Article.

Transcription

1 Zootaxa 4103 (2): Copyright 2016 Magnolia Press Article ISSN (print edition) ZOOTAXA ISSN (online edition) The phylogenetic relationships of a new Stream Toad of the genus Ansonia Stoliczka, 1870 (Anura: Bufonidae) from a montane region in Peninsular Malaysia HAYDEN R. DAVIS 1, L. LEE GRISMER 1, RANDY L. KLABACKA 2, MOHD ABDUL MUIN 3, EVAN S.H. QUAH 3, SHAHRUL ANUAR 3,4, PERRY L. WOOD JR. 2 & JACK W. SITES 2 1 Department of Biology La Sierra University, 4500 Riverwalk Parkway, Riverside, California, USA. hayden.davis.hd@gmail.com; lgrismer@lasierra.edu 2 Department of Biology, Brigham Young University, 150 East Bulldog Boulevard, Provo, Utah USA. perryleewoodjr@gmail.com; klabacka.randy@gmail.com 3 School of Biological Sciences, Universiti Sains Malaysia, USM, Pulau Pinang, Malaysia. mamuin@gmail.com; evanquah@yahoo.com; shahrulanuar@gmail.com 4 Center for Marine and Coastal Studies, Universiti Sains Malaysia, USM, Pulau Pinang, Malaysia Abstract Twelve species of Ansonia occur on the Thai-Malay peninsula, of which, five from Peninsular Malaysia, form a monophyletic group. One of these, A. jeetsukumarani, is endemic to the Titiwangsa Mountain Range, in which, we discovered a new population of Ansonia that is not A. jeetsukumarani or even its closest relative. Based on morphology, color pattern, and molecular phylogenetic analyses using the mitochondrial genes 12s and 16s rrna, we have determined that this new species, A. smeagol sp. nov., forms the sister lineage to an upland, monophyletic group composed of A. jeetsukumarani, A. lumut, A. malayana, and A. penangensis. We have noted similar biogeographic patterns in other taxa from the Titiwangsa Mountain Range in a number of upland lineages in Peninsular Malaysia. We hypothesize that the phylogeographic structure of these upland populations is a result of stochastic processes stemming from interaction of climate-driven forest dynamics and life histories. Key words: Titiwangsa, Genting Highlands, biogeography, conservation, uplands Introduction The bufonid genus Ansonia Stoliczka is composed of 28 small, scansorial, stream-dwelling species ranging as far north as Myanmar, as far east as the Philippines, and southward through the Thai-Malay Peninsula to Borneo (Chan et al. 2014). Eight species of Ansonia are known from Peninsular Malaysia, of which four (A. jeetsukumarani Wood, Grismer, Ahmad, & Senawi, A. lumut Chan, Wood, Anuar, Muin, Quah, Sumarli, Grismer, A. malayana Inger, and A. penangensis Stoliczka) form an upland monophyletic group distributed across the peninsula s mountainous landscape (Fig.1). Given their lotic lifestyle, these species are restricted to microhabitats with a consistent flow of water and as such, their distributions are fragmented and circumscribed. In the months of March and August of 2015, we collected a series of nine specimens of Ansonia from the uplands of Genting Highlands, Pahang. Previous knowledge of this population was based on a single juvenile collected during August 2004 (Grismer, unpublished) but its identity could not be determined. Morphological analyses on this new series of specimens confirms their placement in the genus Ansonia being that they have a small body size (maximum SVL 27.4 mm in females; 20.0 mm in males); long slender limbs bearing long slender digits with bulbous tips; no parotoid glands; weak subarticular tubercles; and webbing on the feet (Inger 1960, 1992). We suspected that the specimens of this new population would be conspecific with A. jeetsukumarani based on their overall similar morphology and the fact that A. jeetsukumarani occurs approximately 33 km to the north at Fraser s Hill, Pahang (Wood et al. 2008). However, morphological and genetic analyses indicated that although the Accepted by J. Rowley: 14 Mar. 2016; published: 12 Apr

