Evolution and host-adaptation of the mammalian bordetellae. D.A. Diavatopoulos

Transcription

1 Evolution and host-adaptation of the mammalian bordetellae D.A. Diavatopoulos

2 Cover: Tree partially hidden by fog banks The tree is a widely used symbol for the evolution of bacterial species, the fog represents the uncertainties scientists working on bacterial evolution need to cope with. Adapted from ISBN: D.A. Diavatopoulos, Utrecht 2006 All rights reserved. Printed by Ponsen & Looijen BV., Wageningen The printing of this thesis was financially supported by: J.E. Jurriaanse Stichting, Dr. Ir. van de Laar Stichting, Eijkman Graduate School for Infection and Immunity.

3 Evolution and host-adaptation of the mammalian bordetellae Evolutie en gastheeradaptatie van de zoogdier bordetellae (met een samenvatting in het Nederlands) Proefschrift ter verkrijging van de graad van doctor aan de Universiteit Utrecht op gezag van de Rector Magnificus, Prof. Dr. W.H. Gispen ingevolge het besluit van het College voor Promoties in het openbaar te verdedigen op vrijdag 10 februari 2006 des middags te uur door Dimitri Adriaan Diavatopoulos geboren op 4 december 1976, te Lage Zwaluwe

4 Promotores: Prof. Dr. F.R. Mooi Prof. Dr. J. Verhoef Co-promotor: Dr. L.M. Schouls Paranimfen: M. Hijnen T.A. Diavatopoulos The research presented in this thesis was performed at the Laboratory for Vaccine Preventable Diseases at the National Institute for Public Health and the Environment (RIVM), Bilthoven, the Netherlands and at the Eijkman-Winkler Institute, University Medical Center Utrecht, the Netherlands.

5 Voor Cecile

6 Science in a nutshell: For a moment, nothing happened.then, after a second or so, nothing continued to happen. by Douglas Adams

7 contents Chapter 1 General Introduction 9 Chapter 2 Genetic Relationships of the Mammalian Bordetellae Chapter 2&3, PLoS Pathogens, Chapter 3 Chapter 4 Chapter 5 Chapter 6 Genetic Changes Associated With the Adaptation of a B. bronchiseptica Lineage to the Human Host 47 Chapter 2&3, PLoS Pathogens, 2005 Identification and Characterization of B. bronchiseptica Complex IV-Specific Sequences 69 Manuscript in preparation Transfer of an Iron-Uptake Island From Bordetella pertussis to Bordetella holmesii 81 Submitted Evolution of the Bordetella Autotransporter Pertactin: Identification of Regions Subject to Positive Selection 113 Submitted Chapter 7 Summarizing Discussion 131 A Nederlandse samenvatting 141 B Dankwoord 145 C Curriculum Vitae 149 D Appendix 153

8

9 11 Chapter Chapter General Introduction

10 Chapter 1 1 bordetella genus The genus Bordetella, member of the β-proteobacterial family of the Alcaligenaceae, currently comprises nine species. Four Bordetella species are associated with respiratory disease in mammals: Bordetella bronchiseptica, Bordetella parapertussis, Bordetella pertussis and Bordetella holmesii (see Table 1). Of these species, B. pertussis and to a lesser extent B. parapertussis are the etiological agents of an acute respiratory illness in humans, designated whooping cough or pertussis. Until recent years, pertussis morbidity in adults was significantly underestimated, as it was assumed that vaccination induced long-lasting immunity. Pertussis is especially severe in young, unvaccinated children, but recent studies also showed that B. pertussis infection is a common cause of persistent cough in adults and adolescents, and this may have important consequences for its epidemiology 1,2. In many parts of Europe and America, mass pertussis vaccination was introduced in the 1940s and 1950s, resulting in a major decrease in pertussis incidence. Estimations of current pertussis disease suggest that, world-wide, approximately 48.5 million people contract pertussis resulting in 295,000 deaths 3. Morbidity and mortality due to pertussis is highest in developing countries, as mass vaccination is often not readily available in these countries. However, in the last two decades, the number of pertussis cases has also increased in countries with traditionally high vaccination coverage 4-6. Table 1. Characteristics of Bordetella species that cause respiratory illness in mammalian species. Species Diseases Hosts B. pertussis Whooping cough Humans B. parapertussis hu Mild whooping cough Humans B. parapertussis ov Chronic nonprogressive pneumonia Sheep B. bronchiseptica Chronic tracheobronchitis; bronchopneumonia; septicemia; kennel cough (dogs); atrophic rhinitis (swine); catarrh (rabbits) B. holmesii Septicemia; endocarditis; respiratory illness Mice, rats, guinea pigs, skunks, opossums, rabbits, raccoons, cats, dogs, ferrets, foxes, pigs, hedgehogs, sheep, koalas, turkeys, leopards, horses, lesser bushbabies, monkeys, humans Immunocompromised humans origin of pertussis The origin of the disease pertussis is still a mystery. Although it has very typical symptoms in children and was one of the major causes of child mortality previous to the introduction of vaccination, the first written reference to the disease in Europe is found in In contrast, historical descriptions of other major diseases with typical symptoms, such as diphtheria and tetanus, can be found in the ancient Greek literature. The first description of a pertussis epidemic, which occurred in Paris, was given by Baillon in 10

11 General Introduction In the 16th and 17th century, descriptions of whooping cough and epidemics in Europe are documented frequently in the literature 8. The absence of references to pertussislike symptoms in the ancient (European) literature has been taken as evidence that the association of B. pertussis with humans is of recent origin. 1 properties of bordetella species In 1906, Bordet and Gengou were the first to describe B. pertussis, which was isolated from the sputum of a patient with whooping cough 9. B. parapertussis was first described in 1937 as a clinical entity in humans that resembled B. pertussis 10,11. B. pertussis and B. parapertussis hu have been isolated from humans only and cause non-invasive acute and transient infections. No evidence exists that an animal reservoir exists for B. pertussis. B. parapertussis is comprised of two distinct lineages, one of which is found exclusively in humans, and one that is found exclusively in sheep, designated B. parapertussis hu and B. parapertussis ov, respectively. Previous research based on multilocus enzyme electrophoresis and the distribution of insertion sequence elements suggested that there is little or no exchange between these reservoirs 12. Not only B. pertussis, but also B. parapertussis hu has been described to cause epidemics in countries across the world (reviewed in 13 ). Usually, B. parapertussis hu infections result in less severe whooping cough-like symptoms in young infants and in adults, with paroxysmal coughing, but without lymphocytosis that is one of the hallmarks of B. pertussis infections 14. It was shown that in 40% of the B. parapertussis hu infections, infected persons remained without symptoms 15. In sheep, B. parapertussis ov has been described to cause chronic non-progressive pneumonia 16,17. B. bronchiseptica was first described in literature in and has since been isolated from the respiratory tract of a diverse range of mammalian species, including humans. In contrast to B. pertussis and B. parapertussis hu, which are non-invasive, B. bronchiseptica has also been described to cause septicemia in humans Usually, however, B. bronchiseptica causes chronic and often asymptomatic infections of the upper respiratory tract. Diseases caused by this bacterium include kennel cough in dogs, atrophic rhinitis in swine and snuffles in rabbits 23. Human infections by B. bronchiseptica, mainly in immune-compromised individuals 24,25, have also been described. It is generally assumed that humans are not a natural reservoir of B. bronchiseptica, and human infections are usually considered to be of zoonotic origin 26. B. bronchiseptica is increasingly being used as a model organism for B. pertussis, due to the fastidious nature of B. pertussis and the advantages of using B. bronchiseptica in a mouse or rat model, both of which are natural hosts for this bacterium. B. bronchiseptica has the ability, in contrast to B. pertussis and B. parapertussis, to survive outside the host for prolonged periods of time; it has been shown to survive and even replicate in lake water without added nutrients 27,28. B. holmesii was first described in 1995 as a species that resembled B. pertussis, and was originally isolated from septicemic patients with immune disorders 29. During a pertussis 11

