Dinophysis Nguyen Van Nguyen RESEARCH INSTITUTE FOR MARINE FISHERIES, VIETNAM

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Dinophysis Nguyen Van Nguyen RESEARCH INSTITUTE FOR MARINE FISHERIES, VIETNAM"

Transcription

1 WESTPAC workshop on the development of a research strategy for Harmful Algal Blooms Toward the future development of HAB science in the Western Pacific What we know, and what we do not know on HABs Dinophysis Nguyen Van Nguyen RESEARCH INSTITUTE FOR MARINE FISHERIES, VIETNAM Institute of Oceanography, Nha Trang, Vietnam, December 2016

2 1-1. List of known toxic species (in the world) 1-2. List of toxic species in the region, and distribution Species Distribute in the region Toxins 1 Dinophysis acuminata Claparède & Lachmann, Japan, New-zealand DTX1, PTX2 2 Dinophysis acuta Ehrenberg, 39 New-zealand OA, DTX1, DTX2, PTX2, PTX11, PTX12 3 Dinophysis caudata Saville-Kent, 81 Widely ditributed OA, DTX1, PTX2 4 Dinophysis fortii Pavillard, 13 Japan OA, DTX1, PTX2 5 Dinophysis infundibulum J. Schiller, 18 Japan PTX2 6 Dinophysis miles Cleve, 1900 Tropical waters DTX-1 7 Dinophysis sacculus Stein, 83 Europe OA 8 Dinophysis tripos Gourret, 83 Japan DTX1, PTX2, 9 Dinophysis ovum Schütt, 95 Europe, US OA 10 Phalacroma mitra F.Schütt, 95 Tropical DTX1 11 Dinophysis rotundata Claparède & Lachmann, Worldwide OA, DTXs, PTXs Other more than 200 species Not yet analized There are over 200 species described, with few species appeared in high abundance. So far 11 species are known to produce toxins. The rest are unknown in terms of toxin production due to difficulty in having significant numbers of cell because most of them are scare in density and culturing techniques are unavailable yet.

3 1-3 Morphological characters for species identification o Conventional classification is based on cell size and shape, structure of sulcal lists and presence of chloroplast. o These parameters, especially cell size and shape, show wide range of variation within certain species, and the range may overlap among species. o Species boundary is not clear. o Classification needs re-evaluation. 3

4 Polymorphism More and more evidence of species go on morphological deformation process which distorts cell form and leads to interpretation as different species and make classification of boundaries complicated. Ornithocercus Metadinophysis Histioneis Dinophysis 4

5 The need to revise classification of Dinophysis Genus level: Phalacroma vs Dinophysis Species level: Separation

6 Separation of species needed Difference in DNA sequences usually implicates difference in morphology. Thus, DNA sequence is an useful criterion. But this criterion should be applied with caution on the underestimation of the difference. 6

7 At genus level Phalacroma and Dinophysis: merge or separate? Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis caudata Okirai-JP Dinophysis caudata Omura Bay-JP 31.3 Dinophysis caudata Okirai-JP Dinophysis caudata MR.5 Dinophysis caudata Catba-VN Dinophysis caudata Catba-VN Dinophysis caudata Iki Bay-JP Dinophysis caudata MR38.1 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis tripos Miyako-JP Dinophysis tripos French AF3238 Dinophysis tripos Okirai-JP Dinophysis miles NT-VN Dinophysis infundibulus s. Abe AB3746 Dinophysis fortii short MR40.4 Dinophysis fortii short MR40. Dinophysis schroederii MR5.4 Dinophysis fortii short MR40.19 Dinophysis fortii short MR40.5 Dinophysis fortii French AF3236 Dinophysis norvegica Okirai-JP Dinophysis acuminata Tokyo-JP Dinophysis acuminata French AF32 Dinophysis hastata f.e Dinophysis hastata f.c MR24.2 Dinophysis hastata f.c MR.1 Dinophysis whittingae MR40.14 Dinophysis sp MR39.1 Dinophysis argus MR40.17 Dinophysis expulsa MR10.1 Dinophysis infudibulus s.taylor MR17.4 Dinophysis infudibulus s.taylor MR20.4 Dinophysis similis MR17.5 Citharistes regius MR20.1 Citharistes regius MR30.1 Citharistes apsteinii 17.1 Ornithocercus heteroporus Ornithocercus galea MR42.5 Ornithocercus splendidus MR32.4 Ornithocercus magnificus MR14-4 Ornithocercus magnificus MR14-3 Ornithocercus magnificus MR-5 Dinophysis hastata f.a MR7.2 Dinophysis hastata f.b MR14.1 Dinophysis hastata f.a MR30.9 Ornithocercus thumii MR19.1 Ornithocercus quadratus MR7.6 Ornithocercus thumi MR22.1 Ornithocercus thumii MR5.2 Ornithocercus thumii MR22.2 Ornithocercus thumii MR14.2 Ornithocercus thumii MR22.2(2) Ornithocercus quadratus MR Histioneis megalocopa MR40.1 Histioneis megalocopa MR Histioneis highleyi 9.1 Histionesis isseli MR.3 Histionesis sp Histioneis dentata MR34.3 Histioneis crateriformis MR25.8 Histioneis crateriformis MR34.8 Dinophysis amandula MR15.1 Dinophysis amandula MR5.3 Dinophysis parvula MR40.12 Dinophysis rapa MR17.11 Dinophysis sp MR25.5 Oxyphysis oxytoxoides EF6133 Dinophysis cuenus MR33.1 Dinophysis sp1 MR17.9 Dinophysis favus MR20.2 Dinophysis doryphora MR17.8 Dinophysis rotundata French AF3235 Dinophysis rotundata Tokyo-JP Amphisolenia bidentata MR19.3 Amphisolenia bidentata MR19.4 Amphisolenia bidentata MR38.10 Amphisolenia thrinax MR.1 Amphisolenia palaeotheroides MR32.1 Amphisolenia schauinlandii MR38.4 Amphisolenia clavispes MR14.6 Amphisolenia clavispes MR38.8 Metaphalacroma skogsbergii MR31.1 Prorocentrum lima DQ3360 Heterocapsa triquetra AF0401 Alexandrium tamarense AF Dinophysis sensu lato Oxyphysis and former Phalacroma 7

8 A. schauinslandii A. clavipes A. papaeotheroides A. bidentata A. thrinax O. splendidus O. heteroporus O. biclavatus O. magnificus O. magnificus O. steinii O. thumii O. skogsbergii O. quadratus O. galea D. parvula D. rotundata D. elongata D. amandula D. sp. D. argus D. apicata D. cuneus D. favus D. mitra D. rapa D. hindmarchii D. doryphora D. acutissima D. expulsa D. hastata D. sphaerica D. infundibulus D. norvegica D. acuminata D. fortii D. schroederi D. caudata D. tripos D. miles H.megalocopa, H. dolon, H. helenae, H. hippoperoides H. highleyi H. biremis H. crateriformis H. sp. H. isselii H. dentata C. regius C. apsteinii M. skogsbergii P. nasutum P. sp. separate separate, but further data needed merge, but further data needed M. sp. M. sinensis O. oxytoxoides 8

9 Future evolutionary study

10 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis caudata Okirai-JP Dinophysis caudata Omura Bay-JP 31.3 Dinophysis caudata Okirai-JP Dinophysis caudata MR.5 Dinophysis caudata Catba-VN Dinophysis caudata Catba-VN Dinophysis caudata Iki Bay-JP Dinophysis caudata MR38.1 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis tripos Miyako-JP Dinophysis tripos French AF3238 Dinophysis tripos Okirai-JP Dinophysis miles NT-VN Dinophysis infundibulus s. Abe AB3746 Dinophysis fortii short MR40.4 Dinophysis fortii short MR40. Dinophysis schroederii MR5.4 Dinophysis fortii short MR40.19 Dinophysis fortii short MR40.5 Dinophysis fortii French AF3236 Dinophysis norvegica Okirai-JP Dinophysis acuminata Tokyo-JP Dinophysis acuminata French AF32 Dinophysis hastata f.e Dinophysis hastata f.c MR24.2 Dinophysis hastata f.c MR.1 Dinophysis whittingae MR40.14 Dinophysis sp MR39.1 Dinophysis argus MR40.17 Dinophysis expulsa MR10.1 Dinophysis infudibulus s.taylor MR17.4 Dinophysis infudibulus s.taylor MR20.4 Dinophysis similis MR17.5 Citharistes regius MR20.1 Citharistes regius MR30.1 Citharistes apsteinii 17.1 Ornithocercus heteroporus Ornithocercus galea MR42.5 Ornithocercus splendidus MR32.4 Ornithocercus magnificus MR14-4 Ornithocercus magnificus MR14-3 Ornithocercus magnificus MR-5 Dinophysis hastata f.a MR7.2 Dinophysis hastata f.b MR14.1 Dinophysis hastata f.a MR30.9 Ornithocercus thumii MR19.1 Ornithocercus quadratus MR7.6 Ornithocercus thumi MR22.1 Ornithocercus thumii MR5.2 Ornithocercus thumii MR22.2 Ornithocercus thumii MR14.2 Ornithocercus thumii MR22.2(2) Ornithocercus quadratus MR Histioneis megalocopa MR40.1 Histioneis megalocopa MR Histioneis highleyi 9.1 Histionesis isseli MR.3 Histionesis sp Histioneis dentata MR34.3 Histioneis crateriformis MR25.8 Histioneis crateriformis MR34.8 Dinophysis amandula MR15.1 Dinophysis amandula MR5.3 Dinophysis parvula MR40.12 Dinophysis rapa MR17.11 Dinophysis sp MR25.5 Oxyphysis oxytoxoides EF6133 Dinophysis cuenus MR33.1 Dinophysis sp1 MR17.9 Dinophysis favus MR20.2 Dinophysis doryphora MR17.8 Dinophysis rotundata French AF3235 Dinophysis rotundata Tokyo-JP Amphisolenia bidentata MR19.3 Amphisolenia bidentata MR19.4 Amphisolenia bidentata MR38.10 Amphisolenia thrinax MR.1 Amphisolenia palaeotheroides MR32.1 Amphisolenia schauinlandii MR38.4 Amphisolenia clavispes MR14.6 Amphisolenia clavispes MR38.8 Metaphalacroma skogsbergii MR31.1 Prorocentrum lima DQ3360 Heterocapsa triquetra AF0401 Alexandrium tamarense AF Metaphalacroma 10

