THESIS MOLECULAR BARCODING OF FIFTEEN VENOMOUS SNAKES, AND IDENTIFICATION EIGHT SNAKE GROUPS IN THAILAND USING MULTIPLEX PCR ARJAREE SUPIKAMOLSENI
|
|
- Kathryn Higgins
- 5 years ago
- Views:
Transcription
1 THESIS MOLECULAR BARCODING OF FIFTEEN VENOMOUS SNAKES, AND IDENTIFICATION EIGHT SNAKE GROUPS IN THAILAND USING MULTIPLEX PCR ARJAREE SUPIKAMOLSENI GRADUATE SCHOOL, KASETSART UNIVERSITY 2016
2 Master of Science (Genetics) DEGREE Genetics FIELD Genetics DEPARTMENT TITLE: Molecular barcoding of fifteen venomous snakes, and identification eight snake groups in Thailand using multiplex PCR. NAME: Miss Arjaree Supikamolseni THIS THESIS HAS BEEN ACCEPTED BY ( Assistant Professor Kornsorn Srikulnath, Ph.D. ) THESIS ADVISOR ( Associate Professor Surin Peyachoknagul, Ph.D. ) THESIS CO-ADVISOR ( Miss Lawan Chanhome, Ph.D. ) THESIS CO-ADVISOR ( Associate Professor Arinthip Thamchaipenet, Ph.D. ) DEPARTMENT HEAD APPROVED BY THE GRADUATE SCHOOL ON ( Associate Professor Gunjana Theeragool, D.Agr. ) DEAN
3 THESIS MOLECULAR BARCODING OF FIFTEEN VENOMOUS SNAKES, AND IDENTIFICATION EIGHT SNAKE GROUPS IN THAILAND USING MULTIPLEX PCR ARJAREE SUPIKAMOLSENI A Thesis Submitted in Partial Fulfillment of the Requirements for the Degree of Master of Science (Genetics) Graduate School, Kasetsart University 2016
4 Arjaree Supikamolseni 2016: Molecular Barcoding of Fifteen venomous snakes, and identification eight snake groups in Thailand using multiplex PCR.. Master of Science (Genetics), Major Field: Genetics, Department of Genetics. Thesis Advisor: Assistant Professor Kornsorn Srikulnath, Ph.D. 57 pages. DNA barcodes of mitochondrial COI and Cytb genes were constructed from 54 specimens of 16 species for species identification. Intra- and interspecific sequence divergence of COI gene (10 times) were greater than those of Cytb gene (4 times), which suggests that the former gene may be a better marker than the latter for species delimitation in snakes. COI barcode cut-off scores differed by more than 3% between most species, and the minimum interspecific divergence was greater than the maximum intraspecific divergence. Clustering analysis indicated that most species fell into monophyletic clades. These results suggest that these species could be reliably differentiated using COI DNA barcodes. Moreover, a novel species-specific multiplex PCR assay was developed to distinguish between Naja spp, Ophiophagus hannah, Trimeresurus spp, Hydrophiinae snakes, Daboia siamensis, Bungarus fasciatus, and Calloselasma rhodostoma. Antivenom for these species was produced and distributed by the Thai Red Cross for clinical use. Our novel PCR assay could easily be applied to venom and saliva samples and could be used effectively for rapid and accurate identification of species in forensic work, conservation study, and medical research. Student s signature Thesis Advisor s signature / /
5 ACKNOWLEDGEMENTS I would like to express my sincere gratitude to my thesis advisor Assistant Professor Dr. Kornsorn Srikulnath for patience, motivation and valuable suggestion in this study. I would like to grateful thank to Associate Professor Dr. Surin Peyachoknagul and Dr. Lawan Chanhome at Queen Saovabha Memorial Institute, Thai Red Cross Society for serving on my co-advisor and for her advice and much helpful discussion to my research. A very special thanks goes out to Dr. Lawan Chanhome and all staff in the Laboratory of Department of Research and Development, Queen Saovabha Memorial Institute, Thai Red Cross for providing the specimens, had helped and encouragement in this research work. I would like to express my special gratitude to all members in the Laboratory of Animal Cytogenetics & Comparative Genomics, Kasetsart University, Bangkhen for their great helps not only about laboratory but also in daily life all the time. Special thank to my seniors, my friends and my juniors for their kind helps during conducting the field experiment. This work was financially supported by Kasetsart University Research and Development Institute (KURDI), and National Research Council of Thailand (NRCT) Finally I express deep thanks to my family for continuous encouragement. Arjaree Supikamolseni October 2016
6 i TABLE OF CONTENTS Page TABLE OF CONTENTS i LIST OF TABLES ii LIST OF FIGURES iii LIST OF ABBREVIATIONS viii INTRODUCTION 1 OBJECTIVES 4 LITERATURE REVIEW 5 MATERIALS AND METHODS 16 Materials 16 Methods 17 RESULTS AND DISCUSSION 24 CONCLUSION 49 LITERATURE CITED 50 CURRICULUM VITAE
7 ii LIST OF TABLES Table Page 1 Classification and accession numbers of species used in sequence analyses 19 2 Primers used for the amplification of mitochondrial COI and Cytb genes in this study 21 3 Number of haplotypes of COI and Cytb sequences 27 4 Average sequence divergence (p-distance) of COI gene within species and between pairs of venomous snake species. Diagonal values are p-distance for intra-specific comparisons 28 5 Average sequence divergence (p-distance) of Cytb gene within species and between pairs of venomous snake species. Diagonal values are p-distance for intra-specific comparisons 29 6 Summary of species-specific multiplex PCR assay 40
8 iii LIST OF FIGURES Figure Page 1 Ramphotyphlops australis 6 2 Cylindrophis ruffus ruffus 7 3 Xenopeltis unicolor 8 4 Python molurus 9 5 Acrochordus javanicus 10 6 Ahaetulla nasuta 11 7 Naja kaouthia 12 8 Trimeresurus albolabris 13 9 Phylogenetic tree showing currently accepted hypotheses of snake relationships Representative species used in this study. (a) Ophiophagus hannah, (b) Naja siamensis, (c) Naja sumatrana, (d) Naja kaouthia, (e) Bungarus candidus, (f) Bungarus fasciatus, (g) Daboia siamensis, (h) Rhabdophis subminiatus, (i) Boiga cynodon, (j) Trimeresurus albolabris, (k) Trimeresurus macrops, (l) Calloselasma rhodostoma, (m) Hydrophis brookii, (n) Hydrophis obscurus, (o) Enhydrina schistosa, and (p) Python molurus Agarose gel eletrophoresis of PCR products using COI primer (a) and Cytb primer (b). Lane 1 - O. hannah, Lane 2 - N. kaouthia, Lane 3 - B. fasciatus, Lane 4 - B. candidus, Lane 5 - D. siamensis, Lane 6 - T. albolabris Phylogenetic tree shows relationship between 16 species of snake COI gene Phylogenetic tree shows relationship between 16 species of snake Cytb gene. 32
9 iv LIST OF FIGURES (Continued) Figure Page 14 Dot plot analysis of sequence divergence with COI barcode (a) and Cytb barcode (b). A straight line represents 1:1 ratio between minimum congeneric sequence divergence and maximum intraspecific sequence divergence. Sequence divergences of species which was represented by more than one sample are shown here Agarose gel eletrophoresis of PCR products using multiplex PCR assays with the primer set 1 (panel A) (a) and 2 (panel B) (b) and DNA extracted from blood. Lane 1 H. brookii. Lane 2 E. schistosa. Lane 3 H. obscurus. Lane 4 T. albolabris. Lane 5 T. macrops. Lane 6 D. siamensis. Lane 7 B. candidus. Lane 8 B. fasciatus. Lane 9 O. hannah.lane 10 N. siamensis. 11 N. sumatrana. Lane 12 N. kaouthia. Lane 13 C. rhodostoma. Lane 14 Mus musculus. Lane 15 - Homo sapiens Agarose gel eletrophoresis of PCR products using primer COI Forward and (a) HYD Reverse, (b) TC Reverse, (c) DRS Reverse and (d) DB Reverse.Lane 1 H. brookii. Lane 2 E. schistosa. Lane 3 H. obscurus.lane 4 T. albolabris. Lane 5 T. macrops. Lane 6 D. siamensis.lane 7 B. candidus. Lane 8 B. fasciatus. Lane 9 O. hannah.lane 10 N. siamensis. Lane 11 N. sumatrana. Lane 12 N. kaouthia. Lane 13 C. rhodostoma. Lane 14 Mus musculus. Lane 15 - Homo sapiens. 38
10 v LIST OF FIGURES (Continued) Figure Page 17 Agarose gel eletrophoresis of PCR products using primer COI Forward and (a) BF Reverse, (b) OH Reverse, (c) NK Reverse, (d) CR Reverse. Lane 1 H. brookii. Lane 2 E. schistosa. Lane 3 H. obscurus. Lane 4 T. albolabris. Lane 5 T. macrops. Lane 6 D. siamensis. Lane 7 B. candidus. Lane 8 B. fasciatus. Lane 9 O. hannah.lane 10 N. siamensis. Lane 11 N. sumatrana. Lane 12 N. kaouthia. Lane 13 C. rhodostoma. Lane 14 Mus musculus. Lane 15 Homo sapiens Agarose gel eletrophoresis of PCR sensitivity using primer COI Forward and (a) HYD Reverse, (b,c) TC Reverse, (d,e) DRS Reverse. Lane 1 25ng.Lane 2 1ng. Lane 3 0.5ng. Lane ng. Lane ng. Lane ng. Lane ng. Lane ng. Lane ng. Lane ng Agarose gel eletrophoresis of PCR sensitivity using primer COI Forward and (a,b) DB Reverse, (c) BF Reverse, (d) OH Reverse, (e,f,g) NK Reverse, (h) CR Reverse. Lane 1 25ng. Lane 2 1ng. Lane 3 0.5ng. Lane ng. Lane ng. Lane ng. Lane ng. Lane ng. Lane ng. Lane ng. 42
11 vi LIST OF FIGURES (Continued) Figure Page 20 Agarose gel eletrophoresis of PCR products using multiplex PCR sensitivity assays with the primer set 1 (panel A) (a) and 2 (panel B) (b) and DNA concentration 0.5 ug. Lane 1 H. brookii. Lane 2 E. schistosa. Lane 3 H. obscurus. Lane 4 T. albolabris. Lane 5 T. macrops. Lane 6 D. siamensis. Lane 7 B. candidus. Lane 8 B. fasciatus. Lane 9 O. hannah. Lane 10 N. siamensis. Lane 11 N. sumatrana. Lane 12 N. kaouthia. Lane 13 C. rhodostoma. Lane 14 Mus musculus. Lane 15 - Homo sapiens Agarose gel eletrophoresis of PCR products using multiplex PCR assays with the primer set 1 (panel A) (a) and 2 (panel B) (b) and DNA extracted from venom. Lane 1 T. albolabris. Lane 2 T. macrops. Lane 3 D. siamensis. Lane 4 B. candidus. Lane 5 B. fasciatus. Lane 6 O. hannah. Lane 7 N. siamensis. Lane 8 N. sumatrana. Lane 9 N. kaouthia. Lane 10 C. rhodostoma. Lane 11 Mus musculus. Lane 12 Homo sapiens Agarose gel eletrophoresis of PCR products using multiplex PCR assays with the primer set 1 (panel A) (a) and 2 (panel B) (b) and DNA extracted from saliva. Lane 1 T. albolabris. Lane 2 T. macrops. Lane 3 D. siamensis. Lane 4 B. candidus. Lane 5 B. fasciatus. Lane 6 O. hannah. Lane 7 N. siamensis. Lane 8 N. sumatrana. Lane 9 N. kaouthia. Lane 10 C. rhodostoma. Lane 11 Mus musculus. Lane 12 Homo sapiens. 45
12 vii LIST OF FIGURES (Continued) Figure Page 23 Agarose gel eletrophoresis of PCR products using multiplex PCR assays with the primer set 1 (panel A) (a) and 2 (panel B) (b). DNA extracted from bite-site swabs with DNA concentration 2 ug. Lane 1-3 T. albolabris. Lane 4-6 T. macrops. Lane 7-9 D. siamensis. Lane B. candidus. Lane B. fasciatus. Lane O. hannah. Lane N. siamensis. Lane N. sumatrana. Lane N. kaouthia. Lane C. rhodostoma. 47
13 viii LIST OF ABBREVIATIONS A, G, C, and T = adenine, guanine, cytocine and thymine AFLP = amplified fragment length polymorphism AIC = Akaike Information Criterion BI = Bayesian inference BLASTn = Basic Local Alignment Search Tool-nucleotide bp = base pairs C = degree Celcius COI = cytochrome c oxidase I Cyt b = cytochrome b DDBJ = DNA Data Bank of Japan DNA = deoxyribonucleic acid dntp = deoxynucleotide triphosphate EDTA = ethylenediamine tetraacetic acid EST = expressed sequence tag HCl = hydrochloric acid h = hour M = molar MCMC = Markov Chain Monte Carlo MEGA4 = Molecular Evolutionary Genetics Analysis 4 MgCl2 = magnesium chloride min = minute ml = milliliter mm = millimolar mtdna = mitochondrial DNA NaCl = sodium chloride NCBI = National Center for Biotechnology Information ng = nanogram nm = nanometer PCR = Polymerase Chain Reaction ph = Potential of Hydrogen ion
