Article.

Transcription

1 Zootaxa 3948 (1): Copyright 2015 Magnolia Press Article ISSN (print edition) ZOOTAXA ISSN (online edition) An integrative taxonomic review of the agamid genus Bronchocela (Kuhl, 1820) from Peninsular Malaysia with descriptions of new montane and insular endemics L. LEE GRISMER 1, P. L. WOOD, JR. 2, CHEOL HAENG LEE 2, EVAN S. H. QUAH 3, SHAHRUL ANUAR 3, EHWAN NGADI 4 & JACK W. SITES, JR. 2 1 Department of Biology La Sierra University, 4500 Riverwalk Parkway, Riverside, California, USA. lgrismer@lasierra.edu; mmur027@lasierra.edu 2 Department of Biology, Brigham Young University, 150 East Bulldog Boulevard, Provo, Utah USA. perryleewoodjr@gmail.com, cheolhaeng@gmail.com, jack_sites@byu.edu 3 School of Biological Sciences, Universiti Sains Malaysia, USM, Pulau Pinang, Penang, Malaysia. evanquah@yahoo.com, shahrulanuar@gmail.com 4 Institute for Environment and Development, (LESTARI), Universiti Kebangsaan Malaysia, Bangi, Selangor Darul Ehsan, Malaysia. ehwanngadi@yahoo.com Abstract An integrative taxonomic analysis is used to identify and describe two new species of the agamid genus Bronchocela (Kuhl) from Peninsular Malaysia: an upland species B. shenlong sp. nov. from, Perak in the Bintang Mountain Range and Parit Falls, Cameron Highlands, Pahang in the Titiwangsa Mountain Range and an insular species, B. rayaensis sp. nov., from Pulau Langkawi, Kedah off the northwest coast on the border with Thailand. Both species are diagnosed from each other and all other species of Bronchocela on the basis of body shape, scale morphology, and color pattern. The analysis also demonstrates the remarkable genetic similarity of B. cristatella (Kuhl) throughout 1120 km of its range from northern Peninsular Malaysia to western Borneo despite its highly variable coloration and pattern. The two new species are appended to a rapidly growing list of newly described lizard species (60 to date) from Peninsular Malaysia tallied within the last decade. Key words: Peninsular Malaysia, Integrative taxonomy, Bronchocela, Langkawi Island Introduction The agamid genus Bronchocela (Kuhl) contains 10 species (Hallermann 2009) that collectively range from South Asia, southern Indochina and the Philippines, southward and eastward through the Thai-Malay Peninsula and the Indo-Australian Archipelago to at least western New Guinea (Manthey 2008). These are attractive, conspicuous, diurnal, arboreal lizards that inhabit open and disturbed areas ranging from sea level to over 1,600 meters and are often seen perched in open, sunlit areas as high as 30 meters above the ground on the trunks and branches of trees. Currently, only B. cristatella (Kuhl) is known from Peninsular Malaysia although its vast geographic range nearly encompasses that of the entire genus (Manthey 2008). Commensurate with this broad, fragmented distribution is a considerable degree of morphological and color pattern variation (see photos in Manthey [2008] and Grismer [2011]) yet only morphometric variation in Peninsular Malaysian populations has ever been studied (Diong & Lim 1998). Grismer (2011) noted that the upland population of B. cristatella from, Perak in the Bintang Mountain Range was composed of lizards manifesting color pattern characteristics not reported in other populations of B. cristatella and suggested genetic analyses would be helpful in resolving the taxonomic nature of this population. We have recently discovered an unreported upland population of Bronchocela from Parit Falls, Cameron Highlands, Pahang in the adjacent Titiwangsa Mountain Range composed of lizards bearing the same unique color pattern characteristics as those from. We also report here on two specimens of B. Accepted by S. Carranza: 12 Mar. 2015; published: 20 Apr

2 cristatella from a Pulau Langkawi, Kedah, whose diminutive size and unique morphology also require further investigation. The intent of this study is to address the taxonomy of Bronchocela in Peninsular Malaysia by testing the morphological based hypotheses that these three populations are not conspecific with what has been referred to as B. cristatella from Peninsular Malaysia (sensu Diong & Lim 1998; Grismer 2011) and that the upland populations from and Parit Falls are conspecific. To do so, a molecular phylogeny based on 1423 bp of the mitochondrial gene NADH dehydrogenase subunit 2 (ND2) and its flanking trnas (WANCY) was inferred and compared to data derived from additional morphological and color pattern analyses. We want to be clear that this paper does not address the phylogeographic variation of B. cristatella throughout its entire range but only in Peninsular Malaysia or the fact that B. cristatella lacks a type specimen and a type locality. These issues will be addressed at length in an integrative taxonomic revision of the entire genus. Material and methods Taxon Sampling and Outgroup Selection. Mitochondrial DNA. We sampled as widely as possible across the range of Bronchocela cristatella in Peninsular Malaysia, being sure to include multiple representatives of populations from as many peninsular and insular localities as possible. Our ingroup sampling consisted of 55 individuals from 27 localities (Fig. 1; Table 1). In order to test whether or not the Peninsular Malaysian populations formed a monophyletic group we included five additional specimens from the Philippines; one from Ranchan Pool, Sarawak, East Malaysia (Borneo); and another from Pulau Natuna Besar, Indonesia (Indonesia). Based on the relationships of Pyron et al. (2013), six other agamid species were used as outgroups to root the tree. All new sequences were deposited in GenBank (Table 1). FIGURE1. Distribution map showing the locations of the specimens examined in this study. Stars represent type localities. Yellow and green circles represent specimens of Bronchocela that were included in the morphological and the molecular analyses; blue circles are specimens included only in the morphological analysis. Philippine material was included only in the molecular analysis. Numbers in circles refer to localities listed in Table 1. Letters in circles are as follows: A = Pulau Singa Besar, Kedah; B = Perlis State Park, Perlis; C = Mertajam, Penang; D = Gerik, Perak; E = NE Gerik, Perak; F = Pulau Jarak, Perak; G = Tapah, Perak; H = Kuala Teku, Pahang; I = Gunung Benom, Pahang; K = Pulau Pisang, Johor; L = Singapore; and Pulau Ubin, Singapore. 2 Zootaxa 3948 (1) 2015 Magnolia Press GRISMER ET AL.

