encountered. However, the specimens of C. circumscriptus, C. punctatus and C. kibunensis were found to be PCR-positive for BTV genome by one-step RT-PCR [37]. Nevertheless, BTV was not detected either from the C. imicola complex, which is the principal BTV vector, or from the C. schultzei complex, which is a possible vector or from the other Culicoides species identified in the present study. BTV activity is not at present reported in ruminants in Turkey, while it had been recorded until a few years ago. As a conclusion, although C. obsoletus and C. nubeculosus complexes are not undoubtedly considered as vectors in transmission of EHDV according to the EFSA [19], the present study demonstrate that EHDV genome is detected by one step RT-PCR in these Culicoides species and in others such as the C. imicola complex and C. circumscriptus, C. longipennis (C. sahariensis?), C. festivipennis and C. gejgelensis in some areas of the southern and western Turkey. Therefore, all these species can be considered as potential EHDV vectors. By contrast, in agreement with the low prevalence of BTV in Turkey at present, the BTV genome was not detected in any Culicoides species in the present study. Acknowledgement This study was funded by the Scientific Research Projects Unit (BAP) of Selçuk University (BAP Project No: ). We would like to thank the official veterinarians who kindly assisted us in provinces and districts. We would also like to thank Geomatic Engineer Dr. İlkay Buğdaycı for preparing the map presented in the paper. References 1. - ALBAYRAK H., ÖZAN E.: Orta Karadeniz bölgesinde ruminant ve tek tırnaklılarda kan emici sineklerle nakledilen bazı arboviral enfeksiyonların seroprevalansı. Kafkas Univ. Vet. Fac. J., 2010, 16, ARADAIB I., ALI N.: Current status and future prospects of epizootic haemorrhagic disease of deer-a review. Vet. Archiv., 2004, 74, BALDET T., DELECOLLE J.C., MATHİEU B., ROCQUE S., ROGER F.: Entomological surveillance of bluetongue in France in Vet. Italy., 2004, 40, BREARD E., SAILLEAU C., COUPİER H., RAVAUD K.M., HAM- MOUMI S., GICQUEL B., HAMBLIN C., DUBOURGET P., ZIEN- TARA S.: Molecular epidemiological analysis of genome segments 2, 7 and 10 of bluetongue virus in Corsica, and differentiation between field isolates and the vaccine strain by RT-PCR. Virus Res., 2003, 34, BULUT O., YAVRU S., YAPKIÇ O., SIMSEK A., KALE M., AVCI O.: Serological investigation of bluetongue virus infection by serum neutralization test and ELISA in sheep and goats. Bull. Vet. Inst. Pulawy., 2006, 50, BURGU I., AKCA Y., HAMBLIN C., KITCHING P.: Epizootic Haemorrhagic Disease virus antibodies in Turkey. Trop. Anim. Health Produc., 1991, 23, BURGU İ., URMAN H.K., AKCA Y., YONGUÇ A., MELLOR P.S., HAMBLIN C.: Serologic survey and vector surveillance for bluetongue in southern Turkey. In: Bluetongue, African Horse Sickness and related arboviruses, Walton T.E. and Ousburn B.I. (eds), Boca Raton, CRC Press, Florida, 1992, pp.: CAGIENARD A., GRIOT C., MELLOR P.S., DENISON E., STARK K.D.C.: Bluetongue vector species of Culicoides in Switzerland. Med. Vet. Entomol., 2006, 20, CAPELA R., PURSE B.V., PENA I., WITTMAN E.J., MARGARITA Y., CAPELA M., ROMAO L., MELLOR P.S., BAYLIS M.: Spatial distribution of Culicoides species in Portugal in relation to the transmission of African horse sickness and bluetongue viruses. Med. Vet. Entomol., 2003, 17, CARACAPPA S., TORINA A., GUERCIO A., VITALE F., CALABRO A., PURPARI G., FERRANTELLI V., VITALE M., MELLOR P.S.: Identification of novel a bluetongue virus vector species of Culicoides in Sicily. Vet. Rec., 2003, 19, CARPENTER S., Mc ARTHUR C., SELBY R., WARD R., NOLAN D.V., MORDUE LUNTZ A.J., DALLAS J.F., TRIPET F., MELLOR P.S.: Experimental infection studies of UK Culicoides species midges with bluetongue virus serotypes 8 and 9. Vet. Rec., 2008, 163, DIJKSTRA E., VAN DER VEN I.J.K., MEISWENKEL R., HÖLZEL D.R., VAN RIJN P.A., MEISWENKEL R.: Culicoides chiopterus as a potential vector of bluetongue virus in Europe. Vet. Rec., 2008, 162, DIK B.: Adana, İçel ve Antalya yörelerinde bulunan Culicoides Latreille, 1908 (Diptera: Cerato pogonidae) türlerinin tespiti, [Turkish]. Türk Vet. Hek. Derg., 1993, 5, DIK B.: Ege Bölgesi Culicoides (Diptera: Ceratopogonidae) Türlerinin Tespiti, [Turkish]. Parazitol. Derg., 1996, 20, DIK B., DINCER Ş.: Studies on Culicoides (Diptera: Ceratopogonidae) species around Konya (Turkey). [Turkish]. Doğa-Tr. J. Vet. Anim. Sci., 1992, 16, DIK B., KARATEPE M., KARATEPE B., YAGCI Ş.: Culicoides Latr, 1809 (Diptera: Ceratopogonidae) species in the Niğde province. Turk. Soc. Parasitol., 2006, 30, DIK B., KURT M., AYDIN I.: Karadeniz bölgesi Culicoides (Diptera: Ceratopogonidae) türleri üzerine bir araştırma. Bornova Vet. Kont. Araş. Enst. Derg., 2008, 30, DIK B., YAGCI Ş., LINTON Y.M.: A review of species diversity and distribution of Culicoides Latreille, 1809 (Diptera.Ceratopogonidae) in Turkey. J. Nat. Hist., 2006, 40, EFSA (European Food Safety Authority) 2009: Scientific opinion of Epizootic Hemorrhagic Disease, EFSA panel on Animal Health and Welfare (AHAW). EFSA J., 2009, 1418, EREN H., YAGCI Ş., DINCER Ş.: Ankara'da bulunan Culicoides (Diptera: Ceratopogonidae) türleri. Ankara Üniv. Vet. Fak. Derg., 1995, 42,

6 510 DIK (B.) AND COLLABORATORS GURTURK S., BURGU I., TOKER A.: Türkiye de sığırlarda Mavi Dil (Blue Tongue) enfeksiyonu üzerine araştrımalar. Ankara Univ. Vet. Fak. Derg., 1980, 27, JENNINGS M., BOORMAN J.P.T., ERGUN H.: Culicoides from western Turkey in relation to bluetongue disease of sheep and cattle. Rev. Elev. Méd. Vét. Pays Trop., 1983, 36, MEISWINKEL R., GOMULSKI L.M., DELECOLLE J.C., GOFFREDO M., GASPERI G.: The taxonomy of Culicoides vector complexesunfinished business. Vet. Italy., 2004, 40, MEISWINKEL R., VAN RIJN P., LEIJS P., GOFFREDO M.: Potential new Culicoides vector of bluetongue virus in northern Europe. Vet. Rec., 2007, 161, MELLOR P.S., BOORMAN J., BAYLIS M.: Culicoides biting midges: their role as arbovirus vectors. Ann. Rev. Entomol., 2000, 45, MELLOR P.S., WITTMANN E.J.: Bluetongue virus in the mediterranean basin Vet. J., 2002, 164, OHASHI S., YOSHIDA K., YANASE T., KATO T., TSUDA T.: Simultaneous detection of bovine arboviruses using single-tube multiplex reverse transcription-polymerase chain reaction. J. Virol. Method., 2004, 120, ROSENSTOCK S.S., RAMBERG F., COLLINS J.K., RABE M.J.: Culicoides mohave (Diptera: Ceratopogonidae): New occurrence records and potential role in transmission of Haemorrhagic disease. J. Med. Entomol., 2003, 40, SARTO I., MONTEYS V., SAIZ-ARDANAZ M.: Culicoides midges in Catalonia (Spain), with special reference to likely bluetongue virus vectors. Med. Vet. Entomol., 2003, 17, SELLERS R.F., PEDGLEY D.E.: Possible windborne spread to Western Turkey of Bluetongue virus in 1977 and of Akabane virus in J. Hyg. Cambridge., 1985, 95, TEMIZEL E.M., YESILBAG K., BATTEN C., SENTURK S., MAAN N.S., MERTENS P.P.C., BATMAZ H.: Epizootic Hemorrhagic Disease in cattle, Western Turkey. Emerg. Inf. Dis., 2009, 15, USLU U., DIK B.: Seasonal distribution of species Culicoides (Diptera: Ceratopogonidae) in Konya province. J. Vet. Sci., 2004, 20, USLU U., DIK B.: Vertical distribution of Culicoides larvae and pupae. Med. Vet. Entomol., 2006, 20, USLU U., DIK B.: Description of breeding sites of Culicoides species (Diptera: Ceratopogonidae) in Turkey. Bull. Soc. Fr. Parasitol., 2007, 14, USLU U., DIK B.: Chemical characteristics of breeding sites of Culicoides species (Diptera: Ceratopogonidae). Vet. Parasitol., 2010, 169, USLU U., DIK B.: Seasonal distribution of immature stages of Culicoides (Diptera: Ceratopogonidae) species. Euras. J. Vet. Sci., 2011, 27, YAVRU S., DIK B., BULUT O., USLU U., YAPICI O., KALE M., AVCI O.: İç ve İç Batı Anadolu da Koyunlarda Mavi Dil Virus (MDV) Enfeksiyonu nun Serolojik ve Virolojik Olarak Araştırılması ve Vektör Culicoides Türlerinin Belirlenmesi, 2009, (Tübitak Project No: 106O456) YILMAZ H.: Elazığ Yöresinde Bulunan Culicoides (Diptera: Ceratopogonidae) Türleri Üzerine Araştırmalar, Doktora Tezi, Fırat Üniversitesi Sağlık Bilimleri Enstitüsü, Elazığ, 1994, 109 sayfa YONGUÇ A.D., TAYLOR W.P., CSONTOS L., WORRALL E.: Bluetongue in Western Turkey. Vet. Rec., 1982, 14,