2 Genting Highlands population is a member of the Malaysian upland clade, it is not conspecific with A. jeetsukumarani, nor are they even sister species. As such, the Genting Highlands population is described herein as a new species. FIGURE 1. Distribution map of the upland clade of Ansonia. Ansonia smeagol sp. nov. shown with a blue circle, all others from the clade are shown with a white circle. Materials and methods Morphology analysis. Color notes were taken from the digital images of living and euthanized specimens prior to preservation. The following characters were measured with a Control Company digimatic caliper to the nearest 0.1 mm: snout-vent length (SVL), from tip of snout to vent; head length (HL), from posterior margin of mandible to tip of snout; head width (HW), measured at the level of the jaw articulation; snout length (SL), from anterior margins of eyes to tip of snout; snout width (SW), distance between anterior margins of eyes; internarial distance (IND), 138 Zootaxa 4103 (2) 2016 Magnolia Press DAVIS ET AL.

3 et al. Ansonia albomaculata Ansonia albomaculata Ansonia albomaculata Ansonia endauensis Ansonia hanitschi Ansonia hanitschi Ansonia inthanon Ansonia jeetsuuarani Ansonia jeetsuuarani Ansonia jeetsuuarani Ansonia jeetsuuarani Ansonia jeetsuuarani Ansonia kraensis Ansonia kraensis Ansonia kraensis Ansonia latiffi Ansonia latirostra Ansonia latirostra Ansonia lumut Ansonia lumut Ansonia lumut Ansonia lumut Ansonia lumut Ansonia lumut Ansonia lumut Ansonia lumut Ansonia leptopus Ansonia minuta Ansonia malayana Ansonia malayana Ansonia mcgegori continued on the next page NEW ANSONIA FROM A HIGHLAND IN PENINSULAR MALAYSIA Zootaxa 4103 (2) 2016 Magnolia Press 139

4 Ansonia minuta Ansonia minuta Ansonia muelleri Ansonia penangensis Ansonia penangensis Ansonia platysoma Ansonia platysoma Ansonia siamensis Ansonia siamensis Ansonia smeagol sp. nov. Ansonia smeagol Ansonia smeagol Ansonia smeagol smeagol Ansonia smeagol Ansonia Ansonia Ansonia spinulifer Ansonia thinthinae Ansonia thinthinae Ansonia thinthinae Ansonia thinthinae Ansonia thinthinae Ansonia thinthinae Ansonia tiomanica Ansonia tiomanica Ansonia torrentis Leptophryne borbonica Pedostibes hosii Pelophryne sigmata et al. et al. et al. et al. et al. et al. et al. et al. 140 Zootaxa 4103 (2) 2016 Magnolia Press DAVIS ET AL.