12 Chapter 1 1 Figure 1. Respiratory tract infection model of humans by Bordetella bronchiseptica, Bordetella parapertussis and Bordetella pertussis. Bacteria enter the host through inhalation of aerosols. Adherence takes place in the nasal cavity, followed by colonization of the pharynx and the trachea and in rare cases the lungs. They subsequently pass through different Bvg phases during infection, depending on the level of phosphorylation of BvgA, which is modulated by environmental signals such as temperature. The Bvg - phase (the avirulent phase) is thought to be important for survival outside the host, and in this phase the virulence-repressed genes (vrgs) are expressed. B. bronchiseptica expresses flagella for motility and urease in the bvg - phase. The Bvg i phase is thought to be important for initial colonization of the nasopharynx, and is characterized by optimal expression of BipA. In the Bvg + phase, the virulence-activated genes are expressed (vags), including adhesins and toxins. This phase may be divided in an early and a late phase. In the early Bvg + phase, adhesins are expressed but not toxins, and this phase is associated with colonization of the upper respiratory tract. The late Bvg + phase is characterized by expression of toxins in addition to adhesins, and these toxins may modulate the immune system of the host for <26 C Bvg - Flagella O-antigen Urease vrgs Bordetella BvgA-phosphorylation Larynx Primary bronchi 35 C 37 C Bvg i Bvg + BipA BrkA/BrkB Early genes TTSS FHA Prn Fim TcfA Dnt Late genes vags Ptx CyA Nasal cavity Pharynx Trachea Upper respiratory tract survival and may contribute to induction of disease symptoms that are important for transmission. The list of virulence factors is incomplete, and only represents the most studied virulence factors. Other virulence factors, either controlled by BvgAS or not, may be important for transmission as well. Abbreviations: Bvg, Bordetella virulence gene; vrgs, virulence-repressed genes; BipA, Bvg intermediate phase protein A; BrkA/B, Bordetella resistance to killing A/B; TTSS, type III secretion system; Prn, pertactin; TcfA, tracheal colonization factor A; Dnt, dermonecrotic toxin; FHA, filamentous haemagglutinin; Fim, fimbriae; Ptx, pertussis toxin; CyA, adenylate cyclase. A color version of this figure is available in the appendix. epidemic in Massachusetts, it has also been isolated from the respiratory tract of previously healthy patients with pertussis symptoms 30. Although most B. holmesii infections occur in immune-compromised individuals, a serious infection of a healthy adolescent was also described. A recent study suggested that B. holmesii may be especially pathogenic to asplenic patients in which it causes bacteremia 31. Not much is known about the pathogenesis and transmission of this pathogen. Lungs Lower respiratory tract 12

13 General Introduction virulence factors The close evolutionary relationship between B. bronchiseptica, B. parapertussis and B. pertussis is reflected in the fact that they express a similar set of virulence factors and contain nearly identical BvgAS global virulence control systems. On the other hand, they also differ with respect to certain virulence factors, and this in turn may reflect their differences in host range and disease symptoms. The bacteria enter the upper respiratory tract by inhalation of aerosols by the host, and subsequently binding of the bacteria to the ciliated epithelial cells is initiated through adhesins. Upon adherence, the mammalian bordetellae produce a range of immune-modulating substances, such as toxins, which interfere with clearance of the bacteria and enable them to colonize the host (Figure 1). Several secreted or surfaceassociated factors have been described to play an important role in the virulence of the mammalian bordetellae. 1 the bvgas system The expression of many of almost all virulence factors is controlled by the BvgAS (Bordetella virulence genes) two-component system, encoded by the bvg locus. This two-component system is comprised of a sensor protein, BvgS, that senses and responds to external signals, and which can (de-)activate the transcriptional regulator protein BvgA that in turn controls the expression of many virulence-associated genes. The BvgAS system mediates the transition between what is now regarded as a spectrum of states. These states can range between two extremes with on the one hand the virulent phase (bvg + ) and on the other hand the avirulent phase (bvg - ) (reviewed in 32 ). The virulent phase is important for infection of the host, while the avirulent phase is considered to be important for survival outside the host. Genes that are up-regulated in the bvg + phase are called vags (virulence activated genes), while genes that are down-regulated in this phase are called vrgs (virulence repressed genes). In the bvg - phase, vags are repressed and vrgs are expressed. More recently, an intermediate state has been described, designated the bvg i -phase. This phase is characterized by the expression of adhesins, but not toxins, and also by the expression of BipA (Bordetella intermediate gene), which is expressed specifically in this phase A third gene, bvgr, was also described in the bvg genetic locus, which encodes another transcriptional regulator, BvgR 37,38. Expression of bvgr is activated by BvgA, and BvgR in turn down-regulates the expression of virulencerepressed genes. A number of stimuli have been identified that can modulate the transition between the bvgphases, including temperature, nicotinic acid and sulfate. Temperature may be considered a natural stimulus, as the virulent phase is induced at temperatures corresponding to body temperature, while the avirulent phase is induced at temperatures of 25 C or lower 39. Other external signals may fine-regulate the expression of various virulence factors in vivo in response to changing micro-environments. 13

14 Chapter 1 1 commonly and differently expressed virulence factors B. bronchiseptica, B. parapertussis and B. pertussis express a similar set of virulence factors. These include adhesins, such as filamentous hemagglutinin (FHA), the fimbriae (Fim) and pertactin (Prn); but also toxins such as adenylate cyclase toxin (CyaA), tracheal cytotoxin (TCT) and dermonecrotic toxin (Dnt). There are also numerous virulence factors that do not belong to either adhesins or toxins, and these include for example siderophores, which are involved in iron acquisition from the host, and the type III secretion system (TTSS), which can inject modulating substances into host-cells. Some virulence factors are expressed in only one species, e.g. expression of pertussis toxin (Ptx) and tracheal colonization factor A (TcfA) has only been observed in B. pertussis 40,41. Table 2 shows the commonly and differentially expressed virulence factors for the mammalian bordetellae. In the next paragraphs, the virulence factors lipopolysaccharide (LPS), Prn, Ptx, DNT and alcaligin are described in detail. Table 2. Virulence factors of Bordetella species B. pertussis B. parapertussis B. bronchiseptica B. holmesii Gene(s) Production Gene(s) Production Gene(s) Production Gene(s) Production Toxins Ptx Cya Dnt Tct Adhesins Prn ? - TcfA ?? Fha Fimbriae Other BrkA + + +? + some strains?? Alcaligin ?? TTSS ?? Abbreviations: Ptx, pertussis toxin; Cya, adenylate cyclase; Dnt, dermonecrotic toxin; Tct, tracheal cytotoxin; Prn, pertactin; TcfA, tracheal colonization factor A; Fha, filamentous haemagglutinin; BrkA, Bordetella resistance to killing protein A; TTSS, type III secretion system lipopolysaccharide Lipopolysaccharide (LPS), also known as endotoxin, is a major component of the outermembrane of gram-negative bacteria, and may constitute up to 75% of the surface. LPS is essential for survival of the bacteria, as it provides a protective barrier against the 14

