This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and

Transcription

1 This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier s archiving and manuscript policies are encouraged to visit:

2 Molecular Phylogenetics and Evolution 56 (2010) Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: Genetic structure, phylogeny, and biogeography of Brazilian eyelid-less lizards of genera Calyptommatus and Nothobachia (Squamata, Gymnophthalmidae) as inferred from mitochondrial DNA sequences Ana Carolina Siedchlag a, Maria Lúcia Benozzati a, José Carlos Passoni a, Miguel Trefaut Rodrigues b, * a Departamento de Genética e Biologia Evolutiva, Instituto de Biociências, Universidade de São Paulo, Brazil b Departamento de Zoologia, Instituto de Biociências, Universidade de São Paulo, Brazil article info abstract Article history: Received 23 October 2009 Revised 24 March 2010 Accepted 23 April 2010 Available online 29 April 2010 Keywords: Cyt b 12S 16S mtdna phylogeny Biogeography Divergence times Calyptommatus Nothobachia Gymnophthalmidae lizards São Francisco River sand dunes Brazil Calyptommatus and Nothobachia genera of gymnophthalmid lizards are restricted to sandy open habitats on São Francisco River margins, northeastern Brazil. Phylogenetic relationships and geographic distribution of the four recognized species of Calyptommatus were analyzed from partial mitochondrial cyt b, 12S, and 16S rrna genes sequencing, taking allopatric populations of the monotypic Nothobachia ablephara as the outgroup. In Calyptommatus a basal split separated C. sinebrachiatus, a species restricted to the eastern bank of the river, from the three other species. In this clade, C. confusionibus, found on western margin, was recovered as the sister group of the two other species, C. leiolepis and C. nicterus, from opposite margins. According to approximate date estimations, C. sinebrachiatus would have separated from the other congeneric species by my, and C. nicterus, also from eastern bank, would be diverging by my from C. leiolepis, the sister species on the opposite margin. C. confusionibus and C. leiolepis, both from western sandy areas, would be differentiating by my. Divergence times of about my were estimated for allopatric populations of Nothobachia restricted to western margin. Significant differences in 16S rrna secondary structure relatively to other vertebrates are reported. Distinct evolutionary patterns are proposed for different taxa in those sandy areas, probably related to historical changes in the course of São Francisco River. Ó 2010 Elsevier Inc. All rights reserved. 1. Introduction The neotropical lizard family Gymnophthalmidae comprises small animals which live in leaf litter or ground vegetation of forests and open areas; some are semiaquatic or fossorial. According to phylogenies (Presch, 1980; Pellegrino et al., 2001; Brandley et al., 2008) limb reduction seems to have originated independently multiple times in this family. One of the limb-reduced lineages is characterized by the presence of scincoid scales on body, eyelid loss in most genera, a reduced series of femoral pores, and a more pronounced reduction of forelimbs in regard to hindlimbs, among other remarkable fossorial adaptations (Rodrigues, 1991a). This radiation, the Gymnophthalmini, according to Pellegrino et al. (2001) is much more rich than previously reported (MacLean, 1974; Presch, 1980) due to the discovery of an undisclosed diversity associated with the continental dunes of the middle São Francisco River, in the morphoclimatic domain of the semiarid Brazilian * Corresponding author. Address: Departamento de Zoologia, Instituto de Biociências, Universidade de São Paulo, CP , CEP, São Paulo, SP, Brazil. Fax: address: mturodri@usp.br (M.T. Rodrigues). Caatinga (Rodrigues, 1991a,b,c, 1996; Rodrigues and Juncá, 2002). Among several other squamates endemic for this area, new genera were described for this group: Calyptommatus (4 species), Nothobachia (1), Procellosaurinus (2), Psilophthalmus (1), and Vanzosaura (1). The other genera of Gymnophthalmini are restricted to the Amazon (Tretioscincus and Gymnophthalmus), or broadly distributed in Cerrados and Caatingas (Micrablepharus), but not on dunes. More recently another new, monotypic, elongate, eyelid-less and limbreduced genus (Scriptosaura catimbau) was described for this radiation from a sandy area in the state of Pernambuco (Rodrigues and Santos, 2008). In this radiation, the sister relationships between the elongate and limb-reduced genera Calyptommatus and Nothobachia and their position as the most derived clade within Gymnophthalmini has been highly supported in all studies (Rodrigues, 1991c; Pellegrino et al., 2001; Benozzati and Rodrigues, 2003; Castoe et al., 2004). They are psammophilous fossorial lizards restricted to dunes or sandy habitats adjacent or close to the middle course of São Francisco River, in the state of Bahia (Rodrigues et al., 2001). Four species of Calyptommatus are presently admitted, all nocturnal. C. sinebrachiatus occurs on the sandy habitats at the right bank of the river in a set of geographically close localities, whereas /$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi: /j.ympev

3 A.C. Siedchlag et al. / Molecular Phylogenetics and Evolution 56 (2010) C. nicterus is known only from a place situated about 30 km apart, in the same bank. The two other species, C. leiolepis and C. confusionibus, occur on the opposite margin of São Francisco River. C. leiolepis is found in several areas in two distinct dune fields separated by a region of rocky soils approximately 150 km long: Alagoado, on northern dune field, also referred as Casanova dune field, and at Queimadas, Ibiraba, Mocambo do Vento, Ilha do Gado Bravo, and Barra, all on the southern dune field also referred as Xique-Xique dune field. C. confusionibus, from Toca da Cabocla in Serra das Confusões National Park, Piauí, is the only species occurring out of São Francisco drainage and its complex of continental dunes. Nevertheless, as the sandy areas where this species occurs are not distant from São Francisco dunes and are in the same direction of the northwestern winds responsible for building those dunes, it was suggested they have been in contact in the past as a result of more intense wind activities during cooler phases in the Pleistocene (Rodrigues et al., 2001). Nothobachia is a monotypic genus, diurnal, and similar in habitat and ecological requirements to Calyptommatus. N. ablephara is sympatric and syntopic with C. leiolepis at most localities, being restricted to sandy habitats on left bank of the river, on Casanova and Xique-Xique dune fields. Based on geomorphological and paleoclimatic