Article.

Transcription

1 Zootaxa 3746 (3): Copyright 2013 Magnolia Press Article ISSN (print edition) ZOOTAXA ISSN (online edition) A new species of karst-adapted Cnemaspis Strauch, 1887 (Squamata: Gekkonidae) from a threatened karst region in Pahang, Peninsular Malaysia L. LEE GRISMER 1, PERRY L. WOOD, JR. 2, MAKETAB MOHAMED 3, KIN ONN CHAN 4, HEATHER M. HEINZ 5, ALEX S-I. SUMARLI 1, JACOB A. CHAN 1 & ARIEL I. LOREDO 1 1 Department of Biology, La Sierra University, 4500 Riverwalk Parkway, Riverside, California USA. lgrismer@lasierra.edu 2 Department of Biology, Brigham Young University, 150 East Bulldog Boulevard, Provo, Utah USA. pwood@byu.edu 3 Malaysian Nature Society, JKR 641, Jalan Kelantan, Bukit Persekutuan, 50480, Kuala Lumpur, Malaysia. maketab_mohamed@yahoo.com 4 Biodiversity Institute and Department of Ecology and Evolutionary Biology, University of Kansas, Lawrence, Kansas 66045, USA. ; chan@ku.edu 5 Department of Biology, San Diego State University, San Diego, California, USA Abstract A new species of karst-adapted gekkonid lizard of the genus Cnemaspis Strauch is described from Gua Gunting and Gua Goyang in a karst region of Merapoh, Pahang, Peninsular Malaysia whose unique limestone formations are in immediate danger of being quarried. The new species differs from all other species of Cnemaspis based on its unique suite of morphological and color pattern characters. Its discovery underscores the unique biodiversity endemic to karst regions and adds to a growing list of karst-adapted reptiles from Peninsular Malaysia. We posit that new karst-adapted species endemic to limestone forests will continue to be discovered and these regions will harbor a significant percentage of Peninsular Malaysia s biodiversity and thusly should be conserved rather than quarried. Key words: new species, Cnemaspis, karst, limestone, conservation, biodiversity, Merapoh, Peninsular Malaysia Introduction Karst formations compose some of Peninsular Malaysia s most dramatic landscapes. Their unique topography is formed through the dissolution of layers of carbonate bedrock creating caves, sinkholes, and karst towers. Exposed karst surfaces are particularly subject to weathering and as such, karst towers and cliff faces often bear a deep corrugated appearance resulting from years of erosion and fracturing. Such weathering creates a very unique microhabitat to which a number of organisms have become adapted (Komo 1998a,b; Tija 1998). In Peninsular Malaysia, plants are particularly successful at colonizing karst regions. Although limestone karsts account for only 0.3% of the total land surface area of Peninsular Malaysia, 14% of the country's flora is endemic to karst surfaces (Kiew 1998). The flora surrounding karst formations is also unique and generally referred to as limestone forest. It is an open canopy forest composed of a number of endemic, small, spindly trees and spiny plants adapted to nutrient poor conditions and periodic drought (Kiew 1998). Despite the astonishing degree of floral endemism, karst formations and their surrounding limestone forests are often overlooked by vertebrate systematists and thus, only a few specialized vertebrates are known to exploit these unique microhabitats (i.e. Alström et al. 2010; Jenkins et al. 2004; Woxvold et al. 2009). Reptiles, however, are a growing exception. We have been surveying karst regions in Peninsular Malaysia since 2008 and have discovered five new karst-adapted species of Rock Geckos (Cnemaspis: Grismer et al. 2008a,b, 2009; Wood et al. 2013) with an additional description of another species in progress; two new species of karst-adapted Bent-toed Geckos (Cyrtodactylus: Grismer et al. 2012) with two additional species descriptions in progress; and a new species of limestone forest adapted snake (Quah et al. in preparation). Remarkably, we have only explored approximately 2% of the known karst formations and associated Accepted by A. Bauer: 23 Oct. 2013; published: 12 Dec