3 TABLE 1. Specimens used in this study with locality data GenBank Accessions numbers. Museum acronyms follow Sabaj-Perez (2014): CDS refers to Cameron D. Siler field series; KU refers to Kansas University Museum of Natural History collection; LSUHC refers to the La Sierra University Herpetological Collection, La Sierra University, Riverside, California, USA; RMB refers to Rafe M. Brown field series; TNHC refers to TNHC, Texas Natural History Collection; WHT refers to the Wildlife Heritage Trust, Colombo, Sri Lanka. Voucher no. Species Name Locality GenBank Accession # TNHC57874 Aphaniotis fusca Malaysia, Selangor, Ulu Gombak, Field Studies Center AF WHT1682 Ceratophora stoddartii Sri Lanka AF N/A Cophotis dumbara Sri Lanka GQ KU Gonocephalus cf. semperi Philippines KR LSUHC3788 Gonocephalus chamaeleontinus Malaysia, Pahang, Pulau Tioman, Tekek-Juara Trail KR WHT2196 Lyriocephalus scutatus Sri Lanka, Knuckles Hills, Puwakpitiya AF LSUHC4027 Bronchocela cristatella 1 East Malaysia, Sarawak, Ranchan Pool on Sadong River XX LSUHC11616 Bronchocela cristatella 2 Indonesia, Natuna Besar KR LSUHC7711 Bronchocela cristatella 3 Malaysia, Johor, Endau-Rompin, Peta KR LSUHC7654 Bronchocela cristatella 3 Malaysia, Johor, Endau-Rompin, Peta KR LSUHC7678 Bronchocela cristatella 3 Malaysia, Johor, Endau-Rompin, Peta KR LSUHC10581 Bronchocela cristatella 4 Malaysia, Johor, Gunung Ledang KR LSUHC3959 Bronchocela cristatella 5 Malaysia, Johor, Pulau Aur KR LSUHC5568 Bronchocela cristatella 6 Malaysia, Johor, Pulau Babi Besar KR LSUHC5738 Bronchocela cristatella 6 Malaysia, Johor, Pulau Babi Besar KR LSUHC4467 Bronchocela cristatella 7 Malaysia, Johor, Pulau Pemanggil KR LSUHC8022 Bronchocela cristatella 7 Malaysia, Johor, Pulau Pemanggil KR LSUHC5541 Bronchocela cristatella 8 Malaysia, Johor, Pulau Sibu KR LSUHC5776 Bronchocela cristatella 8 Malaysia, Johor, Pulau Sibu KR LSUHC5777 Bronchocela cristatella 8 Malaysia, Johor, Pulau Sibu KR LSUHC4761 Bronchocela cristatella 9 Malaysia, Johor, Pulau Tinggi, Pasir Panjang Waterfall Trail KR LSUHC6323 Bronchocela cristatella 9 Malaysia, Johor, Pulau Tinggi; Pasir Panjang Waterfall Trail KR LSUHC8931 Bronchocela cristatella 10 Malaysia, Johor, rd. between K. Tinggi and Kulai KR LSUHC8235 Bronchocela cristatella 11 Malaysia, Johor, Selai KR LSUHC8121 Bronchocela cristatella 11 Malaysia, Johor, Selai KR LSUHC6429 Bronchocela cristatella 12 Malaysia, Pahang, Pulau Tioman, Kg. Juara KR LSUHC4613 Bronchocela cristatella 12 Malaysia, Pahang, Pulau Tioman, Monkey Bay KR LSUHC5412 Bronchocela cristatella 12 Malaysia, Pahang, Pulau Tioman, Monkey Bay KR LSUHC5045 Bronchocela cristatella 12 Malaysia, Pahang, Pulau Tioman, Tekek-Juara Trail KR LSUHC6295 Bronchocela cristatella 12 Malaysia, Pahang, Pulau Tioman, Tekek-Juara Trail KR LSUHC3889 Bronchocela cristatella 13 Malaysia, Johor, Pulau Tulai KR LSUHC4689 Bronchocela cristatella 13 Malaysia, Johor, Pulau Tulai KR continued on the next page NEW BRONCHOCELA FROM PENINSULAR MALAYSIA Zootaxa 3948 (1) 2015 Magnolia Press 3

4 TABLE 1. (Continued) Voucher no. Species Name Locality GenBank Accession # LSUHC4690 Bronchocela cristatella 13 Malaysia, Johor, Pulau Tulai KR LSUHC6276 Bronchocela cristatella 13 Malaysia, Johor, Pulau Tulai KR LSUHC12103 Bronchocela cristatella 14 Malaysia, Perak, 12 km S Parit Falls, Cameron Highlands KR LSUHC11804 Bronchocela cristatella 15 Malaysia, Penang, Air Hitam XX LSUHC6742 Bronchocela cristatella 15 Malaysia, Penang, Air Hitam KR LSUHC10647 Bronchocela cristatella 16 Malaysia, Penang, Penang Hill KR LSUHC12102 Bronchocela cristatella 17 Malaysia, Perak, Base of KR LSUHC5673 Bronchocela cristatella 18 Malaysia, Perak, Temengor, PITC Logging Camp KR LSUHC12056 Bronchocela cristatella 19 Malaysia, Perak, Pulau Banding, Belum KR LSUHC11423 Bronchocela cristatella 20 Malaysia, Terengganu, Pulau Bidong KR LSUHC6660 Bronchocela cristatella 21 Malaysia, Selangor, Ampang Reservoir KR LSUHC6661 Bronchocela cristatella 21 Malaysia, Selangor, Ampang Reservoir KR LSUHC5097 Bronchocela cristatella 22 Malaysia, Selangor, Genting Highlands KR LSUHC6543 Bronchocela cristatella 23 Malaysia, Selangor, Kuala Selangor Nature Park KR LSUHC6544 Bronchocela cristatella 23 Malaysia, Selangor, Kuala Selangor Nature Park KR LSUHC11878 Bronchocela cristatella 24 Malaysia, Terengganu, Pulau Lang Tengah KR LSUHC11901 Bronchocela cristatella 24 Malaysia, Terengganu, Pulau Lang Tengah KR LSUHC11902 Bronchocela cristatella 24 Malaysia, Terengganu, Pulau Lang Tengah KR LSUHC8737 Bronchocela cristatella 25 Malaysia, Terengganu, Pulau Perhentian Besar KR LSUHC9390 Bronchocela cristatella 26 Malaysia, Terengganu, Pulau Redang, Redang Reef Trail KR LSUHC11992 Bronchocela cristatella 27 Malaysia, Terengganu, Sungai Bubu KR CDS2105 Bronchocela cristatella 28 Philippines, Luzon Island KR RMB9878 Bronchocela cristatella 28 Philippines, Luzon Island KR RMB8882 Bronchocela cristatella 29 Philippines, Polillo, Island KR RMB8883 Bronchocela cristatella 29 Philippines, Polillo, Island KR LSUHC12065 Bronchocela cristatella 30 Malaysia, Perak, Belum KR LSUHC12061 Bronchocela rayaensis sp. nov. 31 Malaysia, Kedah, Pulau Langkawi, Gunung Raya KR LSUHC7535 Bronchocela rayaensis sp. nov. 31 Malaysia, Kedah, Pulau Langkawi, Gunung Raya KR LSUHC12105 Bronchocela shenlong sp. nov. 32 Malaysia, Pahang, Cameron Highlands, Parit Falls KR LSUHC12104 Bronchocela shenlong sp. nov. 32 Malaysia, Pahang, Cameron Highlands, Parit Falls KR LSUHC10271 Bronchocela shenlong sp. nov. 33 Malaysia, Perak, KR LSUHC10660 Bronchocela shenlong sp. nov. 33 Malaysia, Perak, KR LSUHC11300 Bronchocela shenlong sp. nov. 33 Malaysia, Perak, KR LSUHC11301 Bronchocela shenlong sp. nov. 33 Malaysia, Perak, KR LSUHC11587 Bronchocela shenlong sp. nov. 33 Malaysia, Perak, KR LSUHC9017 Bronchocela shenlong sp. nov. 33 Malaysia, Perak, KR LSUHC9144 Bronchocela shenlong sp. nov. 33 Malaysia, Perak, KR Zootaxa 3948 (1) 2015 Magnolia Press GRISMER ET AL.