5 measured from medial, inner margins of nostrils; interorbital diameter (IOD), distance between medial margins of palpebrae at its closest point; eye diameter (ED), length between anterior and posterior margins of eye; tympanum diameter (TD), length of the vertical axis; manus length (ML), distance from the proximal edge of the outer metacarpal tubercle to the tip of the third finger; crus length (CL), distance from knee inflection to tarsal inflection; pes length (PL), measured from proximal edge of inner metatarsal tubercle to tip of fourth toe. Toe webbing formula follows Savage & Heyer (1997). These characters were compared to additional discrete character states for all congeners listed in Wood et al. (2008) and to specimens of other species examined first hand (Appendix) (Wilkinson 2012; Chan 2014). The type series is deposited in the La Sierra University Herpetological Collection (LSUHC), La Sierra University, Riverside, California, USA. DNA extraction and amplification. Genomic DNA was extracted from liver samples that were stored in 95% ethanol using the animal tissue protocol in the Qiagen DNeasy tissue kit (Qiagen. Valencia, California). A 2451 bp fragment of the mitochondrial genes 12S, trna val, and 16S was amplified using a double stranded polymerase chain reaction (PCR) under the following conditions: 1.0 µl of 5X buffer (1.5 µm), 0.1 µl of Taq polymerase, 1 µl of Bovine Serum Albumin (BSA [.05 mg/ml]), 1 µl dinucleotide pairs (dntp [1.5 µl]), 1 µl of each of the external primers (Table 1), and 6.5 µl of dih 2 O. All PCR reactions were carried out on an MJ Research PTC-2000 Peltier Thermal Cycler: initial denaturation at 94 C for 2 min, followed by 35 cycles of a secondary denaturation at 94 C for 30 s, annealing at 55 C for 30 s, elongation at 72 C for 1.5 min, with a final extension at 72 C for 10 min. PCR products were visualized via agarose gel electrophoresis. PCR products that were the same size as the targeted regions were purified using PrepEase PCR Purification 96-well (Ultrafiltration) plates and the products were resuspended in dih 2 O. Purified PCR products were sequenced using an ABI Big-Dye Terminator v3.1 Cycle Sequencing Kit in an ABI GeneAmp PCR 9700 thermal cycler. All cycle sequencing reactions were purified using Sephadex G-50 Fine (GE Healthcare) and analyzed on an ABI 3730xl DNA Analyzer at the Brigham Young University Sequencing center. Sequences were edited and aligned in GENEIOUSv8.1.5 (Drummond et al. 2011). Initial alignment was constructed using the MUSCLEv3.831 algorithm (Edgar 2004) implemented in GENEIOUSv The alignment was then adjusted by eye in Mesquite v3.02 (Maddison & Maddison 2015). Phylogenetic analyses. Maximum Likelihood (ML) and Bayesian Inference (BI) were used to construct phylogenetic trees using the individuals listed in Table 1. The dataset was partitioned by gene as determined in IQ- TREE (Nguyen 2015) using the BIC criterion. TIM2+I+G4 was the best-fit model of evolution for 12S and 16S and TIMe+G4 was the best-fit model for valine (val). The ML analysis was performed on IQ-TREE and 1000 bootstrap pseudoreplicates were run using the ultrafast bootstrap analysis (Minh et al. 2013). The Bayesian analysis was performed on CIPRES Science Gateway (Miller et al. 2010) using MrBayes v3.2.4 (Ronquist et al. 2012). Two simultaneous runs were performed with four chains: three hot and one cold. The Markov Chain Monte Carlo (MCMC) chain was run for 50,000,000 generations and it was sampled every 5000 generations with the, with the first 25% of each run being discarded as burn-in. The posterior distribution of trees was summarized using the sumt function in MrBayes v3.2.4 (Ronquist et al. 2012). Stationary was checked in Tracer v1.6 (Rambaut & Drummond 2013) to ensure convergence, which was determined by assuring that effective sample sizes were greater than 200 for all parameters. We considered Bayesian posterior probabilities (BPP) of 0.95 and above and ultrafast bootstrap support values (UBS) of 90 and above as significant nodal support (Huelsenbeck & Ronquist 2001; Minh et al. 2013). TABLE 2. Primers used in this study for PCR amplification and sequencing reactions. Type Primer name Primer sequence 5' 3' Primer reference External ThrLm AAARCATKGGTCTTGTAARCC (Matsui et al. 2010) External Hedges16H1 CTCCGGTCTGAACTCAGATCACGTAGG (Hedges & Maxson 1993) Internal 12S-3H CAAGTCCTTTGAGTTTTAAGCT (Matsui et al. 2010) Internal 12SL1091 AAACTGGGATTAGATACCCCACTAT (Matsui et al. 2010) Internal 12StVal-H AAGTAGCTCGCTTAGTTTCGG (Matsui et al. 2010) Internal 12SL2021 CCTACCGAGCTTAGTRATAGCTGGTT (Tominaga et al. 2006) Internal 16SH2715 AAGCTCCATAGGGTCTTCTCGTC (Tominaga et al. 2006) Internal 16S1M CCGACTGTTTACCAAAAACAT (Fu, 2000) NEW ANSONIA FROM A HIGHLAND IN PENINSULAR MALAYSIA Zootaxa 4103 (2) 2016 Magnolia Press 141