2 limestone forests in Peninsular Malaysia (Price 2001) and anticipate that tens of additional new species will eventually be discovered as exploration continues. In this paper, we present the description of a new species of karst-adapted gekkonid lizard of the genus Cnemaspis. This species bears the diagnostic traits of the genus (see Grismer et al. 2010) yet manifests a unique suite of character states and a percent sequence divergence based on the mitochondrial gene NADH dehydrogenase subunit 2 (ND2) that differentiate it from all other known species of Cnemaspis. More importantly, this new species comes from Gua Goyang and Gua Gunting, which are karst formations in Merapoh, Pahang with a particularly high concentration of calcium making them a valuable resource for the cement industry. As such, these formations are scheduled to be quarried at the time of this writing. We hope that the description of this new species and that of a new Bent-toed Gecko (Cyrtodactylus; in prep.) from the same formations will bring attention to the high conservation value of karst regions in general and the Gua Goyang and Gua Gunting sites in particular. Materials and methods Color characters were taken from digital images of living specimens cataloged in the La Sierra University Digital Photo Collection (LSUDPC) and in some cases, from living specimens. The following measurements on the type series were taken with Mitutoyo dial calipers to the nearest 0.1 mm under a Nikon SMZ 1500 dissecting microscope on the left side of the body where appropriate: snout-vent length (SVL), taken from the tip of snout to the vent; tail length (TL), taken from the vent to the tip of the tail, original or regenerated; tail width (TW), taken at the base of the tail immediately posterior to the postcloacal swelling; forearm length (FL), taken on the dorsal surface from the posterior margin of the elbow while flexed 90 to the inflection of the flexed wrist; tibia length (TBL), taken on the ventral surface from the posterior surface of the knee while flexed 90 to the base of the heel; axilla to groin length (AG), taken from the posterior margin of the forelimb at its insertion point on the body to the anterior margin of the hind limb at its insertion point on the body; head length (HL), the distance from the posterior margin of the retroarticular process of the lower jaw to the tip of the snout; head width (HW), measured at the angle of the jaws; head depth (HD), the maximum height of head from the occiput to the throat; eye diameter (ED), the greatest horizontal diameter of the eye-ball; eye to ear distance (EE), measured from the anterior edge of the ear opening to the posterior edge of the eye-ball; eye to snout distance (ES), measured from anteriormost margin of the eye-ball to the tip of snout; eye to nostril distance (EN), measured from the anterior margin of the eye-ball to the posterior margin of the external nares; inner orbital distance (IO), measured between the anterior edges of the orbit; ear length (EL), the greatest horizontal distance of the ear opening; and internarial distance (IN), measured between the nares across the rostrum. Additional character states evaluated were numbers of supralabial and infralabial scales counted from below the middle of the orbit to the rostral and mental scales, respectively; size and number of postmental scales contacting the mental; the texture of the scales on the anterior margin of the forearm; the number of paravertebral tubercles between limb insertions counted in a straight line immediately left of the vertebral column (where applicable); the presence or absence of a row of enlarged, widely spaced tubercles along the ventrolateral edge of the body between the limb insertions; the number of subdigital lamellae beneath the fourth toe counted from the base of the first phalanx to the claw; the total number of precloacal pores, their orientation, shape, and degree of separation; the degree and arrangement of body and tail tuberculation; the relative size and morphology of the subcaudal scales, subtibial scales, and submetatarsal scales beneath the first metatarsal; and the number of postcloacal tubercles on each side of the tail base. Longitudinal rows of caudal tubercles on the nonregenerated portion of the tail are quite variable between species and useful in differentiating several taxa. Up to five pairs of the following rows may be present in varying combinations: paravertebral row the dorsal row adjacent to the middorsal, caudal furrow; dorsolateral row the row between the paravertebral row and the lateral, caudal furrow on the dorsolateral margin of the tail; lateral row the row immediately below the lateral, caudal furrow; and ventrolateral row the row below the lateral row on the ventrolateral margin of the tail. When present, this row is usually restricted to the anterior 25% (or less) of the tail. Rarely there may be a row of tubercles within the lateral, caudal furrow. Various color pattern characteristics were also evaluated (see description). A 1335 aligned base pair fragment of the mitochondrial gene NADH dehydrogenase subunit 2 (ND2) and its flanking t-rnas (t-rna-trp, t-rna-ala, t-rna-asn, and t-rna-cys) was amplified using the following primers L4437b 5 -AAGCAGTTGGGCCCATACC-3 and L AACCAAACCCAACTACGAAAAAT Zootaxa 3746 (3) 2013 Magnolia Press GRISMER ET AL.