15 General Introduction environment 42. LPS also plays an important role in the interaction with the host immune system. Van den Akker showed that production of LPS by Bordetella species was modulated by both temperature and sulfate 43, and thus, LPS modulation is probably regulated by the BvgAS system. The LPS molecules of gram-negative bacteria usually consist of three, covalently linked, major domains: the lipid A, the branched chain oligosaccharide core and the hydrophilic O-antigen (reviewed in 42,44,45 ). Several genetic loci have been shown to play a role in the synthesis of these domains in Bordetella, although there probably are many other, unknown, genes that may play a role in the biosynthesis of LPS. These genetic loci include the lpx locus (lipid A), the waa locus (inner core), the wlb locus (outer core) and the wbm locus (O-antigen) Extensive polymorphism in the LPS molecular structure has been observed between Bordetella species, for instance with regard to the expression of the outer-membrane associated PagP. PagP is a palmitoyl transferase, that mediates acylation of the lipid A, in a BvgAS-dependent matter 51. Preliminary evidence suggests that B. parapertussis also expresses PagP. In contrast, although B. pertussis also contains the gene encoding PagP (pagp), it is not expressed due to the disruption of pagp by an insertion sequence element in the promoter region 51,52. PagP, which is regulated by the BvgAS system, was shown to be required for persistent colonization of the mouse by B. bronchiseptica 51,53. Polymorphism is also observed between the Bordetella species with regard to the O- antigen, which is only produced by B. bronchiseptica and B. parapertussis. This structure is absent from B. pertussis due to the deletion of the wbm locus 47. It was shown that for B. bronchiseptica, the O-antigen was essential for establishing chronic infections, but not for initial colonization 54. Further, B. bronchiseptica and B. parapertussis mutant strains lacking O-antigen were highly susceptible to complement-mediated killing. Possibly to compensate for this lack of O-antigen, B. pertussis expresses BrkA (Bordetella resistance to killing), which confers resistance to serum, and through another mechanism that has not been elucidated 55. Although the gene encoding BrkA (brka) is also present in B. bronchiseptica, only some strains express BrkA 56. O-antigen may interfere with other virulence factors, possibly by steric hindrance by the long stretches of O-antigenic repeats. In Shigella, shortening of the O-antigen increased the virulence by enhancing the function of the type III secretion system, without loss of LPS protection against the immune system 57. The trisaccharide (the outer core) of the LPS has been shown, similar to the O-antigen, not to be required for initial colonization of the host by B. bronchiseptica, but is important for establishing persistent infections in the presence of adaptive immunity 58. It was also shown to confer resistance against surfactant A (SP-A), a bactericidal host factor that can bind to the lipid A SP-A could inhibit adherence to ciliated epithelial cells of B. bronchiseptica mutants lacking the trisaccharide, but showed only limited effects on ciliary adherence of wild type B. bronchiseptica strains

16 Chapter 1 1 pertactin The genomes of B. bronchiseptica, B. parapertussis and B. pertussis contain 21 genes that encode autotransporters 63, of which B. bronchiseptica comprises the most complete set. Autotransporters are produced as precursors and have the ability to mediate transfer to the outer-membrane through their own C-terminal region. Autotransporters typically consist of a signal sequence, a passenger domain and a conserved autotransporter domain. The signal sequence at the N-terminus directs the transport of the passenger domain to the periplasmic space. In the periplasm, this sequence is cleaved off, and the C-terminal autotransporter domain subsequently forms a β-barrel-shaped pore-like structure in the outer-membrane through which the N-terminal passenger domain can translocate. The passenger domain may encode diverse functions such as proteases, adhesins, toxins and lipases. It may either be cleaved off after translocation to the outer-membrane or it may remain associated to the surface through non-covalent binding 64. One of the autotransporters that is expressed by all three species, in a BvgAS-dependent manner, is Prn. The three species produce mature Prn-molecules with different apparent molecular sizes on gel, a 68-kDa protein (P.68) in B. bronchiseptica 65, a 69-kDa protein (P.69) in B. pertussis 66 and a 70-kDa protein (P.70) in B. parapertussis 67. Comparative analysis of the nucleotide sequences showed that the prn genes of B. bronchiseptica and B. parapertussis were more similar to each other than to B. pertussis 65. Prn contains a Arg- Gly-Asp (RGD) motif that has been proposed to play a role in adherence to host cells 68. Comparison of the prn genes of clinical isolates showed that Prn contains two amino acid repeat regions of which the number of repeat units is polymorphic 69,70. The first amino acid repeat region, designated region 1, is located adjacent to the RGD motif, and the second repeat region, designated region 2, is located more proximate to the C-terminal autotransporter domain. P.69 was shown to elicit protective antibodies in a number of studies 71-74, and it is currently a component of many acellular pertussis vaccines. The crystal structure of the passenger domain of P.69 has been determined 75,76, and the location of linear epitopes has been studied in detail 73,77. Pertactin is a component of many acellular pertussis vaccines. Polymorphism has been observed in pertactin in B. pertussis and it was shown that the pertactin type represented by the vaccine has been gradually replaced by non-vaccine types in the years following vaccination 69,78. Further, the non-vaccine pertactin types have been associated with the reemergence of pertussis in the Netherlands 69. It has been hypothesized that vaccine pressure has selected for non-vaccine types that are better adapted to a situation in which high vaccination coverage exists. pertussis toxin Pertussis toxin (Ptx) is an A-B toxin, composed of five subunits that are designated S1- S5. The subunits are encoded by the ptx operon, comprised of the genes ptxabcde 79,80. 16

17 General Introduction Translocation of Ptx through the outer membrane is mediated through the associated type IV secretion system Ptl (pertussis toxin liberation) that is comprised of nine proteins 81,82. The ptl locus, which encodes Ptl, is located adjacent to the ptx locus and within the same transcriptional unit as Ptx. Ptx is thought to be expressed and produced exclusively by B. pertussis. Curiously, in both B. bronchiseptica and B. parapertussis the genes that are required for expression and secretion of Ptx appear to be largely intact 40. Interspecific differences in expression of Ptx are though to be the result of mutations in the promoter region of the ptx/ ptl locus. Indeed, replacement of the ptx/ptl promoter sequence in a B. parapertussis hu and a B. bronchiseptica strain with the B. pertussis promoter actually resulted in the production and secretion of biologically active Ptx 83. Based upon interspecific comparative analysis of the ptx/ptl promoter sequences, Parkhill et al. postulated that Ptx expression has increased in B. pertussis in the course of its evolution, in contrast to the previous assumption that B. bronchiseptica and B. parapertussis have lost the ability to express Ptx 63. The expression of Ptx and Ptl is controlled by the BvgAS system, and Ptx is thought to play an important role in transmission of B. pertussis. Many studies, both in vitro and in mouse and rat models, have demonstrated major effects of Ptx on mammalian cell signaling pathways. These may lead to a cascade of biological effects, such as insulinemia, histamine sensitization, leukocytosis 84,85 and both immunosuppression and stimulation Important roles have been shown for Ptx in the early phases of respiratory tract infections of mice by B. pertussis. Ptx was further shown to suppress production of B. pertussis-specific antibodies 89,90. Several studies have also shown that Ptx may also function as an adhesin 91,92. Although Ptx was shown to affect the innate and the acquired immune system, a specific role for Ptx has so far not been demonstrated in transmission between humans. Ptx is a major component of all acellular pertussis vaccines, and polymorphism in Ptx was shown to be correlated to the emergence of nonvaccine-type B. pertussis strains in the Netherlands 4,69. 1 dermonecrotic toxin Although the dermonecrotic toxin (Dnt) was one of the first described B. pertussis virulence factors 93, it is one of the less studied toxins of B. pertussis. The toxin, encoded by the BvgAS-regulated gene dnt, is expressed by B. bronchiseptica, B. parapertussis and B. pertussis 94. When purified Dnt is injected intradermally into animals, it produces localized necrotic lesions, hence the name dermonecrotic toxin 93,95,96. For mice, Dnt is lethal at low doses when injected intravenously 93,96,97. Dnt is an atypical toxin in the sense that it is not secreted but remains in the cytoplasm 98,99. Like the cytotoxic necrotizing toxin factor (Cnf) that is produced by Escherichia coli, Dnt activates the small Rho GTPase through deamidation or polyamination 100,101, which leads to stimulation of DNA replication, but blocks cell division. When administered to mammalian cells, it has been shown to induce drastic morphological changes in vitro 100. Although it has been shown to induce extensive mucosal damage in pigs, resulting in turbinate atrophy, and to enhance colonization of the upper 17