11 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis caudata Okirai-JP Dinophysis caudata Omura Bay-JP 31.3 Dinophysis caudata Okirai-JP Dinophysis caudata MR.5 Dinophysis caudata Catba-VN Dinophysis caudata Catba-VN Dinophysis caudata Iki Bay-JP Dinophysis caudata MR38.1 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis tripos Miyako-JP Dinophysis tripos French AF3238 Dinophysis tripos Okirai-JP Dinophysis miles NT-VN Dinophysis infundibulus s. Abe AB3746 Dinophysis fortii short MR40.4 Dinophysis fortii short MR40. Dinophysis schroederii MR5.4 Dinophysis fortii short MR40.19 Dinophysis fortii short MR40.5 Dinophysis fortii French AF3236 Dinophysis norvegica Okirai-JP Dinophysis acuminata Tokyo-JP Dinophysis acuminata French AF32 Dinophysis hastata f.e Dinophysis hastata f.c MR24.2 Dinophysis hastata f.c MR.1 Dinophysis whittingae MR40.14 Dinophysis sp MR39.1 Dinophysis argus MR40.17 Dinophysis expulsa MR10.1 Dinophysis infudibulus s.taylor MR17.4 Dinophysis infudibulus s.taylor MR20.4 Dinophysis similis MR17.5 Citharistes regius MR20.1 Citharistes regius MR30.1 Citharistes apsteinii 17.1 Ornithocercus heteroporus Ornithocercus galea MR42.5 Ornithocercus splendidus MR32.4 Ornithocercus magnificus MR14-4 Ornithocercus magnificus MR14-3 Ornithocercus magnificus MR-5 Dinophysis hastata f.a MR7.2 Dinophysis hastata f.b MR14.1 Dinophysis hastata f.a MR30.9 Ornithocercus thumii MR19.1 Ornithocercus quadratus MR7.6 Ornithocercus thumi MR22.1 Ornithocercus thumii MR5.2 Ornithocercus thumii MR22.2 Ornithocercus thumii MR14.2 Ornithocercus thumii MR22.2(2) Ornithocercus quadratus MR Histioneis megalocopa MR40.1 Histioneis megalocopa MR Histioneis highleyi 9.1 Histionesis isseli MR.3 Histionesis sp Histioneis dentata MR34.3 Histioneis crateriformis MR25.8 Histioneis crateriformis MR34.8 Dinophysis amandula MR15.1 Dinophysis amandula MR5.3 Dinophysis parvula MR40.12 Dinophysis rapa MR17.11 Dinophysis sp MR25.5 Oxyphysis oxytoxoides EF6133 Dinophysis cuenus MR33.1 Dinophysis sp1 MR17.9 Dinophysis favus MR20.2 Dinophysis doryphora MR17.8 Dinophysis rotundata French AF3235 Dinophysis rotundata Tokyo-JP Amphisolenia bidentata MR19.3 Amphisolenia bidentata MR19.4 Amphisolenia bidentata MR38.10 Amphisolenia thrinax MR.1 Amphisolenia palaeotheroides MR32.1 Amphisolenia schauinlandii MR38.4 Amphisolenia clavispes MR14.6 Amphisolenia clavispes MR38.8 Metaphalacroma skogsbergii MR31.1 Prorocentrum lima DQ3360 Heterocapsa triquetra AF0401 Alexandrium tamarense AF Amphisolenia spp. 11

12 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis caudata Okirai-JP Dinophysis caudata Omura Bay-JP 31.3 Dinophysis caudata Okirai-JP Dinophysis caudata MR.5 Dinophysis caudata Catba-VN Dinophysis caudata Catba-VN Dinophysis caudata Iki Bay-JP Dinophysis caudata MR38.1 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis tripos Miyako-JP Dinophysis tripos French AF3238 Dinophysis tripos Okirai-JP Dinophysis miles NT-VN Dinophysis infundibulus s. Abe AB3746 Dinophysis fortii short MR40.4 Dinophysis fortii short MR40. Dinophysis schroederii MR5.4 Dinophysis fortii short MR40.19 Dinophysis fortii short MR40.5 Dinophysis fortii French AF3236 Dinophysis norvegica Okirai-JP Dinophysis acuminata Tokyo-JP Dinophysis acuminata French AF32 Dinophysis hastata f.e Dinophysis hastata f.c MR24.2 Dinophysis hastata f.c MR.1 Dinophysis whittingae MR40.14 Dinophysis sp MR39.1 Dinophysis argus MR40.17 Dinophysis expulsa MR10.1 Dinophysis infudibulus s.taylor MR17.4 Dinophysis infudibulus s.taylor MR20.4 Dinophysis similis MR17.5 Citharistes regius MR20.1 Citharistes regius MR30.1 Citharistes apsteinii 17.1 Ornithocercus heteroporus Ornithocercus galea MR42.5 Ornithocercus splendidus MR32.4 Ornithocercus magnificus MR14-4 Ornithocercus magnificus MR14-3 Ornithocercus magnificus MR-5 Dinophysis hastata f.a MR7.2 Dinophysis hastata f.b MR14.1 Dinophysis hastata f.a MR30.9 Ornithocercus thumii MR19.1 Ornithocercus quadratus MR7.6 Ornithocercus thumi MR22.1 Ornithocercus thumii MR5.2 Ornithocercus thumii MR22.2 Ornithocercus thumii MR14.2 Ornithocercus thumii MR22.2(2) Ornithocercus quadratus MR Histioneis megalocopa MR40.1 Histioneis megalocopa MR Histioneis highleyi 9.1 Histionesis isseli MR.3 Histionesis sp Histioneis dentata MR34.3 Histioneis crateriformis MR25.8 Histioneis crateriformis MR34.8 Dinophysis amandula MR15.1 Dinophysis amandula MR5.3 Dinophysis parvula MR40.12 Dinophysis rapa MR17.11 Dinophysis sp MR25.5 Oxyphysis oxytoxoides EF6133 Dinophysis cuenus MR33.1 Dinophysis sp1 MR17.9 Dinophysis favus MR20.2 Dinophysis doryphora MR17.8 Dinophysis rotundata French AF3235 Dinophysis rotundata Tokyo-JP Amphisolenia bidentata MR19.3 Amphisolenia bidentata MR19.4 Amphisolenia bidentata MR38.10 Amphisolenia thrinax MR.1 Amphisolenia palaeotheroides MR32.1 Amphisolenia schauinlandii MR38.4 Amphisolenia clavispes MR14.6 Amphisolenia clavispes MR38.8 Metaphalacroma skogsbergii MR31.1 Prorocentrum lima DQ3360 Heterocapsa triquetra AF0401 Alexandrium tamarense AF Chloroplast holding Dinophysis sensu stricto 12