5 Data. Mitochondrial DNA. Genomic DNA was isolated from liver or skeletal muscle samples stored in 95% ethanol using the Qiagen DNeasy TM tissue kit (Valencia, CA, USA). ND2 was amplified using a double-stranded Polymerase Chain Reaction (PCR) under the following conditions: 1.0 µl (~10 30 µg of DNA) genomic DNA, 1.0 µl (10 µm) light strand primer, 1.0 µl (10µM) heavy strand primer, 1µl (10 µm) dinucleotide pairs, 2.0 µl (1.5 mm) 5x buffer, 1.0 µl (1.5 mm) MgCl 10x buffer, 2.5 u Taq polymerase, and 7.56 µl ultra-pure H 2 O (Table 2). PCR reactions were executed on an Eppendorf Mastercycler gradient thermal cycler under the following conditions: initial denaturation at 95 C for 2 min, followed by a second denaturation at 95 C for 35 s, annealing at 48 C for 35 s, followed by a cycle extension at 72 C for 35 s, for 31 cycles. All PCR products were visualized on a 1 % agarose gel electrophoresis. Successful PCR products were vacuum purified using MANU 30 PCR plates (Millipore) and purified products were resuspended in ultra-pure water. Purified PCR products were sequenced using the ABI Big- Dye Terminator v3.1 Cycle Sequencing Kit in an ABI GeneAmp PCR 9700 thermal cycler. Cycle sequencing reactions were purified with Sephadex G-50 Fine (GE Healthcare) and sequenced on an ABI 3730xl DNA Analyzer at the BYU DNA Sequencing center. Primers used for amplification and sequencing are presented in Table 2. Sequences were analyzed from both the 3' and the 5' ends separately to confirm congruence between the reads. Both the forward and the reverse sequences were uploaded and edited in Geneious TM version v5.5.6 (Drummond et al. 2011). The protein-coding region of the ND2 sequence was aligned by eye. MacClade v4.08 (Maddison & Maddison 2005) was used to calculate the correct amino acid reading frame and to confirm the lack of premature stop codons. For the phylogenetic analyses we applied two model-based methods, Maximum Likelihood (ML) and Bayesian Inference (BI). The Bayesian Information Criterion (BIC) as implemented in imodeltest v2.1.3 (Darriba et al. 2012), was used to calculate the best-fit model of evolution for each codon position (Table 3). Maximum Likelihood analysis was performed using RAxML HPC v7.5.4 (Stamatakis et al. 2008) via the command line, with an initial search of 200 replicates for the best tree. Nodal support was calculated with 1000 bootstrap pseudoreplicates via the rapid hill-climbing algorithm (Stamatakis et al. 2008). Nodes that had bootstrap values (ML) above 70 were considered significantly supported. The Bayesian analysis was carried out in MrBayes v3.2 (Ronquist et al. 2012). Two simultaneous runs were performed with eight chains per run, seven hot and one cold following default priors. The analysis was run for 5,000,000 generations and sampled every 500 generations from the Markov Chain Monte Carlo (MCMC). The analysis was halted after the average standard deviation split frequency was below Conservatively the first 25% of the trees from each run were discarded as burnin. A consensus tree was then computed from the two parallel runs using MrBayes v3.2 (Ronquist et al. 2012). Nodes that had posterior probabilities (BBP) above 0.95 were considered significantly supported (<XREF>Wilcox et al. 2002). Uncorrected pairwise sequence divergences were calculated in MEGA v5.2.2 using both the ND2 and the trnas (Tamura et al. 2011). TABLE 2. Summary of primers used for PCR amplification and DNA sequencing. Primer Name Location Reference Primer Sequence METF6 External Macey & Schulte (1999) 5 AAGCTTTCGGGCCCATACC 3 BRONF1 Nested XXXXXXXXXXXXXXX 5 TAGAAYTAAAYKCHTTCGCYAT 3 BRONR1 Nested XXXXXXXXXXXXXXX 5 TTTAGGCGGTGAGCTGTAAATT 3 CO1R1 External Macey & Schulte (1999) 5 AGRGTGCCAATGTCTTTGTGRTT 3 TABLE 3. Models of molecular evolution used in this study calculated based on the BIC in jmodeltest v2.1.3 (Darriba et al. 2012). Gene Model selected Model applied ND2 1st pos HKY+Γ HKY+Γ 2nd pos HKY+Γ HKY+Γ 3rd pos GTR+I+Γ GTR+I+Γ trnas HKY+Γ HKY+Γ NEW BRONCHOCELA FROM PENINSULAR MALAYSIA Zootaxa 3948 (1) 2015 Magnolia Press 5