18 Chapter 1 1 respiratory tract 102, its role in pertussis pathogenesis has not yet been elucidated. B. pertussis transposon mutants lacking Dnt were no less virulent than wild type B. pertussis strains in a mouse model 103. alcaligin Iron is essential to sustain growth of Bordetella species in the respiratory tract of their host. Mammalian hosts keep the concentration of free iron as low as 10-9 M through sequestration by heme, transferrin, lactoferrin and other iron-chelating factors. Bacterial pathogens have developed different strategies to acquire the necessary iron from the host (reviewed in 104 ). One of these strategies is the production and secretion of low-molecular-weight compounds that can chelate iron with high affinity, known as siderophores. B. bronchiseptica, B. parapertussis and B. pertussis can produce the siderophore alcaligin, and are able to utilize siderophores from other bacteria 105,106. Alcaligin is a hydroxamate siderophore, and is encoded by the alc operon, comprised of the genes alcabcde Transport of iron-bound siderophores across the outer membrane is mediated through a TonB-dependent mechanism. The genomes of the mammalian bordetellae comprise up to 16 TonB-dependent ferric complex receptors, of which B. bronchiseptica may contain the most complete set 63. The receptor for iron-bound alcaligin is FauA, which is encoded by the gene faua, located adjacent to the alc operon 111. The genes alcabcde encode enzymes for the biosynthesis of alcaligin. Under iron-rich conditions, expression of these genes is repressed by Fur. Expression of faua and alcabcde is also regulated by the AraC-like regulator AlcR, encoded by alcr 108,109,112. Recently, the gene alcs, previously designated bcr because of homology to the E. coli bicyclomycin resistance protein, was shown to encode the alcaligin sensor protein AlcS, which was shown to be important for alcaligin secretion 110. Although iron is essential for growth and virulence of Bordetella species, an AlcR deficient B. pertussis, unable to produce and secrete alcaligin, was as virulent as the wild type in mouse respiratory tract infections 109. In contrast, alcaligin was required to confer maximal virulence for B. bronchiseptica in pigs

19 General Introduction virulence, genome reduction, host adaptation and evolution In recent years, developments in molecular biology have led to the ability to determine the complete genome sequences of a bacterium in a relatively short period of time. Recently, the complete sequence of a Mycoplasma genitalum strain was determined in just four hours 114. The comparative genomic analysis of closely related species, some of which may be pathogens, has led to an increased understanding of the mechanism by which bacteria evolve and adapt to changing environments (reviewed in 115 ). It was shown that bacterial genomes are not static and are often in a permanent state of genome flux. Also, the traditional belief that bacteria contain a single circular genome has been challenged; it was shown that Vibrio cholerae contains two circular chromosomes 116 and Borrelia burfdorferi comprises one linear chromosome in addition to at least 17 linear and circular plasmids 117. Several pathogens have evolved predominantly by acquisition of novel functions through DNA uptake. Many distinct mechanisms exist through which bacteria can acquire DNA, such as transformation, conjugation and bacteriophage 118. Examples of pathogenic bacteria in which DNA uptake has played a pivotal role in their evolution are H. pylori, which causes gastro-intestinal infections and N. meningitidis, a commensal of the respiratory tract that can cause diseases such as meningitis and septicemia 123. Genomic islands are large genomic regions, often associated with trna-encoding genes and mobile genetic elements. They usually differ in GC-content in comparison to the rest of the genome. Genomic islands contribute to adaptation to the environment in diverse ways, illustrated by their functional association to virulence, symbiosis, antibiotic resistance, metabolism and many other functions (reviewed in 124 ). If these genomic islands confer an increase in virulence potential, they are called pathogenicity islands, and these have been detected in a number of pathogenic bacterial species (reviewed in ). Yersinia pestis, the causative agent of the plague, and as such responsible for the deaths of countless millions in the Middle Ages, is a clone that has evolved from the enteropathogen Yersinia pseudotuberculosis approximately 6,500 years ago 128,129. Comparison of the genomes of these two closely related species showed that differences in virulence may be attributed to the acquisition of virulence factors, including a high-pathogenicity island (HPI), followed by the deletion and inactivation of genes no longer required for transmission 130,131. Thus, the mechanism of Y. pestis evolution is characterized by the uptake of DNA, followed by a sifting round of genes no longer necessary. This large-scale inactivation of genes, or genome decay, has also been suggested to be the primary driving force of evolution of some other bacterial pathogens. Genome decay may also be associated with increased adaptation to the host, as is observed in the obligate intracellular pathogens Rickettsia prowazekii 132 and Treponema pallidum 133. The genome of Mycobacterium leprae, which causes leprosy, is also riddled with pseudogenes and is also much smaller than the genomes of other, closely related Mycobacterial species, such as Mycobacterium tuberculosis 134,135. Large-scale inactivation of genes may be accomplished through different means, such as the accumulation of mobile 1 19

20 Chapter 1 1 insertion sequence elements that insert in and disrupt genes or the expansion of repetitive DNA sequences. Thus, not only gain of function may enable a bacterium to evolve into a pathogen or restrict the host range, but genome reduction (e.g. through deletion of genes encoding proteins that are readily recognized by the host immune system) may also be an important strategy. evolution of bordetella species causing respiratory infections in mammals Previous studies, based on DNA-DNA hybridization, multilocus enzyme electrophoresis (MLEE), the distribution of insertion sequence elements and the comparison of the 16S and 23S ribosomal RNA sequences suggested that B. bronchiseptica, B. parapertussis and B. pertussis are very closely related 12, These species are commonly referred to as the mammalian bordetellae or the classical bordetellae. Musser et al. and Van der Zee et al. showed that B. parapertussis hu and B. pertussis independently evolved from a B. bronchisepticalike ancestor 12,136. Both B. pertussis and B. parapertussis hu show very limited genetic diversity, whereas B. bronchiseptica is a much more diverse species, genetically 12,136,137,140. Recently, the genome sequences of single strains of B. bronchiseptica, B. parapertussis and B. pertussis have been described by Parkhill et al. 63. The genome sizes of these species are 5.3, 4.8 and 4.1 million basepairs, respectively. The genomes of B. pertussis and B. parapertussis hu contain an unusually high number of pseudogenes (9.4% and 5%, respectively) and insertion sequence elements are widespread in both species. Comparative analysis of the genome sequences showed that the host-restricted species B. pertussis and B. parapertussis hu evolved from a B. bronchiseptica-like ancestor approximately and million years ago, respectively, and that their evolution was accompanied by extensive genome decay. Parkhill et al. suggested that adaptation to a single host by these species was primarily the consequence of loss of function, as there were no indications of significant DNA acquisition in both B. pertussis and B. parapertussis hu. Analysis of the genes that were most frequently deleted or inactivated showed that many of these were involved in membrane transport, smallmolecule metabolism, regulation of gene expression and synthesis of surface structures 63. This was consistent with a comparative genomic hybridization study in which the genomes of various Bordetella strains were hybridized to microarrays representing the genomes of the sequenced Bordetella strains 141. B. holmesii is a recently identified Bordetella species, and not much is known about its evolution and epidemiology. Based upon the nearly identical 16S ribosomal RNA sequences of B. holmesii and B. pertussis, it was originally assumed that these two species were very closely related 29, an assumption that was consistent with the discovery of the B. pertussis insertion sequence element IS481 in B. holmesii 142. However, characterization of the BvgAS virulence control system and analysis of the cellular fatty acid composition suggested that B. holmesii may be more closely related to B. avium, an important pathogen of poultry 29,143. Several studies have shown that B. holmesii does not express many of the virulence factors 20