6 Results The Bayesian and ML analyses produced trees with a very similar topology (Fig. 2), indicating that the Genting Highlands population is a separate lineage that is not conspecific with A. jeetsukumarani. Both analyses also indicate it as the sister species to a clade containing A. lumut, A. penangensis, A. malayana, and A. jeetsukumarani but this relationship is weakly supported (--/72) for the ML analysis. Within that clade, the Genting Highlands population is the most distantly related to the sister species A. malayana and A. jeetsukumarani (Fig. 2). The ML phylogeny shows low support (69 UBS) for the sister species relationship between A. latirostra and A. tiomanica a close relationship first noted by Grandison (1972) and discussed by Grismer (2006). However, this relationship was not supported in the BI phylogeny which placed A. smeagol sp. nov. as the sister species to A. tiomanica but with very low support (0.64 PP). The ML topology was preferred here as it matched the topology of Chan et al. (2014). The morphological and color pattern analyses corroborate the molecular analyses by demonstrating that the Genting Highlands population is discretely diagnosable from all other species of Ansonia by having a unique suite of characters (Table 3) and specifically from A. jeetsukumarani by having an inner metatarsal tubercle, absence of a dorsolateral row of enlarged tubercles, the absence of orange coloration on the flanks, and the absence of orange banding on the front and hind limbs. FIGURE 2. Phylogram of the relationships of the species of Ansonia. The tree is a maximum likelihood topology (-ln L ) with Bayesian posterior probabilities (PP) and bootstrap values (UBS), respectively, at the nodes. 142 Zootaxa 4103 (2) 2016 Magnolia Press DAVIS ET AL.

7 Ansonia Ansonia smeagol albomaculata anotis endauensis fuliginea glandulosa guibei hanitschi continued on the next page NEW ANSONIA FROM A HIGHLAND IN PENINSULAR MALAYSIA Zootaxa 4103 (2) 2016 Magnolia Press 143

8 inthanon jeetsukumarani kraensis latidisca latiffi latirostra leptopus continued on the next page 144 Zootaxa 4103 (2) 2016 Magnolia Press DAVIS ET AL.

9 longidigita lumut malayana mcgegori minuta continued on the next page NEW ANSONIA FROM A HIGHLAND IN PENINSULAR MALAYSIA Zootaxa 4103 (2) 2016 Magnolia Press 145

10 muelleri ornata penangensis platysoma rubigina continued on the next page 146 Zootaxa 4103 (2) 2016 Magnolia Press DAVIS ET AL.

11 siamensis spinulifer tiomanica torrentis smeagol NEW ANSONIA FROM A HIGHLAND IN PENINSULAR MALAYSIA Zootaxa 4103 (2) 2016 Magnolia Press 147

12 Taxonomy Ansonia smeagol sp. nov. The Precious Stream-Toad Fig. 3A Holotype. Adult female (LSUHC 12124) collected on 16 March 2015 from Genting Highlands, Malaysia ( N; , 1218 m in elevation) by Lee Grismer, Perry L. Wood JR., Brandon T. Burch, Anthony J. Cobos, Matthew L. Murdoch, and Hayden R. Davis. Paratypes. All nine paratypes have the same collection data as the holotype (LSUHC 12122, 12123, 12125, 12126, 11641, 11645, 12076, 12078, 12270). LSUHC is the only male. Diagnosis. Ansonia smeagol sp. nov. is assigned to the genus Ansonia based on its phylogenetic placement and the following morphological characteristics: small body size; slender limbs; no parotoid glands; weak subarticular tubercles; and membranous foot webbing. It can be differentiated from all other species of Ansonia by the combination of the following characters: SVL mm in females; snout projecting beyond lower jaw; tympanum visible; white tubercle at rictus; finger and toe tips rounded; presence of inner and outer metatarsal tubercle; presence of gular spotting; faint presence of crossbars on hind limbs; and the faint presence of a middorsal stripe extending from the tip of the snout to the interscapular region. FIGURE 3. (A) adult female of Ansonia smeagol sp. nov. (paratype LSUHC 12124), (B) adult female A. jeetsukumarani (LSUDPC 2550) from Fraser s Hill, Pahang, (C) adult female A. malayana (LSUDPC 4392) from Bukit Larut, Perak, (D) adult female A. penangensis (LSUDPC 5738) from Penang Island, Penang, and (E) adult female A. lumut (LSUDPC 6599) from Gunung Tebu, Terengganu. Description of holotype. Adult female, SVL 27.3 mm; head longer than wide (HL/HW=1.02); snout shorter than wide (SL/SW=0.68), extending beyond lower jaw, dorsally convex with a midline depression; canthus rostralis distinct; nares open laterally just below canthus, nearly terminal on snout; distance between nares smaller than snout length (IND/SL=0.93) and snout width (IND/SW=0.63); eyes large, slightly protruding beyond labials in dorsal view, diameter slightly larger than snout length (ED/SL=1.07), less than one-half the size of interorbital distance (ED/IOD=0.40); tympanum fairly distinct, circular with horizontal axis being shorter than eye diameter (TD/ED=0.45); choanae subcircular, separated by a distance larger than their diameter; vomerine ridge and teeth absent; tongue narrow, ending in median point, posterior one-half free. 148 Zootaxa 4103 (2) 2016 Magnolia Press DAVIS ET AL.