14 ix LIST OF ABBREVIATIONS (Continued) pm = Picomolar RAPD = randomly amplified polymorphic DNA RFLP = restriction fragment length polymorphism RNA = ribonucleic acid s = second SDS = Sodium dodecyl sulfate SNP = single nucleotide polymorphism ssp. = subspecies Tris = tris (hydroxyl methyl) aminomethane U = Unit USA = United states of America UV = ultra violet WI = Wisconsin w/v = weight of a substance of the total volume μg = microgram μl = microliter
15 1 MOLECULAR BARCODING OF FIFTEEN VENOMOUS SNAKES, AND IDENTIFICATION EIGHT SNAKE GROUPS IN THAILAND USING MULTIPLEX PCR INTRODUCTION Snakes (Serpentes) are carnivorous squamate reptiles that exhibit phenotypically diverse radiation (Secor and Diamond, 1998; Castoe et al., 2008, 2009) with extant snakes over 3,000 known species worldwide (Uetz, 2014). Snakes form the most divergent group in Squamata and their speciation occurred over a relatively short period. These characteristics make snakes difficult to place among iguanians and anguimorphs, to which they are closely related (Srikulnath et al., 2010; Pyron et al., 2013). It is also difficult for evolutionary biologists to classify all snakes with conserved morphology within the sublevels of Serpentes. However, snake biodiversity is decreasing globally owing to hunting and trading for health food, medicinal products, and pets. This issue requires serious attention in the context of conservation biology, and has led to an effort to produce a collection of entire diversity of snake alongside a modern, accurate taxonomy. The Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) regulates the trade of certain snakes. It is essential to develop reliable methods to forensically identify snake products in order to enforce trading laws. Conventional morphology-based taxonomic procedures for snakes are well established (Cox et al., 2012), but are time-consuming due to the limited availability of snake specimens and differences between life stages and sexes, which can lead to misidentification. This suggests that modern techniques, such as molecular approaches, are needed in addition to traditional taxonomic methods in order to identify species. DNA sequences of a standardized region from an unknown species can be compared to sequences available in databases in order to identify them as belonging to a particular species. This technique is known as DNA barcoding. The reference sequence library is constructed from a known species and becomes the barcode. The
16 2 degree of nucleotide divergence between individuals can facilitate identification of species. The gene most commonly used as a marker for the barcode is the mitochondrial COI gene because it has been studied in many vertebrates and exhibits interspecific nucleotide divergence that is greater than its intraspecific nucleotide divergence (Chaves et al., 2008). Other mitochondrial genes, such as Cytb and 16S rrna (Xia et al., 2012; Nicolas et al., 2012), have also been employed as barcodes with varying levels of success. Snake DNA barcodes based on COI, Cytb, and 12S rrna genes are well established in India, China, and the USA (Wong et al., 2004; Pook and McEwing, 2005; Dubey et al., 2011; Gaur et al., 2012). However, these successes were based on studies of only those species that are abundant in a given country, and there is no single standard gene for the reliable identification of snakes at the species level. Global expansion of the snake DNA barcode library is therefore necessary to aid work in conservation biology, medicine, and forensic science. In Thailand, venomous snakebites remain a serious daily occurrence. Even though several specific antivenoms are available, bites from venomous snakes that cause morbidity and mortality often occur. There are seven effective antivenoms available from the Thai Red Cross for clinical use. These include antivenoms to Naja kaouthia, Ophiophagus hannah, Trimeresurus albolabris, Daboia siamensis, Bungarus fasciatus, Bungarus candidus, and Calloselasma rhodostoma. Clinically, the most serious problem for antivenom therapy is snake identification. The classification of snakebites is first performed by investigation of the clinical signs and symptoms or examination of the carcass of the snake and the local ecology. However, this is timeconsuming and must be performed by a specialist. Therefore, several approaches have been developed to the examination of snakebites, such as radioimmunoassay, agglutination assay, enzyme-linked immunosorbent assay, and DNA fingerprinting (Selvanayagam and Gopalakrishnakone, 1999; Suntrarachun et al., 2001). However, there remain problems with false positives, low sensitivity, and availability that is limited to local-species-specific markers (Tibballs, 1992; Mead and Jelinek, 1996). In this study, we generated COI and Cytb barcodes for 53 venomous snakes and one non-venomous snake (Python bivittatus bivittatus) found in Thailand, and
17 3 identified snakes using the degree of nucleotide divergence between barcodes and clustering analysis with a phylogenetic tree. Species-specific multiplex PCR markers were then developed from barcodes to rapidly delimit eight groups of venomous snakes. Effective antivenom is available from the Thai Red Cross for most of these groups.
18 4 OBJECTIVES 1. To develop DNA barcodes of venomous snake species in Thailand. Thailand. 2. To develop DNA markers for differentiating venomous snake species in
19 5 LITERATURE REVIEW Snakes Snakes are reptiles that have been systematically classified in order Squamata. as follows:- Kingdom Animalia Phylum Chordata Subphylum Class Order Suborder Vertebrata Reptilia Squamata Serpentes In Thailand, snake can be divided into 8 families (Jintakun and Chanhome, 1995) as follows:- 1. Family Typhlopidae (typical blind snakes): They are mostly found in the tropical region. There are 2 genera in Thailand consisting of Ramphotyphlops such as Ramphotyphlops braminus (ง ด นธรรมดา) and Typhlops. Such as Typhlops khoratensis (ง ด นโคราช). Morphology: The body is nearly cylindrical and is remarkably rigid in cross section; both characteristics are mechanical adaptations for a subterranean life. Adults, especially of larger species, are slightly thinner anteriorly than posteriorly. Young (or small) individuals have stouter bodies than old (or large) individuals of the same species. The body is darker above and on the sides. The colour of the head and snout shields is consistent within each species. The tail may be characteristically pigmented in some species and in some species the anterior body is slightly paler.
20 6 Distribution: Found throughout Thailand. The snakes are often found in termite hills and also in flower pots and other damp and dark areas. They eat termite eggs. (Ehmann and Michael, 1993) Figure 1 Ramphotyphlops australis Source: Ehmann and Michael. (1993). 2. Family Cylindrophiidae (pipesnakes): There is only 1 species, Cylindrophis ruffus (ง ก นขบ), in Thailand. Morphology: Small head not distinct from neck, covered with large symmetrical shields; the nostril in a single nasal, which forms a suture with its fellow behind the rostral, with no loreal or preocular scale; a small postocular, a mental groove present; tail short and blunt Distribution: Throughout Thailand in humid regions and flat land. Some have also been found at heights of up to 1700 Meters (Hoser, 2013).
21 7 Figure 2 Cylindrophis ruffus ruffus Source: Bulian (1999). 3. Family Xenopeltidae (sunbeam snakes): There is only 1 species, Xenopeltis unocolor (ง แสงอาท ตย ). Morphology: The ground color of the snake's dorsal side is a dark brown, almost black, with the ventral side being a white or cream color. In the sunlight, or under strong artificial light, the scales scatter the illumination like a prism, showcasing a breathtaking display of rainbow coloration. There is no snake in the world that can rival the iridescent of the sunbeam snake, this species most enchanting feature (Vitt et al., 2009). Distribution: Can be met in the whole of Thailand.
22 8 Figure 3 Xenopeltis unicolor Source: Bulian (1999). 4. Family Pythonidae (pythons): There are 3 species as Python reticulates (ง เหล อม), P. molurus (ง หลาม) and P. curtus (ง หลามปากเป ด). Morphology: Pythons (family Pythonidae) represent a family of nonvenomous and now restricted to the warmer regions of the Old World. Distribution: The Python is to be found throughout Thailand. The animals can even be regularly found in the inner city areas of Bangkok (Schleip and Mark, 2010).
23 9 Figure 4 Python molurus Photo by: Deekrachang (2014). 5. Family Acrochordidae (wart snakes): There are 2 species as Acrochordus javanicus (ง งวงช าง) and A. granulates (ง ผ าข ร ว). Morphology: Small to medium-sized aquatic snakes with blunt heads not distinct from the neck, dorsally directed small eyes and nares, flabby and roughened skin bearing small, spinate scales. Body stout and capable of lateral compression for swimming (Lillywhite and Harvey B, 1996). Distribution: In the coastal areas in the whole of Thailand.
24 10 Figure 5 Acrochordus javanicus Source: Bulian (1999). 6. Family Colubridae (typical snake): It is the largest snakes family consisting of 5 subfamily, as follows:- - Subfamily Calamariinae such as Calamaria lumbricoidea (ง พงอ อ ลาย), Calamaria pavimentata (ง พงอ อท องเหล อง). - Subfamily Colubrinae such as Ahaetulla fasciolata (ง เข ยวห วจ งจกลาย จ ด), Oligodon joynsoni (ง ป แก วใหญ ). - Subfamily Natricinae such as Amphiesma deschauenseei (ง ลายสาบท อง สามข ด), Opisthotropis maculosus (ง ลายสอจ ดเหล อง). - Subfamily Pseudoxenodontinae such as Plagiopholis nuchlis (ง ห ว ศร), Pseudoxenodon macrops (ง ลายสาบตาโต). - Subfamily Xenodontinae such as Gongylosoma baliodeira (ง สายทอง ลายแถบ). Morphology: Their ventral scales are well developed, usually as broad as the belly. The head is usually oval shaped with systematically arranged shields. The tails are normally cylindrical and pointed (Ehmann, 1993).
25 11 Distribution: Throughout Thailand. Figure 6 Ahaetulla nasuta Source: Bulian (1999). 7. Family Elapidae: There are 4 subfamilies as follows:- - Subfamily Elapinae as Bungarus candidus (ง ท บสม งคลา), Bungarus fasciatus (ง สามเหล ยม), Naja kaouthia (ง เห าไทย), Naja siamensis (ง เห าพ นพ ษสยาม), Naja sumatrana (ง เห าพ นพ ษส ทอง) and Ophiophagus hannah (ง จงอาง). - Subfamily Hydrophiinae as Hydrophis brookii (ง แสมร งท องเหล อง), Hydrophis obscurus (ง แสมร งระนอง). - Subfamily Psammophiinae as Psammophis indochinensis (ง ม าน ทองอ นโดจ น). - Subfamily Xenodermatinae as Xenodermus javanicus (ง ขอนไม ). Morphology: Elapids show a variety of body forms. The head is usually not much broader than the neck and tail tip is pointed. All are venomous. Short front deeply grooved fangs to administer venom. The fangs are fixed fangs (Shea et at., 1993).
26 12 Distribution: Throughout Thailand. Figure 7 Naja kaouthia Photo by: Deekrachang (2014). 8. Family Viperidae is venomous snakes found all over the world. It is commonly known as vipers or viperids. There are 2 subfamily: as follows- - Subfamily Crotalinae as Calloselasma rhodostoma (ง กะปะ), Trimeresurus macrops (ง เข ยวหางไหม ตาโต), Ovophis monticola (ง หางแฮ ม ภ เขา), Parias hageni (ง แก วหางแดง) and Popeia fucata (ง เข ยวหางไหม ท องเข ยว ถ นใต ). - Subfamily Viperinae as Daboia russelii (ง แมวเซา). Morphology: All are venomous. The fangs are long, hollow and moveable. They administer primarily a hemotoxin venom. Pit viper has two highly developed facial pits to detect infrared radiation (Nilson and Gutberlet, 2004). Distribution: Throughout Thailand.