3 (Macey & Schulte 1999) and sequenced for nearly all named species of Cnemaspis (see Grismer et al. unpublished). Uncorrected pairwise sequence divergences were calculated in PAUP* v4.0 (Swofford 2002) for the undescribed Merapoh species (two specimens: LSUHC 11016) and its sister taxon C. bayensis Grismer, Grismer, Wood & Onn (two specimens: LSUHC ). Specimens examined as comparative material are listed in the appendices of Grismer et al and Wood et al. 2013). LSUHC refers to the La Sierra University Herpetological Collection, La Sierra University, Riverside, California, USA; Systematics Cnemaspis selamatkanmerapoh sp. nov. Merapoh Rock Gecko Cicak Batu Merapoh Figure 1 Holotype. Adult male (LSUHC 11016) collected on 23 June 2013 by L. Lee Grismer at 2200 hrs at 23 m from Gua Gunting, Merapoh, Pahang, Peninsular Malaysia ( N E; at 257 m elevation). Paratype. Adult female (LSUHC 11015) bears the same data as the holotype except it was collected at 1500 hrs. Diagnosis. Cnemaspis selamatkanmerapoh sp. nov. differs from all other Southeast Asian species of Cnemaspis in having the unique combination of adult males reaching at least 37.6 mm SVL, adult females reaching 43.4 mm SVL; 10 supralabials; nine or 10 infralabials; keeled ventrals; at least one, round precloacal pore in males; moderately prominent dorsal tubercles; 30 paravertebral tubercles; dorsal body tubercles semi-randomly arranged; tuberculation weak on flanks; caudal tubercles not encircling tail; lateral caudal tubercles not within lateral caudal furrows; ventrolateral caudal tubercles absent; subcaudals keeled; no enlarged, median subcaudal scale row; three postcloacal tubercles; no enlarged femoral, subtibial, or submetatarsal scales; subtibials keeled; subdigital lamellae on fourth toe; no ocelli in shoulder region; no distinct, yellow bars on flanks; and no yellow, postscapular band. These differences are summarized across all Southeast Asian species in Wood et al. (2013:Table 2). Description of holotype. Adult male; SVL 37.6 mm; head oblong in dorsal profile, moderate in size (HL/SVL 0.27), somewhat narrow (HW/SVL 0.17), flattened (HD/HL 0.41), distinct from neck; snout short (ES/HL 0.47), slightly concave in lateral profile; postnasal region constricted medially, flat; scales of rostrum weakly keeled, raised, slightly larger than more rounded scales on occiput; low, supraorbital ridges; moderate frontorostral sulcus; canthus rostralis weak; eye large (ED/HL 0.23); extra-brillar fringe scales largest anteriorly; pupil round; ear opening oval, taller than wide; rostral concave, dorsal 80% divided by longitudinal groove; rostral bordered posteriorly by supranasals and one small, azygous scale and laterally by first supralabials; 10R,L raised supralabials of similar size; nine or 10 infralabials, decreasing in size posteriorly; nostrils elliptical, oriented posterolaterally, bordered posteriorly by small, granular, postnasal scales; mental large, triangular, bordered posteriorly by four large postmentals, outer two largest; gular scales raised, keeled; throat scales larger, raised, keeled. Body slender, elongate; small, keeled, dorsal scales equal in size throughout body, intermixed with larger, multicarinate tubercles more or less randomly arranged; tubercles extend from occiput to base of tail; tubercles on lower flanks sparse, moderate in size; 30 paravertebral tubercles; pectoral and abdominal scales raised, keeled, not elongate, same size throughout; abdominal scales slightly larger