21 General Introduction that are commonly expressed by B. bronchiseptica, B. parapertussis and B. pertussis 144,145. Due to the lack of formal phylogenetic studies, the position of B. holmesii within the Bordetella genus remains unclear. 1 21

22 Chapter 1 1 outline of this thesis The aim of this thesis was to elucidate the phylogenetic relationships between the Bordetella species causing respiratory disease in mammalian species, and to identify key molecular events that are important for adaptation to humans. In chapter 2 the population genetic relationships between the mammalian bordetellae (B. bronchiseptica, B. parapertussis and B. pertussis) are clarified using a combination of multilocus sequence typing, sequencing of a virulence gene and by determining the distribution of several insertion sequence elements. Evidence is provided for the existence of a B. bronchiseptica lineage, associated with humans, that is closely related to B. pertussis. In chapter 3, the population structure of the mammalian bordetellae, as defined in chapter 2, is refined by comparative genomic hybridization to a Bordetella microarray. Host adaptation of B. pertussis and B. bronchiseptica complex IV strains is studied at a genome-wide level. The absence or polymorphism of several major virulence factors such as pertussis toxin, dermonecrotic toxin and the lipopolysaccharide is suggested to be associated with adaptation of complex IV strains to the human host, and may result in a decrease in cross-immunity to other human-specific Bordetella species in the human host. Gene content comparison suggested genome reduction in the B. bronchiseptica complex IV strains compared to its ancestral lineage, and this was further studied in chapter 4. Using subtractive hybridization, the genomes of B. bronchiseptica complex IV strains were compared to B. bronchiseptica complex I to identify complex IV-specific sequences. Further, by comparison of two B. bronchiseptica complex IV strains, the level of DNA uptake within complex IV is estimated. We provide evidence that DNA uptake has played little or no role in the evolution of B. bronchiseptica complex IV and B. pertussis. In chapter 5, the phylogenetic position of B. holmesii in the Bordetella genus is elucidated by sequencing of housekeeping genes and by comparative genomic hybridization. It is shown that B. holmesii is much closer related to B. avium and B. holmesii than to B. pertussis, despite the presence of B. pertussis-like 16S rrna genes in the genome of B. holmesii. Comparative genomic hybridization identified the presence of a genomic island in the B. holmesii genome conferring iron-uptake functions, and detailed analysis suggested that this island was most likely acquired from B. pertussis and may have played an important role in the evolution and emergence of B. holmesii. The evolution of the pertactin gene in the mammalian bordetellae is studied in chapter 6. Positive selection acting on pertactin is studied by comparing several nucleotide substitution models; and positively selected codons are compared to the location of epitopes. Evidence is provided for immune evasion of the pertactin gene. In the summarizing discussion in chapter 7, the evolution of the Bordetella species that cause respiratory disease in mammals is discussed. 22

23 reference list 1. Cherry,J.D. (1999). Epidemiological, clinical, and laboratory aspects of pertussis in adults. Clin. Infect. Dis. 28 Suppl 2, S112-S Birkebaek,N.H., Kristiansen,M., Seefeldt,T., Degn,J., Moller,A., Heron,I., Andersen,P.L., Moller,J.K., and Ostergard,L. (1999). Bordetella pertussis and chronic cough in adults. Clin. Infect. Dis. 29, Crowcroft,N.S., Stein,C., Duclos,P., and Birmingham,M. (2003). How best to estimate the global burden of pertussis? Lancet Infect. Dis. 3, Mooi,F.R., van Loo,I.H., and King,A.J. (2001). Adaptation of Bordetella pertussis to Vaccination: A Cause for Its Reemergence? Emerg. Infect. Dis ;7. (3 Suppl): , Crowcroft,N.S. and Britto,J. (2002). Whooping cough--a continuing problem. BMJ 324, Orenstein,W.A. (1999). Pertussis in adults: epidemiology, signs, symptoms, and implications for vaccination. Clin. Infect. Dis. 28 Suppl 2, S147- S Major R.H. (1945). Classic Descriptions of Disease, Springfield, C. C. Thomas. 8. LAPIN,J.H. (1943). Whooping Cough, Springfield, Illinois: Charles C. Thomas. 9. Bordet,J. and Gengou,O. Le microbe de la coqueluche. Ann. Inst.Pasteur 20, Paris. Ref Type: Generic 10. Bradford,W.L. and Slavin,B. (1937). An organism resembling Hemophilus pertussis. Am. J. Pub. Health 27, Eldering,G. and Kendrick,P. (1937). A group of cultures resembling both Bacillus pertussis and Bacillus bronchisepticus but identical with neither. J. Bacteriol van der Zee,A., Mooi,F., van Embden,J., and Musser,J. (1997). Molecular evolution and host adaptation of Bordetella spp.: phylogenetic analysis using multilocus enzyme electrophoresis and typing with three insertion sequences. J. Bacteriol. 179, Watanabe,M. and Nagai,M. (2004). Whooping General Introduction cough due to Bordetella parapertussis: an unresolved problem. Expert. Rev Anti. Infect. Ther. 2, Heininger,U., Stehr,K., Schmitt-Grohe,S., Lorenz,C., Rost,R., Christenson,P.D., Uberall,M., and Cherry,J. D. (1994). Clinical characteristics of illness caused by Bordetella parapertussis compared with illness caused by Bordetella pertussis. Pediatr. Infect. Dis. J. 13, VYSOKA,B. (1958). The epidemiology of pertussis and parapertussis. J. Hyg. Epidemiol. Microbiol. Immunol. 2, Weiss,A.A. (1992). The Genus Bordetella. In: The prokaryotes: a handbook on the biology of bacteria, ed. A.Balows, H.G.Truper, M.Dworking, W.Harder, and K.H.SchleiferBerlin: Springer, Cullinane,L.C., Alley,M.R., Marshall,R.B., and Manktelow,B.W. (1987). Bordetella parapertussis from lambs. N. Z. Vet. J. 35, Ferry,N.S. (1910). A preliminary report of the bacterial findings in canine distemper. Am. Vet. Rev. 37, Bauwens,J.E., Spach,D.H., Schacker,T.W., Mustafa,M.M., and Bowden,R.A. (1992). Bordetella bronchiseptica pneumonia and bacteremia following bone marrow transplantation. J. Clin. Microbiol. 30, Espino,A.R., Gascon,L.F., Amor,T.J., Mongil,R., I, Garcia,C.F., and de la Torre,C.C. (1992). [Bacteremia caused by Bordetella bronchiseptica in the course of inflammatory tinea capitis]. An. Esp. Pediatr. 36, Borras,S.M., Bonal,J., Bonet,J., Arnal,J., Roca,F., and Caralps,A. (1991). Bordetella bronchiseptica septicemia in a hemodialysis patient. Nephron 59, Katzenstein,D.A., Ciofalo,L., and Jordan,M.C. (1984). Bordetella bronchiseptica bacteremia. West J. Med. 140, Goodnow,R.A. (1980). Biology of Bordetella bronchiseptica. Microbiol. Rev. 44, Gueirard,P., Weber,C., Le Coustumier,A., and Guiso,N. (1995). Human Bordetella bronchiseptica infection related to contact with infected animals: persistence of bacteria in host. J. Clin. Microbiol 33,