27 13 Figure 8 Trimeresurus albolabris Photo by: Deekrachang (2014). According to most paleontologists, reptiles evolved from the large group of ancient amphibians known as Labrynthodonts, which received their names from the distinctive structure of their teeth. Based on these fossil finds, as well as on anatomical study of modern reptiles, scientists have concluded that the snakes probably evolved from a family of lizards during the time of the dinosaurs. Snakes and lizards share a number of distinct features in the structure of their skull; both, for instance, possess a moveable quadrate bone at the back of the jaw, and both are missing the quadratojugal bone at the rear of the skull (Lenny Flank.Jr, 1997). Pythons and boas (primitive groups among modern snakes) have vestigial hind limbs: tiny, clawed digits known as anal spurs, which are used to grasp during mating. The families Leptotyphlopidae and Typhlopidae (Figure 9) also possess remnants of the pelvic girdle, appearing as horny projections when visible.
28 14 Figure 9 Phylogenetic tree showing currently accepted hypotheses of snake relationships. Source: Lee et al. (2007) DNA barcoding DNA barcoding is a taxonomic method that uses a short genetic marker in an organism's DNA to identify it as belonging to a particular species. It differs from molecular phylogeny in that the main goal is not to determine classification but to identify an unknown sample in terms of a known classification (Kress et al., 2005). A desirable locus for DNA barcoding should be standardized in most taxa of interest and sequenced without species-specific PCR primers. The amplicons are short enough to be easily sequenced with current technology (Kress and Erickson, 2008). They also provide a large variation among species but a relatively small amount of variation within a species. The gene most commonly used as a marker for the barcode is the mitochondrial COI gene because it has been studied in many vertebrates and exhibits interspecific nucleotide divergence that is higher than its intraspecific nucleotide divergence (Chaves et al., 2008; Vargas et al., 2009). As of 2009, databases of COI sequences included at least 620,000 specimens from over 58,000 species of animals, larger than databases available for any other gene (Ausubel, 2009). Other
29 15 mitochondrial genes have also been employed with varying levels of success, such as Cytb and 16S rrna (Feng et al., 2011; Xia et al., 2012; Nicolas et al., 2012). Snake DNA barcodes based on COI, Cytb, and 12S rrna genes have been well established in India, China, and the USA (Wong et al., 2004; Pook and McEwing 2005; Dubey et al., 2011; Gaur et al., 2012). DNA markers The development of DNA-based markers has had a revolutionary impact on gene mapping and, more generally, on all of animal and plant genetics. With DNAbased markers, it is theoretically possible to exploit the entire diversity in DNA sequence that exists in any cross (Dodgson et al., 1996). Molecular genetic markers are powerful approaches to examine genetic traits of individuals, populations, or species (Avise, 1994; Linda and Paul, 1995). These markers could also determine genetic diversity, leading to the application for management of the natural resources and genetic improvement programs (Hillis et al., 1996; Liu and Cordes, 2004). Molecular markers can be classified into two groups: group I markers are based on investigation of various functional gene products, such as allozyme marker, and group II markers are based on detection of the variation of nucleotide sequences from anonymous genomic regions through PCR (polymerase chain reaction) or hybridization techniques (O Brien, 1991). Species-specific PCR assay is developed to identify species, genus, of any organisms based on nucleotide polymorphism in each lineage. This assay has been reported for species identification in term of biological conservation and forensic identification, such as mammalian and poultry species (Candrian and Luethy, 1994; Cocolin et al., 2000; Arslan et al., 2006; Magnussen et al., 2007). The advantages of this species-specific method are relatively fast, precise, sensitive, and cost effective, comparing to other DNA markers based assay [restriction fragment length polymorphism (RFLP), randomly amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), microsatellite typing, single nucleotide polymorphism (SNP), and expressed sequence tag (EST) markers] (Mane et al., 2007). Therefore, the species-specific PCR assay is a good technique to identify venomous snakes in this study.
30 16 MATERIALS AND METHODS Materials 1. Snake samples collection A total of fifty four specimens from sixteen species of snakes were used (O. hannah, N. siamensis, N. sumatrana, N. kaouthia, B. candidus, B. fasciatus, D. siamensis, R. subminiatus, B. cynodon, T. albolabris, T. macrops, C. rhodostoma, H. brookii, H. obscurus, E. schistosa, and P. molurus.) as described in Table 1. All specimens were classified into four families (Elapidae, Viperidae, Colubridae and Pythonidae) which were mainly found in Bangkok. 2. Computer and programs for nucleotide sequence analysis 2.1) Basic Local Alignment Search Tool - nucleotide; Blastn and Blastx from 2.2) Multiple Sequence Alignment; ClustalW from 2.3) OligoAnalyzer 3.1; OligoAnalyzer from 2.4) Reverse Complement; Reverse Complement from 2.5) ORF Finder (Open Reading Frame Finder); ORF Finder from 2.6) ExPASy-tranlate tool; ORF translate from 2.7) MEGA4 (Kumar et al., 2004) 2.8) PUAP (Swofford D.L. 2002) 2.9) Mr.BAY (Huelsenbeck JP and Ronquist F 2001.)
31 17 Methods 1. Specimen collection Blood samples were collected from sixteen snake species (54 individual ) of venomous snakes (O. hannah, N. kaouthia, B. fasciatus, B. candidus, N. sumatrana, D. siamensis, T. albolabris, T. macrops, H. brookii, E. schistosa, H. obscurus, C. rhodostoma, N. siamensis, B. cynodon, R. subminiatus, and P. molurus) (Figure 10 and Table 1). These samples were available in Snake Farm of Queen Saovabha Memorial Institute, Thai Red Cross Society (Bangkok, Thailand). Blood sample was individually collected from each snake through the ventral tail vein with a 10 mm EDTA treated 25-gauge needle attached to a 1 ml disposable syringe and kept at -20 C Snake venom and saliva samples were collected from ten snake species (30 individual) (O. hannah, N. kaouthia, B. fasciatus, B. candidus, N. sumatrana, D. siamensis, T. albolabris, T. macrops, C. rhodostoma, and N. siamensis) using swab snake mouth, and kept in normal saline solution (0.9 % w/v). Because the antivenom of ten venomous species in this study were available. Bite-site swabs were collected by inducing venomous snakes to bite Swiss albino mice (Mus musculus), and then kept in normal saline solution (0.9 % w/v) for DNA extraction. 2. Genomic DNA Extraction Whole genomic DNA was extracted from blood, snake venom, saliva and bitesite swabs samples using Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA), and/or following a standard salting-out protocol, and used as a template for polymerase chain reaction (PCR). Briefly, the blood cells were digested at 55 C for 1 h using 1.6 μg/μl proteinase K in extraction buffer (50 mm Tris-HCl (ph 8.0), 20 mm EDTA, and 1% (w/v) sodium dodecyl sulfate (SDS). The mixture was then extracted using a salt solution (0.05 volumes of 5 M NaCl) and the DNA was precipitated using two volumes of isopropanol. After washing in 70% ethanol, genomic DNA was air-dried, resuspended in 10 mm Tris-HCl (ph 8.0), and kept at -
32 18 80 C. DNA quality and concentration were determined by 1% agarose gel electrophoresis and nucleic acid quantitation was carried out by spectrophotometer at 260 and 280 nm. Figure 10 Representative species used in this study. (a) Ophiophagus hannah, (b) Naja siamensis, (c) Naja sumatrana, (d) Naja kaouthia, (e) Bungarus candidus, (f) Bungarus fasciatus, (g) Calloselasma rhodostoma, (h) Rhabdophis subminiatus, (i) Boiga cynodon, (j) Trimeresurus albolabris, (k) Trimeresurus macrops, (l) Daboia siamensis, (m) Hydrophis brookii, (n) Hydrophis obscurus, (o) Enhydrina schistosa, and (p) Python molurus.
33 19 Table 1 Classification and accession numbers of species used in all sequence analyses Family Species Sex Locality Code COI Accession number Cytb Accession number Elapidae Ophiophagus hannah female Bangkok OHA1 AB AB Elapidae Ophiophagus hannah female Bangkok OHA2 AB AB Elapidae Ophiophagus hannah female Bangkok OHA3 AB AB Elapidae Naja kaouthia male unknow NKA1 AB AB Elapidae Naja kaouthia female Bangkok NKA2 AB AB Elapidae Naja kaouthia male Bangkok NKA3 AB AB Elapidae Naja sumatrana female unknow NSU1 AB AB Elapidae Naja siamensis male unknow NSI2 AB AB Elapidae Naja siamensis male Rayong NSI3 AB AB Elapidae Bungarus fasciatus female unknow BFA1 AB AB Elapidae Bungarus fasciatus female unknow BFA2 AB AB Elapidae Bungarus fasciatus female unknow BFA3 AB AB Elapidae Bungarus candidus male NakhonRatchasima BCA1 AB AB Elapidae Bungarus candidus female unknow BCA2 AB AB Elapidae Bungarus candidus female unknow BCA3 AB AB Elapidae Hydrophis brookii male unknow HBR1 AB AB Elapidae Hydrophis brookii female unknow HBR5 AB AB Elapidae Hydrophis brookii female unknow HBR6 AB AB Elapidae Hydrophis obscurus male unknow HOB2 AB AB Elapidae Hydrophis obscurus male unknow HOB3 AB AB Elapidae Hydrophis obscurus male unknow HOB4 AB AB Elapidae Hydrophis obscurus female unknow HOB5 AB AB Elapidae Hydrophis obscurus female unknow HOB8 AB AB Elapidae Hydrophis obscurus female unknow HOB15 AB AB Elapidae Enhydrina schistosa female unknow ESC4 AB AB Elapidae Enhydrina schistosa female unknow ESC5 AB AB Elapidae Enhydrina schistosa female unknow ESC6 AB AB Elapidae Enhydrina schistosa male unknow ESC7 AB AB Elapidae Enhydrina schistosa female unknow ESC9 AB AB Elapidae Enhydrina schistosa male unknow ESC12 AB AB Elapidae Enhydrina schistosa female unknow ESC13 AB AB Viperidae Daboia siamensis male Bangkok DSI1 AB AB920249
34 20 Table 1 (Continued) Family Species Sex Locality Code COI Accession number Cytb Accession number Viperidae Daboia siamensis female Bangkok DSI2 AB AB Viperidae Viperidae Trimeresurus albolabris female Bangkok Trimeresurus albolabris female Chanthaburi TAL3 AB AB TAL4 AB AB Viperidae Trimeresurus macrops female NongBuaLamphu TMA2 AB AB Viperidae Trimeresurus macrops female Bangkok TMA7 AB AB Viperidae Trimeresurus macrops female Sara Buri TMA14 AB AB Viperidae Trimeresurus macrops female RajchaBuri TMA19 AB AB Viperidae Trimeresurus macrops female RajchaBuri TMA20 AB AB Viperidae Trimeresurus macrops female RajchaBuri TMA21 AB AB Viperidae Trimeresurus macrops female RajchaBuri TMA24 AB AB Viperidae Trimeresurus macrops female NakhonRatchasima TMA31 AB AB Viperidae Trimeresurus macrops male unknow TMA35 AB AB Viperidae Trimeresurus macrops female unknow TMA36 AB AB Viperidae Trimeresurus macrops female unknow TMA37 AB AB Viperidae Trimeresurus macrops - unknow TMA39 AB AB Viperidae Calloselasma rhodostoma female Chon Buri CRH1 AB AB Colubridae Boiga cynodon female unknow BCY4 AB AB Colubridae Boiga cynodon male unknow BCY5 AB AB Colubridae Colubridae Colubridae Rhabdophis subminiatus male NakhonRatchasima Rhabdophis subminiatus female NakhonRatchasima Rhabdophis subminiatus female unknow RSU1 AB AB RSU2 AB AB RSU3 AB AB Pythonidae Python molurus - unknow PMO1 AB AB PCR amplification and sequencing The partial DNA fragments of the COI and Cytb mitochondrial genes were then amplified using PCR primers (Table 2). Standard PCR reaction was performed using 1 ThermalPoll reaction buffer containing 1.5 mm MgCl 2, 0.2 mm dntps, 5