data on the São Francisco sand dunes (Ab Saber, 1969; Tricart, 1974), Rodrigues proposed a vicariant model to explain the speciation of endemic pairs of closely related psammophilous species of tropidurids, gymnophthalmids, snakes, and amphisbaenians living in opposite banks of the river and showing the same geographic distribution (Rodrigues, 1986, 1991a,b,c,d). He hypothesized that the ancestral populations were bisected by São Francisco River after the last glacial period, about 12,000 years ago. According to this model, until the Pleistocene the river flowed into a paleolake and, at the end of the Würm Wisconsin glaciation, it found the way out to the Atlantic Ocean. More recently it was also argued that, although this paleolacustrine hypothesis could account for the speciation in the area, forsaken meanders of the river might be in the origin of those vicariant patterns (Rodrigues, 1996). Paleoclimatic and geomorphological data on this region support the model (Souza-Lima et al., 2005). Speciation timing in the neotropical region has been widely debated. The original idea considering tropical species richness as a result of a long-term process in stable environments was abandoned with the advent of the refuge hypothesis, and most of speciation was attributed to Quaternary events (Haffer, 1969, 2001). More recently, a growing evidence of pre-quaternary differentiation has been accumulated, attributing to tectonic, eustatic, orogenic events (Rull, 2006; Geurgas et al., 2008; Ribas et al., 2009) or to rivers (Pellegrino et al., 2005; Passoni et al., 2008) the barriers to gene flow. The advance of molecular phylogenetic and phylogeographic studies allowing inferences on divergence time of lineages have stimulated the controversy (Galewski et al., 2005; Carnaval et al., 2009). The rich squamate fauna of the Quaternary sand dunes of São Francisco River characterized by high degree of endemism in a relatively small area provides a great opportunity to contribute to this debate comparing evolutionary patterns among different taxa (Rodrigues, 1996; Rodrigues and Juncá, 2002). Previous morphological (Rodrigues, 1991a), allozymical (Martins, 1997), and karyotypical (Yonenaga-Yassuda et al., 1998) analyses could not resolve unequivocally phylogenetic relationships among the three Calyptommatus species known at the time, although the monophyly of the group was demonstrated in all them. Therefore, in the present study mitochondrial DNA sequencing data were used to obtain more precise estimations of phylogenetic relationships in Calyptommatus genus, taking N. ablephara as outgroup. Secondary structure of ribosomal RNAs was also used in molecular analyses. Nothobachia samples from different localities were available, so that phylogeographical pattern in this genus could be compared to that of sympatric populations of C. leiolepis, on western margin of São Francisco River. Approximate dates for vicariance events were proposed for both genera, allowing comparison to previous estimates for other lizards endemic in the area. 2. Materials and methods 2.1. Taxonomic sampling A sample of 26 individuals representing the four described species of Calyptommatus and eight individuals of N. ablephara were collected at 10 different localities in middle São Francisco sand dunes (Bahia), and from Serra das Confusões (Piauí). They were all assayed for a mitochondrial gene sequence encoding for part of cytochrome b (cyt b) protein. In this analysis, two individuals of Procellosaurinus erythrocercus were used as the outgroup (Rodrigues, 1991c). From those 34 ingroup specimens, DNA samples showing different cyt b haplotypes were also sequenced for 12S and 16S ribosomal RNAs (rrna) gene segments. Fig. 1 and Table 1 show, respectively, geographic distribution and size of analyzed samples DNA extraction DNA enriched in mitochondrial fraction was obtained according to Hillis and Davis (1986) and Dowling et al. (1990), as modified by Passoni et al. (2000). Field collected samples were stored at 196 C. Entire lizards weighting from 0.4 to 0.5 g approximately were pulverized to fine powder in liquid nitrogen, yielding approximately 3 4 lg of DNA enriched in mitochondrial fraction. Each individual was homogenized in 800 ll STES (0.01 M NaCl, 0.01 M Tris, 0.1 M EDTA, 0.25 M sucrose, ph 7.5) and then centrifuged for 5 min at 1200g at 4 C to pellet the nuclei. The supernatant was centrifuged at 23,000g for 20 min at 4 C for mitochondrial precipitation. The pellet was suspended in 250 ll STE (0.1 M NaCl, 0.01 M Tris, 0.1 M EDTA, ph 7.5), with 1% sodium dodecyl sulfate (SDS) and 10 U/ml proteinase K. After incubation for 2 h at 55 C, the preparation was extracted with one volume of phenol, and then with one volume of 24:1 chloroform: isoamyl alcohol solution. DNA was precipitated from the supernatant by the addition of 1/10 volume buffer (3 M NaCl, 0.25 M Tris, 0.1 M EDTA) and 2.5 volumes 100% ethanol at 20 C overnight. The DNA pelleted after 15 min centrifugation at 23,000 g at 4 C was washed in 70% ethanol, air dried and dissolved in ll TE (0.01 M Tris, M EDTA, ph 8.0), and stored at 20 C DNA amplification and sequencing Partial mitochondrial sequences of cyt b protein and of 12S and 16S rrna coding genes were amplified via polymerase chain reaction (PCR) in 25 or 50 ll reaction volumes containing ng DNA, 1 PCR buffer, 4 mm MgCl 2, 0.2 mm each dntp, 1 lm each primer, and 2.5 U AmpliTaq DNA Polymerase (Perkin-Elmer, Roche). Amplification primers and thermocycler conditions are specified in Table 2. Negative controls were made to avoid contamination. Amplification products were checked by electrophoresis on 0.8% agarose gel with 0.3 lg/ml ethidium bromide (the target fragment size was estimated from molecularweight markers). Products were cleaned with the Concert Rapid PCR Purification System or the Concert Rapid Gel Extraction System (Gibco-BRL Life Technologies) in cases of non-specific amplifications. Purified PCR products containing about 100 ng (cyt b) to 200 ng (ribosomal RNAs) of DNA in a final volume of 6 ll were utilized for sequencing using the Big Dye Terminator Ready-Reaction Kit (Perkin-Elmer Applied Biosystems). A Perkin-Elmer-2400