13 TABLE 4. Selected measurements of the type series of Ansonia smeagol sp. nov. continued. LSUHC Holo-type LSUHC Para-type LSUHC Para-type LSUHC Para-type LSUHC Para-type Sex F F F F F F SVL HL HW SL SW IND IOD ED TD ML CL PL LSUHC Para-type LSUHC Para-type LSUHC Para-type Mean ± Std Error: Min-Max Sex F F M SVL ± 1.4: HL ± 0.3: HW ± 0.3: SL ± 0.1: SW ± 0.2: IND ± 0.1: IOD ± 0.3: ED ± 0.1: TD ± 0.05: ML ± 0.3: CL ± 0.4: PL ± 0.6: LSUHC Para-type Forelimbs and fingers long and slender; finger length from shortest to longest: I, II, IV, III; basal webbing not extending beyond proximal subarticular tubercle; fingertips rounded, slightly dilated but not forming discs; subarticular tubercles distinct; inner and outer metacarpal tubercles distinct, oval, raised, inner slightly smaller than outer. Hindlimbs and toes are long and slender (CL/SVL=0.29), foot longer than tibia (PL/CL=1.33); toe length from longest to shortest: I, II, III, V, IV; webbing formula: I 1, II ½-2, III 1½-2, IV 3½-3.7, V 1.5; tips rounded, dilated but not forming discs; subarticular tubercles distinct; inner tubercle elongate, raised; outer tubercle raised, oval, slightly smaller than inner. Upper eyelid, interorbital region, and dorsal part of snout and canthus covered in small, raised tubercles bearing keratinized tips; interorbital ridges absent; few randomly dispersed tubercles present on lores; single row of small spinules on upper lip and outer margin of upper eyelid; large tubercle just above rictus, posterior to tympanum; supratympanic fold and parotoid gland absent; back, flanks, and dorsal part of limbs bearing irregularly spaced large and small tubercles bearing white or brown keratinized spinules; entire ventral surface except for manus and pes covered with fine, evenly spaced spinules that are most dense around rictal and pectoral region; and ventral surface finely granular in both males and females. NEW ANSONIA FROM A HIGHLAND IN PENINSULAR MALAYSIA Zootaxa 4103 (2) 2016 Magnolia Press 149