than dorsals; one precloacal pore; forelimbs moderately long, slender; dorsal scales of brachium raised, weakly keeled; dorsal scales of forearm raised, keeled; ventral scales of brachium smooth, raised, juxtaposed; ventral scales of forearm weakly, raised, juxtaposed; palmar scales smooth, juxtaposed, weakly raised; digits long with an inflected joint; claws recurved; subdigital lamellae unnotched; lamellae beneath first phalanges granular proximally, widened distally; lamellae beneath phalanx immediately following inflection granular, lamellae of distal phalanges wide; weak interdigital webbing at base of digits; fingers increase in length from first to fourth with fourth and fifth nearly equal in length; hind limbs slightly longer and thicker than forelimbs; dorsal scales of thigh keeled, raised, juxtaposed; scales of anterior surface of thigh keeled; ventral scales of thigh weakly keeled; subtibial scales keeled, flat, subimbricate, with no enlarged A NEW SPECIES OF KARST-ADAPTED CNEMASPIS Zootaxa 3746 (3) 2013 Magnolia Press 465

4 anterior row; plantar scales smooth, juxtaposed, raised; no enlarged submetatarsal scales beneath first metatarsal; digits elongate with an inflected joint; claws recurved; subdigital lamellae unnotched; lamellae beneath first phalanges granular proximally but wider distally; lamellae beneath phalanx immediately following inflection granular, lamellae of distal phalanges wide; weak interdigital webbing at base of digits; toes increase in length from first to fourth with fourth being slightly longer than fifth; 31 subdigital lamellae on fourth toe; caudal scales arranged in segmented whorls; dorsal caudal scales flat anteriorly, weakly keeled, juxtaposed; deep middorsal and lateral furrows; no enlarged, median subcaudal scales; subcaudal scales keeled; no median row of enlarged keeled subcaudal scales; caudal tubercles do not encircle tail; caudal tubercles absent from lateral furrow posteriorly; three enlarged postcloacal tubercles on lateral surface of hemipenal swellings at base of tail. Color pattern in life (Fig. 1). Dorsal ground color grey; top of head bearing small dark spots; thin, dark postorbital stripes meeting medially on occiput and turning anteriorly; rostrum and supralabial region greenish; paired, light colored, paravertebral, blotches extend from nape to base of tail where they transform into light colored caudal bands, blotches united on nape and shoulder region into a single blotch; flanks bearing dark mottling and yellowish spots; limbs darkly mottled with a faint banding pattern; overall color of venter unicolor beige with all scales bearing black stippling. There is no sexual dimorphism in color pattern and coloration lightens considerably at night. FIGURE 1. Holotype (LSUHC 11016) of Cnemaspis selamatkanmerapoh sp. nov. from Gua Gunting, Merapoh, Pahang, Peninsular Malaysia. Variation. The paratype (LSUHC 11015) approaches the holotype in coloration except there are indistinct, yellowish bars on the flanks. The specimen was badly damaged during capture and is missing skin on the posterior half of the body dorsally and ventrally. Morphometric variation and variation in scalation is presented in Table 1. Distribution. Cnemaspis selamatkanmerapoh sp. nov. is known only from the type locality of Gua Gunting, Merapoh, Pahang, Peninsular Malaysia (Fig. 2). Eggs, presumably of this species, were observed on the connected karst outcrop Gua Goyang. 466 Zootaxa 3746 (3) 2013 Magnolia Press GRISMER ET AL.