4 624 A.C. Siedchlag et al. / Molecular Phylogenetics and Evolution 56 (2010) Fig. 1. Sand dune region of middle São Francisco River, Brazil. Localities: (1) Alagoado; (2) Queimadas; (3) Vacaria; (4) Ibiraba; (5) Mocambo do Vento; (6) Ilha do Gado Bravo; (7) Lagoa de Itaparica; (8) Gameleira do Assuruá; (9) Santo Inácio; (10) Barra; (11) Toca da Cabocla (Serra das Confusões). Table 1 Samples of Calyptommatus and Nothobachia from different localities of São Francisco River sand dunes in Bahia, and in Piauí (), analyzed for cyt b, 12S, and 16S mitochondrial gene segments. Procellosaurinus erythrocercus was used as outgroup in cyt b analyses. Species Locality Mitochondrial gene marker Left margin Right margin Cyt b 12S 16S C. leiolepis Alagoado Mocambo do Vento Ilha do Gado Bravo Queimadas Barra Ibiraba C. nicterus Vacaria C. sinebrachiatus Santo Inácio Gameleira do Assuruá Lagoa de Itaparica C. confusionibus Toca da Cabocla* N. ablephara Alagoado Queimadas Mocambo do Vento Ibiraba P. erythrocercus Queimadas 1 Toca da Cabocla* 1 thermocycler was used with the following parameters (time in minutes:seconds): 96 C (0:10), 50 C (0:05), 60 C (4:00) 25 (0:05 at 96 C before first cycle). Both strands of each segment were sequenced for each specimen. An ABI PRISM 310 Genetic Analyzer (Perkin-Elmer Applied Biosystems) was used and the sequences were edited using Sequence Navigator (Perkin-Elmer Applied Biosystems). The obtained cyt b and ribosomal RNA gene sequences were deposited in GenBank. For distance analyses, the substitutional model that best fit each data set was found employing PAUP* 4.0b10 (Swofford, 2002) and MOD- ELTEST 3.06 (Posada and Crandall, 1998) programs Phylogenetic analyses Multiple alignments were accomplished using Clustal X 1.64b (Thompson et al., 1997). For 12S and 16S segments, gap-opening values of 6, 8, 10, and 12, and a gap-extension value of 0.05 were used to assess the effects on sequence alignment according to Gatesy et al. (1993), Wiens and Reeder (1997), and Reeder and Montanucci (2001). Regions of ambiguous alignments were excluded. 12S rrna secondary structure models for a scincoid lizard (Hickson et al., 1996), for the lizard family Opluridae (Titus and Frost, 1996) and for hyperoliid treefrogs (Richards and Moore,

5 A.C. Siedchlag et al. / Molecular Phylogenetics and Evolution 56 (2010) Table 2 List of PCR and sequencing primers, and a summary of the PCR conditions for all three gene segments. Primer label Sequence ( ) PCR conditions: denaturation/annealing/extension 35 * B1 a CCATCCAACATCTCAGCATGATGAAA 95 C (1:00), 52 C (1:00), 72 C (2:00) B2 a (cyt b) GCCCCTCAGAATGATATTTGTCCTCA L1091 b AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT 95 C (1:00), C (1:00), 72 C (2:00) H1478 b (12S) TGACTGCAGAGGGTGACGGGCGGTGTGT Ar-5 0c CAAACCCCGCCTGTTTACCAAAAACAT 95 C (1:00), C (1:00), 72 C (2:00) Br-3 0c (16S) CCGGTCTGAACTCAGATCACGT Incubation times are given in parentheses, in minutes:seconds. References for primers are a Fu et al. (1997), b Kocher et al. (1989), and c Palumbi (1996). * At 95 C for 5:00 before first cycle and for 10:00 at 72 C after the last cycle. 1996), and the 16S rrna secondary structure models for humans (Gutell and Fox, 1988) and for mammals (Burk et al., 2002) were considered, along with 12S and 16S models for Eurolophosaurus lizards (Passoni et al., 2008). Cyt b sequences were translated into amino acid sequences to check for unexpected occurrences of stop codons, which might indicate that pseudogenes had been amplified (Sorenson and Fleischer, 1996; Zhang and Hewitt, 1996). The degree of saturation in each gene segment was investigated by plotting proportions of transitions and transversions against the pairwise Lake 94 corrected distances employing DAMBE program (Xia, 2000; Xia and Xie, 2001). For protein-coding segments these analyses were accomplished considering all codon positions, the first and second codon positions together, and the third position separately. Analyses of transition and transversion substitutions at third codon positions showed some saturation in both cases. At 12S and 16S ribosomal gene sequences no saturation was detected. The partition homogeneity test (Farris et al., 1994) using PAUP* (1000 replicates) indicated that the three gene regions could be analyzed together. Phylogenetic signal was detected for the combined data set using the g 1 statistic (Sokal and Rohlf, 1981; Hillis, 1991; Huelsenbeck, 1991; Hillis and Huelsenbeck, 1992), which measured the skewness of the distribution of 10,000 random cladograms. Phylogenetic analyses were conducted on combined cyt b and ribosomal sequences, taking only one specimen from each of the 15 sampled populations. PAUP* 4.0b10 (Swofford, 2002) was used in maximum parsimony (MP), maximum-likelihood (ML), and neighbor joining (NJ) analyses. Cyt b sequences of two or more individuals from different sampled regions (see Table 1) were also analyzed separately to evaluate genetic structure of main populations of Calyptommatus and Nothobachia, taking P. erythrocercus as outgroup. Parsimony trees were constructed from combined data set using a branch-and-bound search, and the confidence tested by 1000 bootstrap replicates (Felsenstein, 1985). Due to saturation on third codon positions, MP analyses were done considering three different weightings for those characters, 0, 0.5, and 1. In ribosomal segments, gap was treated as a fifth character state. Maximumlikelihood (ML) heuristic searches and NJ tree estimates were based on the best evolutionary model for each data set found by PAUP* 4.0b10 (Swofford, 2002) and MODELTEST 3.7 (Posada and Crandall, 1998) programs. The substitution model for all three concatenated segments was found to be the TrN+G (Tamura and Nei, 1993), with gamma shape parameter and no invariable sites. In ML analyses, tree bisection reconnection (TBR) branch swapping, MULTREES, and random addition of sequences (100 replicates) were employed. Bootstrap values (BVs) were estimated by 100 replicates with 10 replicates of random addition of sequences. In NJ analyses, BVs were calculated by 1000 replicates Divergence time estimations The hypothesis of rate constancy was tested by the likelihoodratio test (Muse and Weir, 1992) for the three concatenated gene sequences, and for the three possible couples of sequences (cyt b/ 12S, cyt b/16s and 12S/16S) using PAUP* to calculate log likelihood values of trees obtained enforcing the molecular clock and trees calculated without this assumption. PAUP* and MODELTEST were used to select the most appropriate model of evolution for each data set. Evolutionary rate constancy was detected for the three pairs of sequences, but only when the less frequent haplotype of C. sinebrachiatus from Santo Inácio (SI2) was included in the analyses. A distance matrix was constructed from corrected genetic distances and divergence times estimated for combined cyt b/16s data set (616 bp; P = 0.001). ML distance matrixes were constructed from this data set, and also for cyt b haplotypes taking P. erythrocercus as the outgroup (P = 0.01). 