14 Coloration in life (Fig. 3A). Dorsal ground color is dark brown to black; flanks bearing randomly arranged, white patches; large, white tubercle at rictus with a smaller, white tubercle present between rictus and posterior upper labial tubercles on left side of head but absent on right; four small, white patches on upper, right lip and three small, white patches on upper, left lip; white patches on ventral side of mandible, near the vent, and on anterior portion of thigh; and ventral portion of thigh much lighter than other parts of body. Variations (Fig. 4). All paratypes closely resembled the holotype in both coloration and pattern. Apart from one paratype (LSUHC 12125), the ventral portion of the thigh was not lighter in coloration than the rest of the ventral surface. The same paratype also showed a higher prominence of white spotting on the ventral portion of the body. None of the paratypes had a tubercle anterior to the large, white tubercle at the rictus, as was seen in the holotype. Measurements showing the variation in size within the type series are shown in Table 4. FIGURE 4. (A) Dorsal and (B) ventral view of the first five specimens of Ansonia smeagol sp. nov. collected. From left to right LSUHC 12122, LSUHC 12123, LSUHC 12124, LSUHC 12125, and LSUHC Comparisons. Morphological data for species comparisons were obtained from Wood et al. (2008) and the material examined (Appendix). Ansonia smeagol sp. nov. forms a monophyletic group with A. jeetsukumarani, A. lumut, A. malayana, and A. penangensis (Fig. 3). Ansonia smeagol sp. nov. differs from A. lumut by having a slightly smaller SVL ( mm versus mm in females, respectively), lacking a large yellow tubercle at the angle of the jaw, lacking a dorsolateral row of enlarged tubercles, and having a coarsely granular abdomen. It is differentiated from A. jeetsukumarani by lacking a dorsolateral row of enlarged tubercles, having an inner metatarsal tubercle, and the absence of orange coloration on the flanks and orange banding on the limbs. It differs from A. malayana by lacking a large yellow tubercle at the angle of the jaw, the absence of a light orange coloration on limbs and dorsum, and the absence of an X pattern on the dorsum. It differs from A. penangensis by its smaller SVL (24.6 mm versus 37.2 mm in females), the absence of a tarsal ridge, and the absence of orange bands on the limbs. Comparisons to all other Ansonia species can be found in Table 3. Distribution and natural history. Ansonia smeagol sp. nov. is only known to occur in the upland regions of the Titiwangsa Mountain Range (1218m in elevation) at Genting Highlands. Four of the specimens were found between 2000 and 2300 hrs in a small drainage ditch at the side of a dirt road, next to a muddy slope covered by hill dipterocarp forest. Five other specimens were found on top of the leaf litter, in a closed canopy forest (Fig. 5). Both localities were in the vicinity ( m) of a large, fast-flowing rocky stream with various side pools. The holotype and four out of the eight paratypes were collected during the month of March, three of which were gravid indicating that March falls within this species reproductive season. Etymology. The specific epithet is a noun in apposition in reference to Sméagol, a fictional character created by J. R. R. Tolkien in The Hobbit (1937). Sméagol is an upland, semiaquatic, large-eyed, creature inhabiting the Misty Mountains of Middle Earth who has long, thin limbs bearing digits with bulbous tips, large webbed feet, and large protruding eyes characters found in the new population being described herein. Discussion The phylogeny presented here matched the topology of Chan et. al. (2014). However, we faced the same problem that previous Ansonia phylogenies have in that many nodes are not well supported (Chan et al. 2014; Matsui et al. 2010, 2012; Wilkinson et al. 2012). The clade containing A. smeagol sp. nov. only had one well supported node (1/ 100) placing A. penangensis as sister species to A. jeetsukumarani. The description of Ansonia smeagol sp. nov. brings the total number of described species of Ansonia to 29 but more importantly, it underscores the rich, undiscovered diversity that still exists in the cloud forests of Peninsular 150 Zootaxa 4103 (2) 2016 Magnolia Press DAVIS ET AL.

15 Malaysia. New species are continually being discovered in well-studied areas throughout the Titiwangsa Mountain Range north of Genting Highlands (Grismer & Quah 2015) as well as in other mountain ranges (Grismer et al. 2010, 2013a,b, 2014; Wood et al. 2008, 2009) and there is no reason why Genting Highlands will prove to be any different. Being that only five species of Ansonia are known from the upland habitats of Peninsular Malaysia, it suggests that the diversity of this genus may be largely underestimated owing to the vast expanses of upland habitats that remain unexplored. Additionally, the taxonomy of many upland species of Ansonia are in dire need of a molecular analysis. For example, A. malayana is known from four isolated populations separated by approximately km (Grismer 2006; Grismer et al. 2010); A. latirostra is known from two isolated mountain tops separated by approximately 127 km (Grismer 2006); and A. latffi is known from six separate upland and lowland localities (reported here for the first time from Hutan Lipur Sekayu and Hutan Lipur Chemerong) separated by km (Grismer 2006) and this species shows a marked degree of genetic substructuring (Fig. 2). Much the same can be said for A. kraensis from southern Thailand (Grismer 2006). This underscores the notion that the biodiversity of the upland systems of the Thai-Malaya Peninsula will be greatly increased with additional field-based research which will hopefully lead to the preservation and conservation of these unique and fragmented ecosystems. FIGURE 5. (A) Microhabitat and (B) habitat of Ansonia smeagol sp. nov. in the Genting Highlands, Pahang. NEW ANSONIA FROM A HIGHLAND IN PENINSULAR MALAYSIA Zootaxa 4103 (2) 2016 Magnolia Press 151