24 1 Chapter Bauwens,J.E., Spach,D.H., Schacker,T.W., Mustafa,M.M., and Bowden,R.A. (1992). Bordetella bronchiseptica pneumonia and bacteremia following bone marrow transplantation. J. Clin. Microbiol 30, Woolfrey,B.F. and Moody,J.A. (1991). Human infections associated with Bordetella bronchiseptica. Clin. Microbiol. Rev. 4, Porter,J.F., Parton,R., and Wardlaw,A.C. (1991). Growth and survival of Bordetella bronchiseptica in natural waters and in buffered saline without added nutrients. Appl. Environ. Microbiol. 57, Porter,J.F. and Wardlaw,A.C. (1993). Long-term survival of Bordetella bronchiseptica in lakewater and in buffered saline without added nutrients. FEMS Microbiol. Lett. 110, Weyant,R.S., Hollis,D.G., Weaver,R.E., Amin,M. F., Steigerwalt,A.G., O Connor,S.P., Whitney,A. M., Daneshvar,M.I., Moss,C.W., and Brenner,D.J. (1995). Bordetella holmesii sp. nov., a new gramnegative species associated with septicemia. J. Clin. Microbiol. 33, Yih,W.K., Silva,E.A., Ida,J., Harrington,N., Lett,S.M., and George,H. (1999). Bordetella holmesii-like organisms isolated from Massachusetts patients with pertussis-like symptoms. Emerg. Infect. Dis. 5, Shepard,C.W., Daneshvar,M.I., Kaiser,R.M., Ashford,D.A., Lonsway,D., Patel,J.B., Morey,R. E., Jordan,J.G., Weyant,R.S., and Fischer,M. (2004). Bordetella holmesii bacteremia: a newly recognized clinical entity among asplenic patients. Clin. Infect. Dis. 38, Cotter,P.A. and Jones,A.M. (2003). Phosphorelay control of virulence gene expression in Bordetella. Trends Microbiol 11, Scarlato,V., Arico,B., Prugnola,A., and Rappuoli,R. (1991). Sequential activation and environmental regulation of virulence genes in Bordetella pertussis. EMBO J. 10, Prugnola,A., Arico,B., Manetti,R., Rappuoli,R., and Scarlato,V. (1995). Response of the bvg regulon of Bordetella pertussis to different temperatures and short-term temperature shifts. Microbiology 141 ( Pt 10), Cotter,P.A. and Miller,J.F. (1997). A mutation in the Bordetella bronchiseptica bvgs gene results in reduced virulence and increased resistance to starvation, and identifies a new class of Bvgregulated antigens. Mol. Microbiol. 24, Stockbauer,K.E., Fuchslocher,B., Miller,J. F., and Cotter,P.A. (2001). Identification and characterization of BipA, a Bordetella Bvgintermediate phase protein. Mol. Microbiol Jan. ;39. (1): , Merkel,T.J. and Stibitz,S. (1995). Identification of a locus required for the regulation of bvg-repressed genes in Bordetella pertussis. J. Bacteriol. 177, Merkel,T.J., Barros,C., and Stibitz,S. (1998). Characterization of the bvgr locus of Bordetella pertussis. J. Bacteriol. 180, Martinez de Tejada,G., Miller,J.F., and Cotter,P. A. (1996). Comparative analysis of the virulence control systems of Bordetella pertussis and Bordetella bronchiseptica. Molecular Microbiology 22, Marchitto,K.S., Smith,S.G., Locht,C., and Keith,J. M. (1987). Nucleotide sequence homology to pertussis toxin gene in Bordetella bronchiseptica and Bordetella parapertussis. Infect. Immun. 55, Finn,T.M. and Stevens,L.A. (1995). Tracheal colonization factor: a Bordetella pertussis secreted virulence determinant. Mol. Microbiol. 16, Gronow,S. and Brade,H. (2001). Lipopolysaccharide biosynthesis: which steps do bacteria need to survive? J. Endotoxin. Res. 7, van den Akker,W.M. (1998). Lipopolysaccharide expression within the genus Bordetella: influence of temperature and phase variation. Microbiology 144 ( Pt 6), Caroff,M., Karibian,D., Cavaillon,J.M., and Haeffner- Cavaillon,N. (2002). Structural and functional analyses of bacterial lipopolysaccharides. Microbes. Infect. 4, Erridge,C., Bennett-Guerrero,E., and Poxton,I.R. (2002). Structure and function of lipopolysaccharides. Microbes. Infect. 4, Isobe,T., White,K.A., Allen,A.G., Peacock,M., Raetz,C. R., and Maskell,D.J. (1999). Bordetella pertussis waaa encodes a monofunctional 2-keto-3-deoxy- D-manno-octulosonic acid transferase that can complement an Escherichia coli waaa mutation. J. 24

25 Bacteriol. 181, Preston,A., Allen,A.G., Cadisch,J., Thomas,R., Stevens,K., Churcher,C.M., Badcock,K.L., Parkhill,J., Barrell,B., and Maskell,D.J. (1999). Genetic basis for lipopolysaccharide O-antigen biosynthesis in bordetellae. Infect. Immun. 67, Preston,A. and Maskell,D. (2001). The molecular genetics and role in infection of lipopolysaccharide biosynthesis in the Bordetellae. J. Endotoxin. Res. 7, Allen,A.G., Isobe,T., and Maskell,D.J. (1998). Identification and cloning of waaf (rfaf) from Bordetella pertussis and use to generate mutants of Bordetella spp. with deep rough lipopolysaccharide. J. Bacteriol. 180, Allen,A. and Maskell,D. (1996). The identification, cloning and mutagenesis of a genetic locus required for lipopolysaccharide biosynthesis in Bordetella pertussis. Mol Microbiol 19, Preston,A., Maxim,E., Toland,E., Pishko,E.J., Harvill,E. T., Caroff,M., and Maskell,D.J. (2003). Bordetella bronchiseptica PagP is a Bvg-regulated lipid A palmitoyl transferase that is required for persistent colonization of the mouse respiratory tract. Mol Microbiol 48, Bishop,R.E., Gibbons,H.S., Guina,T., Trent,M. S., Miller,S.I., and Raetz,C.R. (2000). Transfer of palmitate from phospholipids to lipid A in outer membranes of gram-negative bacteria. EMBO J. 19, Bishop,R.E. (2005). The lipid A palmitoyltransferase PagP: molecular mechanisms and role in bacterial pathogenesis. Molecular Microbiology 57, Burns,V.C., Pishko,E.J., Preston,A., Maskell,D.J., and Harvill,E.T. (2003). Role of Bordetella o antigen in respiratory tract infection. Infect. Immun. 71, Pishko,E.J., Betting,D.J., Hutter,C.S., and Harvill,E. T. (2003). Bordetella pertussis Acquires Resistance to Complement-Mediated Killing In Vivo. Infect. Immun. 71, Rambow,A.A., Fernandez,R.C., and Weiss,A.A. (1998). Characterization of BrkA Expression in Bordetella bronchiseptica. Infect. Immun. 66, West,N.P. et al. (2005). Optimization of virulence functions through glucosylation of Shigella LPS. General Introduction Science 307, Harvill,E.T., Preston,A., Cotter,P.A., Allen,A.G., Maskell,D.J., and Miller,J.F. (2000). Multiple roles for Bordetella lipopolysaccharide molecules during respiratory tract infection. Infect. Immun. 68, Banemann,A., Deppisch,H., and Gross,R. (1998). The lipopolysaccharide of Bordetella bronchiseptica acts as a protective shield against antimicrobial peptides. Infect. Immun. 66, Schaeffer,L.M., McCormack,F.X., Wu,H., and Weiss,A. A. (2004). Interactions of pulmonary collectins with Bordetella bronchiseptica and Bordetella pertussis lipopolysaccharide elucidate the structural basis of their antimicrobial activities. Infect. Immun. 72, Schaeffer,L.M., McCormack,F.X., Wu,H., and Weiss,A. A. (2004). Bordetella pertussis lipopolysaccharide resists the bactericidal effects of pulmonary surfactant protein A. J. Immunol. 173, Edwards,J.A., Groathouse,N.A., and Boitano,S. (2005). Bordetella bronchiseptica Adherence to Cilia Is Mediated by Multiple Adhesin Factors and Blocked by Surfactant Protein A. Infect. Immun. 73, Parkhill,J., Sebaihia,M., Preston,A., Murphy,L.D., Thomson,N., Harris,D.E., Holden,M.T., Churcher,C. M., Bentley,S.D., Mungall,K.L., Cerdeno-Tarraga,A. M., Temple,L., James,K., Harris,B., Quail,M.A., Achtman,M., Atkin,R., Baker,S., Basham,D., Bason,N., Cherevach,I., Chillingworth,T., Collins,M., Cronin,A., Davis,P., Doggett,J., Feltwell,T., Goble,A., Hamlin,N., Hauser,H., Holroyd,S., Jagels,K., Leather,S., Moule,S., Norberczak,H., O Neil,S., Ormond,D., Price,C., Rabbinowitsch,E., Rutter,S., Sanders,M., Saunders,D., Seeger,K., Sharp,S., Simmonds,M., Skelton,J., Squares,R., Squares,S., Stevens,K., Unwin,L., Whitehead,S., Barrell,B.G., Maskell,D. J. (2003). Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet. 35, Henderson,I.R. and Nataro,J.P. (2001). Virulence functions of autotransporter proteins. Infect. Immun. 69, Li,J., Fairweather,N.F., Novotny,P., Dougan,G., and Charles,I.G. (1992). Cloning, nucleotide sequence and heterologous expression of the protective outer-membrane protein P.68 pertactin from Bordetella bronchiseptica. J. Gen. Microbiol. 138 ( 1 25