35 21 pm specific primers, 0.25 U of Taq polymerase (Vivantis Technologies, Selangor Darul Ehsan, Malaysia), and 25 ng genomic DNA in a final reaction volume of 20 µl. PCR cycling conditions contained the initial denaturation at 94 C for 3 min, followed by 35 cycles of denaturation at 94 C for 30 s, primer annealing at 56 C of COI primers and 49 C of Cytb primers for 30 s, primer extension at 72 C for 45 s, then postcycling extension at 72 C for 10 min. The PCR products were examined by electrophoresis on 1% agarose gel. The DNA fragments were subsequently be extracted from the ethidium bromide-stained gel using Gel/PCR DNA fragments Extraction Kit (Geneaid, Sijhih, Taipei, Taiwan), and directly sequenced by 1 st Base DNA sequencing service (Seri Kembangan, Malaysia). Table 2 Primers used for the amplification of mitochondrial COI and Cytb genes in this study. Primer name Targeted gene Forward primer (5'-3') Specific snake Reference Amplified sized COI forward COI TCAGCCATACTCCTGTGTTCA all snakes Makowsky et al. 700 (2010) COI reverse COI TAGACTTCTGGGTGGCCAAAGAATCA all snakes Makowsky et al. 700 (2010) H16064 Cytb CTTTGGTTTACAAGAACAATGCTTTA all snakes Palumbi (1996) 1100 Gludg Cytb TGACTTGAARAACCAYCGTTG all snakes Burbrink (2000) 1100 HYD COI AGGGCCCTGAGTGAACAATA snake in Hydrophiinae in this study 411 TC COI GAAAGCCATGTCTGGGGTT Trimeresurus spp. in this study 272 DB COI TAATAGCATAGTAATTGCTGCTGCAAG Daboia siamensis in this study 621 DRS COI CGGATCAAACAAATAGAGGGAAGTTAA Daboia siamensis and in this study 579 Bungarus candidus BF COI AGGACTGGTAGGGCTAGTAAA Bungarus fasciatus in this study 590 OH COI TAAATGCGTGGGCAGTTACTAAA Ophiophagus hannah in this study 181 NK COI AGAGAAGTAGGAGGGATGGAGG Naja spp. in this study 322 CR COI CGAGTGAACTAGGTTTCCGG Calloselasma rhodostoma in this study Nucleotide sequence and phylogenetic analysis The COI and Cytb nucleotide sequences of all specimens were used to search the homologies of mitochondrial genes in the National Center for Biotechnology
36 22 Information (NCBI) database using the BLASTx and BLASTn programs, and were deposited in the DNA Data Bank of Japan ( The partial mitochondrial COI and Cytb sequences of 54 venomous snakes and P. molurus were aligned using the default parameters of Molecular Evolutionary Genetics Analysis 4 (MEGA4) software (Kumar et al., 2004). All unalignable sites and gap-containing sites were carefully removed from these data sets. Sequence divergence was conducted with two data sets (COI and Cytb nucleotide sequences) with uncorrected pairwise distances (p-distance) using MEGA4. The phylogenetic trees were reconstructed using Bayesian inference (BI) with MrBayes v3.0b4 (Huelsenbeck and Ronquist, 2001). The corresponding best-fit evolutionary model and parameters indicated by Modeltest version 3.7 (Posada and Crandall, 1998) based on the Akaike Information Criterion (AIC) and PAUP* v. 4.0b10 (Swofford, 2002) were used. The Markov Chain Monte Carlo (MCMC) process was set to run four chains simultaneously for 1 million generations. After the log-likelihood value reached stationarity, sampling procedure was performed at every 100 generations to get 10,000 trees and subsequently provide a majority-rule consensus tree with averaged branch lengths. All sample points prior to reaching convergence were discarded as burn-in, and Bayesian posterior nodal relationship in the sampled tree population was shown in percentages. 5. Species-specific multiplex PCR markers The nucleotide sequences of partial mitochondrial COI gene of sixteen species of venomous snakes (O. hannah, N. siamensis, N. sumatrana, N. kaouthia, B. candidus, B. fasciatus, D. siamensis, R. subminiatus, B. cynodon, T. albolabris, T. macrops, C. rhodostoma, H. brookii, H. obscurus, E. schistosa, and P. molurus.) were aligned using the default parameter of ClustalW. Species-specific primers were designed based on the sites of all mitochondrial COI nucleotide sequences of the venomous snakes in this study that differed between different clusters of snake species. Primers were examined using two different approaches:
37 23 1. Single primer pairs PCRs were used to examine different snake clades (Naja spp. (1); O. hannah (2); Trimeresurus spp. (3); Hydrophiinae (4); D. siamensis (5); B. fasciatus (6); B. candidus (7); and C. rhodostoma (8)) using the appropriate annealing temperature (Table 2). PCR reaction was performed using 1 ThermalPoll reaction buffer containing 1.5 mm MgCl 2, 0.2 mm dntps, 5 pm specific primers, 0.25 U of Taq polymerase (Vivantis), and 25 ng genomic DNA in a final reaction volume of 15 µl. PCR cycling conditions contained the initial denaturation at 94 C for 3 min, followed by 35 cycles of denaturation at 94 C for 30 s, specific primer annealing temperature for 30 s, primer extension at 72 C for 45 s, then postcycling extension at 72 C for 5 min. The PCR products were examined by electrophoresis on 1% agarose gel. 2. Single tube multiplex PCRs were performed to detect simultaneously different snake species group. Multiplex PCR reaction was performed using 1 ThermalPoll reaction buffer containing 1.5 mm MgCl 2, 0.2 mm dntps, specific primers concentration (Table 3), 0.25 U of Taq polymerase (Vivantis), and 25 ng genomic DNA in a final reaction volume of 20 µl. PCR cycling conditions contained the initial denaturation at 94 C for 3 min, followed by 35 cycles of denaturation at 94 C for 30 s, specific primer annealing temperature for 30 s, primer extension at 72 C for 45 s, then postcycling extension at 72 C for 5 min. The PCR products were examined by electrophoresis on 1% agarose gel. To test the sensitivity of species-specific single PCR markers and multiplex PCR markers, serial dilutions of the DNA template ranging from ng to 5 ng were subjected to PCR. The specificity of the single and multiplex PCR systems was also determined by adding DNA mixture from all snake species to each PCR reaction, and the amplification was performed as mentioned above. Snake venom, saliva and snakebites were also collected from almost all snake species, except for B. cynodon, R. subminiatus, P. molurus, and snakes of Hydrophiinae. Whole-genomic DNA was isolated as described above. Multiplex PCR reactions were performed with ng of DNA template, and the PCR products were also examined by electrophoresis on 1% agarose gel.
38 24 RESULTS AND DISCUSSION 1. DNA Extraction and Gene amplification with PCR Whole genomic DNA was extracted from blood, snake venom, saliva, and snakebites samples. The results showed that the DNA concentrations were ng/µl, and DNA purities were between in absorbance at 260/280 nm. Then, DNA quality were determined by 1% agarose gel electrophoresis. Genomic DNA was then used as templates to amplify two partial mitochondrial COI and Cytb genes under PCR based method (Table 2). The results showed that size of DNA fragments of COI gene was about 700 bp and size of DNA fragments of Cytb gene was about 1,100 bp in all snake species (Figure 11). Figure 11 Agarose gel eletrophoresis of PCR products using COI primer (a) and Cytb primer (b). Lane 1 - O. hannah, Lane 2 - N. kaouthia, Lane 3 - B. fasciatus, Lane 4 - B. candidus, Lane 5 - D. siamensis, Lane 6 - T. albolabris
39 25 2. Barcode construction DNA barcodes of mitochondrial COI and Cytb gene sequences were constructed from 54 specimens representing 16 species, belonging to 11 genera (O. hannah, N. siamensis, N. sumatrana, N. kaouthia, B. candidus, B. fasciatus, D. siamensis, R. subminiatus, B. cynodon, T. albolabris, T. macrops, C. rhodostoma, H. brookii, H. obscurus, E. schistosa, and P. molurus.). Most of all species were represented by two or more samples. Good quality sequences of approximately 528 bp for COI gene sequences and 396 bp for Cytb gene sequences were obtained from all samples used in this study. Average nucleotide frequencies for the entire data set were A =26.49%; T =30.51%; C =26.60%; G =16.39% for COI data set and A =31.60%; T =30.22%; C =29.57%; G =8.6% for Cytb data set. There were also no statistically significant proportion differences among snake sequences, indicating that the two data set analyses had no heterogeneity of base frequencies. No stop codons were found in these sequences, indicating that nuclear pseudogenes had not occurred in the analysis. All barcodes represent the functional mitochondrial COI and Cytb gene sequences. 3. Sequence analysis The sequences were deposited in DDBJ (Accession Numbers AB AB920287). Sequence divergences were then conducted with two data sets (COI and Cytb nucleotide sequences), and estimated with MEGA4 using uncorrected pairwise distances (p-distance). Different COI haplotypes were found in N. siamensis, B. fasciatus, B. candidus, T. macrops, T. albolabris, H. brookii, E. schistosa and H. obscurus (Table 3) with the mean intraspecific uncorrected pairwise distance (pdistance) of 0.2%, 0.9%, 0.6%, 3.6%, 1.52%, 0.13%, 0.7% and 0.1%, respectively (Table 4). By contrast, O. hannah, N. kaouthia, D. siamensis, B. cynodon and R. subminiatus had each only one haplotype. The overall mean sequence divergence was 16.7%, and the average distance of intrafamily Elapidae, Viperidae, and Colubridae were 13.1%, 10% and 10.8%, respectively. The analysis of Cytb sequences showed that various Cytb haplotypes were found in O. hannah, N. kaouthia, N. siamensis, B.
40 26 fasciatus, B. candidus, T. macrops, T. albolabris, E. schistosa, H. obscurus and R. subminiatus (Table 3) with the mean intraspecific uncorrected pairwise distance (pdistance) of 0.4%, 1.1%, 4%, 0.9%, 14.4%, 6.1%, 1.1%, 0.1%, 0.3% and 0.5%, respectively (Table 5). By contrast, D. siamensis, H. brookii and B. cynodon had each only one haplotype. The overall mean sequence divergence was 22.8%, and the average distance of intrafamily Elapidae, Viperidae, and Colubridae were 17.4%, 12.3% and 14.1%, respectively. The results showed that the minimum of sequence divergence for COI gene was 3.1% between N. siamensis and N. sumatrana and maximum of sequence divergence was 21.9% between N. kaouthia and D. siamensis. Generally, the sequence divergence of intraspecific variation is approximately 2% which is low for the COI gene (Avise 2000; Hebert et al., 2003). The variation of sequence divergence of sea turtle in Brazil have been revealed between % (mean 8.2%) (Vargas et al., 2009). The minimum of sequence divergence for Cytb gene was 5.1% between H. brookii and H. obscurus and maximum of sequence divergence was 32.7% between B. candidus and P. molurus. Generally, the sequence divergence of intraspecific variation is approximately 3% (Johns and John, 1998). The variation of sequence divergence of genus Natrix between N. maura and N. natrix was about 16.0% and N. maura and N. tessellate was about 18.4% (Guicking et al., 2006). Therefore, the sequence divergence of COI and Cytb barcodes in this study were similar to those of other vertebrates, and can be used for identifying each snake species.