3. Results 3.1. Population structure Calyptommatus and Nothobachia DNA samples were firstly assayed for mitochondrial cyt b sequences in order to evaluate population structure in both genera. Twenty-three different haplotypes were identified from two or more specimens of main sampled localities. Analyses were based on nucleotide divergence estimations and MP phylogenetic analysis (not shown) of those 23 different cyt b haplotypes consisting of 242 cyt b precisely aligned characters, taking two different haplotypes of P. erythrocercus as the outgroup. These sequences were deposited in GenBank under Accession Nos.: GU952800, HM HM A consensus MP cladogram (63 of the 73 variable sites were informative under parsimony) was estimated from seven most parsimonious trees, considering 0.5 weighting for third cyt b codon positions (L = 82; CI = 0.58; RI = 0.83). Calyptommatus and Nothobachia were recovered as monophyletic genera, with 92% and 90% BVs, respectively. In N. ablephara, the haplotype identified in three specimens from Alagoado (see Fig. 1) was shown as a sister taxon (58% BV) to those from Queimadas, Mocambo do Vento, and Ibiraba localities, with nucleotide differentiation of between them. In each of these three localities on southern dune field, different haplotypes diverged from 0.0 to In Calyptommatus, cyt b MP analysis recovered two major clades, one of them composed of five haplotypes identified in eight specimens of C. sinebrachiatus (97% BV), and the other one of the 14 haplotypes identified in the remaining three species, C. nicterus, C. leiolepis, and C. confusionibus, grouped in a polyphyly (63% BV). In C. sinebrachiatus clade, the five specimens collected in Santo Inácio showed two haplotypes with 0.02 of nucleotide divergences between them, the most frequent one diverging by 0.01 from the haplotypes of Lagoa de Itaparica and Gameleira do Assuruá. The second clade was composed by the haplotypes identified in the three other Calyptommatus species. In C. leiolepis, 10 haplotypes were identified in 15 specimens: Alagoado (3); Queimadas (2); Barra (1); Ibiraba (2); Mocambo do Vento (1); and Ilha do Gado

6 626 A.C. Siedchlag et al. / Molecular Phylogenetics and Evolution 56 (2010) Bravo (1). In this species, estimated intrapopulation divergences were (Ibiraba), (Queimadas) and (Alagoado). Interpopulation nucleotide divergences ranged from 0.0 between Ibiraba and Ilha do Gado Bravo, to about 0.07 between Queimadas haplotypes and those of the other four localities on southern dune fields. In the two remaining species, C. nicterus (Vacaria) and C. confusionibus (Serra das Confusões), two different haplotypes were grouped in each clade, respectively, with 96% and 99% BVs (nucleotide divergences of in C. nicterus and in C. confusionibus) Molecular characterization Molecular and phylogenetical analyses were based on cyt b results: only the individuals of Calyptommatus and Nothobachia showing the most frequent cyt b haplotypes were considered in ribosomal analyses. Ribosomal gene sequences have been deposited in GenBank under Accession Nos.: HM HM for 12S; HM HM for 16S (accession numbers of cyt b sequences are given in Section 3.1). Protein-coding sequences had no indels or premature stop codons, and ribosomal sequences apparently code for rrnas with stable secondary structures, suggesting that the three sequenced DNA segments correspond to functional mitochondrial genes (see Zhang and Hewitt, 1996). Nucleotide frequencies (Table 3) show the bias against guanine on light strands of protein-coding sequences, and the bias against guanine and thymine on light strands of the ribosomal sequences. Those analyses corroborate the assumption that the analyzed sequences do not represent nuclear-integrated copies of mitochondrial genes (e.g. Zhang and Hewitt, 1996; Macey et al., 1997; Ast, 2001). Ribosomal sequences were precisely aligned, and stem and loop regions could be identified. No ambiguously aligned characters were identified in the analyzed 294 bp of 12S rrna gene sequences (Appendix I). Four insertion/deletion events (indels) corresponding to characters 107, 171, 172, and 176 were identified, which did not disrupt the RNA secondary structure. Only one of them is located in a paired region of the RNA molecule (character 176 in 42 0 region) but it did not compromise the 42/42 0 stem structure (see Hickson et al., 1996; Titus and Frost, 1996; Passoni et al., 2008). In 388 bp of 16S ribosomal gene sequences (Appendix II), 14 characters were ambiguously aligned and, therefore, unconsidered in phylogenetic analyses. Twelve indels (characters 15, 196, 250, 271, 272, 273, 274, 287, 288, 289, 290, 353) were identified. Five of them were located in paired regions ( and 353) but did not disrupt 16S secondary structure. et al., 1994) using PAUP* (1000 replicates) detected no significant heterogeneity among those gene segments. The g 1 statistic (Hillis and Huelsenbeck, 1992) estimated for the total data matrix was 1.119, indicating the presence of phylogenetic signal. Therefore, main phylogenetic analyses were carried on this combined data consisting of 910 precisely aligned sites, with 110 of the 154 variable sites being informative under parsimony. Two most parsimonious trees were obtained from MP analyses of 15 combined haplotypes identified in Calyptommatus and Nothobachia samples, considering a 0.5 weighting for third codon positions in cyt b sequences (L = 178; CI = 0.80; RI = 0.88). Fig. 2 shows the strict consensus MP cladogram, with bootstrap supports P50% (1000 replicates) indicated on the branches. Phylogeny of Calyptommatus could be resolved in MP analysis, although with low BVs in some branches. Monophyly of both genera was corroborated with 100% bootstrap. NJ and ML analyses using the TrN+G model with an estimated gamma distribution shape parameter of and no invariable sites (Tamura and Nei, 1993) also confirmed their monophyly with 100% BV, as indicated below the branches in Fig. 2. Nevertheless, both methods grouped Calyptommatus species in polytomies (not shown). MP analysis recovered two major clades in Calyptommatus. One of them with 100% BV is composed of C. sinebrachiatus haplotypes from three different locations in a southern dune field on right margin of São Francisco 3.3. Phylogeny Phylogenetic analyses were based on mitochondrial gene sequences composed of 242 bp from cyt b, 294 bp from 12S rrna, and 374 bp from 16S rrna. The partition homogeneity test (Farris Table 3 Mean base frequencies, v 2 and P values in homogeneity test among taxa for each DNA segment. Gene Cyt b 12S 16S Bp a %A %C %G %T v P a Number of characters. Fig. 2. Tree estimated for combined mitochondrial gene sequences (cyt b, 12S, and 16S) in Calyptommatus and Nothobachia gymnophthalmids. Bootstrap values correspond to MP (bold), ML (italics), and NJ (regular) analyses.