13 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis caudata Okirai-JP Dinophysis caudata Omura Bay-JP 31.3 Dinophysis caudata Okirai-JP Dinophysis caudata MR.5 Dinophysis caudata Catba-VN Dinophysis caudata Catba-VN Dinophysis caudata Iki Bay-JP Dinophysis caudata MR38.1 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis tripos Miyako-JP Dinophysis tripos French AF3238 Dinophysis tripos Okirai-JP Dinophysis miles NT-VN Dinophysis infundibulus s. Abe AB3746 Dinophysis fortii short MR40.4 Dinophysis fortii short MR40. Dinophysis schroederii MR5.4 Dinophysis fortii short MR40.19 Dinophysis fortii short MR40.5 Dinophysis fortii French AF3236 Dinophysis norvegica Okirai-JP Dinophysis acuminata Tokyo-JP Dinophysis acuminata French AF32 Dinophysis hastata f.e Dinophysis hastata f.c MR24.2 Dinophysis hastata f.c MR.1 Dinophysis whittingae MR40.14 Dinophysis sp MR39.1 Dinophysis argus MR40.17 Dinophysis expulsa MR10.1 Dinophysis infudibulus s.taylor MR17.4 Dinophysis infudibulus s.taylor MR20.4 Dinophysis similis MR17.5 Citharistes regius MR20.1 Citharistes regius MR30.1 Citharistes apsteinii 17.1 Ornithocercus heteroporus Ornithocercus galea MR42.5 Ornithocercus splendidus MR32.4 Ornithocercus magnificus MR14-4 Ornithocercus magnificus MR14-3 Ornithocercus magnificus MR-5 Dinophysis hastata f.a MR7.2 Dinophysis hastata f.b MR14.1 Dinophysis hastata f.a MR30.9 Ornithocercus thumii MR19.1 Ornithocercus quadratus MR7.6 Ornithocercus thumi MR22.1 Ornithocercus thumii MR5.2 Ornithocercus thumii MR22.2 Ornithocercus thumii MR14.2 Ornithocercus thumii MR22.2(2) Ornithocercus quadratus MR Histioneis megalocopa MR40.1 Histioneis megalocopa MR Histioneis highleyi 9.1 Histionesis isseli MR.3 Histionesis sp Histioneis dentata MR34.3 Histioneis crateriformis MR25.8 Histioneis crateriformis MR34.8 Dinophysis amandula MR15.1 Dinophysis amandula MR5.3 Dinophysis parvula MR40.12 Dinophysis rapa MR17.11 Dinophysis sp MR25.5 Oxyphysis oxytoxoides EF6133 Dinophysis cuenus MR33.1 Dinophysis sp1 MR17.9 Dinophysis favus MR20.2 Dinophysis doryphora MR17.8 Dinophysis rotundata French AF3235 Dinophysis rotundata Tokyo-JP Amphisolenia bidentata MR19.3 Amphisolenia bidentata MR19.4 Amphisolenia bidentata MR38.10 Amphisolenia thrinax MR.1 Amphisolenia palaeotheroides MR32.1 Amphisolenia schauinlandii MR38.4 Amphisolenia clavispes MR14.6 Amphisolenia clavispes MR38.8 Metaphalacroma skogsbergii MR31.1 Prorocentrum lima DQ3360 Heterocapsa triquetra AF0401 Alexandrium tamarense AF Ornithocercus 1 Ornithocercus 2 13

14 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis caudata Okirai-JP Dinophysis caudata Omura Bay-JP 31.3 Dinophysis caudata Okirai-JP Dinophysis caudata MR.5 Dinophysis caudata Catba-VN Dinophysis caudata Catba-VN Dinophysis caudata Iki Bay-JP Dinophysis caudata MR38.1 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis tripos Miyako-JP Dinophysis tripos French AF3238 Dinophysis tripos Okirai-JP Dinophysis miles NT-VN Dinophysis infundibulus s. Abe AB3746 Dinophysis fortii short MR40.4 Dinophysis fortii short MR40. Dinophysis schroederii MR5.4 Dinophysis fortii short MR40.19 Dinophysis fortii short MR40.5 Dinophysis fortii French AF3236 Dinophysis norvegica Okirai-JP Dinophysis acuminata Tokyo-JP Dinophysis acuminata French AF32 Dinophysis hastata f.e Dinophysis hastata f.c MR24.2 Dinophysis hastata f.c MR.1 Dinophysis whittingae MR40.14 Dinophysis sp MR39.1 Dinophysis argus MR40.17 Dinophysis expulsa MR10.1 Dinophysis infudibulus s.taylor MR17.4 Dinophysis infudibulus s.taylor MR20.4 Dinophysis similis MR17.5 Citharistes regius MR20.1 Citharistes regius MR30.1 Citharistes apsteinii 17.1 Ornithocercus heteroporus Ornithocercus galea MR42.5 Ornithocercus splendidus MR32.4 Ornithocercus magnificus MR14-4 Ornithocercus magnificus MR14-3 Ornithocercus magnificus MR-5 Dinophysis hastata f.a MR7.2 Dinophysis hastata f.b MR14.1 Dinophysis hastata f.a MR30.9 Ornithocercus thumii MR19.1 Ornithocercus quadratus MR7.6 Ornithocercus thumi MR22.1 Ornithocercus thumii MR5.2 Ornithocercus thumii MR22.2 Ornithocercus thumii MR14.2 Ornithocercus thumii MR22.2(2) Ornithocercus quadratus MR Histioneis megalocopa MR40.1 Histioneis megalocopa MR Histioneis highleyi 9.1 Histionesis isseli MR.3 Histionesis sp Histioneis dentata MR34.3 Histioneis crateriformis MR25.8 Histioneis crateriformis MR34.8 Dinophysis amandula MR15.1 Dinophysis amandula MR5.3 Dinophysis parvula MR40.12 Dinophysis rapa MR17.11 Dinophysis sp MR25.5 Oxyphysis oxytoxoides EF6133 Dinophysis cuenus MR33.1 Dinophysis sp1 MR17.9 Dinophysis favus MR20.2 Dinophysis doryphora MR17.8 Dinophysis rotundata French AF3235 Dinophysis rotundata Tokyo-JP Amphisolenia bidentata MR19.3 Amphisolenia bidentata MR19.4 Amphisolenia bidentata MR38.10 Amphisolenia thrinax MR.1 Amphisolenia palaeotheroides MR32.1 Amphisolenia schauinlandii MR38.4 Amphisolenia clavispes MR14.6 Amphisolenia clavispes MR38.8 Metaphalacroma skogsbergii MR31.1 Prorocentrum lima DQ3360 Heterocapsa triquetra AF0401 Alexandrium tamarense AF Citharistes 14

15 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis caudata Okirai-JP Dinophysis caudata Omura Bay-JP 31.3 Dinophysis caudata Okirai-JP Dinophysis caudata MR.5 Dinophysis caudata Catba-VN Dinophysis caudata Catba-VN Dinophysis caudata Iki Bay-JP Dinophysis caudata MR38.1 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis tripos Miyako-JP Dinophysis tripos French AF3238 Dinophysis tripos Okirai-JP Dinophysis miles NT-VN Dinophysis infundibulus s. Abe AB3746 Dinophysis fortii short MR40.4 Dinophysis fortii short MR40. Dinophysis schroederii MR5.4 Dinophysis fortii short MR40.19 Dinophysis fortii short MR40.5 Dinophysis fortii French AF3236 Dinophysis norvegica Okirai-JP Dinophysis acuminata Tokyo-JP Dinophysis acuminata French AF32 Dinophysis hastata f.e Dinophysis hastata f.c MR24.2 Dinophysis hastata f.c MR.1 Dinophysis whittingae MR40.14 Dinophysis sp MR39.1 Dinophysis argus MR40.17 Dinophysis expulsa MR10.1 Dinophysis infudibulus s.taylor MR17.4 Dinophysis infudibulus s.taylor MR20.4 Dinophysis similis MR17.5 Citharistes regius MR20.1 Citharistes regius MR30.1 Citharistes apsteinii 17.1 Ornithocercus heteroporus Ornithocercus galea MR42.5 Ornithocercus splendidus MR32.4 Ornithocercus magnificus MR14-4 Ornithocercus magnificus MR14-3 Ornithocercus magnificus MR-5 Dinophysis hastata f.a MR7.2 Dinophysis hastata f.b MR14.1 Dinophysis hastata f.a MR30.9 Ornithocercus thumii MR19.1 Ornithocercus quadratus MR7.6 Ornithocercus thumi MR22.1 Ornithocercus thumii MR5.2 Ornithocercus thumii MR22.2 Ornithocercus thumii MR14.2 Ornithocercus thumii MR22.2(2) Ornithocercus quadratus MR Histioneis megalocopa MR40.1 Histioneis megalocopa MR Histioneis highleyi 9.1 Histionesis isseli MR.3 Histionesis sp Histioneis dentata MR34.3 Histioneis crateriformis MR25.8 Histioneis crateriformis MR34.8 Dinophysis amandula MR15.1 Dinophysis amandula MR5.3 Dinophysis parvula MR40.12 Dinophysis rapa MR17.11 Dinophysis sp MR25.5 Oxyphysis oxytoxoides EF6133 Dinophysis cuenus MR33.1 Dinophysis sp1 MR17.9 Dinophysis favus MR20.2 Dinophysis doryphora MR17.8 Dinophysis rotundata French AF3235 Dinophysis rotundata Tokyo-JP Amphisolenia bidentata MR19.3 Amphisolenia bidentata MR19.4 Amphisolenia bidentata MR38.10 Amphisolenia thrinax MR.1 Amphisolenia palaeotheroides MR32.1 Amphisolenia schauinlandii MR38.4 Amphisolenia clavispes MR14.6 Amphisolenia clavispes MR38.8 Metaphalacroma skogsbergii MR31.1 Prorocentrum lima DQ3360 Heterocapsa triquetra AF0401 Alexandrium tamarense AF Histioneis 1 Histioneis 2 Histioneis 3 15