41 27 Table 3 Number of haplotypes of COI and Cytb sequences Species COI haplotypes Cytb haplotypes Ophiophagus hannah 1 3 Naja. kaouthia 1 3 Naja. siamensis 2 2 Bungarus. fasciatus 2 2 Bungarus. candidus 2 3 Trimeresurus. macrops 6 8 Trimeresurus. albolabris 2 2 Hydrophis. brookii 3 1 Enhydrina. schistosa 2 4 Hydrophis. obscurus 4 5 Rhabdophis. subminiatus 1 2 Daboia. siamensis 1 1 Boiga. cynodon 1 1
42 28 Table 4 Average sequence divergence (p-distance) of COI gene within species and between pairs of venomous snake species. Diagonal values are p-distance for intra-specific comparisons. Species O. hannah N. kaouthia N. sumatrana N. siamensis B. fasciatus B. candidus H. brookii H. obscurus E. schistosa D. siamensis T. albolabris T. macrops C. rhodostoma B. cynodon R. subminiatus P. molurus O. hannah (1) N. kaouthia (1) N. sumatrana a N. siamensis (2) B. fasciatus (2) B. candidus (3) H. brookii (2) H. obscurus (2) E. schistosa (5) D. siamensisi (1) T. albolabris (2) T. macrops (6) C. rhodostoma a B. cynodon (1) R. subminiatus (1) P. molurus a The numbers in parentheses indicate the number of haplotypes per species. a Samples were collected from only one individual.
43 29 Table 5 Average sequence divergence (p-distance) of Cytb gene within species and between pairs of venomous snake species. Diagonal values are p-distance for intra-specific comparisons. Species O. hannah N. kaouthia N. sumatrana N. siamensis B. fasciatus B. candidus H. brookii H. obscurus E. schistosa D. siamensis T. albolabris T. macrops C. rhodostoma B. cynodon R. subminiatus P. molurus O. hannah (2) N. kaouthia (2) N. sumatrana a N. siamensis (2) B. fasciatus (3) B. candidus (3) H. brookii (1) H. obscurus (4) E. schistosa (2) D. siamensis (1) T. albolabris (2) T. macrops (8) C. rhodostoma a B. cynodon (1) R. subminiatus (3) P. molurus a The numbers in parentheses indicate the number of haplotypes per species. a Samples were collected from only one individual..
44 30 4. Phylogenetic analysis Bayesian inference cladograms were reconstructed based on COI and Cytb data sets. They produced similar topology, and strongly supported the monophyletic clade of the sequences belonging to the same species from both Genbank and this study (Figure 12, 13). This indicates the diagnostic ability of COI and Cytb to correctly identify species. However, almost all individual snakes of T. macrops and T. albolabris were not included within the monophyletic group in either COI or Cytb data sets.
45 31 Figure 12 Phylogenetic tree shows relationship between 16 species of snake COI gene.
46 32 Figure 13 Phylogenetic tree shows relationship between 16 species of snake Cytb gene. There were nucleotide sequence variation of partial mitochondrial COI and Cytb genes in most snake species in this study, but the mtdna-based identification enabled differentiation between intraspecific and interspecific variation. The level of intraspecific sequence divergence of COI gene was low (0.59%). This is similar to the
47 33 intraspecific sequence divergence of 0.30% reported for N. siamensis (Wuster and Thorpe, 1994). In vertebrates, the sequence divergence of intraspecific variation is about 2%, whereas the sequence divergence of interspecific variation ranges from 4% to 32% (mean = 9.6%; Avise 2000; Hebert et al., 2003). By contrast, the level of sequence divergence of Cytb gene was about 2.22% for intraspecific and 10.47% for interspecific distance (Ophiophagus, Naja, Bungarus, Daboia, Trimeresurus, Hydrophis, Enhydrina, Boiga, Rhabdophis, Calloselasma, and Python) in our snake data set. This result agrees with that obtained for African cobras, for which the range is reported to be 0 11% (Wuster et al., 2007). However, these percentages are high compared with the interspecific distances between mammals and reptiles in general, which are approximately 3% (Johns and Avise, 1998). Among turtles, the intraspecific distances are mostly lower than 1%, with an interspecific divergence rate of more than 8% (Shen et al., 2013). This implies that, in the snake lineage, the mutation rate of the COI gene has been slower than that of the Cytb gene over the course of evolution. In terms of the barcoded cut-off scores for snake identification, these might vary depending on the specimen collection, the gene studied, and its length (Dawnay et al., 2007). In this study, we applied three analytical methods: (1) 98% identity (Dove et al., 2008; Eaton et al., 2010), (2) 10X rule threshold values (Hebert et al., 2004), and (3) 3% threshold values (Hebert et al., 2003). First of all, the DNA sequences of the unidentified organism must be at least 98% similar to the most common haplotype of the described taxon. However, using this criterion, more than three snake species were misidentified at the intraspecific level regardless of whether the COI or Cytb genes were considered. To employ 10X rule threshold values, the interspecific distance should be 10 times the intraspecific distance in order to differentiate between species. Our standard COI barcode sequence divergence between species within a genus (average: 5.10%) was about 10 times the average divergence within species (0.59%; Table 4). In contrast, the average interspecific sequence divergence of the Cytb gene within each genus (average: 10.47%) was about four times the intraspecific distance (2.22%; Table 5). This result suggests that the interval divergence at the species and genus levels was greater for the COI gene than for the Cytb gene. This indicates that the COI gene may be a more suitable marker than the Cytb gene for species identification in snakes.
48 34 However, the barcoded cut-off scores of the COI barcode were insufficient to differentiate species of Naja spp, and the species in Hydrophiinae which suggests that these species recently diverged from one another (Wüster et al., 2007; Pyron et al., 2013.). Hebert et al. (2003) asserted that, in order to differentiate among species, interspecific divergence should be at least 3%. This threshold agrees with our COI barcode, which can be used to differentiate all snake species in this study, except for T. macrops, which has a high degree of intraspecific nucleotide divergence (3.6%). To determine the barcoding gap, which can be used to monitor the difference between intraspecific and interspecific divergence, graphic representations were produced by plotting the minimum interspecific divergence on the y axis and the maximum intraspecific divergence on the x axis for both COI and Cytb barcodes (Rasmussen et al., 2009). There was a distinct barcoding gap between intra- and interspecific divergence, even though the species from Naja and Hydrophiinae were not differentiated using 10X rule threshold values (Figure. 14). However, T. macrops could not be differentiated using the COI barcoding gap, and T. macrops and B. candidus could not be differentiated using the Cytb barcoding gap. One green viper specimen (T. macrops: TMA2) was collected from Nong Bua Lamphu ( N, E) in the northeast of Thailand, whereas the other T.macrops specimens were collected from the central regions. This suggests that the barcoding gap decreased when species were sampled across a broad geographic area, owing to intraspecific divergence. While BI clustering analyses of both COI and Cytb indicated that most species of the same genus and family clustered together, one T. macrops individual (TMA2) was positioned in the clade of T. albolabris (Figure 12, 13). The snakes in the genus Trimeresurus (Asian green pit vipers) are one of the most diverse radiations of pit vipers; they inhabit southern Asia and the Indo Malay Archipelago. The species complex is remarkable for its extreme morphological similarity, occupies a wide range of ecological habitats, and exhibits diverse life histories and behaviors (Malhotra et al., 2011). Our results suggest that the Trimeresurus species complex has frequently been misidentified. Interspecific divergence of the COI gene between TMA2 and two T. albolabris individuals was 1%, whereas divergence between TMA2 and other T. macrops specimens was 13% 15% for the COI gene. These results collectively suggest that TMA2 is a variant of T. albolabris
49 35 or is a cryptic species that is closely related to T. albolabris. However, morphologic studies and more specimens are needed to examine the barcode of Trimeresurus spp. Figure 14 Dot plot analysis of sequence divergence with COI barcode (a) and Cytb barcode (b). A straight line represents 1:1 ratio between minimum congeneric sequence divergence and maximum intraspecific sequence divergence. Sequence divergences of species which was represented by more than one sample are shown here.
50 36 5. Species-specific multiplex PCR markers Interspecific nucleotide sequence differences were observed to design eight species-specific reverse primers. These primers were paired with the forward primer (COI Forward), and amplified into eight snake groups according to antivenom: Naja spp. (1); O. hannah (2); Trimeresurus spp. (3); Hydrophiidae snakes (4); D. siamensis (5); B. fasciatus (6); B. candidus (7); and C. rhodostoma (8) (Table 2). Whereas the primer NK, OH, BF, DB, TC, HYD, and CR amplified specifically for group (1) (6) and (8), the primer DRS could amplify the two target species, D. siamensis (5) and B. candidus (7). For more efficient analysis, the multiplex-pcr assay was developed to differentiate all eight snake groups with two sequential panels. Each multiplex PCR panel allows the rapid identification between individuals assigned to each of the groups. Firstly, the multiplex PCR (panel A) was performed using three speciesspecific primers: HYD, TC, and DRS in combination with COI Forward (used as common forward primer) allowing the following diagnostic bands: (i) one bands of 418 bp for snakes in Hydrophiidae (4), (ii) one band of 277 bp for Trimeresurus spp. (3), and (iii) one band of 621 bp for both D. siamensis (5) and B. candidus (7) (Figure 15a). However, cross-reaction was detected in O. hannah with the two DNA bands at 500 and 600 bp, indicating that non-specific band was derived from the combination of multiple primers in the PCR reaction. Secondly, multiplex PCR (panel B) comprised five primers: DB; BF; OH; NK; and CR in combination with COI Forward. The species-specific PCR products of 541 bp, 599 bp, 176 bp, 323 bp, and 400 bp could be observed from D. siamensis (5), B. fasciatus (6), O. hannah (2), Naja spp. (1), and C. rhodostoma (8), respectively, but no PCR products were found from B. candidus (Figure. 15b). However, cross-species amplification was detected in T. macrops with the two DNA bands at 400 and 500 bp, indicating that non-specific bands resulted from the combination of multiple primers in the PCR reaction. Specificity was also performed in both single PCR and multiplex PCR assays by pooling the DNA of all snake species. The results indicated the DNA fragments from all species were specifically detected as mentioned above (Figure 16 and 17). The sensitivity of each species-specific DNA markers and each multiplex PCR markers were examined by detecting the limitation of those specific primers in amplification
51 37 of serially diluted DNA templates from 25, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, , and ng (Figure 18, 19). The results showed that the minimum detection limits was ng for COI Forward-BF primers. By contrast, the limitation of detection for multiplex PCRs was 0.5 ng with the species-specific PCR products of panel A and panel B (Figure 20). Figure 15 Agarose gel eletrophoresis of PCR products using multiplex PCR assays with the primer set 1 (panel A) (a) and 2 (panel B) (b) and DNA extracted from blood. Lane 1 H. brookii. Lane 2 E. schistosa. Lane 3 H.obscurus. Lane 4 T. albolabris. Lane 5 T. macrops. Lane 6 D. siamensis. Lane 7 B. candidus. Lane 8 B. fasciatus. Lane 9 O. hannah. Lane 10 N. siamensis. Lane 11 N. sumatrana. Lane 12 N. kaouthia. Lane 13 C. rhodostoma. Lane 14 Mus musculus. Lane 15 - Homo sapiens.
52 38 Figure 16 Agarose gel eletrophoresis of PCR products using primer COI Forward and (a) HYD Reverse, (b) TC Reverse, (c) DRS Reverse and (d) DB Reverse.Lane 1 H. brookii. Lane 2 E. schistosa. Lane 3 H. obscurus. Lane 4 T. albolabris. Lane 5 T. macrops. Lane 6 D. siamensis. Lane 7 B. candidus. Lane 8 B. fasciatus. Lane 9 O. hannah. Lane 10 N. siamensis. Lane 11 N. sumatrana. Lane 12 N. kaouthia. Lane 13 C. rhodostoma. Lane 14 Mus musculus. Lane 15 - Homo sapiens.
53 39 Figure 17 Agarose gel eletrophoresis of PCR products using primer COI Forward and (a) BF Reverse, (b) OH Reverse, (c) NK Reverse, (d) CR Reverse. Lane 1 H. brookii. Lane 2 E. schistosa. Lane 3 H. obscurus. Lane 4 T. albolabris. Lane 5 T. macrops. Lane 6 D. siamensis. Lane 7 B. candidus. Lane 8 B. fasciatus. Lane 9 O. hannah. Lane 10 N. siamensis. Lane 11 N. sumatrana. Lane 12 N. kaouthia. Lane 13 C. rhodostoma. Lane 14 Mus musculus. Lane 15 - Homo sapiens.