16 Acknowledgements For field assistance, we thank A. J. Cobos, M. L. Murdoch, B. T. Burch, C. Aguilar C., K. O. Chan, A. X. Y. Sumarli, Z. Grady, N. Riasat, D. Burgess, A. Verano, and V. Raya. This research was support in part by grants to LLG from the College of Arts and Sciences, La Sierra University, Riverside, California and the National Geographic Society Explorer s Grant (number ). Shahrul Anuar was supported by Universiti Sains Malaysia and Ministry of Higher Education Research Grants. DNA sequencing was supported by an NSF award (EF ) to J.W. Sites Jr., and the department of biology at Brigham Young University. References Chan, K.O., Wood, P.L., Anuar, S., Muin, M.A., Quah, E.S.H., Sumarli, A.X.Y. & Grismer, L.L. (2014) A new species of upland Stream Toad of the genus Ansonia Stoliczka, 1870 (Anura: Bufonidae) from northeastern Peninsular Malaysia. Zootaxa, 3764 (4), Drummond, A.J., Ashton, B., Buxton, S., Cheung, M., Cooper, A., Duran, C. & Wilson, A. (2011) Geneious v5.4. Available from: (accessed 30 July 2015) Edgar, R.C. (2004) MUSCLE User Guide. Nucleic Acids Research, 32 (November), Fu, J. (2000) Toward the phylogeny of family Lacertidae: why 4708 base pairs of mtdna sequences cannot draw the picture. Biological Journal of the Linnean Society, 71, Grandison, A.G.C. (1972) The Gunong Benom Expedition Reptiles and amphibians of Gunong Benom with a description of a new species of Macrocalamus. Bulletin of the British Museum of Natural History. Zoology, 23, Grismer, L.L. (2006) A new species of Ansonia Stoliczka 1872 (Anura: Bufonidae) from Central Peninsular Malaysia and revised taxonomy for Ansonia from the Malay Peninsula. Zootaxa, 1327, Grismer, L.L., Chan, K.O., Grismer, J.L., Wood, P.L. Jr. & Norhayati, A. (2010) A checklist of the herpetofauna of the Banjaran Bintang, Peninsular Malaysia. Russian Journal of Herpetology, 17, Grismer, L.L., Anuar, S., Muin, M.A., Quah, E.S.H. & Wood, P.L. Jr. (2013a) Phylogenetic relationships and description of a new upland species of Bent-toed Gecko (Cyrtodactylus Gray, 1827) of the C. sworderi complex from northeastern Peninsular Malaysia. Zootaxa, 3616 (3), Grismer, L.L., Wood, P.L. Jr., Anuar, S., Muin, M.A., Quah, E.S.H., McGuire, J.A., Brown, R.M., Tri, N.V. & Thai, P.H. (2013b) Integrative taxonomy uncovers high levles of cryptic species diverstiy in Hemiphyllodactylus Bleeker, 1860 (Sqamata: Gekkonidae) and the description of a new species from Peninsular Malaysia. Zoological Journal of the Linnean Society, 169, Grismer, L.L., Wood, P.L. Jr., Anuar, S., Riyanto, A., Norhayati, A., Muin, M.A., Sumontha, M., Grismer, J.L., Chan, K.O., Quah, E.S.H. & Pauwels, O.S.A. (2014) Systematics and natural history of Southeast Asian Rock Geckos (genus Cnemaspis Strauch, 1887) with descriptions of eight new species from Malaysia, Thailand, and Indonesia. Zootaxa, 3880 (1), Grismer, L.L. & Quah, E.S.H. (2015) The rediscovery of Sphenomorphus malayanus Doria, 1888 (Squamata: Scincidae) from the Titiwangsa Mountain Range of Peninsular Malaysia and its re-description as S. senja sp. nov. Zootaxa, 3931 (1), Hedges, S.B. & Maxson, L.R. (1993) A molecular perspective on lissamphibian phylogeny. Herpetological Monograph, 7, Huelsenbeck, J.P. & Ronquist, F. (2001) MRBAYES: Bayesian inference of phylogeny. Bioinformatics, 17, Inger, R.F. (1960) A review of the oriental toads of the genus Ansonia Stoliczka. Fieldiana. Zoology, 39, Inger, R.F. (1992) Variation of apomorphic characters in stream-dwelling tadpoles of the bufonid genus Ansonia (Amphibia: Anura). Zoological Journal of the Linnaean Society, 105, Maddison, W.P. & Maddison, D.R. (2015) Mesquite: a modular system for evolutionary analysis. Version 3.02 Sinauer Sunderland Massachusetts. Available from: (accessed 30 October 2015) Miller, M.A., Pfeiffer, W. & Schwartz, T. (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic 152 Zootaxa 4103 (2) 2016 Magnolia Press DAVIS ET AL.