6 Morphological analysis. Color notes were taken from digital images of living specimens of all available age classes and populations prior to preservation. The following measurements and scale counts were taken under a Nikon SMZ 1500 dissecting microscope or with digital calipers on the right side of the body when appropriate: snout-vent length (SVL), taken from the tip of snout to the vent; tail length (TL); diameter of the tympanum (DT), measured as the greatest horizontal distance regardless tympanum height; diameter of the orbit (DO), measured as the horizontal distance across the anterior and posterior edges of the orbit (not the eyeball); head length (HL), measured from the posterior margin of the tympanum to the tip of the snout; head width (HW), measured as the transverse width of the head at the angles of the jaws; head depth (HD), measured as the distance from the top of the head between the orbits to the lower margin of the dentary bone (not the gular region); hand length (HaL), measured from the base of the palm along an imaginary line between the base of the first and fifth digit to the tip of the third finger not including the claw; forelimb length (FLL), measured from a point equidistant between its anterior and posterior insertion points on the body to the tip of the fourth toe not including the claw; foot length (FoL), measured from the base of the palm along an imaginary line between the base of the first and fifth digit to the tip of the fourth toe not including the claw; hind limb length (HLL), measured from a point equidistant between its anterior and posterior insertion points on the body to the tip of the fourth toe not including the claw; size of ventral scales relative to dorsal scales; length and height of nuchal crest; shape of nuchal crest scales; presence or absence of dorsal crest; and the lengths of the 3rd and 4th fingers and the 5th toe were compared. Meristic characters included numbers of supralabial and infralabial scales counted from the first scale contacting the rostral or mental scale, respectively, to the angle of the jaw; the number of loreal scales (= canthal scales in Hallermann [2009]) between the nasal scale and the granular scales along the anterior border of the orbit; the number of postmental scales; the number of subdigital lamellae beneath the third finger and fourth toe counted from the first scale following the digits insertion point on the hand or foot, respectively, to the claw; midbody scales (MS), counted as the number of scales around the body midway between fore- and hind limb insertions; the number of paravertebral rows of dorsal scales whose keels point dorsoposteriorly; the number of adjacent rows of scales whose keels point posteriorly (i.e. parallel to the orientation of the keels of the dorsal crest scales); and the number and nuchal spines (NS) counted as the number of enlarged nuchal spines at least twice the size of the enlarged vertebral scales on the dorsum. Color pattern characters examined included the presence or absence of an infralabial stripe and the degree of their extent; head, gular, body and hind limb markings; and caudal banding. These character states in other species were taken from Hallermann (2004, 2005, 2009) where possible. Specimens examined of Bronchocela critatella are listed in the Appendix. Tissue samples are listed in Table 1. CDS refers to Cameron D. Siler field series; DWNP refers to the Department of Wildlife and National Parks, PERHILITAN, Ringit, Pahang; LRCUKM refers to the Langkawi research Center of Universiti Kebangsaan Malaysia on Langkawi Island, Kedah, Malaysia; KU refers to Kansas University Museum of Natural History collection; LSUHC refers to the La Sierra University Herpetological Collection, La Sierra University, Riverside, California, USA; RMB refers to Rafe M. Brown field series; TNHC refers to TNHC, Texas Natural History Collection; WHT refers to the Wildlife Heritage Trust,Colombo, Sri Lanka; ZRC refers to the Zoological Reference Collection in Lee Kong Chian Natural History Museum, National University of Singapore, Singapore; and LSUDPC refers to the La Sierra University Digital Photo Collection. Results The molecular analysis indicates that the specimens sampled in this study compose four, very distinctive, strongly supported (1.00/100) major lineages and that the populations from Peninsular Malaysia do not form a monophyletic group in that the Indonesian, Bornean, and Philippine populations are imbedded within the phylogeny at different places (Fig. 2). The Pulau Langkawi population is basal to all others; the two Philippine populations sampled here form a monophyletic group and are weakly supported (0.89/72) as being most closely related to a strongly supported (1.00/100) sister lineage relationship between the upland populations from and Parit Falls and the remaining populations from Peninsular Malaysia, its associated islands, Indonesia, and Borneo (Fig. 2). The populations from and Parit Falls (upland populations) form a well-supported (1.00/100) monophyletic group despite being 79 km apart on separate mountain ranges (Fig. 2). However, the Parit Falls 6 Zootaxa 3948 (1) 2015 Magnolia Press GRISMER ET AL.

7 population is phylogenetically imbedded within the population (Fig. 2) despite the fact that the latter is composed of individuals collected along a 1 km stretch of road between 1058 and 1169 meters in elevation. The greatest uncorrected pairwise sequence divergence between any members of the upland populations is less than 2.8%. FIGURE 2. Inferred phylogenetic relationships of Bronchocela from Peninsular Malaysia and its associated islands with samples from Indonesia, Borneo, and the Philippines. The phylogram is a Maximum Likelihood topology (- ln L ) with Bayesian posterior probabilities and Maximum Likelihood bootstrap values, respectively. The remaining populations from Peninsular Malaysia and 13 of its associated islands; Indonesia; and Borneo compose a strongly supported lineage (1.00/100) that extends approximately 1120 km from Belum, Perak in northern Peninsular Malaysia, southeastward across the Sunda Shelf through the Natuna Archipelago to western Borneo (Fig. 1). Despite the geographic distance and fragmented distribution of this lineage, no combination of populations bears more than 2.5% sequence divergence between them. This stands in contrast to the degree of morphological (Diong & Lim 1998) and color pattern variability (Manthey 2008; Grismer 2011) seen in populations from Peninsular Malaysia and its associated islands. The morphological and color pattern analyses also support the separate lineage identities of the Pulau Langkawi population and upland populations with respect to all other species of Bronchocela, including B. cristatella, in that each is discretely diagnosable by having unique traits concerning body shape, scale morphology, and color pattern (Tables 4, 5; Figs. 3 6). As such, these three populations are described below as two new species. NEW BRONCHOCELA FROM PENINSULAR MALAYSIA Zootaxa 3948 (1) 2015 Magnolia Press 7

8 Systematics Bronchocela rayaensis sp. nov. Gunung Raya Green-crested Lizard Figs. 3,4 Bronchocela cristatela Zimmerer 2004:87. Bronchocela cristatella Manthey 2008:49; Lim et al. 2009:23; Grismer 2011:143. Holotype. Adult male (LSUHC 7535) collected on 18 August 2005 by L. Lee Grismer and Perry L. Wood Jr., at 2140 hrs at 834 m a.s.l. from Gunung Raya, Pulau Langkawi, Kedah, Peninsular Malaysia ( N; E). Paratype. LRCUKM 0136 (=LSUHC 12061) collected on 2 May 2014 by Ehwan N. at 1000 hrs at 400 m a.s.l. from Gunung Raya, Pulau Langkawi, Kedah, Peninsular Malaysia ( N; E). Diagnosis. A small species reaching 85 mm SVL; Tympanum small (DT/DO ); head squarish in lateral profile (HD/HL ), relatively narrow (HW/HL ); forelimbs relatively long (FLL/SVL 0.59); foot relatively short (FoL/HLL ); hind limbs relatively long (HLL/SVL ); 5 7 loreal scales; three postmentals; nuchal crest low, longer than diameter of orbit, spines lancolate; midbody scales; no rows of paravertebral scales bearing keels pointing dorsoposteriorly; 5 7 rows of dorsal scales bearing keels pointing posteriorly; ventral scales less than five times the width of dorsal scales; 30 subdigital lamellae on the third finger; subdigital lamellae on the fourth toe; third finger longer than fourth finger; fourth finger not longer than fifth toe; no white patch between tympanum and orbit; tympanum green in adults; no white or yellow supralabial stripe; no red gular patch; no white ventrolateral line on body; no postfemoral red line; and faint caudal bands. These characters are scored across all species in Tables 4 and 5. Description of holotype. Adult male (SVL 82.0 mm); head disproportionately large, thick in lateral profile (HD/HL 0.49); interorbital, frontal, and rostral regions sloped anteriorly; canthus rostralis sharp, extending to anterior margin of eye and continuous with enlarged, superciliary scales extending slightly beyond posterior border of eye; loreal region concave bearing seven canthal scales; rostral moderately sized, rectangular, four times as wide as high, bordered laterally by first supralabials and posteriorly by five small scales; nasals protuberant, centrally located, external nares elevated above surface of rostrum, nasals bordered ventrally by one or three infranasals, posteriorly by three small postnasal scales and dorsally by three slightly elongate supranasals; scales on top of head small, slightly elongate, keeled, those bordering medial margins of orbits enlarged; slightly enlarged parietal scale with eyespot; single row of slightly enlarged, weekly keeled scales above supralabials; eye deeply set in orbit, surrounded by granular scales; tympanum naked; 11(R,L) elongate, keeled supralabials, first of series usually small and square, remaining supralabials much larger and rectangular; mental triangular, much larger than adjacent infralabials; three postmentals of equal size; lateral postmentals contact first infralabial, and first chinshield; chinshields slightly enlarged, decreasing in size posteriorly, keeled, and extending to a point below anterior margin of orbit; anterior chinshields separated from infralabials by one scale row increasing to two and usually three rows posteriorly; 9(R) 10(L) large, thin, rectangular, concave infralabials with upturned, laterally projecting, labial margins and strongly keeled, ventral sections; gulars sharply keeled; small, non-extensible dewlap. Body somewhat long, thin, triangular in cross-section; vertebral crest on nape composed of 13 slightly enlarged, lancolate scales; nuchal crest longer than diameter of orbit and abruptly tapers posteriorly to a single row of much smaller, keeled, triangular scales extending onto base of tail; lateral neck fold anterior to forelimb, posterior end forming a shallow pocket dorsal to forelimb insertion; dorsal scales of body small, keeled, spinose, 71 around midbody; no rows of paravertebral scales bearing keels pointing dorsoposteriorly; eight rows of dorsal scales bearing keels pointing posteriorly; scales of flanks point ventroposteriorly; scales of belly and pectoral region similar in size, heavily keeled, spinose, arranged in semi-transverse rows more than twice the size of dorsal scales; forelimbs long (FLL/SVL 0.59), thin; dorsal and ventral scales of forelimbs keeled, spinose, nearly equal in size; five digits on manus; 30 subdigital lamellae on third finger; third finger longer than fourth finger, fourth finger not longer than fifth toe; hind limbs long (HLL/SVL 0.99), thin; scales of hind limbs keeled, spinose; postfemoral scales slightly smaller, less keeled; five digits on pes; 33 subdigital lamellae on fourth toe; tail 3.76 times SVL, covered with longitudinal rows of keeled, spinose scales of similar size. 8 Zootaxa 3948 (1) 2015 Magnolia Press GRISMER ET AL.