54 40 Table 6. Summary of species-specific multiplex PCR assay. Family Species name Common name Multiplex PCR set Antivenom panel A DNA banded size (bp) panel B DNA banded size (bp) Elapidae Ophiophagus hannah King Cobra a Ophiophagus Elapidae Naja kaouthia Monocled cobra Naja spp. Elapidae Naja sumatrana Sumatran Cobra Naja spp. Elapidae Naja siamensis Indo-Chinese spitting cobra Naja spp. Elapidae Bungarus fasciatus Banded krait Bungarus fasciatus Elapidae Bungarus candidus Malayan krait Bungarus candidus Elapidae Hydrophis brookii Brooke's Sea Snake b Elapidae Hydrophis obscurus Russell's Sea Snake b Elapidae Enhydrina schistosa Beaked sea snake b Viperidae Daboia siamensis Russell's viper Daboia siamensis Viperidae Trimeresurus albolabris White-lipped Pit Viper a - Trimeresurus spp. Viperidae Trimeresurus macrops Big-eyed pit viper a - Trimeresurus spp. Viperidae Calloselasma rhodostoma Malayan pit viper Calloselasma rhodostoma a Non-specific DNA bands are found in the PCR reaction. b There is no any specific antivenom which is available in Thailand. + It is possible to identify with appearance of a specific DNA band. - Impossible to identify.
55 41 Figure 18 Agarose gel eletrophoresis of PCR sensitivity using primer COI Forward and (a) HYD Reverse, (b,c) TC Reverse, (d,e) DRS Reverse. (f,g) DB Reverse Lane 1 25ng. Lane 2 1ng. Lane 3 0.5ng. Lane ng. Lane ng. Lane ng. Lane ng. Lane ng. Lane ng. Lane ng.
56 42 Figure 19 Agarose gel eletrophoresis of PCR sensitivity using primer COI Forward and (a) BF Reverse, (b) OH Reverse, (c,d,e) NK Reverse, (f) CR Reverse. Lane 1 25ng. Lane 2 1ng. Lane 3 0.5ng. Lane ng. Lane ng. Lane ng. Lane ng. Lane ng. Lane ng. Lane ng.
57 43 Figure 20 Agarose gel eletrophoresis of PCR products using multiplex PCR sensitivity assays with the primer set 1 (panel A) (a) and 2 (panel B) (b) and DNA concentration 0.5 ng. Lane 1 H. brookii. Lane 2 E. schistosa. Lane 3 H. obscurus. Lane 4 T. albolabris. Lane 5 T. macrops. Lane 6 D. siamensis. Lane 7 B. candidus. Lane 8 B. fasciatus. Lane 9 O. hannah. Lane 10 N. siamensis. Lane 11 N. sumatrana. Lane 12 N. kaouthia. Lane 13 C. rhodostoma. Lane 14 Mus musculus. Lane 15 - Homo sapiens. Species-specific multiplex PCR markers were applied to examine with DNA extracted from venom and saliva samples from 10 species (O. hannah, N. kaouthia, B. fasciatus, B. candidus, N. sumatrana, D. siamensis, T. albolabris, T. macrops, C. rhodostoma and N. siamensis) (Figure 21, 22). The results showed that DNA extracted from venom and saliva were consistent with the multiplex PCR with DNA extracted from blood.
58 44 Figure 21 Agarose gel eletrophoresis of PCR products using multiplex PCR assays with the primer set 1 (panel A) (a) and 2 (panel B) (b) and DNA extracted from venom. Lane 1 T. albolabris. Lane 2 T. macrops. Lane 3 D. siamensis. Lane 4 B. candidus. Lane 5 B. fasciatus. Lane 6 O. hannah. Lane 7 N. siamensis. Lane 8 N. sumatrana. Lane 9 N. kaouthia. Lane 10 C. rhodostoma. Lane 11 Mus musculus. Lane 12 Homo sapiens.
59 45 Figure 22 Agarose gel eletrophoresis of PCR products using multiplex PCR assays with the primer set 1 (panel A) (a) and 2 (panel B) (b) and DNA extracted from saliva. Lane 1 T. albolabris. Lane 2 T. macrops. Lane 3 D. siamensis. Lane 4 B. candidus. Lane 5 B. fasciatus. Lane 6 O. hannah. Lane 7 N. siamensis. Lane 8 N. sumatrana. Lane 9 N. kaouthia. Lane 10 C. rhodostoma. Lane 11 Mus musculus. Lane 12 Homo sapiens. Species-specific multiplex PCR markers were applied to examine with DNA extracted from snake bite-site swabs (Figure 23). The results showed that DNA extracted from bite-site swabs were not consistent with the multiplex PCR with DNA
60 46 extracted from blood. This might result from low amont and quality of gdna from snake bite-site swabs. The new primers should be designed to amplify the PCR product of smaller sizes for easier and better amplification.
61 47 Figure 23 Agarose gel eletrophoresis of PCR products using multiplex PCR assays with the primer set 1 (panel A) (a) and 2 (panel B) (b). DNA extracted from bite-site swabs with DNA concentration 2 ug. Lane 1-3 T. albolabris. Lane 4-6 T. macrops. Lane 7-9 D. siamensis. Lane B. candidus. Lane B. fasciatus. Lane O. hannah. Lane N. siamensis. Lane N. sumatrana. Lane N. kaouthia. Lane C. rhodostoma. To develop DNA marker to differentiate among snakes for which antivenom is available in Thailand, Species-distinguishing sites were investigated in the COI barcode for snake identification. Eight DNA markers (HYD, TC, DRS, DB, BF, OH, NK and CR) were designed based on distinctive sites of COI sequences. These markers were successfully used to distinguish Naja spp (1), O. hannah (2),
Banded Krait Venomous Deadly
Banded Krait Venomous Deadly Yellow and black Banded Krait (Bungarus fasciatus) venomous and deadly. Copyright Tom Charlton. These are yellow and black kraits here in Thailand. In some other part of the
More informationPCR detection of Leptospira in. stray cat and
PCR detection of Leptospira in 1 Department of Pathology, School of Veterinary Medicine, Islamic Azad University, Shahrekord Branch, Shahrekord, Iran 2 Department of Microbiology, School of Veterinary
More informationMalayan Pit Viper Venomous Very Dangerous
Malayan Pit Viper Venomous Very Dangerous Adult Malayan Pit Viper in situ, found in a culvert in Krabi, Thailand. [Page Updated: 4 April 2018] Calloselasma rhodostoma (Malayan Pit Viper, Malaysian Pit
More information5 Dangerous Venom Types Thailand Snakes. Thailand Snake Venom Types:
5 Dangerous Venom Types Thailand Snakes Snakes in Thailand have different types of venom that affect you in different ways if you are bitten and venom is inside your bloodstream (envenomation). Here are
More informationLecture 11 Wednesday, September 19, 2012
Lecture 11 Wednesday, September 19, 2012 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean
More informationTitle: Phylogenetic Methods and Vertebrate Phylogeny
Title: Phylogenetic Methods and Vertebrate Phylogeny Central Question: How can evolutionary relationships be determined objectively? Sub-questions: 1. What affect does the selection of the outgroup have
More informationSNAKES. CITES Identification manual. Tentative tool for Thai CITES officers TANYA CHAN-ARD. Compiled by
SNAKES CITES Identification manual Tentative tool for Thai CITES officers Compiled by TANYA CHAN-ARD NATIONAL SCIENCE MUSEUM MINISTRY OF SCIENCE AND TECHNOLOGY CLASSIFICATION ORDER SQUAMATA SUBORDER SERPENTES
More informationModern Evolutionary Classification. Lesson Overview. Lesson Overview Modern Evolutionary Classification
Lesson Overview 18.2 Modern Evolutionary Classification THINK ABOUT IT Darwin s ideas about a tree of life suggested a new way to classify organisms not just based on similarities and differences, but
More informationCLADISTICS Student Packet SUMMARY Phylogeny Phylogenetic trees/cladograms
CLADISTICS Student Packet SUMMARY PHYLOGENETIC TREES AND CLADOGRAMS ARE MODELS OF EVOLUTIONARY HISTORY THAT CAN BE TESTED Phylogeny is the history of descent of organisms from their common ancestor. Phylogenetic
More informationPhotos. Photos Collection COBRA SNAKE PHOTOS. King Cobra (Ophiophagus hannah) [Page Updated: 8 May 2017]
Thailand Photos Venomous Snake Thailand Venomous Photos Collection Snake [Page Updated: 8 May 2017] COBRA SNAKE PHOTOS King Cobra (Ophiophagus hannah) This is the longest venomous snake on the planet,
More informationPhylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA.
Zoology Department Phylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA By HAGAR IBRAHIM HOSNI BAYOUMI A thesis submitted in
More informationCh 1.2 Determining How Species Are Related.notebook February 06, 2018
Name 3 "Big Ideas" from our last notebook lecture: * * * 1 WDYR? Of the following organisms, which is the closest relative of the "Snowy Owl" (Bubo scandiacus)? a) barn owl (Tyto alba) b) saw whet owl
More informationThe Most Venomous Dangerous Deadly Poisonous Snakes?
The Most Venomous Dangerous Deadly Poisonous Snakes? Venomous and somewhat dangerous, but not deadly or poisonous, Trimeresurus venustus the beautiful pit viper, aka, the brown-spotted pit viper. This
More information17.2 Classification Based on Evolutionary Relationships Organization of all that speciation!
Organization of all that speciation! Patterns of evolution.. Taxonomy gets an over haul! Using more than morphology! 3 domains, 6 kingdoms KEY CONCEPT Modern classification is based on evolutionary relationships.
More informationCladistics (reading and making of cladograms)
Cladistics (reading and making of cladograms) Definitions Systematics The branch of biological sciences concerned with classifying organisms Taxon (pl: taxa) Any unit of biological diversity (eg. Animalia,
More informationSpecies: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum: Chordata
CHAPTER 6: PHYLOGENY AND THE TREE OF LIFE AP Biology 3 PHYLOGENY AND SYSTEMATICS Phylogeny - evolutionary history of a species or group of related species Systematics - analytical approach to understanding
More informationVenomous Mildly Dangerous. Mangrove Cat Snake Boiga dendrophila
Banded Mangrove Snake Venomous Mildly Dangerous One of the B dendrophila snakes I ve found at night in the tropical secondary rainforest in Southern Thailand, Krabi Province. (Page Updated: 6 September
More informationVIPERIDAE. Adult Teo Eng Wah. Wirot's Palm Pit Viper (EN) Trimeresurus wiroti. MyBIS: IUCN Red List GPAV HPAV. Least Concern (LC)
VIPERIDAE MyBIS: 53772 IUCN Red List Least Concern (LC) GPAV HPAV Wirot's Palm Pit Viper (EN) Trimeresurus wiroti 70 Gernot Vogel 71 VIPERIDAE Female MyBIS: 57443 IUCN Red List Least Concern (LC) GPAV
More informationThe Rufford Foundation Final Report
The Rufford Foundation Final Report Congratulations on the completion of your project that was supported by The Rufford Foundation. We ask all grant recipients to complete a Final Report Form that helps
More informationSuper Toxic Thailand Sea Snakes
Super Toxic Thailand Sea Snakes Laticauda colubrina. Also known as colubrine sea krait or yellow-lipped sea krait. 2012 Elias Levy at Flickr.com. THAILAND SEA SNAKES CRUCIAL INFORMATION Thailand is surrounded,
More informationBrown Kukri Snake Non Venomous Not Dangerous
Brown Kukri Snake Non Venomous Not Dangerous Kukri Snake Non Venomous Not Dangerous Oligodon purpurascens (Brown Kukri Snake) Thais say: Ngoo koot Appearance: Typical kukri shape not long, but thick snakes
More informationName Kornsorn Srikulnath Position Lecturer (Kasetsart University) Researcher (Reptile Cytogenetics, Nagoya University)
Name Kornsorn Srikulnath Position Lecturer (Kasetsart University) Researcher (Reptile Cytogenetics, Nagoya University) Associate Editor of Thai Journal of Genetics Tel. +66-25625444 ext.4240 Email address:
More informationTaxonomy. Chapter 20. Evolutionary Development Diagram. I. Evolution 2/24/11. Kingdom - Animalia Phylum - Chordata Class Reptilia.