5 TABLE 1. Meristc and mensural character state of thew type series of Cnemaspis selamatkanmerapoh sp. nov. Abbreviations are listed in Materials and Methods. LSUHC LSUHC holotype paratype Sex m f Maximun SVL Supralabials Infralabials 10 9 Ventral scales keeled (1) or not (0) 1 1 No. of precloacal pores 1 / Precloacal pores continuous (1) or separated (0) / / Precloacal pores elongate (1) or round (0) 0 / No. of paravertebral tubercles 30 / Tubercles linearly arranged (1) or more random (0) 0 0 Tubercles present (1) or absent (0) on lower flanks w / Caudal tubercles in lateral furrow (1) or not (0) 0 0 Ventrolateral caudal tubercles anteriorly (1) or not (0) 0 0 Lateral caudal tubercle row present (1) or absent (0) 0 0 Caudal tubercles restricted to a single paravertebral row on each side (1) or not (0) 0 0 Subcaudals keeled (1) or not (0) 1 1 Single median row of keeled subcaudals (1) or not (0) 0 0 Caudal tubercles encircle tail (1) or not (0) 0 0 Enlarged median subcaudal scale row (1) or not (0) 0 0 No. of postcloacal tubercles 3 / Enlarged femoral scales present (1) or absent (0) 0 0 Shield-like subtial scales present (1) or absent (0) 0 0 Subtibial scales keeled (1) or not (0) 1 1 Enlarged submetatarsal scales on 1st toe (1) or not (0) 0 0 No. of 4th toe lamellae TL / / TW FL TBL AG HL HW HD ED EE ES EN IO EL IN A NEW SPECIES OF KARST-ADAPTED CNEMASPIS Zootaxa 3746 (3) 2013 Magnolia Press 467

6 FIGURE 2. Map showing the location of the type locality Gua Gunting, Merapoh, Pahang, Peninsular Malaysia for Cnemaspis selamatkanmerapoh sp. nov. Natural history. Both specimens were collected approximately 1 m above the ground from the perimeter of an extensive karst system surrounded by a limestone forest (Fig. 3). The female was carrying two eggs and observed at approximately 1500 hrs while positioned face down on a shaded surface outside a deep crevice into which she attempted to retreat prior to capture. The male was captured later that night at 2200 hrs while abroad in essentially the same area. These observations suggest this species in nocturnal. Etymology. The specific epithet selamatkanmerapoh is a combination of the Malay word selamatkan which is analogous to the English transitive verb save (as in to protect) and Merapoh which is the region wherein the type locality occurs. This name is in reference to the fact that karst formations of Gua Gunting and Gua Goyang have been determined to possess high quality limestone and are slated to be quarried. It also echoes the campaigning slogan Save Merapoh Caves that is being used by the Malaysian Nature Society and other local agencies that are fighting to conserve the karst formations in this region. 468 Zootaxa 3746 (3) 2013 Magnolia Press GRISMER ET AL.

7 FIGURE 3. Karst formation and limestone forest at Gua Goyang (right) and Gua Gunting (left), Merapoh, Pahang, Peninsular Malaysia. Comparisons. Cnemaspis selamatkanmerapoh sp. nov. is a member of a monophyletic lineage referred to as the affinis group (Grismer et al. in prep.) which contains C. affinis (Stoliczka); C. harimau Chan, Grismer, Anuar, Quah, Muin, Savage, Grismer, Ahmad, Remegio & Greer; C. pseudomcguriei Grismer, Ahmad, Chan, Belabut, Muin, Wood & Grismer; C. narathiwatensis Grismer, Sumontha, Cota, Grismer, Wood, Pauwels & Kunya; C. shahruli Grismer, Chan, Quah, Muin, Savage, Grismer, Ahmad, Greer & Remegio; C. mcguirei Grismer, Grismer, Wood & Chan; C. grismeri Wood, Quah, Anuar & Muin; C. flavolineata (Nicolls) and C. bayuensis Grismer, Grismer, Wood & Chan. This group is diagnosed by having the unique combination of an adult SVL ranging from mm; 8 13 supralabials; 7 10 infralabials; keeled ventral scales; 0 10 round precloacal pores; paravertebral tubercles; caudal tubercles not restricted to a single paravertebral row; keeled subcaudals; no median row of enlarged subcaudals; 1 5 postcloacal tubercles; no enlarged femoral, subtibial, or submetatarsal scales; and subdigital lamellae on the 4th toe. Cnemaspis selamatkanmerapoh sp. nov. differs from C. affinis, C. bayuensis, C. flavolineata, C. grismeri, C. harimau, C. mcguirei, and C. narathiwatensis in having one precloacal pore as opposed to lacking precloacal pores or having It differs from all species in the affinis group except C. pseudomcguirei in having tubercles only in the anterior section of the lateral caudal furrow as opposed to tubercles occurring throughout the furrow. Additional differences separating it from individual species are highlighted in Table 2. Cnemaspis selamatkanmerapoh sp. nov. is most closely related to C. bayuensis, a karst dwelling species from Kampung Bayu, Kelantan 75 km to north but separated from it on the basis of caudal tuberculation and the numbers of precloacal pores as described above. These species also have a 5.3% sequence divergence from one another. A NEW SPECIES OF KARST-ADAPTED CNEMASPIS Zootaxa 3746 (3) 2013 Magnolia Press 469

8 470 Zootaxa 3746 (3) 2013 Magnolia Press GRISMER ET AL.