9 TABLE 4. Diagnostic characters separating the species of Bronchocela. Data for all species except B. cristatella, B. shenglong sp. nov. and B. rayaensis sp. nov. come from Hallermann (2004, 2005, 2009) and Manthey (2008). Abbreviations are listed in the Materials and Methods. / = data not recorded in the references used. danieli smaragdina vietnamensis celebensis cristatella marmorata hayeki jubata orlovi rubrigularis shenglong sp. nov. rayaensis sp. nov. DT/DO > 0.5 yes yes no no yes yes yes yes yes yes no no no. of canthal scales between nasal and anterior border of orbit / / / / / / 4 5,6 3, postmentals / 3 2 / / / / / / / 2,3 3 nuchal crest as long or longer than diameter of orbit yes yes yes yes yes no yes yes yes yes yes yes nuchal crest low yes yes yes no no yes no no no no no yes nuchal crest spines crescent-shaped or lancolate lan lan cres lan lan lan cres lan lan no lan lan dorsal crest present yes no no yes yes yes yes yes yes yes yes no upper dorsal scale rows pointing upwards 5,6 1, upper dorsal scale rows pointing backwards / 4, midbody scales ventral scales 5 times size of dorsals yes no no / / var / / no no no no 4th finger longer than 5th toe yes yes yes no no no no no no no no no HLL/SVL> yes no no / no / no yes yes var var yes white patch between tympanum and orbit yes no no no no no no no no no no no yellow stripe on labial region no no no no no no no yes no no no no white stripe on supralabial region no no no no no no no no no no yes no red gular patch in males no no no no no no no no no yes no no white line along body and tail no no yes no no no no no no no no no red postfemoral stripe extending onto tail no no no no no no no no no no yes no tail banded no no yes no var no no yes no no yes yes NEW BRONCHOCELA FROM PENINSULAR MALAYSIA Zootaxa 3948 (1) 2015 Magnolia Press 9

10 TABLE 5. Diagnostic characters separating Bronchocela cristatella from Peninsular Malaysia, B. rayaensis sp. nov., and B. shenglong sp. nov. from each other. Abbreviations are listed on the Materials and Method. B. rayaensis sp. nov. B. shenglong sp. nov. B. shenglong sp. nov. B. cristatella Pulau Langkawi Cameron Highlands adult SVL TL/SVL ear diameter DT/DO Orbit diamteter HW/HL HD/HL HL/SVL HaL/FLL FLL/SVL FoL/HLL HLL/SVL supralabials 10, 11 9, infralabials , rd finger lamellae th toe lamellae rd finger longer than 4th in langkawi yes no no no midbody scales nuchal spines small large large large no. nuchal spines , tympanum color in unstressed adults green green green black white lower lip no yes yes no postfemoral red stripe no yes yes no sample size Zootaxa 3948 (1) 2015 Magnolia Press GRISMER ET AL.

11 FIGURE 3. Upper left and right and middle left: Bronchocela rayaensis sp. nov. from Pulau Langkawi, Kedah, Peninsular Malaysia. Upper left and right: adult females from Lubuk Sembilan (LSUDPC 9458 [photograph by D. Hegner] and LSUDPC 4696 [photograph by L. L. Grismer], respectively). Middle left: female paratype (LRCUKM 0136) from 400 m on the northwestern slope of Gunung Raya (Photograph by Ehwan N.). Lower: type series of B. rayaensis sp. nov.; holotype LSUHC 7535 (left) and paratype LRCUKM 0136 (right). Photographs by L. L. Grismer. Coloration (unstressed). Dorsal surfaces of head, body limbs and anterior portion of tail light green; tympanum green, scales in orbit surrounding eye yellowish; gular region yellowish; faint, obliquely arranged, turquois spots on dorsum between limb insertions; faint, light-colored area below tympanum; all ventral surfaces yellow; posterior three-fourths of tail brown, faintly banded. Variation. The paratype (LRCUKM 0136) is a gravid female (SVL 85.0 mm) carrying two eggs (Fig. 3). The color pattern closely resembles that of the holotype except there is more dorsal spotting and the light area below the tympanum is more extensive and pronounced. Both individuals turned dark gray when stressed. The crest scales of the paratype are smaller than those of the holotype which may be a sexually dimorphic trait. The dewlap is absent. Additional meristic differences are listed in Table 6. Distribution. Bronchocela rayaensis sp. nov. is confirmed only from Pulau Langkawi, Kedah, Peninsular Malaysia (Fig. 1). However, B. cristatella has been reported from Pulau Singa Besar, a small satellite island off the southern coast of Pulau Langkawi (Grismer 2008; Lim et al. 2009). The specimens on which these reports were based (DWNP 2250, 2997) should be re-examined as they may be B. rayaensis sp. nov. NEW BRONCHOCELA FROM PENINSULAR MALAYSIA Zootaxa 3948 (1) 2015 Magnolia Press 11