26 1 Chapter 1 Pt 8), Charles,I.G., Dougan,G., Pickard,D., Chatfield,S., Smith,M., Novotny,P., Morrissey,P., and Fairweather,N.F. (1989). Molecular cloning and characterization of protective outer membrane protein P.69 from Bordetella pertussis. Proc. Natl. Acad. Sci. U. S. A 86, Li,L.J., Dougan,G., Novotny,P., and Charles,I.G. (1991). P.70 pertactin, an outer-membrane protein from Bordetella parapertussis: cloning, nucleotide sequence and surface expression in Escherichia coli. Mol. Microbiol. 5, Leininger,E., Roberts,M., Kenimer,J.G., Charles,I. G., Fairweather,N., Novotny,P., and Brennan,M. J. (1991). Pertactin, an Arg-Gly-Asp-containing Bordetella pertussis surface protein that promotes adherence of mammalian cells. Proc. Natl. Acad. Sci. U. S. A. 88, Mooi,F.R., van Oirschot,H., Heuvelman,K., van der Heide,H.G., Gaastra,W., and Willems,R.J. (1998). Polymorphism in the Bordetella pertussis virulence factors P.69/pertactin and pertussis toxin in The Netherlands: temporal trends and evidence for vaccine-driven evolution. Infect. Immun. 66, Boursaux-Eude,C. and Guiso,N. (2000). Polymorphism of Repeated Regions of Pertactin in Bordetella pertussis, Bordetella parapertussis, and Bordetella bronchiseptica. Infect. Immun. 68, Cherry,J.D., Gornbein,J., Heininger,U., and Stehr,K. (1998). A search for serologic correlates of immunity to Bordetella pertussis cough illnesses. Vaccine 16, Kerr,J.R. and Matthews,R.C. (2000). Bordetella pertussis infection: pathogenesis, diagnosis, management, and the role of protective immunity. Eur. J. Clin. Microbiol Infect. Dis. 19, King,A.J., Berbers,G., van Oirschot,H.F., Hoogerhout,P., Knipping,K., and Mooi,F.R. (2001). Role of the polymorphic region 1 of the Bordetella pertussis protein pertactin in immunity. Microbiology 147, Storsaeter,J., Hallander,H.O., Gustafsson,L., and Olin,P. (1998). Levels of anti-pertussis antibodies related to protection after household exposure to Bordetella pertussis. Vaccine 16, Emsley,P., Charles,I.G., Fairweather,N.F., and Isaacs,N.W. (1996). Structure of Bordetella pertussis virulence factor P.69 pertactin. Nature 381, Emsley,P., McDermott,G., Charles,I.G., Fairweather,N. F., and Isaacs,N.W. (1994). Crystallographic characterization of pertactin, a membraneassociated protein from Bordetella pertussis. J. Mol. Biol. 235, Hijnen,M., Mooi,F.R., van Gageldonk,P.G., Hoogerhout,P., King,A.J., and Berbers,G.A. (2004). Epitope structure of the Bordetella pertussis protein P.69 pertactin, a major vaccine component and protective antigen. Infect. Immun. 72, van Loo,I.H.M., Heuvelman,K.J., King,A.J., and Mooi,F.R. (2002). Multilocus Sequence Typing of Bordetella pertussis Based on Surface Protein Genes. J. Clin. Microbiol. 40, Locht,C. and Keith,J.M. (1986). Pertussis toxin gene: nucleotide sequence and genetic organization. Science 232, Nicosia,A., Perugini,M., Franzini,C., Casagli,M.C., Borri,M.G., Antoni,G., Almoni,M., Neri,P., Ratti,G., and Rappuoli,R. (1986). Cloning and sequencing of the pertussis toxin genes: operon structure and gene duplication. Proc. Natl. Acad. Sci. U. S. A 83, Weiss,A.A., Johnson,F.D., and Burns,D.L. (1993). Molecular characterization of an operon required for pertussis toxin secretion. Proc. Natl. Acad. Sci. U. S. A 90, Farizo,K.M., Cafarella,T.G., and Burns,D.L. (1996). Evidence for a ninth gene, ptli, in the locus encoding the pertussis toxin secretion system of Bordetella pertussis and formation of a PtlI-PtlF complex. J. Biol. Chem. 271, Hausman,S.Z., Cherry,J.D., Heininger,U., Wirsing Von Konig,C.H., and Burns,D.L. (1996). Analysis of proteins encoded by the ptx and ptl genes of Bordetella bronchiseptica and Bordetella parapertussis. Infect. Immun. 64, Reisine,T. (1990). Pertussis toxin in the analysis of receptor mechanisms. Biochem. Pharmacol. 39, Wong,W.S. and Rosoff,P.M. (1996). Pharmacology of pertussis toxin B-oligomer. Can. J. Physiol Pharmacol. 74, Morse,S.I. and Morse,J.H. (1976). Isolation and properties of the leukocytosis- and lymphocytosis- 26