9 Discussion The description of Cnemaspis selamatkanmerapoh sp. nov. is yet another new species in a growing list of karstadapted geckos from Peninsular Malaysia. More importantly however, this growing list of species underscores the conservation value of karst formations and their surrounding limestone forests and illuminates the fact that these regions harbor a significant portion of Malaysia s biodiversity. The conservation value of these habitats can no longer be ignored and as many as possible should be studied before they are systematically destroyed. Converting Gua Gunting and Gua Goyang into cement would not only drive C. selamatkanmerapoh sp. nov. and Cyrtodactylus sp. nov. to extinction, but would also eliminate a number of endemic plants and invertebrates (Kiew 1998). Karst regions should be protected and better studied by vertebrate systematists. If reptiles are an indication of the hidden diversity within these unique habitats, then karst regions may be some of the most biotically rich habitats in Peninsular Malaysia with a level of herpetological endemism approaching that of Malaysia s islands (see Chan et al. 2010; Grismer 2008, 2011a,b; Grismer et al. 2011). Terminating this biodiversity before it is discovered, described, and studied is not only illogical, it is tantamount to discarding a wrapped gift before it is opened and its value assessed. Acknowledgements For field assistance we thank the many individuals of the Save Merapoh Caves campaign. For the loan of specimens we are indebted to Kelvin K. P. Lim (ZRC). We also thank the Malaysian Nature Society for the financial and logistical support of this project. This research was supported in part by grants to LLG from the College of Arts and Sciences, La Sierra University, Riverside, California. References Alström, P., Davidson, P., Duckworth, J.W., Eames, J.C., Trai, T.L., Nguyen, C., Ollson, U., Robinson, C. & Timmins, R. (2010) Description of a new species of Phylloscopus warbler from Vietnam and Laos. Ibis, 152, Chan, K.O., van Rooijen, J., Grismer, L.L., Belabut, D., Akil, M.A.M.M., Jamaludin, R., Gregory, R. & Norhayati, A. (2010) First report on the herpetofauna of Pulau Pangkor, Perak, Malaysia. Russian Journal of Herpetology, 17, Grismer, L.L. (2008) A new species of insular skink (Genus Sphenomorphus Fitzinger 1843) from the Langkawi Archipelago, Kedah, West Malaysia with the first report of the herpetofauna of Pulau Singa Besar and an updated checklist of the herpetofauna of Pulau Langkawi. Zootaxa, 1691, Grismer, L.L. (2011a) Lizards of Peninsular Malaysia, Singapore and Their Adjacent Archipelagos. Edition Chaimiara, Frankfürt am Main, 728 pp. Grismer, L.L. (2011b) Field Guide to the Amphibians and Reptiles of the Seribuat Archipelago, Peninsular Malaysia. Edition Chaimira, Frankfurt am Main, 258 pp. Grismer, L.L., Chan, K.O., Nurolhuda, N. & Sumontha, M. (2008a) A new species of karst dwelling gecko (genus Cnemaspis Strauch 1887) from the border region of Thailand and Peninsular Malaysia. Zootaxa, 1875, Grismer, L.L., Grismer, J.L., Wood, P.L. Jr. & Chan, K.O. (2008b) The distribution, taxonomy, and redescription