7 A.C. Siedchlag et al. / Molecular Phylogenetics and Evolution 56 (2010) River (see Fig. 1). This group was also recovered with 100% BV in NJ analysis. The other MP clade is composed of C. nicterus, and the two species on the opposite margin, C. leiolepis and C. confusionibus, with 83% bootstrap. In this group, C. confusionibus was recovered as the sister taxon to a clade composed of C. nicterus and the six C. leiolepis haplotypes from six different localities, although with lower bootstrap support (62%). Populations of N. ablephara also showed two differentiated clades in MP analyses. The haplotype of Alagoado, on northern dune field, was recovered sister to a clade consisting of haplotypes from Queimadas, Mocambo do Vento, and Ibiraba, all localities on southern dunes, with high bootstrap support (93%). NJ analyses also evidenced those two groups with a 71% BV (see Fig. 2) Divergence times Approximate divergence times were estimated based on corrected genetic distances for 16 concatenated cyt b/16s gene sequences (see Section 2.3), considering an evolutionary rate of 2% sequence divergence per million of years. Table 4 shows pairwise distances for Calyptommatus and Nothobachia haplotypes (616 bp), corrected by the GTR+G substitutional model (Rodríguez et al., 1990), as selected by MODELTEST, and rough divergence times estimated for main taxa. In Calyptommatus, nucleotide divergences estimated for conspecific haplotypes from different localities varied from to in C. sinebrachiatus, and from to in C. leiolepis, the highest values being detected between C. leiolepis of Queimadas and those of Mocambo do Vento and Ilha do Gado Bravo. Interspecific divergences were estimated in about , between C. sinebrachiatus and the three other species, in between C. leiolepis and C. nicterus, and in between C. confusionibus haplotype and those of C. leiolepis and C. nicterus. In the monospecific Nothobachia, on left margin of São Francisco River, the highest divergences have been detected between population from Alagoado, on northern dunes, and those from Queimadas (0.061), Mocambo do Vento (0.065), and Ibiraba (0.080), all on southern dune fields. According to present estimates, C. sinebrachiatus would have diverged from the three other congeners by my. C. confusionibus (Piauí) would have diverged by my from C. leiolepis, the geographically closer species in southern dunes, on left margin of São Francisco River (Bahia). C. nicterus, from eastern margin of the river, would be diverging by my from C. leiolepis, the sister species on the opposite margin. Populations of C. leiolepis from northern and those from southern dune fields on west margin would have diverged by approximately my. Genetic differentiation between N. ablephara specimens from those two fields suggests they have diverged by my. According to present estimates, the ancestor of Nothobachia and Calyptommatus would date from approximately 9 to 15 my. 4. Discussion Information about population structure in both genera was obtained from cyt b analyses, taking two specimens of P. erythrocercus as outgroup. These sequencing data evidenced genetically divergent populations in different localities on São Francisco dune fields. They corroborated previous data based on 41 mitochondrial restriction sites (Arruda Campos, 1999) in which monophyletic units were shown in samples of Calyptommatus and Nothobachia from some of those localities. In N. ablephara nucleotide divergences estimated between haplotypes from Alagoado and those from southern dune fields were of about , 10 times higher than divergences estimated for haplotypes from different southern locations ( ). Otherwise, in C. leiolepis divergences estimated between haplotypes of Alagoado and those from southern dunes were of , of the same order than divergences estimated between Queimadas and the other four southern haplotypes ( ). Genetic distances based on combined cyt b and 16S sequences corroborated this pattern of differentiation (see Table 4). Divergences between haplotype of C. leiolepis from Alagoado and those from southern dune fields were lower than the estimated for sympatric N. ablephara populations. A similar pattern had also been suggested by previous mitochondrial RFLP data (Arruda Campos, 1999). Regarding rrna second structure, in both Calyptommatus and Nothobachia the analyzed 16S rrna sequence showed three unpaired regions different in length regarding literature data. The 40/40 0 loop and the helix between 42 0 and 44 stem regions (see Appendix II) are smaller than corresponding helixes in mammals (Gutell and Fox, 1988; Burk et al., 2002) and in Eurolophosaurus lizards (Passoni et al., 2008). On the other hand, the helix between 44 0 and 45 stem regions was longer than in mammals and Eurolophosaurus. A more comprehensive analysis of these characters, including other representatives of eyelid-less gymnophthalmids, would be valuable to a better characterization of the group. Phylogenetic analyses based on combined cyt b, 12S and 16S mitochondrial sequences (see Fig. 2) corroborated the monophyly of Calyptommatus genus with 100% of BV, taking Nothobachia as Table 4 Maximum-likelihood percent distance matrix (GTR+G model) for cyt b/16s combined data (below diagonal) and divergence time estimates for main taxa (in bold, above diagonal). No, Nothobachia ablephara; Csi, Calyptommatus sinebrachiatus; Cle, C. leiolepis; Cni, C. nicterus; Cco, C. confusionibus. NoAla NoQue NoMVe NoIbi CsiSI1 CsiSI2 CsiGAs CsiLIt CleAla CleQue CleIbi CleMVe CleBar CleIGB CniVac CcoSCo NoAla NoQue NoMVe NoIbi CsiSI CsiSI CsiGAs CsiLIt CleAla CleQue CleIbi CleMVe CleBar CleIGB CniVac CcoSCo Localities: Ala, Alagoado; Que, Queimadas; Ibi, Ibiraba; MVe, Mocambo do Vento; SI, Santo Inácio; LIt, Lagoa de Itaparica; GAs, Gameleira do Assuruá; IGB, Ilha do Gado Bravo; Bar, Barra; Vac, Vacaria; SCo, Serra das Confusões (Piauí).