12 TABLE 6. Measurements, morphometric ratios, scales counts, and color pattern characteristics of the type series of Bronchocela rayaensis sp. nov., B. shenglong sp. nov., and additional specimens of B. shenglong sp. nov. B. rayaensis sp. nov. B. shenglong sp. nov. LSUHC LRCUKM LSUHC LSUHC LSUHC LSUHC LSUHC LSUHC LSUHC LSUHC LSUHC ZRC ZRC Langkawi Island Langkawi Island Parit Falls Parit Falls holotype paratype holotype paratype paratype paratype paratype paratype juvenile hatchling Sex SVL TL / / 363 TL/SVL / / 3.46 DT / DO / DT/DO / HL / HW / HD / HW/HL / HD/HL / HL/SVL / HaL / FLL / HaL/FLL / FLL/SVL / FoL / continued on the next page 12 Zootaxa 3948 (1) 2015 Magnolia Press GRISMER ET AL.

13 TABLE 6. (Continued) B. rayaensis sp. nov. B. shenglong sp. nov. LSUHC LRCUKM LSUHC LSUHC LSUHC LSUHC LSUHC LSUHC LSUHC LSUHC LSUHC ZRC ZRC Langkawi Island Langkawi Island Parit Falls Parit Falls holotype paratype holotype paratype paratype paratype paratype paratype juvenile hatchling HLL / FoL/HLL / HLL/SVL / supralabials infralabials number of canthal scales postmentals upper dorsal scale rows / pointing dorsoposteriorly upper dorsal scale rows / pointing backwards MS nuchal spines small small large large large large large large large small large large large NS th finger lamellae rd finger longer than 4th in yes yes no no no no no no no no no no no langkawi 3rd finger longer than 4th in yes yes no no no no no no no no no no no langkawi white infralabial stripe no no yes yes yes yes yes yes yes no yes yes yes postfemoral red line no no yes yes yes yes yes yes yes no yes / / NEW BRONCHOCELA FROM PENINSULAR MALAYSIA Zootaxa 3948 (1) 2015 Magnolia Press 13

14 Natural history. Like most other species of Bronchocela, B. rayaensis sp. nov. occurs in both disturbed and undisturbed habitats (Fig. 4). The holotype was collected at night along the side of the road sleeping on a branch approximately two meters above the ground at 834 meters in elevation near the summit of Gunung Raya in disturbed, edge-forest vegetation. The paratype was seen crossing the road leading to the summit of Gunung Raya at 400 meters in hill dipterocarp forest when it was struck by a car, paralyzing its hindquarters. The paratype was a gravid female carrying two eggs indicating the reproductive season for this species extends through the month of May. We have also examined photographs of B. rayaensis sp. nov. from highly disturbed parklands at Lubuk Sembilan at 70 meters in elevation (Fig. 3). These data indicate that B. rayaensis sp. nov. is a habitat generalist with an extensive elevational range. FIGURE 4. Habitat of Bronchocela rayaensis sp. nov. on Gunung Raya, Pulau Langkawi, Kedah, Peninsular Malaysia. Upper: hill dipterocarp forest. Lower: microhabitat within hill dipterocarp forest. Photographs by L. L. Grismer. 14 Zootaxa 3948 (1) 2015 Magnolia Press GRISMER ET AL.

15 Etymology. The specific epithet is derived from the Malay word raya meaning great and the Latin suffix - ensis meaning originating in and refers to this species discovery at the type locality on Gunung Raya. Comparisons. Bronchocela rayaensis sp. nov. can be differentiated from B. danieli (Tiwari & Biswas), B. smaragdina Günther, B. cristatella, B. hayeki (Müller), B. jubata Duméril & Bibron, B. orlovi Hallermann, and B. rubrigularis Hallerman by the tympanum being less than 50% of the diameter of the eye. Having a low nuchal crest separates it from B. celebesensis Gray, B. cristatella, B. hayeki (Müller), B. jubata, B. orlovi, B. rubrigularis and B. shenlong sp. nov. Having midbody scale rows separates it from B. smaragdina, B. vietnamesnsis Hallermann & Orlov 2005, B. jubata, B. orlovi, B. rubrigularis, and B. shenlong sp. nov. Bronchocela rayaensis sp. nov. is also differentiated from various combinations of all other species on the basis of numerous color pattern characteristics (Tables 4,5). Bronchocela rayaensis sp. nov. most closely resembles B. cristatella and B. shenlong sp. nov. from Peninsular Malaysia but can be differentiated further from them by its smaller maximum adult SVL (85 mm vs mm collectively for B. cristatella and B. shenlong); a relatively longer forelimb (FLL/SVL 0.59 vs collectively for B. cristatella and B. shenlong); the third finger being longer than the fourth; and very small nuchal spines. It can be further separated from B. cristatella by having more subdigital lamellae on the third toe (30 vs 24 29) and having a green as opposed to a black tympanum. Bronchocela rayaensis sp. nov. can be further differentiated from B. shenlong sp. nov. by having a relatively shorter foot (FoL/HLL vs ); fewer midbody scale rows (67 71 vs ); having paravertebral scales bearing posteriorly directed keels as opposed to lacking such scales; land lacking a white infralabial region and a red postfemoral stripe that extends onto the anterior portion of the tail. These character states are summarized in Table 5. Remarks. The presence of Bronchocela rayaensis sp. nov. on Pulau Langkawi adds to a growing list of newly discovered, endemic insular species in this archipelago. Based on photographs we have examined of small, gracile B. cristatella from southern Thailand (specifically Phuket Island) bearing little to no nuchal crests, we suspect the phylogenetic affinities of B. rayensis sp. nov. will be with Indochinese taxa rather than with populations from Peninsular Malaysia. Many other species from the Langkawi Archipelago have phylogenetic affinities to Thai and Indochinese taxa as well. These include the dicroglossid Limnonectes macrognathus (Boulenger); the megophryid Leptobrachium smithii Matsui, Nabhitabhata, & Panha (Grismer et al. 2006); the agamid Acanthosaura sp. nov. (Wood et al. in prep.); the gekkonids Cyrtodactylus langkawiensis Grismer, Wood, Quah, Anuar, Muin, Sumontha, Norhayati, Bauer, Wangkulangkul, Grismer & Pauwels (Grismer et al. 2012); Cnemaspis roticanai Grismer & Chan (Grismer & Chan 2010; Grismer et al. 2014); and Cnemaspis monochorum Grismer, Norhayati, Chan, Belabut, Muin, Wood & Grismer (Grismer et al. 2009); the colubrid Boiga cyanea (Duméril, Bibron & Duméril); the elapid Calliophis maculiceps (Günther); and the viperids Calloselasma rhodostoma (Kuhl) and Cryptelytrops venusta (Vogel) (Grismer et al. 2006). To this we add the skink, Scincella melanosticta Boulenger (LSUHC , , 11809, , ), which is reported here for the first time on Pulau Langkawi and constitutes a new generic record for Peninsular Malaysia as well. These records make sound biogeographical sense in that the Langkawi Archipelago is an offshore extension of the Nakawan Mountain Range that separates southern Thailand from Peninsular Malaysia and is the southern range limit for many Indochinese taxa (Grismer 2011). Bronchocela shenlong sp. nov. Sheng Long Green-crested Lizard Figs. 5,6,7 Bronchocela cristatella Diong & Lim 1998:347; Grismer et al. 2010:149; Grismer 2011:141. Holotype. Adult male (LSUHC 9017) collected on 16 June 2008 by L. Lee Grismer and Perry L. Wood Jr., at 2145 h at 1100 m a.s.l. from, Perak, Peninsular Malaysia ( N, E). Paratypes. LSUHC 9144 collected on 16 November 2008 by L. Lee Grismer, Jesse L. Grismer, Evan S. H. Quah, P. L. Wood Jr., and Chan K. O. between 2150 and 1350 hrs 1169 m a.s.l. from, Perak, Peninsular Malaysia ( N, E). LSUHC and bear the same collector data as the holotype but were collected on 30 June 2012 and 6 July 2013, respectively, and LSUHC was collected at 1058 m a.s.l. Additional specimens examined from. LSUHC 9416, 11587, 10271; ZRC 2.336, NEW BRONCHOCELA FROM PENINSULAR MALAYSIA Zootaxa 3948 (1) 2015 Magnolia Press 15