Taxonomy Chapter 20 Reptiles Kingdom - Animalia Phylum - Chordata Class Reptilia Order Testudines - turtles Order Crocodylia - crocodiles, alligators Order Sphenodontida - tuataras Order Squamata - snakes
More informationPARTIAL REPORT. Juvenile hybrid turtles along the Brazilian coast RIO GRANDE FEDERAL UNIVERSITY
RIO GRANDE FEDERAL UNIVERSITY OCEANOGRAPHY INSTITUTE MARINE MOLECULAR ECOLOGY LABORATORY PARTIAL REPORT Juvenile hybrid turtles along the Brazilian coast PROJECT LEADER: MAIRA PROIETTI PROFESSOR, OCEANOGRAPHY
More informationIndochinese Rat Snake Non Venomous Not Dangerous
Indochinese Rat Snake Non Venomous Not Dangerous Extra beautiful after hatching the Indo-Chinese rat snake juvenile doesn t resemble most of the adults which turn dark brown, grey, or black as they mature.
More informationmuscles (enhancing biting strength). Possible states: none, one, or two.
Reconstructing Evolutionary Relationships S-1 Practice Exercise: Phylogeny of Terrestrial Vertebrates In this example we will construct a phylogenetic hypothesis of the relationships between seven taxa
More informationUNIT III A. Descent with Modification(Ch19) B. Phylogeny (Ch20) C. Evolution of Populations (Ch21) D. Origin of Species or Speciation (Ch22)
UNIT III A. Descent with Modification(Ch9) B. Phylogeny (Ch2) C. Evolution of Populations (Ch2) D. Origin of Species or Speciation (Ch22) Classification in broad term simply means putting things in classes
More informationClass Reptilia Testudines Squamata Crocodilia Sphenodontia
Class Reptilia Testudines (around 300 species Tortoises and Turtles) Squamata (around 7,900 species Snakes, Lizards and amphisbaenids) Crocodilia (around 23 species Alligators, Crocodiles, Caimans and
More informationGeo 302D: Age of Dinosaurs LAB 4: Systematics Part 1
Geo 302D: Age of Dinosaurs LAB 4: Systematics Part 1 Systematics is the comparative study of biological diversity with the intent of determining the relationships between organisms. Humankind has always
More informationVENOMOUS SNAKE BITES IN LAO PDR: A RETROSPECTIVE STUDY OF 21 SNAKEBITE VICTIMS IN A PROVINCIAL HOSPITAL
VENOMOUS SNAKEBITES IN LAO PDR VENOMOUS SNAKE BITES IN LAO PDR: A RETROSPECTIVE STUDY OF 21 SNAKEBITE VICTIMS IN A PROVINCIAL HOSPITAL Joerg Blessmann, Chanhom Khonesavanh, Phanalone Outhaithit, Saikham
More information2. Introduction. 2.1 Venomous snakes of Southeast Asia The venom apparatus (Fig 2) Classification
2. Introduction 2.1 Venomous snakes of Southeast Asia 2.1.1 The venom apparatus (Fig 2) Venomous snakes of medical importance have a pair of enlarged teeth, the fangs, at the front of their upper jaw.
More informationKazumi Matsubara 1,2,5*, Chizuko Nishida 3, Yoichi Matsuda 2,4 and Yoshinori Kumazawa 1
Matsubara et al. Zoological Letters (2016) 2:19 DOI 10.1186/s40851-016-0056-1 RESEARCH ARTICLE Open Access Sex chromosome evolution in snakes inferred from divergence patterns of two gametologous genes
More informationMolecular Characterization of Staphylococcus aureus of Camel (Camelus dromedarius) Skin Origin
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 01 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.701.410
More informationCh 34: Vertebrate Objective Questions & Diagrams
Ch 34: Vertebrate Objective Questions & Diagrams Invertebrate Chordates and the Origin of Vertebrates 1. Distinguish between the two subgroups of deuterostomes. 2. Describe the four unique characteristics
More informationSquamates of Connecticut
Squamates of Connecticut Reptilia Turtles are sisters to crocodiles and birds Yeah, birds are reptiles, haven t you watched Jurassic Park yet? Lizards and snakes are part of one clade called the squamates
More informationWorst Snake To Be Bitten By in Thailand? The King Cobra
Worst Snake To Be Bitten By in Thailand? The King Cobra This is a tough call because Thailand has a few snakes that could kill you within a couple hours if you weren t able to reach medical care quickly
More informationCh. 17: Classification
Ch. 17: Classification Who is Carolus Linnaeus? Linnaeus developed the scientific naming system still used today. Taxonomy What is? the science of naming and classifying organisms. A taxon group of organisms
More informationA Mitochondrial DNA Phylogeny of Extant Species of the Genus Trachemys with Resulting Taxonomic Implications
NOTES AND FIELD REPORTS 131 Chelonian Conservation and Biology, 2008, 7(1): 131 135 Ó 2008 Chelonian Research Foundation A Mitochondrial DNA Phylogeny of Extant Species of the Genus Trachemys with Resulting
More informationHematozoa of Snakes in Queen Saovabha Memorial Institute
Kasetsart J. (Nat. Sci.) 35 : 149-156 (2001) Hematozoa of Snakes in Queen Saovabha Memorial Institute Jarernsak Salakij 1, Chaleow Salakij 1, Nual-Anong Narkkong 2, Lawan Chanhome 3, Nirachra Rochanapat
More informationMalayan Krait Blue Krait Bungarus candidus Highly Toxic Venom
Malayan Krait Blue Krait Bungarus candidus Highly Toxic Venom Adult Malayan (Blue) Krait from Thailand. These are common across much of the country, and have a very potent neurotoxic venom. Contact with
More informationBio 1B Lecture Outline (please print and bring along) Fall, 2006
Bio 1B Lecture Outline (please print and bring along) Fall, 2006 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #4 -- Phylogenetic Analysis (Cladistics) -- Oct.
More informationAre Turtles Diapsid Reptiles?
Are Turtles Diapsid Reptiles? Jack K. Horner P.O. Box 266 Los Alamos NM 87544 USA BIOCOMP 2013 Abstract It has been argued that, based on a neighbor-joining analysis of a broad set of fossil reptile morphological
More informationPeng GUO 1, 2*, Qin LIU 1, 2, Jiatang LI 3, Guanghui ZHONG 2, Yueying CHEN 3 and Yuezhao WANG Introduction. 2. Material and Methods
Asian Herpetological Research 2012, 3(4): 334 339 DOI: 10.3724/SP.J.1245.2012.00334 Catalogue of the Type Specimens of Amphibians and Reptiles in the Herpetological Museum of the Chengdu Institute of Biology,
More informationEvolutionary Trade-Offs in Mammalian Sensory Perceptions: Visual Pathways of Bats. By Adam Proctor Mentor: Dr. Emma Teeling
Evolutionary Trade-Offs in Mammalian Sensory Perceptions: Visual Pathways of Bats By Adam Proctor Mentor: Dr. Emma Teeling Visual Pathways of Bats Purpose Background on mammalian vision Tradeoffs and bats
More informationVertebrate Structure and Function
Vertebrate Structure and Function Part 1 - Comparing Structure and Function Classification of Vertebrates a. Phylum: Chordata Common Characteristics: Notochord, pharyngeal gill slits, hollow dorsal nerve
More informationMedical Genetics and Diagnosis Lab #3. Gel electrophoresis
Medical Genetics and Diagnosis Lab #3 Gel electrophoresis Background Information Gel electrophoresis is the standard lab procedure for separating DNA by size (e.g. length in base pairs) for visualization
More informationCERTIFIED REFERENCE MATERIAL IRMM 313
EUROPEAN COMMISSION JOINT RESEARCH CENTRE Institute for Reference Materials and Measurements (Geel) CERTIFIED REFERENCE MATERIAL IRMM 313 CERTIFICATE OF ANALYSIS PFGE AGAROSE PLUGS Certified value 2) SmaI
More informationKing Cobra Facts (ง จง อา ง) Size Diet Bite. KING COBRA FACTS (Ophiophagus hannah Thailand King Cobra)
King Cobra Facts (ง จง อา ง) Size Diet Bite One of the most interesting snakes in the world, the King Cobra (Ophiophagus hannah). KING COBRA FACTS (Ophiophagus hannah Thailand King Cobra) In Greek, snake
More informationREPTILES. Scientific Classification of Reptiles To creep. Kingdom: Animalia Phylum: Chordata Subphylum: Vertebrata Class: Reptilia
Scientific Classification of Reptiles To creep Kingdom: Animalia Phylum: Chordata Subphylum: Vertebrata Class: Reptilia REPTILES tetrapods - 4 legs adapted for land, hip/girdle Amniotes - animals whose
More informationWagler s Pit Viper Venomous Dangerous
Wagler s Pit Viper Venomous Dangerous Tropidolaemus wagleri Wagler s Pit Viper Dangerous and potentially deadly bites. Tropidolaemus wagleri also called: Wagler s Pit viper; temple viper; bamboo snake;
More informationJohn moved the snake from his patio over a wall separating his house from some heavy bush.
Thailand Snake Photos Malayan Pit Viper Deadly, and cytotoxic venom which destroys all tissue even bone. This lovely 1 meter long Malayan Pit Viper was submitted by a reader of Thailand Snakes (.com),
More informationLAND SNAKES OF MEDICAL SIGNIFICANCE IN MALAYSIA
LAND SNAKES OF MEDICAL SIGNIFICANCE IN MALAYSIA Ahmad Khaldun Ismail, Teo Eng Wah, Indraneil Das, Taksa Vasaruchapong & Scott A. Weinstein 1 LAND SNAKES OF MEDICAL SIGNIFICANCE IN MALAYSIA Ahmad Khaldun
More informationWhat is the evidence for evolution?
What is the evidence for evolution? 1. Geographic Distribution 2. Fossil Evidence & Transitional Species 3. Comparative Anatomy 1. Homologous Structures 2. Analogous Structures 3. Vestigial Structures
More information6. The lifetime Darwinian fitness of one organism is greater than that of another organism if: A. it lives longer than the other B. it is able to outc
1. The money in the kingdom of Florin consists of bills with the value written on the front, and pictures of members of the royal family on the back. To test the hypothesis that all of the Florinese $5
More informationSystematics and taxonomy of the genus Culicoides what is coming next?
Systematics and taxonomy of the genus Culicoides what is coming next? Claire Garros 1, Bruno Mathieu 2, Thomas Balenghien 1, Jean-Claude Delécolle 2 1 CIRAD, Montpellier, France 2 IPPTS, Strasbourg, France
More informationAnimal Diversity III: Mollusca and Deuterostomes
Animal Diversity III: Mollusca and Deuterostomes Objectives: Be able to identify specimens from the main groups of Mollusca and Echinodermata. Be able to distinguish between the bilateral symmetry on a
More information1 Describe the anatomy and function of the turtle shell. 2 Describe respiration in turtles. How does the shell affect respiration?
GVZ 2017 Practice Questions Set 1 Test 3 1 Describe the anatomy and function of the turtle shell. 2 Describe respiration in turtles. How does the shell affect respiration? 3 According to the most recent
More informationKINGDOM ANIMALIA Phylum Chordata Subphylum Vertebrata Class Reptilia
KINGDOM ANIMALIA Phylum Chordata Subphylum Vertebrata Class Reptilia Vertebrate Classes Reptiles are the evolutionary base for the rest of the tetrapods. Early divergence of mammals from reptilian ancestor.
More informationEvidence for Evolution by Natural Selection. Hunting for evolution clues Elementary, my dear, Darwin!
Evidence for Evolution by Natural Selection Hunting for evolution clues Elementary, my dear, Darwin! 2006-2007 Evidence supporting evolution Fossil record shows change over time Anatomical record comparing
More information(D) fertilization of eggs immediately after egg laying
Name: ACROSS DOWN 24. The amniote egg (A) requires a moist environment for egg laying (B) lacks protective structures for the embryo (C) has membranes enclosing the developing embryo (D) evolved from the
More informationYour web browser (Safari 7) is out of date. For more security, comfort and the best experience on this site: Update your browser Ignore
Your web browser (Safari 7) is out of date. For more security, comfort and the best experience on this site: Update your browser Ignore Activitydevelop EXPLO RING VERTEBRATE CL ASSIFICATIO N What criteria
More informationFastest King Cobra Planet? (Video)
Fastest King Cobra Planet? (Video) on the It s a sensational headline, but I thought it was important that you read this if you handle venomous snakes at all and even if you don t. (King cobra video below)
More informationInterpreting Evolutionary Trees Honors Integrated Science 4 Name Per.