16 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis caudata Okirai-JP Dinophysis caudata Omura Bay-JP 31.3 Dinophysis caudata Okirai-JP Dinophysis caudata MR.5 Dinophysis caudata Catba-VN Dinophysis caudata Catba-VN Dinophysis caudata Iki Bay-JP Dinophysis caudata MR38.1 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis tripos Miyako-JP Dinophysis tripos French AF3238 Dinophysis tripos Okirai-JP Dinophysis miles NT-VN Dinophysis infundibulus s. Abe AB3746 Dinophysis fortii short MR40.4 Dinophysis fortii short MR40. Dinophysis schroederii MR5.4 Dinophysis fortii short MR40.19 Dinophysis fortii short MR40.5 Dinophysis fortii French AF3236 Dinophysis norvegica Okirai-JP Dinophysis acuminata Tokyo-JP Dinophysis acuminata French AF32 Dinophysis hastata f.e Dinophysis hastata f.c MR24.2 Dinophysis hastata f.c MR.1 Dinophysis whittingae MR40.14 Dinophysis sp MR39.1 Dinophysis argus MR40.17 Dinophysis expulsa MR10.1 Dinophysis infudibulus s.taylor MR17.4 Dinophysis infudibulus s.taylor MR20.4 Dinophysis similis MR17.5 Citharistes regius MR20.1 Citharistes regius MR30.1 Citharistes apsteinii 17.1 Ornithocercus heteroporus Ornithocercus galea MR42.5 Ornithocercus splendidus MR32.4 Ornithocercus magnificus MR14-4 Ornithocercus magnificus MR14-3 Ornithocercus magnificus MR-5 Dinophysis hastata f.a MR7.2 Dinophysis hastata f.b MR14.1 Dinophysis hastata f.a MR30.9 Ornithocercus thumii MR19.1 Ornithocercus quadratus MR7.6 Ornithocercus thumi MR22.1 Ornithocercus thumii MR5.2 Ornithocercus thumii MR22.2 Ornithocercus thumii MR14.2 Ornithocercus thumii MR22.2(2) Ornithocercus quadratus MR Histioneis megalocopa MR40.1 Histioneis megalocopa MR Histioneis highleyi 9.1 Histionesis isseli MR.3 Histionesis sp Histioneis dentata MR34.3 Histioneis crateriformis MR25.8 Histioneis crateriformis MR34.8 Dinophysis amandula MR15.1 Dinophysis amandula MR5.3 Dinophysis parvula MR40.12 Dinophysis rapa MR17.11 Dinophysis sp MR25.5 Oxyphysis oxytoxoides EF6133 Dinophysis cuenus MR33.1 Dinophysis sp1 MR17.9 Dinophysis favus MR20.2 Dinophysis doryphora MR17.8 Dinophysis rotundata French AF3235 Dinophysis rotundata Tokyo-JP Amphisolenia bidentata MR19.3 Amphisolenia bidentata MR19.4 Amphisolenia bidentata MR38.10 Amphisolenia thrinax MR.1 Amphisolenia palaeotheroides MR32.1 Amphisolenia schauinlandii MR38.4 Amphisolenia clavispes MR14.6 Amphisolenia clavispes MR38.8 Metaphalacroma skogsbergii MR31.1 Prorocentrum lima DQ3360 Heterocapsa triquetra AF0401 Alexandrium tamarense AF Dinophysis hastata form C & D Dinophysis hastata form A & B 16

17 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis caudata Okirai-JP Dinophysis caudata Omura Bay-JP 31.3 Dinophysis caudata Okirai-JP Dinophysis caudata MR.5 Dinophysis caudata Catba-VN Dinophysis caudata Catba-VN Dinophysis caudata Iki Bay-JP Dinophysis caudata MR38.1 Dinophysis caudata Catba-VN Dinophysis caudata Okirai-JP Dinophysis tripos Miyako-JP Dinophysis tripos French AF3238 Dinophysis tripos Okirai-JP Dinophysis miles NT-VN Dinophysis infundibulus s. Abe AB3746 Dinophysis fortii short MR40.4 Dinophysis fortii short MR40. Dinophysis schroederii MR5.4 Dinophysis fortii short MR40.19 Dinophysis fortii short MR40.5 Dinophysis fortii French AF3236 Dinophysis norvegica Okirai-JP Dinophysis acuminata Tokyo-JP Dinophysis acuminata French AF32 Dinophysis hastata f.e Dinophysis hastata f.c MR24.2 Dinophysis hastata f.c MR.1 Dinophysis whittingae MR40.14 Dinophysis sp MR39.1 Dinophysis argus MR40.17 Dinophysis expulsa MR10.1 Dinophysis infudibulus s.taylor MR17.4 Dinophysis infudibulus s.taylor MR20.4 Dinophysis similis MR17.5 Citharistes regius MR20.1 Citharistes regius MR30.1 Citharistes apsteinii 17.1 Ornithocercus heteroporus Ornithocercus galea MR42.5 Ornithocercus splendidus MR32.4 Ornithocercus magnificus MR14-4 Ornithocercus magnificus MR14-3 Ornithocercus magnificus MR-5 Dinophysis hastata f.a MR7.2 Dinophysis hastata f.b MR14.1 Dinophysis hastata f.a MR30.9 Ornithocercus thumii MR19.1 Ornithocercus quadratus MR7.6 Ornithocercus thumi MR22.1 Ornithocercus thumii MR5.2 Ornithocercus thumii MR22.2 Ornithocercus thumii MR14.2 Ornithocercus thumii MR22.2(2) Ornithocercus quadratus MR Histioneis megalocopa MR40.1 Histioneis megalocopa MR Histioneis highleyi 9.1 Histionesis isseli MR.3 Histionesis sp Histioneis dentata MR34.3 Histioneis crateriformis MR25.8 Histioneis crateriformis MR34.8 Dinophysis amandula MR15.1 Dinophysis amandula MR5.3 Dinophysis parvula MR40.12 Dinophysis rapa MR17.11 Dinophysis sp MR25.5 Oxyphysis oxytoxoides EF6133 Dinophysis cuenus MR33.1 Dinophysis sp1 MR17.9 Dinophysis favus MR20.2 Dinophysis doryphora MR17.8 Dinophysis rotundata French AF3235 Dinophysis rotundata Tokyo-JP Amphisolenia bidentata MR19.3 Amphisolenia bidentata MR19.4 Amphisolenia bidentata MR38.10 Amphisolenia thrinax MR.1 Amphisolenia palaeotheroides MR32.1 Amphisolenia schauinlandii MR38.4 Amphisolenia clavispes MR14.6 Amphisolenia clavispes MR38.8 Metaphalacroma skogsbergii MR31.1 Prorocentrum lima DQ3360 Heterocapsa triquetra AF0401 Alexandrium tamarense AF Dinophysis sensu lato Oxyphysis and former Phalacroma 17

18 (Abe, 1967) (Taylor, 10) (Hallegraeff et Lucas 18) Integrated phylogeny with reference of DNA sequence

19 Life cycle: unclear Proposed life cycle of Dinophysis by Regurea (2001) 19

20 Nutrient and difficulty in study on ecophysiology Dinophysis includes heterotrophic and photosynthetic species, but all feeds on other plankton (ciliate, other phytoplankton). Only photosynthetic species (mixotrophic) have been linked to DSP. Culture success with some Dinophysis Scarcity of sample (most are unable to culture) is the difficulty for taxonomy, ecology and toxins study D. acutisima D. elongata

21 Identified scientific problems/questions/gaps in the region (as well as in the world) Ecology (bloom dynamic) Life cycle Toxin production Roles of suspected species in DSP outbreak Taxonomy at species level and genus level (separation of species, merging, synonym)

Fernando Gómez 2. Purificación López-García and David Moreira

Fernando Gómez 2. Purificación López-García and David Moreira J. Phycol. 47, 393 406 (2011) Ó 2011 Phycological Society of America DOI: 10.1111/j.1529-8817.2011.00964.x MOLECULAR PHYLOGENY OF DINOPHYSOID DINOFLAGELLATES: THE SYSTEMATIC POSITION OF OXYPHYSIS OXYTOXOIDES

More information

THE ARMOURED DINOFLAGELLATA : II. Title PROROCENTRIDAE AND DINOPHYSIDAE (C) AMPHISOLENIA AND OTHERS-

THE ARMOURED DINOFLAGELLATA : II. Title PROROCENTRIDAE AND DINOPHYSIDAE (C) AMPHISOLENIA AND OTHERS- THE ARMOURED DNOFLAGELLATA :. Title PROROCENTRDAE AND DNOPHYSDAE (C) ORNTHOCERCUS, HSTONES, AMPHSOLENA AND OTHERS- Author(s) Abe, Tohru H. Citation PUBLCATONS OF THE SETO MARNE BO LABORATORY (1967), 15(2):

More information

THE ARMOURED DINOFLAGELLAT A: II. PROROCENTRIDAE AND DINOPHYSIDAE (B}-DINOPHYSJS AND ITS ALLIED GENERA TOHRU H. ABE* With 24 Text-figures

THE ARMOURED DINOFLAGELLAT A: II. PROROCENTRIDAE AND DINOPHYSIDAE (B}-DINOPHYSJS AND ITS ALLIED GENERA TOHRU H. ABE* With 24 Text-figures THE ARMOURED DINOFLAGELLAT A: II. PROROCENTRIDAE AND DINOPHYSIDAE (B}-DINOPHYSJS AND ITS ALLIED GENERA TOHRU H. ABE* With 24 Text-figures Genus Sinophysis NIE & WANG Although the two ventral hypothecal

More information

Po-Teen LIM, Chui-Pin LEAW Hong-Chang LIM, Toh-Hii TAN, Sing-Tung TENG, Kieng-Soon HII, Nyuk-Fong KON, Leh-Hie YEK, Roziawati Mohd Razali