16 Diagnosis (adults only). A moderately sized species reaching at least 106 mm SVL; tympanum small (DT/DO ); head squarish in lateral profile (HD/HL ), relatively narrow (HW/HL ); forelimbs relatively long (FLL/SVL ); foot not particularly short (FoL/HLL ); hind limbs relatively long (HLL/SVL ); 6 11 loreal scales; two or three postmentals; nuchal crest high, longer than diameter of orbit, spines lancolate; midbody scales; 4 7 rows of paravertebral scales bearing keels pointing dorsoposteriorly; 1 5 rows of dorsal scales bearing keels pointing posteriorly; ventral scales less than five times the width of dorsal scales; subdigital lamellae on the third finger; subdigital lamellae on the fourth toe; third finger not longer than fourth finger; fourth finger not longer than fifth toe; no white patch between tympanum and orbit; tympanum green in adults; white infralabial stripe extending beyond tympanum; no red gular patch; no white ventrolateral line on body; postfemoral red line; and faint caudal bands. These characters are scored across all species in Tables 4 and 5. Description of holotype. Adult male (SVL mm); head disproportionately large, squarish in lateral profile (HD/HL 0.44); interorbital, frontal, and rostral regions sloped anteriorly; canthus rostralis sharp, extending to anterior margin of eye and continuous with enlarged, superciliary scales extending slightly beyond posterior border of eye; loreal region concave bearing seven canthal scales; rostral moderately sized, subrectangular, three times as wide as high, bordered laterally by first supralabials and posteriorly by four small scales; nasals protuberant, centrally located, external nares elevated above surface of rostrum, nasals bordered ventrally by two infranasals, posteriorly by two postnasal scales and dorsally by two elongate supranasals; scales on top of head small, slightly to moderately elongate, keeled to subspinose, those bordering medial margins of orbits enlarged; eyespot bearing parietal scale absent; single row of slightly enlarged, elongate, weekly keeled scales above supralabials; eye deeply set in orbit, surrounded by granular scales; tympanum naked; 11(R) 9(L) elongate, keeled supralabials, first scale of series smallest and square, remaining supralabials larger and rectangular; mental triangular, much larger than adjacent infralabials; three, elongate postmentals of nearly equal size; lateral postmentals contact first infralabial, first sublabial, and first chinshield; chinshields slightly enlarged, anterior two weakly keeled, decreasing in size posteriorly, and extending to a point below anterior margin of orbit; anterior chinshields separated from infralabials by one scale row of sublabials increasing to two and usually three rows posteriorly; 8(R,L) large, thin, rectangular, concave infralabials with upturned, laterally projecting, labial margins and strongly keeled, ventral sections; gulars sharply keeled; small, non-extensible dewlap. Body somewhat long, thin, triangular in cross-section; vertebral crest on nape composed of 11 greatly enlarged, lancolate scales; nuchal crest longer than diameter of orbit and abruptly tapers posteriorly to a single row of much smaller, keeled, triangular scales extending onto base of tail; lateral neck fold anterior to forelimb, posterior end forming a shallow pocket dorsal to forelimb insertion; dorsal scales of body small, keeled, spinose, 75 around midbody; seven rows of paravertebral scales bearing keels pointing dorsoposteriorly; one row of dorsal scales bearing keels pointing posteriorly; scales of flanks point ventroposteriorly; scales of belly and pectoral region similar in size, heavily keeled, spinose, arranged in semi-transverse rows more than twice the size of dorsal scales; forelimbs long (FLL/SVL 0.55), thin; dorsal and ventral scales of forelimbs keeled, spinose, nearly equal in size; five digits on manus; 26 subdigital lamellae on third finger; third finger not longer than fourth finger, fourth finger not longer than fifth toe; hind limbs long (HLL/SVL 0.90), thin; scales of hind limbs keeled, spinose; postfemoral scales slightly smaller, less keeled; five digits on pes; 27 subdigital lamellae on fourth toe; tail 3.04 times SVL, covered with longitudinal rows of keeled, spinose scales of similar size, Coloration (unstressed). Dorsal surfaces of head, body limbs and anterior portion of tail light green; broad, white stripe extends from anterior section of lower jaw through the infralabials past the angle of the jaw and below the tympanum to nearly the anterior edge of the shoulder region; loreal region and anterior supralabials bearing white flecks and faint striping; tympanum green, scales in orbit surrounding eye yellowish; six faint, transversely arranged, rows of diffuse, dull-white spots on dorsum between limb insertions that extend onto the tail to form faint, caudal bands; red postfemoral stripe extends from half way between the knee and the hind limb insertion on the body onto the anterior portion of the tail and bordered above by a diffuse, short, white stripe centered at the junction of the hind limb and the body; gular region yellowish with diffuse, broken, oblique, white stripes; all other ventral surfaces yellow; posterior three-fourths of tail brown, faintly banded. Variation (figs 5,6,7). The paratypes are remarkably similar to the holotype in all aspects of coloration and pattern although the white dorsal spots are more defined and less diffuse. The hatchling specimen (LSUHC 11587; SVL 43 mm) has a less well-defined white infralabial stripe and the red postfemoral stripe has not yet appeared. 16 Zootaxa 3948 (1) 2015 Magnolia Press GRISMER ET AL.