8 628 A.C. Siedchlag et al. / Molecular Phylogenetics and Evolution 56 (2010) outgroup. Consistent estimates were also obtained at species level. The species on right margin, C. sinebrachiatus, was shown as the basal taxon to a clade comprising C. leiolepis, C. nicterus, and C. confusionibus. In this clade, the first two are found in sandy habitats on opposite margins of São Francisco River (Bahia) while C. confusionibus occurs in Piauí and is restricted to left bank (see Fig. 1). C. nicterus and the six different populations of C. leiolepis were grouped in a monophyletic clade, although with lower bootstraps (60 70%). C. confusionibus was recovered as the sister species to this group, with about 80% BVs. Present sequencing data could, therefore, elucidate phylogenetic relationships between C. nicterus and the two other known species, C. sinebrachiatus and C. leiolepis, which remained ambiguous in all previous studies on this genus (Rodrigues, 1991a; Martins, 1997; Yonenaga-Yassuda et al., 1998; Arruda Campos, 1999). In N. ablephara our results corroborate previous data showing a high genetic differentiation between populations of Alagoado and those on southern dune fields. This pattern was also described for populations of the tropidurid Eurolophosaurus divaricatus, also restricted to dunes on left bank of São Francisco River (Passoni et al., 2000, 2008). In this genus, mitochondrial cit b, COI, and 12S and 16S ribosomal gene sequencing showed two differentiated clades corresponding to northern and southern dune populations, and a taxonomic reevaluation of species limits of E. divaricatus was suggested (Passoni et al., 2008). In Nothobachia similar considerations might be done, as genetic divergences estimated between Casanova and Xique-Xique dune fields were of the same order than those estimated for different species in Calyptommatus (see Table 4). On this basis we strongly suggest a reexamination of specimens from those localities to check the possible existence of an overlooked undescribed species. Divergence time estimations are presently proposed for vicariance events in Calyptommatus and Nothobachia, based on concatenated cyt b and 16S rrna, the longer analyzed gene sequence shown to be evolving according to the molecular clock hypothesis. To the extent that an mtdna molecular clock is reliable, branch points in molecular phylogenies could be dated (Brown et al., 1979; Shields and Wilson, 1987), yielding at least crude assessment of whether branching times are consistent with geologically dated vicariant events (Bermingham and Avise, 1986). Even though fossils are absent and geomorphological records are poorly known for middle São Francisco River sandy dunes, it is worthwhile to estimate preliminary dates for differentiation in those lizards, and compare it with recent estimations for endemic fauna of those dune fields (Benozzati and Rodrigues, 2003; Pellegrino et al., 2005; Passoni et al., 2008). Most of these estimates have considered evolutionary rates of about 2% of sequence divergence per million years, based on previous data on lizard mtdna (Thorpe et al., 1994; González et al., 1996; Carranza et al., 2000). Therefore, rough divergence times have been proposed for the studied genera also considering a 2% evolutionary rate. The Calyptommatus/Nothobachia ancestor would date from Miocene, about 9 15 my. C. sinebrachiatus would have diverged from nicterus/leiolepis/confusionibus complex by approximately my ago. C. nicterus, from the right margin of Rio São Francisco, would be diverging from C. leiolepis, its sister species from the opposite margin, only by approximately my. Furthermore, as shown in Table 4, C. leiolepis population from Alagoado in northern dune fields would be diverging from those on the southern dunes by my. This is interesting because similar divergence times were found between Queimadas and the other four southern C. leiolepis populations, all on Xique-Xique dunes ( my). This pattern differs from that of N. ablephara populations of northern and southern dune fields, which would have differentiated by my ago, about 10 times earlier than its populations on southern dune fields. Divergence times of the same order ( my) were also reported for different populations of E. divaricatus inhabiting northern and southern dune fields (Passoni et al., 2008). Although several alternatives exist, we have no reliable hypothesis to explain the contrasting different patterns of C. leiolepis and N. ablephara distributions in the area. Except for the greater abundance of Calyptommatus in Xique-Xique dune field, both species live in the same areas, are ecologically similar and have apparently homogeneous distributions within sandy habitats of southern and northern dune fields. Incomplete lineage assorting is a possibility and, in this case, nuclear gene sequencing could resolve the issue. Upstream gene flow in Calyptommatus could be admitted if we consider that most of the area was inundated in 1975 during the filling of the Sobradinho reservoir. The hypothesis that Queimadas, located in the northern area of southern dune field, has been formerly isolated and only more recently incorporated to the Xique- Xique dune field could not be ignored too. Rough date estimates were proposed for the whole radiation of Gymnophthalmini in São Francisco River dunes based on mitochondrial DNA restriction-site data (Benozzati and Rodrigues, 2003), in which Nothobachia and Calyptommatus were included as the most derived clade. According to their estimates considering a 2% my evolutionary rate, those microteiids would have diverged from a common ancestor some 7 8 my ago, and the sand dune radiation would date of about 2 3 my. Similar divergence times had also been previously estimated for different populations