Interpreting Evolutionary Trees Honors Integrated Science 4 Name Per. Introduction Imagine a single diagram representing the evolutionary relationships between everything that has ever lived. If life evolved
More information. Analgesics and antipyretics (tabkt mefanemic acid
Inti. Chem. Phalli!. Med. J. Vol. 1(2), pp.123-129 (2004) STUDY OF SNAKEBITE CASES ADMITTED IN NPCC, KARACHI FROM JANUARY 1999 TO DECEMBER 2002 Aftab Turabi1, Mansoor Ahmad2 and Kamran Ahmad Chishti3 J
More informationDO NOT ATTEMPT TO CAPTURE OR HANDLE SNAKES
Advanced Snakes & Reptiles 1 Module # 4 Component # 1 Capturing and Handling This is not a snake Capture or Handling course. This course in no way encourages, teaches, trains, supports, persuades or promotes
More informationPhylogeny Reconstruction
Phylogeny Reconstruction Trees, Methods and Characters Reading: Gregory, 2008. Understanding Evolutionary Trees (Polly, 2006) Lab tomorrow Meet in Geology GY522 Bring computers if you have them (they will
More informationVolume 2 Number 1, July 2012 ISSN:
Volume 2 Number 1, July 2012 ISSN: 229-9769 Published by Faculty of Resource Science and Technology Borneo J. Resour. Sci. Tech. (2012) 2: 20-27 Molecular Phylogeny of Sarawak Green Sea Turtle (Chelonia
More informationHistory of Lineages. Chapter 11. Jamie Oaks 1. April 11, Kincaid Hall 524. c 2007 Boris Kulikov boris-kulikov.blogspot.
History of Lineages Chapter 11 Jamie Oaks 1 1 Kincaid Hall 524 joaks1@gmail.com April 11, 2014 c 2007 Boris Kulikov boris-kulikov.blogspot.com History of Lineages J. Oaks, University of Washington 1/46
More informationIntroduction to phylogenetic trees and tree-thinking Copyright 2005, D. A. Baum (Free use for non-commercial educational pruposes)
Introduction to phylogenetic trees and tree-thinking Copyright 2005, D. A. Baum (Free use for non-commercial educational pruposes) Phylogenetics is the study of the relationships of organisms to each other.
More informationCOMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST
Big Idea 1 Evolution INVESTIGATION 3 COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST How can bioinformatics be used as a tool to determine evolutionary relationships and to
More informationCo-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli 4
SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16176 DOI: 10.1038/NMICROBIOL.2016.176 Co-transfer of bla NDM-5 and mcr-1 by an IncX3 X4 hybrid plasmid in Escherichia coli 4 5 6 7 8 9 10 11 12 13 14 15 16 17
More informationOrigin and Evolution of Birds. Read: Chapters 1-3 in Gill but limited review of systematics
Origin and Evolution of Birds Read: Chapters 1-3 in Gill but limited review of systematics Review of Taxonomy Kingdom: Animalia Phylum: Chordata Subphylum: Vertebrata Class: Aves Characteristics: wings,
More informationPROBE DESIGN FOR ENVIRONMENTAL DNA DETECTION OF CHELODINA OBLONGA IN THE CAPE YORK REGION
edna Probe Design for Chelodina oblonga -TropWATER Report no. 17/36 PROBE DESIGN FOR ENVIRONMENTAL DNA DETECTION OF CHELODINA OBLONGA IN THE CAPE YORK REGION Roger Huerlimann, Agnès Le Port, Damien Burrows,
More informationProtein profile analysis of Malaysian snake venoms by two-dimensional gel electrophoresis
The Journal of Venomous Animals and Toxins including Tropical Diseases ISSN 1678-9199 2010 volume 16 issue 4 pages 623-630 Original Paper Protein profile analysis of Malaysian snake venoms by two-dimensional
More informationGenotypes of Cornel Dorset and Dorset Crosses Compared with Romneys for Melatonin Receptor 1a
Genotypes of Cornell Dorset and Dorset Crosses Compared with Romneys for Melatonin Receptor 1a By Christian Posbergh Cornell Undergraduate Honor Student, Dept. Animal Science Abstract: Sheep are known
More informationEvolution as Fact. The figure below shows transitional fossils in the whale lineage.
Evolution as Fact Evolution is a fact. Organisms descend from others with modification. Phylogeny, the lineage of ancestors and descendants, is the scientific term to Darwin's phrase "descent with modification."
More informationWarm-Up: Fill in the Blank
Warm-Up: Fill in the Blank 1. For natural selection to happen, there must be variation in the population. 2. The preserved remains of organisms, called provides evidence for evolution. 3. By using and
More informationTesting Phylogenetic Hypotheses with Molecular Data 1
Testing Phylogenetic Hypotheses with Molecular Data 1 How does an evolutionary biologist quantify the timing and pathways for diversification (speciation)? If we observe diversification today, the processes
More informationProf. Neil. J.L. Heideman
Prof. Neil. J.L. Heideman Position Office Mailing address E-mail : Vice-dean (Professor of Zoology) : No. 10, Biology Building : P.O. Box 339 (Internal Box 44), Bloemfontein 9300, South Africa : heidemannj.sci@mail.uovs.ac.za
More informationWhat are taxonomy, classification, and systematics?
Topic 2: Comparative Method o Taxonomy, classification, systematics o Importance of phylogenies o A closer look at systematics o Some key concepts o Parts of a cladogram o Groups and characters o Homology
More informationCopyright is owned by the Author of the thesis. Permission is given for a copy to be downloaded by an individual for the purpose of research and
Copyright is owned by the Author of the thesis. Permission is given for a copy to be downloaded by an individual for the purpose of research and private study only. The thesis may not be reproduced elsewhere
More informationSquamates of Connecticut. May 11th 2017
Squamates of Connecticut May 11th 2017 Announcements Should have everyone s hypotheses in my inbox Did anyone else not receive my feedback? Assignment #3, Project Proposal, due tomorrow at 5pm Next week:
More informationSEASONAL DIVERSITY AND POPULATION DYNAMICS OF OPHIDIAN FAUNA IN BULDHANA DISTRICT MAHARASTRA INDIA
Indian J.Sci.Res. 6(1) : 3-8, 015 SEASONAL DIVERSITY AND POPULATION DYNAMICS OF OPHIDIAN FAUNA IN BULDHANA DISTRICT MAHARASTRA INDIA a b1 c P. S. JOSHI, V. T. TANTARPALE AND K. M. KULKARNI ISSN : 0976-876
More informationField Herpetology Final Guide
Field Herpetology Final Guide Questions with more complexity will be worth more points Incorrect spelling is OK as long as the name is recognizable ( by the instructor s discretion ) Common names will
More informationClass Reptilia. Lecture 19: Animal Classification. Adaptations for life on land
Lecture 19: Animal Classification Class Reptilia Adaptations for life on land بيض جنيني egg. Amniotic Water-tight scales. One occipital condyle one point of attachement of the skull with the vertebral
More informationEvolution. Evolution is change in organisms over time. Evolution does not have a goal; it is often shaped by natural selection (see below).
Evolution Evolution is change in organisms over time. Evolution does not have a goal; it is often shaped by natural selection (see below). Species an interbreeding population of organisms that can produce
More informationTOPIC CLADISTICS
TOPIC 5.4 - CLADISTICS 5.4 A Clades & Cladograms https://upload.wikimedia.org/wikipedia/commons/thumb/4/46/clade-grade_ii.svg IB BIO 5.4 3 U1: A clade is a group of organisms that have evolved from a common
More informationWhat is a dinosaur? Reading Practice
Reading Practice What is a dinosaur? A. Although the name dinosaur is derived from the Greek for "terrible lizard", dinosaurs were not, in fact, lizards at all. Like lizards, dinosaurs are included in
More informationHIGLEY UNIFIED SCHOOL DISTRICT INSTRUCTIONAL ALIGNMENT. Zoology Quarter 3. Animal Behavior (Duration 2 Weeks)
HIGLEY UNIFIED SCHOOL DISTRICT INSTRUCTIONAL ALIGNMENT Zoology Quarter 3 Animal Behavior (Duration 2 Weeks) Big Idea: Essential Questions: 1. Compare and contrast innate and learned behavior 2. Compare
More informationComparing DNA Sequences Cladogram Practice
Name Period Assignment # See lecture questions 75, 122-123, 127, 137 Comparing DNA Sequences Cladogram Practice BACKGROUND Between 1990 2003, scientists working on an international research project known
More informationBayesian mixed models and the phylogeny of pitvipers (Viperidae: Serpentes)
Molecular Phylogenetics and Evolution 39 (2006) 91 110 www.elsevier.com/locate/ympev Bayesian mixed models and the phylogeny of pitvipers (Viperidae: Serpentes) Todd A. Castoe, Christopher L. Parkinson
More informationNAME: DATE: SECTION:
NAME: DATE: SECTION: MCAS PREP PACKET EVOLUTION AND BIODIVERSITY 1. Which of the following observations best supports the conclusion that dolphins and sharks do not have a recent common ancestor? A. Dolphins
More informationMay 10, SWBAT analyze and evaluate the scientific evidence provided by the fossil record.
May 10, 2017 Aims: SWBAT analyze and evaluate the scientific evidence provided by the fossil record. Agenda 1. Do Now 2. Class Notes 3. Guided Practice 4. Independent Practice 5. Practicing our AIMS: E.3-Examining
More informationIn the first half of the 20th century, Dr. Guido Fanconi published detailed clinical descriptions of several heritable human diseases.
In the first half of the 20th century, Dr. Guido Fanconi published detailed clinical descriptions of several heritable human diseases. Two disease syndromes were named after him: Fanconi Anemia and Fanconi
More informationGEODIS 2.0 DOCUMENTATION
GEODIS.0 DOCUMENTATION 1999-000 David Posada and Alan Templeton Contact: David Posada, Department of Zoology, 574 WIDB, Provo, UT 8460-555, USA Fax: (801) 78 74 e-mail: dp47@email.byu.edu 1. INTRODUCTION
More informationCarphophis amoenus Family Colubridae Subfamily Xenodontidae
Carphophis amoenus Family Colubridae Subfamily Xenodontidae Small snakes adapted for fossorial life Reduced eyes with a narrow head Tail short and sharply pointed Dorsal scales smooth Anal plate divided
More informationEOQ 3 Exam Review. Genetics: 1. What is a phenotype? 2. What is a genotype?
EOQ 3 Exam Review Genetics: 1. What is a phenotype? 2. What is a genotype? 3. The allele for freckles (f) is recessive to not having freckles (F). Both parents have freckles but only 3 of their 4 children
More informationStuart S. Sumida Biology 342. Simplified Phylogeny of Squamate Reptiles
Stuart S. Sumida Biology 342 Simplified Phylogeny of Squamate Reptiles Amphibia Amniota Seymouriamorpha Diadectomorpha Synapsida Parareptilia Captorhinidae Diapsida Archosauromorpha Reptilia Amniota Amphibia
More informationOrigin and Evolution of Birds. Read: Chapters 1-3 in Gill but limited review of systematics
Origin and Evolution of Birds Read: Chapters 1-3 in Gill but limited review of systematics Review of Taxonomy Kingdom: Animalia Phylum: Chordata Subphylum: Vertebrata Class: Aves Characteristics: wings,
More informationDynamic evolution of venom proteins in squamate reptiles. Nicholas R. Casewell, Gavin A. Huttley and Wolfgang Wüster
Dynamic evolution of venom proteins in squamate reptiles Nicholas R. Casewell, Gavin A. Huttley and Wolfgang Wüster Supplementary Information Supplementary Figure S1. Phylogeny of the Toxicofera and evolution
More information