17 These markings, however, are present in the juvenile specimen LSUHC 9416 (SVL 66 mm) indicating that they are ontogenetically variable. Stressed individuals are usually gray (Figs. 6,7) but may also manifest a mosaic pattern of greens and grays. Females lack a dewlap. The specimens from Parit Falls may have relatively slightly wider heads than those from (HW/HL 0.63 vs ). Meristic differences for all individuals are presented in Table 6. FIGURE 5. Bronchocela shenlong sp. nov. from, Perak, Peninsular Malaysia. Upper left and right: adult female paratypes LSUHC (light color phase) and 9144 (dark color phase), respectively. Lower right: juvenile female paratype LSUHC Lower left: hatchling LSUHC sleeping on a fern at night. Photographs by L. L. Grismer. Distribution. Bronchocela shenlong sp. nov. is known only from, Perak in the Bintang Mountain Range and from Parit Falls, Cameron Highlands, Pahang in the Titiwangsa Mountain Range (Fig. 1). Natural history. Bronchocela shenlong sp. nov. occurs in both disturbed and undisturbed habitats in hill dipterocarp and montane forests (Fig. 8). At, specimens have been recorded from meters in elevation (ZRC and ZRC 2.491, respectively). On, we have observed lizards sleeping at night on forest-edge vegetation along a narrow road that winds through hill dipterocarp and montane forests. One specimen (LSUHC 9144) was collected during the day in a park while sitting on the top of an ornamental bush 1.5 meters above the ground. At Parit Falls, both specimens were collected at night at 1493 meters in elevation. LSUHC was shot out of a tree fern with a blowpipe while sleeping 10 meters above the ground in disturbed montane forest along a highly polluted river. LSUHC was collected by hand from the top of an ornamental bush in a highly disturbed area bordering an apartment complex along the same polluted river. At, gravid females have been observed from June through November and hatchings and juveniles have been collected during September. LSUHC was a gravid female collected during September at Parit Falls. These data may indicate that the reproductive season for B. shenlong sp. nov. takes place during the earlier, drier part of the year. NEW BRONCHOCELA FROM PENINSULAR MALAYSIA Zootaxa 3948 (1) 2015 Magnolia Press 17

18 FIGURE 6. Upper and lower left and upper right: Bronchocela shenlong sp. nov. from Parit Falls, Cameron Highlands, Pahang, Peninsular Malaysia. Upper and lower left: adult male paratype LSUHC in light and dark color phase, respectively. Upper right: adult female paratype LSUHC in light color phase. Lower right: Bronchocela cristatella (LSUHC 12103) from 12 km S Parit Falls. Photographs by L. L. Grismer. Etymology. The specific epithet shenlong is used here to indicate this species morphological and ecological similarity to the Shen Long or Spirit Dragon of Chinese mythology. Shen Long is a wingless, five-toed, azurecolored reptile that resides in mountains and controls the wind, thunder, rain and clouds. As the epithet is used here, shenlong refers to this species upland, cloud forest habitat as well as its general dragon-like appearance. Comparisons. Bronchocela shenlong sp. nov. can be differentiated from B. danieli, B. smaragdina, B. vietnamensis, B. celebesensis, B. jubata, B. orlovi, B. rubrigularis and B. rayaensis sp. nov. by having midbody scales as opposed to collectively. It differs further from B. danieli, B. smaragdina, B. cristatella, B. marmorata Gray, B. hayeki, B. jubata, B. orlovi, and B. rubrigularis by the tympanum being less than 50% of the diameter of the eye. Having a high nuchal crest separates it from B. danieli, B. smaragdina, B. vietnamensis, B. marmorata, and B. rayaensis sp. nov. Bronchocela shenlong sp. nov. is also differentiated from various combinations of all other species on the basis of numerous color pattern characteristics (Tables 4,5). Bronchocela shenlong sp. nov. most closely resembles B. cristatella from Peninsular Malaysia but can be differentiated from it by having a relatively smaller tympanum (DT/DO vs ); a relatively thicker head (HD/HL vs ); a green as opposed to a black tympanum; a broad, white infralabial stripe as opposed to its absence; and a postfemoral red stripe extending onto the tail. For additional characters further differentiating B. shenlong sp. nov. from B. rayaensis sp. nov. see the comparisons section for the latter. These character states are summarized in Table Zootaxa 3948 (1) 2015 Magnolia Press GRISMER ET AL.

19 FIGURE 7. Type series of Bronchocela shenlong sp. nov. From left to right holotype LSUHC 9017 and paratypes LSUHC 11301, 9144, and from, Perak, Peninsular Malaysia and paratypes LSUHC and from Parit Falls, Cameron Highlands, Pahang, Peninsular Malaysia. Photographs by L. L. Grismer. FIGURE 8. Habitat of Bronchocela shenlong sp. nov. Left: disturbed habitat near Parit Falls, Cameron Highlands, Pahang, Peninsular Malaysia (Photograph by L. L. Grismer). Upper right: disturbed habitat at, Perak, Peninsular Malaysia (Photograph by E. S. H. Quah). Lower right: undisturbed microhabitat at (Photograph by L. L. Grismer). NEW BRONCHOCELA FROM PENINSULAR MALAYSIA Zootaxa 3948 (1) 2015 Magnolia Press 19

20 FIGURE 9. Color pattern variation in Bronchocela cristatella. Upper left: adult male from Taiping, Perak, Peninsular Malaysia (LSUHC 12102). Upper right: adult male from Hutan Lipur Sekayu, Terengganu, Peninsular Malaysia (LSUHC 11992). Lower left: adult male from Pulau Natuna Besar, Indonesia (LSUHC 11616). Photographs by L. L. Grismer. Lower right: adult male (LSUDPC 4651) from Kanowit, Sarawak, East Malaysia (Borneo). Photograph by Chan, K. O. Remarks. Grismer and Quah (2015) noted the exceptionally high degree of endemism and co-occurrence of closely related species in Cameron Highlands with respect to other montane areas in Peninsular Malaysia, which they attributed to the extensive plateau-like physiography of this upland region. Although Bronchocela shenlong sp. nov. is not endemic to Cameron Highlands it does occur in probable sympatry with B. cristatella. We collected a specimen of B. cristatella (LSUHC 12103; Fig. 9) in a small, Orang Asli village at 809 meters in elevation 12 km due south of Parit Falls near Ringlet on the western edge of the Cameron Highlands Plateau. The contact zone between B. shenlong sp. nov. and B. cristatella on the western slopes of the Bintang Mountain Range is unknown. Based on a specimen of B. cristatella (LSUHC 12102; Fig. 9) we collected along the base of the mountain at Taiping immediately below at 76 meters in elevation, the two species thus far come to within 2.3 km of one another. The extent to which B. shenlong sp. nov. ranges north and south of Cameron Highlands and 20 Zootaxa 3948 (1) 2015 Magnolia Press GRISMER ET AL.