Po-Teen LIM, Chui-Pin LEAW Hong-Chang LIM, Toh-Hii TAN, Sing-Tung TENG, Kieng-Soon HII, Nyuk-Fong KON, Leh-Hie YEK, Roziawati Mohd Razali Po-Teen LIM, Chui-Pin LEAW Hong-Chang LIM, Toh-Hii TAN, Sing-Tung TENG, Kieng-Soon HII, Nyuk-Fong KON, Leh-Hie YEK, Roziawati Mohd Razali 1 FRST, UNIMAS 2 IBEC, UNIMAS 3 IOES, UM, FRI Outline Nov 2012-2013

More information

*: Corresponding author : E. Nezan, address :

*: Corresponding author : E. Nezan,  address : Please note that this is an author-produced PDF of an article accepted for publication following peer review. The definitive publisher-authenticated version is available on the publisher Web site Harmful

More information

Harmful Algae Report University of Delaware Citizen Monitoring Program

Harmful Algae Report University of Delaware Citizen Monitoring Program Harmful Algae Report All data between 6/17/2015 and 7/1/2015 Atlantic Ocean RWPM: Dagsworthy, Dewey Beach 6/24/2015 12:15 "Gymnodinioid" sp. (S) 25-40 um Grn Chaetoceros spp. (B) Common 0.175 RWPM18A:

More information

ABSTRACT. Ashmore Reef

ABSTRACT. Ashmore Reef ABSTRACT The life cycle of sea turtles is complex and is not yet fully understood. For most species, it involves at least three habitats: the pelagic, the demersal foraging and the nesting habitats. This

More information

PARTIAL REPORT. Juvenile hybrid turtles along the Brazilian coast RIO GRANDE FEDERAL UNIVERSITY

PARTIAL REPORT. Juvenile hybrid turtles along the Brazilian coast RIO GRANDE FEDERAL UNIVERSITY RIO GRANDE FEDERAL UNIVERSITY OCEANOGRAPHY INSTITUTE MARINE MOLECULAR ECOLOGY LABORATORY PARTIAL REPORT Juvenile hybrid turtles along the Brazilian coast PROJECT LEADER: MAIRA PROIETTI PROFESSOR, OCEANOGRAPHY

More information

FOOD SAFETY CONTROL IN THE FISH PRODUCTION CHAIN IN VIETNAM

FOOD SAFETY CONTROL IN THE FISH PRODUCTION CHAIN IN VIETNAM MINISTRY OF FISHERIES NATIONAL FISHERIES QUALITY ASSURANCE AND VETERINARY DIRECTORATE FOOD SAFETY CONTROL IN THE FISH PRODUCTION CHAIN IN VIETNAM CONTENT 1. SUMMARY ON VIETNAM S CURRENT SITUATION IN FISHERY

More information

Emerging Infections and the Ecotone. Cover: Emerging Zoonoses and Pathogens of Public Health Concern

Emerging Infections and the Ecotone. Cover: Emerging Zoonoses and Pathogens of Public Health Concern Emerging Infections and the Ecotone Cover: Emerging Zoonoses and Pathogens of Public Health Concern To learn more, log on to: www.medicalecology.org An ecotone is a narrow transition zone between one

More information

Cystic echinococcosis in a domestic cat: an Italian case report

Cystic echinococcosis in a domestic cat: an Italian case report 13th NRL Workshop, Rome, 24-25 May, 2018 Cystic echinococcosis in a domestic cat: an Italian case report Istituto Zooprofilattico Sperimentale (IZS) of Sardinia National Reference Laboratory for Cistic

More information

Species: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum: Chordata

Species: Panthera pardus Genus: Panthera Family: Felidae Order: Carnivora Class: Mammalia Phylum: Chordata CHAPTER 6: PHYLOGENY AND THE TREE OF LIFE AP Biology 3 PHYLOGENY AND SYSTEMATICS Phylogeny - evolutionary history of a species or group of related species Systematics - analytical approach to understanding

More information

NATIONAL BIORESOURCE DEVELOPMENT BOARD Dept. of Biotechnology Government of India, New Delhi

NATIONAL BIORESOURCE DEVELOPMENT BOARD Dept. of Biotechnology Government of India, New Delhi NATIONAL BIORESOURCE DEVELOPMENT BOARD Dept. of Biotechnology Government of India, New Delhi For office use: MARINE BIORESOURCES FORMS DATA ENTRY: Form- 1(general ) (please answer only relevant fields;add

More information

Lecture 3 Friday, September 6, 2013

Lecture 3 Friday, September 6, 2013 Lecture 3 Friday, September 6, 2013 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean system

More information

Lecture 11 Wednesday, September 19, 2012

Lecture 11 Wednesday, September 19, 2012 Lecture 11 Wednesday, September 19, 2012 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean

More information

READER S DIGEST OVERVIEW: BIGHORN SHEEP. Peregrine Wolff, DVM

READER S DIGEST OVERVIEW: BIGHORN SHEEP. Peregrine Wolff, DVM READER S DIGEST OVERVIEW: RESPIRATORY DISEASE IN BIGHORN SHEEP Peregrine Wolff, DVM Nevada Department of Wildlife During the Lewis & Clark expedition (1804 1806) There may have been 2 million bighorn sheep

More information

Molecular diagnosis of Theileria infections in wildlife from Southern Africa ~ implications for accurate diagnosis.

Molecular diagnosis of Theileria infections in wildlife from Southern Africa ~ implications for accurate diagnosis. Molecular diagnosis of Theileria infections in wildlife from Southern Africa ~ implications for accurate diagnosis. Ronel Pienaar Parasites Vectors and Vector-borne Diseases Onderstepoort Veterinary Institute

More information

Warm-Up: Fill in the Blank

Warm-Up: Fill in the Blank Warm-Up: Fill in the Blank 1. For natural selection to happen, there must be variation in the population. 2. The preserved remains of organisms, called provides evidence for evolution. 3. By using and

More information

Systematics and taxonomy of the genus Culicoides what is coming next?

Systematics and taxonomy of the genus Culicoides what is coming next? Systematics and taxonomy of the genus Culicoides what is coming next? Claire Garros 1, Bruno Mathieu 2, Thomas Balenghien 1, Jean-Claude Delécolle 2 1 CIRAD, Montpellier, France 2 IPPTS, Strasbourg, France

More information

Cyanobacteria. Blue-Green Algae (Part II)

Cyanobacteria. Blue-Green Algae (Part II) Cyanobacteria Blue-Green Algae (Part II) http://www.odh.ohio.gov/~/media/odh/assets/files/eh/habs/hab2010prespart1.ashx Photo: Grand Lake St. Marys St. Marys, Ohio 2010 ODH Involvement: Grand Lake St.

More information

TOPIC CLADISTICS

TOPIC CLADISTICS TOPIC 5.4 - CLADISTICS 5.4 A Clades & Cladograms https://upload.wikimedia.org/wikipedia/commons/thumb/4/46/clade-grade_ii.svg IB BIO 5.4 3 U1: A clade is a group of organisms that have evolved from a common

More information

ESIA Albania Annex 11.4 Sensitivity Criteria

ESIA Albania Annex 11.4 Sensitivity Criteria ESIA Albania Annex 11.4 Sensitivity Criteria Page 2 of 8 TABLE OF CONTENTS 1 SENSITIVITY CRITERIA 3 1.1 Habitats 3 1.2 Species 4 LIST OF TABLES Table 1-1 Habitat sensitivity / vulnerability Criteria...

More information

Culicoides species from the subgenus Culicoides in Catalonia (NE Spain)

Culicoides species from the subgenus Culicoides in Catalonia (NE Spain) Culicoides species from the subgenus Culicoides in Catalonia (NE Spain) Pagès, N., Muñoz-Muñoz, F., Talavera, S., Sarto, V., Lorca, C. and Nuñez, J.I. Identification Background Identification of Culicoides

More information

17.2 Classification Based on Evolutionary Relationships Organization of all that speciation!

17.2 Classification Based on Evolutionary Relationships Organization of all that speciation! Organization of all that speciation! Patterns of evolution.. Taxonomy gets an over haul! Using more than morphology! 3 domains, 6 kingdoms KEY CONCEPT Modern classification is based on evolutionary relationships.