17 trees Gateway Computing Environments Workshop, GCE 2010, Matsui, M., Tominaga, A., Liu, W., Khonsue, W., Grismer, L.L., Diesmos, A.C., Sudin, A., Yambun, P., Yong, H., Sukumaran, J. & Brown, R.M. (2010) Phylogenetic relationships of Ansonia from Southeast Asia inferred from mitochondrial DNA sequences: Systematic and biogeographic implications (Anura: Bufonidae). Molecular Phylogenetics and Evolution, 54, Matsui, M., Nishikawa, K., Yeo, S.T. & Eto, K. (2012) Notes on a rare Bornean Bufonid Ansonia latidisca Inger, 1966, with special reference to its phylogenetic position. The Herpetological Society of Japan, 31 (2), Minh, B.Q., Nguyen, M.A.T. & Haeseler, A. (2013) Ultrafast approximation for phylogenetic bootstrap. Molecular Biology and Evolution, 30, Nguyen, L.T., Schmidt, H.A., Haeseler, A. & Minh, B.Q. (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum likelihood phylogenies. Molecular Biology and Evolution, 32, Rambaut, A. & Drummond, A.J. (2013) Tracer V1.6. Available from: (accessed 30 July 2015) Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, M.A. & Huelsenbeck, J.P. (2012) MrBayes 3.2: efficient Bayesian Phylogenetic inference and model choice across a Large model space. Systematic Biology, 61, Savage, J.M. & Heyer, W.R. (1997) Digital webbing formulae for Anurans: a refinement. Herpetological Review, 28, 131. Stoliczka, F. (1870) Observations on some Indian and Malayan amphibia and reptiles. Journal of the Asiatic Society of Bengal, 32, Tolkien, J.R.R. (1937) The Hobbit. George Allen and Unwin, London, 310 pp. Tominaga, A., Matsui, M., Nishikawa, K. & Tanabe, S. (2006) Phylogenetic relationships of Hynobius naevius (Amphibia: Caudata) as revealed by mitochondrial 12S and 16S rrna genes. Molecular Phylogenetics and Evolution, 38, Wilkinson, J.A., Sellas A.B. & Vindum, J. (2012) A new species of Ansonia (Anura: Bufonidae) from northern Tanintharyi Division, Myanmar. Zootaxa, 3163, Wood, Jr., P.L., Grismer, L.L., Ahmad, N. & Senawi, J. (2008) Two new species of torrent-dwelling toads Ansonia Stoliczka, 1870 (Anura: Bufonidae) from Peninsular Malaysia. Herpetologica, 64 (3), Wood Jr., P.L., Grismer, J.L., Grismer, L.L., Ahmad, N., Onn, C.K. & Bauer, A.M. (2009) Two new montane species of Acanthosaura Gray, 1831 (Squamata: Agamidae) from Peninsular Malaysia. Zootaxa, 2012, APPENDIX. Material examined. The following preserved specimens were examined. Ansonia jeetsukumarani. Malaysia Pahang: Fraser's Hill, UKMHC 0126; LSUHC 08075; Ansonia lumut. Malaysia Terengganu, LSUHC ; Sungai Bubu, NEW ANSONIA FROM A HIGHLAND IN PENINSULAR MALAYSIA Zootaxa 4103 (2) 2016 Magnolia Press 153