of the geckos Cnemaspis affinis (Stoliczka 1887) and C. flavolineata (Nicholls 1949) with descriptions of a new montane species and two new lowland, karst-dwelling species from Peninsular Malaysia. Zootaxa, 1931, Grismer, L.L., Grismer, J.L., Wood, P.L. Jr., Ngo, V.T. & Chan, K.O. (2011) Herpetology on the fringes of the Sunda Shelf: a discussion of discovery, taxonomy, and biogeography. Bonner Zoologische Monographien, 57, Grismer, L.L., Norhayati, A., Chan, K.O., Belabut, D., Muin, M.A., Wood, P.W. Jr. & Grismer, J.L. (2009) Two new diminutive species of Cnemaspis Strauch 1887 (Squamata: Gekkonidae) from Peninsular Malaysia. Zootaxa, 2019, Grismer, L.L., Sumontha, M., Cota, M., Grismer, J.L., Wood, P.L. Jr., Pauwels, O.S.G. & Kunya, K. (2010) A revision and redescription of the rock gecko Cnemaspis siamensis (Taylor 1925) (Squamata: Gekkonidae) from Peninsular Thailand with descriptions of seven new species. Zootaxa, 2576, Grismer, L.L., Wood, P.L. Jr., Quah, E.S.H., Shahrul, A., Muin, M.A. Sumontha, M., Norhayati, A., Bauer, A.M., Wangkulangkul, S., Grismer, J.L. & Pauwels, O.S.G. (2012) A phylogeny and taxonomy of the Thai-Malay Peninsula Bent-toed Geckos of the Cyrtodactylus pulchellus complex (Squamata: Gekkonidae): combined morphological and molecular analyses with descriptions of seven new species. Zootaxa, 3520, A NEW SPECIES OF KARST-ADAPTED CNEMASPIS Zootaxa 3746 (3) 2013 Magnolia Press 471

10 Jenkins, P.D., Kilpatrick, C.,William, C., Robinson, M.F. & Timmins, R.J. (2004) Morphological and molecular investigations of a new family, genus and species of rodent (Mammalia: Rodentia: Hystricognatha) from Lao PDR. Systematics and Biodiversity, 2, Kiew, R. (1998) Limestone, Quartzite and Ultramafic Vegetation. In: Soepadmo (Ed.), The Encyclopedia of Malaysia: Plants. Editions Didier Miller, Singapore, pp Komo, I. (1998a) The Karst Morphology of Langkawi. In: Sham (Ed.), The Encyclopedia of Malaysia: The Environment. Editions Didier Miller, Singapore, pp Komo, I. (1998b) Caves and cave Systems: The Mulu Caves. In: Sham (Ed.), The Encyclopedia of Malaysia: The Environment. Editions Didier Miller, Singapore, pp Macey, J. & Schulte, J. (1999) Molecular phylogenetics, trna evolution, and historical biogeography in anguid lizards and related taxonomic families. Molecular Phylogenetics and Evolution, 12, Price, L. (2001) Caves and Karst of Peninsular Malaysia. Gua Publications, Malaysia, 98 pp. Swofford, D.L. (2002) Paup*: Phylogenetic Analysis Using Parsimony (and Other Methods), Version 4.0. Sinauer Associates, Sunderland, Massachusetts. Tjia, H.D. (1998) Limestone and Karst Morphology. In: Sham (Ed.), The Encyclopedia of Malaysia: The Environment. Editions Didier Miller, Singapore, pp Wood, P.L. Jr., Quah, E.S.H., Anuar, S. & Muin, M.A. (2013) A new species of lowland karst dwelling Cnemaspis Strauch 1887 (Squamata: Gekkonidae) from northwestern Peninsular Malaysia. Zootaxa, 3691 (5), Woxvold, I.A., Duckworth, J.W. & Timmins, R.J. (2009) An unusual new bulbul (Passeriformes: Pycnonotidae) from the limestone karst of Lao PDR. Forktail, 25, Zootaxa 3746 (3) 2013 Magnolia Press GRISMER ET AL.