More information

An integrated study of the Gladstone Marine System

An integrated study of the Gladstone Marine System An integrated study of the Gladstone Marine System Long term movement of Green Turtles, Chelonia mydas, in Gladstone Harbour: advantages of acoustic telemetry Richard Pillans 11-12 August 2015 1 Turtle

More information

Consequences of Antimicrobial Resistant Bacteria. Antimicrobial Resistance. Molecular Genetics of Antimicrobial Resistance. Topics to be Covered

Consequences of Antimicrobial Resistant Bacteria. Antimicrobial Resistance. Molecular Genetics of Antimicrobial Resistance. Topics to be Covered Antimicrobial Resistance Consequences of Antimicrobial Resistant Bacteria Change in the approach to the administration of empiric antimicrobial therapy Increased number of hospitalizations Increased length

More information

MID 23. Antimicrobial Resistance. Consequences of Antimicrobial Resistant Bacteria. Molecular Genetics of Antimicrobial Resistance

MID 23. Antimicrobial Resistance. Consequences of Antimicrobial Resistant Bacteria. Molecular Genetics of Antimicrobial Resistance Antimicrobial Resistance Molecular Genetics of Antimicrobial Resistance Micro evolutionary change - point mutations Beta-lactamase mutation extends spectrum of the enzyme rpob gene (RNA polymerase) mutation

More information

Antimicrobial Resistance

Antimicrobial Resistance Antimicrobial Resistance Consequences of Antimicrobial Resistant Bacteria Change in the approach to the administration of empiric antimicrobial therapy Increased number of hospitalizations Increased length

More information

Antimicrobial Resistance Acquisition of Foreign DNA

Antimicrobial Resistance Acquisition of Foreign DNA Antimicrobial Resistance Acquisition of Foreign DNA Levy, Scientific American Horizontal gene transfer is common, even between Gram positive and negative bacteria Plasmid - transfer of single or multiple

More information

( ) Page: 1/6 COMMUNICATION FROM THE WORLD ORGANISATION FOR ANIMAL HEALTH (OIE)

( ) Page: 1/6 COMMUNICATION FROM THE WORLD ORGANISATION FOR ANIMAL HEALTH (OIE) 14 October (16-5561) Page: 1/6 Committee on Sanitary and Phytosanitary Measures Original: English/French/Spanish 67 TH MEETING OF THE SPS COMMITTEE COMMUNICATION FROM THE WORLD ORGANISATION FOR ANIMAL

More information

International approach for veterinary medicinal products: OIE and Codex alimentarius

International approach for veterinary medicinal products: OIE and Codex alimentarius Dr Catherine Lambert OIE, AFSSA/ANMV Collaborating Centre for Veterinary medicinal products BP 90203-35302 FOUGERES CEDEX, FRANCE c.lambert@anmv.afssa.fr International approach for veterinary medicinal

More information

Ecography. Supplementary material

Ecography. Supplementary material Ecography ECOG-2343 Lin, L.-H. and Wiens, J. J. 216. Comparing macroecological patterns across continents: evolution of climatic niche breadth in varanid lizards. Ecography doi: 1.1111/ecog.2343 Supplementary

More information

Some aspects of wildlife and wildlife parasitology in New Zealand

Some aspects of wildlife and wildlife parasitology in New Zealand Some aspects of wildlife and wildlife parasitology in New Zealand Part 3/3 Part three: Kiwis and aspects of their parasitology Kiwis are unique and unusual in many ways. For a comprehensive and detailed

More information

OIE SRR SEA Activities on Rabies

OIE SRR SEA Activities on Rabies The World Organisation for Animal Health OIE SRR SEA Activities on Rabies Mary Joy N. Gordoncillo Science and One Health Coordinator OIE Sub Regional Representation for South East Asia Bangkok, Thailand

More information

THE LIZARDS OF THE ISLANDS VISITED BY FIELD CLUB A REVISION WITH SOME ADDITIONS By D. R. Towns*

THE LIZARDS OF THE ISLANDS VISITED BY FIELD CLUB A REVISION WITH SOME ADDITIONS By D. R. Towns* Tane (1971) 17: 91-96 91 THE LIZARDS OF THE ISLANDS VISITED BY FIELD CLUB 1953-1954 A REVISION WITH SOME ADDITIONS 1969-1970. By D. R. Towns* SUMMARY The taxonomy of the lizards of the islands visited

More information

MARINE CENTRIC DIATOM RHIZOSOLENIA BRIGHTWELL: ITS OCCURRENCE AND DISTRIBUTION IN NERITIC WATERS OF PAKISTAN

MARINE CENTRIC DIATOM RHIZOSOLENIA BRIGHTWELL: ITS OCCURRENCE AND DISTRIBUTION IN NERITIC WATERS OF PAKISTAN Pak. J. Bot., 43(4): 2187-2193, 2011. MARINE CENTRIC DIATOM RHIZOSOLENIA BRIGHTWELL: ITS OCCURRENCE AND DISTRIBUTION IN NERITIC WATERS OF PAKISTAN ASMA TABASSUM 1* AND S.M. SAIFULLAH 2 1 Department of

More information

Mathematical models for dog rabies that include the curtailing effect of human intervention

Mathematical models for dog rabies that include the curtailing effect of human intervention Mathematical models for dog rabies that include the curtailing effect of human intervention Tiffany Ngo Leung Supervised by Dr Stephen A Davis RMIT University Abstract Rabies is a zoonotic viral disease

More information

SESSION 3: RABIES SITUATION IN THE ASIA-PACIFIC

SESSION 3: RABIES SITUATION IN THE ASIA-PACIFIC FOLLOW UP WORKSHOP ON RELEVANT INTERNATIONAL STANDARDS FOR DOG RABIES Bangkok, Thailand * 17 19 May 2016 SESSION 3: RABIES SITUATION IN THE ASIA-PACIFIC 1 2014 Present (2014) Quantitative Afghanistan Bangladesh

More information

Marine Turtle Research Program

Marine Turtle Research Program Marine Turtle Research Program NOAA Fisheries Southwest Fisheries Science Center La Jolla, CA Agenda Item C.1.b Supplemental Power Point Presentation 2 September 2005 Marine Turtle Research Program Background

More information

Title Collected from Various Localities. Senta, Tetsushi; Kumagai, Shigeru. Citation 長崎大学水産学部研究報告, v.43, pp.35-40; Issue Date

Title Collected from Various Localities. Senta, Tetsushi; Kumagai, Shigeru. Citation 長崎大学水産学部研究報告, v.43, pp.35-40; Issue Date NAOSITE: Nagasaki University's Ac Title Author(s) Variation in the Vertebral Number o Collected from Various Localities Senta, Tetsushi; Kumagai, Shigeru Citation 長崎大学水産学部研究報告, v.43, pp.35-40; 1977 Issue

More information

SERIES OF MISCELLANEOUS PUBLICATIONS. Limnoria. be borne in mind, members of two monospecific

SERIES OF MISCELLANEOUS PUBLICATIONS. Limnoria. be borne in mind, members of two monospecific Beaufortia SERIES OF MISCELLANEOUS PUBLICATIONS ZOOLOGICAL MUSEUM - AMSTERDAM No. 55 Volume 5 November 3, 1956 On commensal Ostracoda from the wood-infesting isopod Limnoria by A.P.C. de Vos and J.H. Stock

More information

Darwin s Finches: A Thirty Year Study.

Darwin s Finches: A Thirty Year Study. Darwin s Finches: A Thirty Year Study. I. Mit-DNA Based Phylogeny (Figure 1). 1. All Darwin s finches descended from South American grassquit (small finch) ancestor circa 3 Mya. 2. Galapagos colonized

More information

Biodiversity and Extinction. Lecture 9

Biodiversity and Extinction. Lecture 9 Biodiversity and Extinction Lecture 9 This lecture will help you understand: The scope of Earth s biodiversity Levels and patterns of biodiversity Mass extinction vs background extinction Attributes of

More information

"Have you heard about the Iguanidae? Well, let s just keep it in the family "

Have you heard about the Iguanidae? Well, let s just keep it in the family "Have you heard about the Iguanidae? Well, let s just keep it in the family " DAVID W. BLAIR Iguana iguana is just one of several spectacular members of the lizard family Iguanidae, a grouping that currently

More information

COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST

COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST COMPARING DNA SEQUENCES TO UNDERSTAND EVOLUTIONARY RELATIONSHIPS WITH BLAST In this laboratory investigation, you will use BLAST to compare several genes, and then use the information to construct a cladogram.

More information

RWO 166. Final Report to. Florida Cooperative Fish and Wildlife Research Unit University of Florida Research Work Order 166.

RWO 166. Final Report to. Florida Cooperative Fish and Wildlife Research Unit University of Florida Research Work Order 166. MIGRATION AND HABITAT USE OF SEA TURTLES IN THE BAHAMAS RWO 166 Final Report to Florida Cooperative Fish and Wildlife Research Unit University of Florida Research Work Order 166 December 1998 Karen A.

More information

NATIONAL BIORESOURCE DEVELOPMENT BOARD Dept. of Biotechnology Government of India, New Delhi

NATIONAL BIORESOURCE DEVELOPMENT BOARD Dept. of Biotechnology Government of India, New Delhi NATIONAL BIORESOURCE DEVELOPMENT BOARD Dept. of Biotechnology Government of India, New Delhi MARINE BIORESOURCES FORMS DATA ENTRY: Form- 1(general ) (please answer only relevant fields;add additional fields

More information

Learning Goals: 1. I can list the traditional classification hierarchy in order.

Learning Goals: 1. I can list the traditional classification hierarchy in order. Learning Goals: 1. I can list the traditional classification hierarchy in order. 2. I can explain what binomial nomenclature is, and where an organism gets its first and last name. 3. I can read and create

More information

Size structure, distribution and interaction characteristics of dominant jellyfish from surface trawls in the Eastern Bering Sea

Size structure, distribution and interaction characteristics of dominant jellyfish from surface trawls in the Eastern Bering Sea Size structure, distribution and interaction characteristics of dominant jellyfish from surface trawls in the Eastern Bering Sea Kristin Cieciel, Lisa Eisner, Mary Courtney, and Angela Feldmann Auke Bay

More information

Temporal Succession of Ecosystem Structure in the Kuroshio Extension Region: Are Gelatinous Zooplankton Species Indicators of Ecosystem Status?