of Calyptommatus and Nothobachia based on mitochondrial RFLP data (Arruda Campos, 1999). Present sequencing data suggest the evolutionary history of Calyptommatus was characterized by a complex and alternate pattern of cladogenesis involving sandy habitats on opposite margins of São Francisco River. The observed pattern strongly suggests that the river led to speciation, isolating in a basal event Santo Inácio area in the right margin from all other regions on left margin. In the state of Piauí, sandy habitats of the Paraiba River drainage are also situated not far from the left bank of São Francisco River, and are closely related to sandy habitats of its left and right margins. Present distribution of C. sinebrachiatus and C. leiolepis, as well as that of C. nicterus and C. leiolepis, occurring in adjacent banks on opposite margins, suggests this hypothesis. Likewise, an apparently isolated population of C. leiolepis occurring at Ilha do Gado Bravo, a large river island between Santo Inácio and Ibiraba, suggests that similar islands could have been the scenario for differentiation, or even areas to transfer species to opposite sides, driven by changes in the course of the river. The presence of a new species of lizard genus Ameiva at Ilha do Gado Bravo, related to the widespread Ameiva ameiva in both sides of the river, gives support to this idea (Rodrigues et al., 2005). Pleistocene refugia are commonly evoked to explain the differentiation and present day distribution of closed related, largely allopatric species. For South America, the main model has been of forest refugia established during Pleistocene drought cycles (Haffer, 1969; Vanzolini and Williams, 1981). Historical geomorphology of those sandy regions has been improved in the last years, but it still encompasses timescales of thousands and not millions of years ago (see Cartelle and Hartwig, 1996; Barreto et al., 1999). Divergence times estimated for radiations of the microteiid and tropidurid lizards living in this area are similar, of the order of a few million years, although more recent events in Calyptommatus and Nothobachia could be attributed to the Pleistocene as previously suggested (Benozzati and Rodrigues, 2003; Passoni et al., 2008). As a final remark we would like to point out the puzzling absence of Nothobachia on the right bank of São Francisco River. Considering the sister relationship, sympatry and shared ecological requirements of Nothobachia and Calyptommatus it would be reasonable to suppose they have been submitted to the same histori-

9 A.C. Siedchlag et al. / Molecular Phylogenetics and Evolution 56 (2010) cal vicissitudes in their occurrence areas. We hope that a more comprehensive phylogeny including more extensive molecular data, and representatives of the whole Gymnophthalmini radiation in the region, might illuminate further this issue as well as reveal new evolutionary patterns for its fauna. Acknowledgments Authors thank the Brazilian agencies Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) for financial support. We also thank D. Pavan, F.F. Curcio, J.M. Martins, P.L.B. Rocha, R. Moraes, G. Skuk, R.M.L. Santos, R. Villela, and J. Roscito for help in field, and J. Cassimiro and M. Teixeira Jr. for help with figures. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi: /j.ympev References Ab Saber, A.N., Participação das superfícies aplainadas nas paisagens do nordeste brasileiro. Geomorfologia (São Paulo) 19, Arruda Campos, C.V., Caracterização de lagartos microteídeos do gênero Calyptommatus (Squamata, Gymnphthalmidae) através da análise de fragmentos de restrição do DNA mitocondrial. M.S. Thesis, Universidade de São Paulo, São Paulo. Ast, J.C., Mitochondrial DNA evidence and evolution in Varanoidea (Squamata). Cladistics 17, Barreto, A.M.F., Suguio, K., Oliveira, P.E., Tatumi, S.H., O campo de dunas inativas do médio Rio São Francisco, Bahia. In: Schobbenhaus, C., Campos, D.A., Queiroz, E.T., Winge, M., Berbert-Born, M.L.C. (Eds.), Sítios Geológicos e Paleontológicos do Brasil. Available from: < sitio056/sitio056.htm/>. Benozzati, M.L., Rodrigues, M.T., Mitochondrial restriction-site characterization of a Brazilian group of eyed-less Gymnophthalmidae lizards. J. Herpetol. 37 (1), Bermingham, E., Avise, J.C., Molecular zoogeography of freshwater fishes in the southeastern United States. Genetics 113, Brandley, M.C., Huelsenbeck, J.P., Wiens, J.J., Rates and patterns in the evolution of snake-like body form in squamate reptiles: evidence for repeated re-evolution of lost digits and long-term persistence of intermediate body forms. Evolution 1, 23. Brown, W.M., George Jr., M., Wilson, A.C., Rapid evolution of animal mitochondrial DNA. Proc. Natl. Acad. Sci. USA 76, Burk, A., Douzery, E.J.P., Springer, M.S., The secondary structure of mammalian mitochondrial 16S rrna molecules: refinements based on a comparative phylogenetic approach. J. Mam. Evol. 9 (3), Carnaval, A.C., Hickerson, M.J., Haddad, C.F.B., Rodrigues, M.T., Moritz, C., Stability predicts genetic diversity in the Brazilian Atlantic Forest hotspot. Science 323, Carranza, S., Arnold, E.N., Mateo, J.A., López-Jurado, L.F., Long-distance colonization and radiation in gekkonidae lizards, Tarentola (Reptilia: Gekkonidae), revealed by mitochondrial DNA sequences. Proc. R. Soc. Lond. B 267, Cartelle, C., Hartwig, W.C., Macacos sul-americanos: ossos que são um verdadeiro tesouro. Ciência Hoje 21 (125), Castoe, T.A., Doan, T.M., Parkinson, C.L., Data partitions and complex models in Bayesian analysis: The phylogeny of gymnophthalmid lizards. Syst. Biol. 53, Dowling, T.E., Moritz, C., Palmer, J.D., Nucleic acids: II. Restriction site analyses. In: Hillis, D.M., Moritz, C. (Eds.), Molecular Systematics. Sinauer Associates, Sunderland, MA, pp