Temporal Succession of Ecosystem Structure in the Kuroshio Extension Region: Are Gelatinous Zooplankton Species Indicators of Ecosystem Status? Temporal Succession of Ecosystem Structure in the Kuroshio Extension Region: Are Gelatinous Zooplankton Species Indicators of Ecosystem Status? H. Saito, K. Hidaka, M. Ichinomiya, Yuichiro Nishibe FRA

More information

Phylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA.

Phylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA. Zoology Department Phylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA By HAGAR IBRAHIM HOSNI BAYOUMI A thesis submitted in

More information

Copyright is owned by the Author of the thesis. Permission is given for a copy to be downloaded by an individual for the purpose of research and

Copyright is owned by the Author of the thesis. Permission is given for a copy to be downloaded by an individual for the purpose of research and Copyright is owned by the Author of the thesis. Permission is given for a copy to be downloaded by an individual for the purpose of research and private study only. The thesis may not be reproduced elsewhere

More information

Quality of veterinary medicines

Quality of veterinary medicines Quality of veterinary medicines Regional Seminar for OIE National Focal Points for Veterinary Products Tokyo, 2 March 2016 Dr. Yoshihiro Shimizu, DVM Executive Director, Asian Animal Health Association

More information

Mobulid rays in the eastern Pacific

Mobulid rays in the eastern Pacific Mobulid rays in the eastern Pacific Joshua Stewart, Nerea Lezama-Ochoa, Marlon Román, Martin Hall 8 th Meeting of the Bycatch Working Group La Jolla, California USA, 10-11 May 2018 Outline Introduction

More information

EDUCATION AND PRODUCTION. Layer Performance of Four Strains of Leghorn Pullets Subjected to Various Rearing Programs

EDUCATION AND PRODUCTION. Layer Performance of Four Strains of Leghorn Pullets Subjected to Various Rearing Programs EDUCATION AND PRODUCTION Layer Performance of Four Strains of Leghorn Pullets Subjected to Various Rearing Programs S. LEESON, L. CASTON, and J. D. SUMMERS Department of Animal and Poultry Science, University

More information

in food safety Jean-Luc ANGOT CVO France

in food safety Jean-Luc ANGOT CVO France The role of OIE and Veterinary Services in food safety Jean-Luc ANGOT CVO France «Evolving Veterinary Education for a safer World» 13th october 2009 OIE s Objectives Transparency : ensure transparency

More information

Our ref: Your ref: PPL - D. Clendon. Date: 1/10/2015. From: Technical Advisor Ecology - J. Marshall. Waitaha Hydro - Lizards

Our ref: Your ref: PPL - D. Clendon. Date: 1/10/2015. From: Technical Advisor Ecology - J. Marshall. Waitaha Hydro - Lizards Internal Correspondence To: PPL - D. Clendon Our ref: Your ref: Date: 1/10/2015 From: Technical Advisor Ecology - J. Marshall Subject: Waitaha Hydro - Lizards Summary The applicant has employed a respected

More information

Cover Page. The handle holds various files of this Leiden University dissertation.

Cover Page. The handle   holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/20908 holds various files of this Leiden University dissertation. Author: Kok, Philippe Jacques Robert Title: Islands in the sky : species diversity, evolutionary

More information

Animal Chlamydioses and the Zoonotic Implications

Animal Chlamydioses and the Zoonotic Implications Food and Agriculture (FA) Domain Committee MONITORING PROGRESS REPORT 2006 COST - Chair: Konrad Sachse 3rd DC meeting, Antalya (TR), 31 Jan 2 Feb 2007 COST Action Domain Food and Agriculture (FA) Animal

More information

from an experimental bag net SHIODE, DAISUKE; TAKAHASHI, MUTSUKI Proceedings of the 6th Internationa SEASTAR2000 workshop) (2011): 31-34

from an experimental bag net SHIODE, DAISUKE; TAKAHASHI, MUTSUKI Proceedings of the 6th Internationa SEASTAR2000 workshop) (2011): 31-34 Development of sea turtle releasing Titlenet/pound net fisheries 2 - practic from an experimental bag net SHIODE, DAISUKE; TAKAHASHI, MUTSUKI Author(s) FUXIANG; TOKAI, TADASHI; KOBAYASHI, ABE, OSAMU Proceedings

More information

FAUNA MARIN RED X Special liquid tonic for algae control RED X

FAUNA MARIN RED X Special liquid tonic for algae control RED X FAUNA MARIN is a special liquid tonic that targets unwanted algae and bacteria in saltwater aquariums. works solely through the aquariums biological process and DOES NOT contain any prescription drugs

More information

Prof. Neil. J.L. Heideman

Prof. Neil. J.L. Heideman Prof. Neil. J.L. Heideman Position Office Mailing address E-mail : Vice-dean (Professor of Zoology) : No. 10, Biology Building : P.O. Box 339 (Internal Box 44), Bloemfontein 9300, South Africa : heidemannj.sci@mail.uovs.ac.za

More information

Comparing DNA Sequence to Understand

Comparing DNA Sequence to Understand Comparing DNA Sequence to Understand Evolutionary Relationships with BLAST Name: Big Idea 1: Evolution Pre-Reading In order to understand the purposes and learning objectives of this investigation, you

More information

SUBFAMILY THYMOPINAE Holthuis, 1974

SUBFAMILY THYMOPINAE Holthuis, 1974 click for previous page 29 Remarks : The taxonomy of the species is not clear. It is possible that 2 forms may have to be distinguished: A. sublevis Wood-Mason, 1891 (with a synonym A. opipara Burukovsky

More information

Stranding numbers and bycatch implications of harbour porpoises along the German Baltic Sea coast

Stranding numbers and bycatch implications of harbour porpoises along the German Baltic Sea coast 16 th ASCOBANS Advisory Committee Meeting Document AC16/Doc.62 (P) Brugge, Belgium, 20-24 April 2009 Dist. 8 April 2009 Agenda Item 5.3 Implementation of the ASCOBANS Triennial Work Plan (2007-2009) Review

More information

International Food Safety Authorities Network (INFOSAN) Antimicrobial Resistance from Food Animals

International Food Safety Authorities Network (INFOSAN) Antimicrobial Resistance from Food Animals International Food Safety Authorities Network (INFOSAN) 7 March 2008 INFOSAN Information Note No. 2/2008 - Antimicrobial Resistance Antimicrobial Resistance from Food Animals SUMMARY NOTES Antimicrobial

More information

AP Lab Three: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST

AP Lab Three: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST AP Biology Name AP Lab Three: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST In the 1990 s when scientists began to compile a list of genes and DNA sequences in the human genome

More information

Companion Animal Science (Biology & Technology)

Companion Animal Science (Biology & Technology) Companion Animal Science (Biology & Technology)011006...6140 Course Description This is a course to help students demonstrate a basic understanding of the care of small animals, while also understanding

More information

Drd. OBADĂ MIHAI DORU. PhD THESIS ABSTRACT

Drd. OBADĂ MIHAI DORU. PhD THESIS ABSTRACT UNIVERSITY OF AGRICULTURAL SCIENCES AND VETERINARY MEDICINE ION IONESCU DE LA BRAD IAŞI FACULTY OF VETERINARY MEDICINE SPECIALIZATION MICROBIOLOGY- IMUNOLOGY Drd. OBADĂ MIHAI DORU PhD THESIS ABSTRACT RESEARCHES

More information

Implementing Management Plans And Voluntary Initiatives Regarding Fads: The Opagac Experience

Implementing Management Plans And Voluntary Initiatives Regarding Fads: The Opagac Experience IATTC Implementing Management Plans And Voluntary Initiatives Regarding Fads: The Opagac Experience MIGUEL HERRERA & JULIO MORON 3 rd Meeting of the IATTC ad-hoc Working Group on FADs, La Jolla 11-12 May

More information

Water quality in Lake Kasumigaura

Water quality in Lake Kasumigaura Water quality in 1 Environmental quality standards for water pollution Environmental quality standards for water pollution in Japan have been established under the Basic Environment Law as the criteria

More information

Testing Phylogenetic Hypotheses with Molecular Data 1

Testing Phylogenetic Hypotheses with Molecular Data 1 Testing Phylogenetic Hypotheses with Molecular Data 1 How does an evolutionary biologist quantify the timing and pathways for diversification (speciation)? If we observe diversification today, the processes

More information

Tortoises And Freshwater Turtles: The Trade In Southeast Asia (Species In Danger) By Martin Jenkins READ ONLINE

Tortoises And Freshwater Turtles: The Trade In Southeast Asia (Species In Danger) By Martin Jenkins READ ONLINE Tortoises And Freshwater Turtles: The Trade In Southeast Asia (Species In Danger) By Martin Jenkins READ ONLINE If searching for the ebook Tortoises and Freshwater Turtles: The Trade in Southeast Asia

More information

Supplementary Table 1. Primers used in the study.

Supplementary Table 1. Primers used in the study. Supplementary Table 1. Primers used in the study. Primer Position (bp) Upstream primer (5 3 ) Downstream primer (5 3 ) Expected (bp) size 1 1 278 ACCAAACAGAGAATCTGTGAG CAGCAATCCGAAGGCAGAATAC 299 2 48 946

More information

A comparison of placental tissue in the skinks Eulamprus tympanum and E. quoyii. Yates, Lauren A.

A comparison of placental tissue in the skinks Eulamprus tympanum and E. quoyii. Yates, Lauren A. A comparison of placental tissue in the skinks Eulamprus tympanum and E. quoyii Yates, Lauren A. Abstract: The species Eulamprus tympanum and Eulamprus quoyii are viviparous skinks that are said to have

More information

OIE global strategy for rabies control, including regional vaccine banks

OIE global strategy for rabies control, including regional vaccine banks Inception meeting of the OIE/JTF Project for Controlling Zoonoses in Asia under the One Health Concept OIE global strategy for rabies control, including regional vaccine banks Tokyo, Japan 19-20 December

More information

Marine Consumers OCN 201 Biology Lecture 6

Marine Consumers OCN 201 Biology Lecture 6 Marine Consumers OCN 201 Biology Lecture 6 Goetze/Peijnenburg Consumer Types Grazers (Herbivore) Predators Parasites Scavengers Detritivores Decomposers Feeding on algae or phytoplankton, consuming the

More information

Introduction to phylogenetic trees and tree-thinking Copyright 2005, D. A. Baum (Free use for non-commercial educational pruposes)

Introduction to phylogenetic trees and tree-thinking Copyright 2005, D. A. Baum (Free use for non-commercial educational pruposes) Introduction to phylogenetic trees and tree-thinking Copyright 2005, D. A. Baum (Free use for non-commercial educational pruposes) Phylogenetics is the study of the relationships of organisms to each other.

More information

Cane toads and Australian snakes

Cane toads and Australian snakes Cane toads and Australian snakes This activity was adapted from an activity developed by Dr Thomas Artiss (Lakeside School, Seattle, USA) and Ben Phillips (University of Sydney). Cane toads (Bufo marinus)

More information

Characterizing Social Vulnerability: a NFIE Integration

Characterizing Social Vulnerability: a NFIE Integration May 8 th 2015 Characterizing Social Vulnerability: a NFIE Integration Written by: Frank Schalla CE 397 Term Project Final Report Table of Contents Introduction... 3 Social Vulnerability Index... 4 Social

More information

Loggerhead Turtle (Caretta caretta)

Loggerhead Turtle (Caretta caretta) Loggerhead Turtle (Caretta caretta) Figure 1. Global distribution and nesting sites for the Loggerhead Turtle Caretta caretta (Wallace et al. 2010). Figure 2. Global map of the 10 IUCN subpopulations (RMUs)

More information

Shrimp Trawl Bycatch Reduction. Dan Foster NOAA Fisheries Service Harvesting Systems and Engineering Division

Shrimp Trawl Bycatch Reduction. Dan Foster NOAA Fisheries Service Harvesting Systems and Engineering Division Shrimp Trawl Bycatch Reduction Dan Foster NOAA Fisheries Service Harvesting Systems and Engineering Division 1 Presentation Proposed certification criterion Revised list of allowable BRDs Status of research

More information

SQUIDS FOUND IN THE STOMACH OF SPERM WHALES IN THE NORTHWESTERN PACIFIC*

SQUIDS FOUND IN THE STOMACH OF SPERM WHALES IN THE NORTHWESTERN PACIFIC* SQUIDS FOUND IN THE STOMACH OF SPERM WHALES IN THE NORTHWESTERN PACIFIC* T AKEHIKO KAWAKAMI Tokai Regional Fisheries Research Laboratory, Tokyo ABSTRACT The squids obtained from the stomachs of sperm whales

More information

6. The lifetime Darwinian fitness of one organism is greater than that of another organism if: A. it lives longer than the other B. it is able to outc

6. The lifetime Darwinian fitness of one organism is greater than that of another organism if: A. it lives longer than the other B. it is able to outc 1. The money in the kingdom of Florin consists of bills with the value written on the front, and pictures of members of the royal family on the back. To test the hypothesis that all of the Florinese $5

More information

Teacher Workbooks. Language Arts Series Internet Reading Comprehension Oceans Theme, Vol. 1

Teacher Workbooks. Language Arts Series Internet Reading Comprehension Oceans Theme, Vol. 1 Teacher Workbooks Language Arts Series Internet Reading Comprehension Oceans Theme, Vol. 1 Copyright 2003 Teachnology Publishing Company A Division of Teachnology, Inc. For additional information, visit

More information

Marine Consumers OCN 201 Biology Lecture 5

Marine Consumers OCN 201 Biology Lecture 5 Marine Consumers OCN 201 Biology Lecture 5 Goetze/Peijnenburg Consumer Types Grazers (Herbivore) Predators Parasites Kill their prey (Herbivore, Carnivore, or Omnivore) Scavengers Detritivores Decomposers

More information

OIE GLOBAL DATABASE ON AMU IN ANIMALS

OIE GLOBAL DATABASE ON AMU IN ANIMALS OIE GLOBAL DATABASE ON AMU IN ANIMALS The database contributes to the Global Action Plan and will allow to establish baseline information on the use of antimicrobials in animals. The information gathered

More information

Protecting Ourselves from Shellfish Poisoning

Protecting Ourselves from Shellfish Poisoning Feature Articles Protecting Ourselves from Shellfish Poisoning Molecular probes deployed by California scientists are just the latest weapons in our species long battle with harmful algae Mary Wilcox Silver

More information

PARASITOLOGICAL EXAMINATIONS CATALOGUE OF SERVICES AND PRICE LIST

PARASITOLOGICAL EXAMINATIONS CATALOGUE OF SERVICES AND PRICE LIST INSTITUTE OF PARASITOLOGY Biomedical Research Center Seltersberg Justus Liebig University Giessen Schubertstrasse 81 35392 Giessen Germany Office: +49 (0) 641 99 38461 Fax: +49 (0) 641 99 38469 Coprological

More information

Work of Regional Representations supporting the implementation of the OIE standards on animal welfare

Work of Regional Representations supporting the implementation of the OIE standards on animal welfare Work of Regional Representations supporting the implementation of the OIE standards on animal welfare Third Global Conference on Animal Welfare Kuala Lumpur, Malaysia, 6-8 November 2012 Dr. Luis Osvaldo

More information

Field observations of sea cucumbers at North Male Atoll in the Maldives

Field observations of sea cucumbers at North Male Atoll in the Maldives 33 Field observations of sea cucumbers at North Male Atoll in the Maldives Nyawira Muthiga 1 Introduction The commercial exploitation of sea cucumbers began recently in the Republic of the Maldives, starting

More information

Ecology of RMSF on Arizona Tribal Lands

Ecology of RMSF on Arizona Tribal Lands Ecology of RMSF on Arizona Tribal Lands Tribal Vector Borne Disease Meeting M. L. Levin Ph.D. Medical Entomology Laboratory Centers for Disease Control mlevin@cdc.gov Rocky Mountain Spotted Fever Disease

More information

Facial Eczema Risk and Incidence Monitor Report

Facial Eczema Risk and Incidence Monitor Report Facial Eczema Risk and Incidence Monitor Report Weekly Summary FE Risk -National trends in spore count levels (% elevated above 3, spg) 8 FACIAL ECZEMA RISK - TRENDS IN SPORE COUNT LEVELS % elevated spore

More information

Essential Question: How do biologists classify organisms?

Essential Question: How do biologists classify organisms? Topic: The Biological Classification System Essential Question: How do biologists classify organisms? In 2008, Usain Bolt set the world record for the 100 meters with one shoelace undone. 3/25/16 Taxonomy

More information

LABORATORY #10 -- BIOL 111 Taxonomy, Phylogeny & Diversity

LABORATORY #10 -- BIOL 111 Taxonomy, Phylogeny & Diversity LABORATORY #10 -- BIOL 111 Taxonomy, Phylogeny & Diversity Scientific Names ( Taxonomy ) Most organisms have familiar names, such as the red maple or the brown-headed cowbird. However, these familiar names

More information

Modern Evolutionary Classification. Lesson Overview. Lesson Overview Modern Evolutionary Classification

Modern Evolutionary Classification. Lesson Overview. Lesson Overview Modern Evolutionary Classification Lesson Overview 18.2 Modern Evolutionary Classification THINK ABOUT IT Darwin s ideas about a tree of life suggested a new way to classify organisms not just based on similarities and differences, but

More information

American Samoa Sea Turtles

American Samoa Sea Turtles American Samoa Sea Turtles Climate Change Vulnerability Assessment Summary An Important Note About this Document: This document represents an initial evaluation of vulnerability for sea turtles based on

More information

Sepia prabahari sp. nov. (Mollusca/Cephalopoda), a new species of Acanthosepion species complex from Tuticorin bay, southeast coast of India

Sepia prabahari sp. nov. (Mollusca/Cephalopoda), a new species of Acanthosepion species complex from Tuticorin bay, southeast coast of India Indian Journal of Marine Sciences Vol. 31(1), March 2002, pp. 45-51 Sepia prabahari sp. nov. (Mollusca/Cephalopoda), a new species of Acanthosepion species complex from Tuticorin bay, southeast coast of

More information

Name: Date: Hour: Fill out the following character matrix. Mark an X if an organism has the trait.

Name: Date: Hour: Fill out the following character matrix. Mark an X if an organism has the trait. Name: Date: Hour: CLADOGRAM ANALYSIS What is a cladogram? It is a diagram that depicts evolutionary relationships among groups. It is based on PHYLOGENY, which is the study of evolutionary relationships.

More information