Farris, J.S., Kallersjo, M., Kluge, A.G., Bult, C., Testing significance of incongruence. Cladistics 10, Felsenstein, J., Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, Fu, J., Murphy, R.W., Darevsky, I.S., Toward the phylogeny of Caucasian rock lizards: implications from mitochondrial DNA gene sequences (Reptilia: Lacertidae). Zool. J. Linn. Soc. 121, Galewski, T., Mauffrey, J.F., Leite, Y.L.R., Patton, J.L., Douzery, E.J.P., Ecomorphological diversification among South American spiny rats (Rodentia; Echimyidae): a phylogenetic and chronological approach. Mol. Phylogenet. Evol. 34 (3), Gatesy, J., Desalle, R., Wheeler, W., Alignment-ambiguous nucleotide sites and the exclusion of systematic data. Mol. Phylogenet. Evol. 2, Geurgas, S.R., Rodrigues, M.T., Moritz, C., The genus Coleodactylus (Sphaerodactylinae, Gekkota) revisited: a molecular phylogenetic perspective. Mol. Phylogenet. Evol. 49, González, P., Pinto, F., Nogales, M., Jiménez-Asensio, J.J., Hernández, M., Cabrera, V.M., Phylogenetic relationships of the Canary Islands endemic lizard genus Gallotia (Sauria: Lacertidae), inferred from mitochondrial DNA sequences. Mol. Phylogenet. Evol. 6, Gutell, R.R., Fox, G.E., A compilation of large subunit RNA sequences presented in a structural format. Nucleic Acids Res. 16 (Suppl.), r175 r269. Haffer, J., Speciation in Amazonian forest birds. Science 165, Haffer, J., Hypothesis to explain the origin of species in Amazonia. In: Vieira, I.G.C., Silva, J.M.C., Oren, D.C., d Incao, M.A. (Eds.), Diversidade Biológica e Cultural da Amazônia. Museu Paraense Emílio Goeldi, Belém, Pará. Hickson, R.E., Simon, C., Cooper, A., Spicer, G.S., Sullivan, J., Penny, D., Conserved sequence motifs, alignment, and secondary structure for the third domain of animal 12S rrna. Mol. Biol. Evol. 13 (1), Hillis, D.M., Discriminating between phylogenetic signal and random noise in DNA sequences. In: Miyamoto, M.M., Cracraft, J. (Eds.), Phylogenetic Analysis of DNA Sequences. Oxford University Press, New York, pp Hillis, D.M., Davis, S.K., Evolution of ribosomal DNA: fifty million years of recorded history in the frog genus Rana. Evolution 40, Hillis, D.M., Huelsenbeck, J.P., Signal, noise, and reliability in molecular phylogenetic analyses. J. Hered. 83, Huelsenbeck, J.P., Tree-length distribution skewness: an indicator of phylogenetic information. Syst. Zool. 40, Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Pääbo, S., Villablanca, F.X., Wilson, A.C., Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proc. Natl. Acad. Sci. USA 86, Macey, J.R., Larson, A., Ananjeva, N.B., Papenfuss, T.J., Evolutionary shifts in three major structural features of the mitochondrial genome among iguanian lizards. J. Mol. Evol. 44, MacLean, W.P., Feeding and locomotor mechanisms of teiid lizards: functional morphology and evolution. Pap. Avulsos Zool. (São Paulo) 27 (15), Martins, J.M., Estudo alozímico de um grupo de lagartos gimnoftalmídeos (Squamata: Gymnophthalmidae). Ph.D. Thesis, Universidade de São Paulo, São Paulo. Muse, S.V., Weir, B., Testing for equality of evolutionary rates. Genetics 132, Palumbi, S.R., Nucleic acids: II. The polymerase chain reaction. In: Hillis, D.M., Moritz, C., Mable, B.K. (Eds.), Molecular Systematics, second ed. Sinauer Associates, Sunderland, MA, pp Passoni, J.C., Benozzati, M.L., Rodrigues, M.T., Mitochondrial DNA polymorphism and heteroplasmy in populations of the three species of Tropidurus of the nanuzae group (Squamata, Tropiduridae). Genet. Mol. Biol. 23 (2), Passoni, J.C., Benozzati, M.L., Rodrigues, M.T., Phylogeny, species limits, and biogeography of the Brazilian lizards of the genus Eurolophosaurus (Squamata: Tropiduridae) as inferred from mitochondrial DNA sequences. Mol. Phylogenet. Evol. 46, Pellegrino, C.K.M., Rodrigues, M.T., Yonenaga-Yassuda, Y., Sites Jr., J.W., A molecular perspective on the evolution of South American microteiid lizards (Squamata, Gymnophthalmidae), and a new classification for the family. Biol. J. Linn. Soc. Lond. 74, Pellegrino, C.K.M., Rodrigues, M.T., Sites Jr., J.W., Phylogeography and species limits in the Gymnodactylus darwinii complex (Gekkonidae, Squamata): genetic structure coincides with river systems in the Brazilian Atlantic Forest. Biol. J. Linn. Soc. Lond. 85, Posada, D., Crandall, K.A., Modeltest: testing the model of DNA substitution. Bioinformatics 14 (9), Presch, W., Evolutionary history of the South American microteiid lizards (Teiidae: Gymnophthalmidae). Copeia 36, 56. Reeder, T.W., Montanucci, R.R., Phylogenetic analysis of the horned lizards (Phrynosomatidae: Phrynosoma): evidence from mitochondrial DNA and morphology. Copeia 309, 323. Ribas, C.C., Miyaki, C.Y., Cracraft, J., Phylogenetic relationships, diversification, and biogeography in Neotropical Brotogeris parakeets. J. Biogeogr. 36, Richards, C.M., Moore, W.S., A phylogeny for the African treefrog family Hyperoliidae based on mitochondrial rdna. Mol. Phylogenet. Evol. 5 (3), Rodrigues, M.T., Um novo Tropidurus com crista dorsal do Brasil com comentários sobre suas relações, distribuição e origem (Sauria, Iguanidae). Pap. Avulsos Zool. (São Paulo) 36 (17), Rodrigues, M.T., 1991a. Herpetofauna das dunas interiores do Rio São Francisco: Bahia: Brasil: I. Introdução à área e descrição de um novo gênero de microteiideos (Calyptommatus) com notas sobre sua ecologia, distribuição e especiação. Pap. Avulsos Zool. (São Paulo) 37 (19), Rodrigues, M.T., 1991b. Herpetofauna das dunas interiores do Rio São Francisco: Bahia: Brasil: II. Psilophthalmus: um novo gênero de microteiideos sem pálpebra (Sauria, Teiidae. Pap. Avulsos Zool. (São Paulo) 37 (20), Rodrigues, M.T., 1991c. Herpetofauna das dunas interiores do Rio São Francisco: Bahia: Brasil: III. Procellosaurinus: um novo gênero de microteiideo sem