27 promoting factor of Bordetella pertussis. J. Exp. Med. 143, Munoz,J.J., Arai,H., Bergman,R.K., and Sadowski,P. L. (1981). Biological activities of crystalline pertussigen from Bordetella pertussis. Infect. Immun. 33, Pittman,M. (1979). Pertussis toxin: the cause of the harmful effects and prolonged immunity of whooping cough. A hypothesis. Rev. Infect. Dis. 1, Carbonetti,N.H., Artamonova,G.V., Andreasen,C., Dudley,E., Mays,R.M., and Worthington,Z.E. (2004). Suppression of Serum Antibody Responses by Pertussis Toxin after Respiratory Tract Colonization by Bordetella pertussis and Identification of an Immunodominant Lipoprotein. Infect. Immun. 72, Mielcarek,N., Riveau,G., Remoue,F., Antoine,R., Capron,A., and Locht,C. (1998). Homologous and heterologous protection after single intranasal administration of live attenuated recombinant Bordetella pertussis. Nat. Biotechnol. 16, Relman,D., Tuomanen,E., Falkow,S., Golenbock,D. T., Saukkonen,K., and Wright,S.D. (1990). Recognition of a bacterial adhesion by an integrin: macrophage CR3 (alpha M beta 2, CD11b/CD18) binds filamentous hemagglutinin of Bordetella pertussis. Cell 61, Tuomanen,E. and Weiss,A. (1985). Characterization of two adhesins of Bordetella pertussis for human ciliated respiratory-epithelial cells. J. Infect. Dis. 152, Bordet,J. and Gengou,O. (1909). L endotoxine coquelucheuse. Ann. Inst. Pasteur 23, Walker,K.E. and Weiss,A.A. (1994). Characterization of the dermonecrotic toxin in members of the genus Bordetella. Infect. Immun. 62, Livey,I. and Wardlaw,A.C. (1984). Production and properties of Bordetella pertussis heat-labile toxin. J. Med. Microbiol. 17, Parton,R. (1985). Effect of prednisolone on the toxicity of Bordetella pertussis for mice. J. Med. Microbiol. 19, Iida,T. and Okonogi,T. (1971). Lienotoxicity of Bordetella pertussis in mice. J. Med. Microbiol. 4, Cowell,J.L., Hewlett,E.L., and Manclark,C.R. (1979). General Introduction Intracellular localization of the dermonecrotic toxin of Bordetella pertussis. Infect. Immun. 25, Nakai,T., Sawata,A., and Kume,K. (1985). Intracellular locations of dermonecrotic toxins in Pasteurella multocida and in Bordetella bronchiseptica. Am. J. Vet. Res. 46, Kashimoto,T., Katahira,J., Cornejo,W.R., Masuda,M., Fukuoh,A., Matsuzawa,T., Ohnishi,T., and Horiguchi,Y. (1999). Identification of functional domains of Bordetella dermonecrotizing toxin. Infect. Immun. 67, Hoffmann,C. and Schmidt,G. (2004). CNF and DNT. Rev. Physiol Biochem. Pharmacol Brockmeier,S.L., Register,K.B., Magyar,T., Lax,A.J., Pullinger,G.D., and Kunkle,R.A. (2002). Role of the Dermonecrotic Toxin of Bordetella bronchiseptica in the Pathogenesis of Respiratory Disease in Swine. Infect. Immun. 70, Weiss,A.A. and Goodwin,M.S. (1989). Lethal infection by Bordetella pertussis mutants in the infant mouse model. Infect. Immun. 57, Schaible,U.E. and Kaufmann,S.H. (2004). Iron and microbial infection. Nat Rev. Microbiol 2, Moore,C.H., Foster,L.A., Gerbig,D.G., Jr., Dyer,D.W., and Gibson,B.W. (1995). Identification of alcaligin as the siderophore produced by Bordetella pertussis and B. bronchiseptica. J Bacteriol. 177, Vanderpool,C.K. and Armstrong,S.K. (2004). Integration of environmental signals controls expression of Bordetella heme utilization genes. J Bacteriol. 186, Kang,H.Y., Brickman,T.J., Beaumont,F.C., and Armstrong,S.K. (1996). Identification and characterization of iron-regulated Bordetella pertussis alcaligin siderophore biosynthesis genes. J Bacteriol. 178, Beaumont,F.C., Kang,H.Y., Brickman,T.J., and Armstrong,S.K. (1998). Identification and characterization of alcr, a gene encoding an AraClike regulator of alcaligin siderophore biosynthesis and transport in Bordetella pertussis and Bordetella bronchiseptica. J. Bacteriol. 180, Pradel,E., Guiso,N., and Locht,C. (1998). Identification of AlcR, an AraC-type regulator of alcaligin siderophore synthesis in Bordetella 1 27

28 1 Chapter 1 bronchiseptica and Bordetella pertussis. J. Bacteriol. 180, Brickman,T.J. and Armstrong,S.K. (2005). Bordetella AlcS Transporter Functions in Alcaligin Siderophore Export and Is Central to Inducer Sensing in Positive Regulation of Alcaligin System Gene Expression. J. Bacteriol. 187, Brickman,T.J. and Armstrong,S.K. (1999). Essential role of the iron-regulated outer membrane receptor FauA in alcaligin siderophore-mediated iron uptake in Bordetella species. J. Bacteriol. 181, Brickman,T.J., Kang,H.Y., and Armstrong,S.K. (2001). Transcriptional activation of Bordetella alcaligin siderophore genes requires the AlcR regulator with alcaligin as inducer. J. Bacteriol. 183, Register,K.B., Ducey,T.F., Brockmeier,S.L., and Dyer,D.W. (2001). Reduced virulence of a Bordetella bronchiseptica siderophore mutant in neonatal swine. Infect. Immun. 69, Margulies,M. et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature Wren,B.W. (2000). Microbial genome analysis: insights into virulence, host adaptation and evolution. Nat. Rev. Genet. 1, Heidelberg,J.F. et al. (2000). DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature 406, Fraser,C.M. et al. (1997). Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390, Ochman,H., Lawrence,J.G., and Groisman,E.A. (2000). Lateral gene transfer and the nature of bacterial innovation. Nature 405, Tomb,J.F. et al. (1997). The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388, Alm,R.A. et al. (1999). Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature 397, Saunders,N.J., Boonmee,P., Peden,J.F., and Jarvis,S. A. (2005). Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori. BMC. Genomics 6, Saunders,N.J., Peden,J.F., Hood,D.W., and Moxon,E. R. (1998). Simple sequence repeats in the Helicobacter pylori genome. Mol. Microbiol. 27, Tettelin,H. et al. (2000). Complete genome sequence of Neisseria meningitidis serogroup B strain MC58. Science 287, Dobrindt,U., Hochhut,B., Hentschel,U., and Hacker,J. (2004). Genomic islands in pathogenic and environmental microorganisms. Nat. Rev. Microbiol. 2, Hacker,J., Blum-Oehler,G., Muhldorfer,I., and Tschape,H. (1997). Pathogenicity islands of virulent bacteria: structure, function and impact on microbial evolution. Mol Microbiol 23, Hacker,J. and Kaper,J.B. (2000). Pathogenicity islands and the evolution of microbes. Annu. Rev. Microbiol 54, Schmidt,H. and Hensel,M. (2004). Pathogenicity Islands in Bacterial Pathogenesis. Clin. Microbiol Rev. 17, Achtman,M., Zurth,K., Morelli,G., Torrea,G., Guiyoule,A., and Carniel,E. (1999). Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis. PNAS 96, Achtman,M. et al. (2004). Microevolution and history of the plague bacillus, Yersinia pestis. PNAS 101, Chain,P.S.G. et al. (2004). Insights into the evolution of Yersinia pestis through whole-genome comparison with Yersinia pseudotuberculosis. PNAS Parkhill,J. et al. (2001). Genome sequence of Yersinia pestis, the causative agent of plague. Nature 413, Andersson,S.G., Zomorodipour,A., Andersson,J. O., Sicheritz-Ponten,T., Alsmark,U.C., Podowski,R. M., Naslund,A.K., Eriksson,A.S., Winkler,H.H., and Kurland,C.G. (1998). The genome sequence of Rickettsia prowazekii and the origin of mitochondria. Nature 396, Fraser,C.M. et al. (1998). Complete genome sequence of Treponema pallidum, the syphilis spirochete. Science 281, Brosch,R., Gordon,S.V., Eiglmeier,K., Garnier,T., and Cole,S.T. (2000). Comparative genomics of the 28

29 leprosy and tubercle bacilli. Res. Microbiol. 151, Brosch,R., Pym,A.S., Gordon,S.V., and Cole,S. T. (2001). The evolution of mycobacterial pathogenicity: clues from comparative genomics. Trends Microbiol Sep. ;9. (9. ): , Musser,J.M., Hewlett,E.L., Peppler,M.S., and Selander,R.K. (1986). Genetic diversity and relationships in populations of Bordetella spp. J. Bacteriol. 166, Musser,J.M., Bemis,D.A., Ishikawa,H., and Selander,R. K. (1987). Clonal diversity and host distribution in Bordetella bronchiseptica. J. Bacteriol. 169, Arico,B., Gross,R., Smida,J., and Rappuoli,R. (1987). Evolutionary relationships in the genus Bordetella. Mol. Microbiol. 1, Muller,M. and Hildebrandt,A. (1993). Nucleotide sequences of the 23S rrna genes from Bordetella pertussis, B.parapertussis, B.bronchiseptica and B.avium, and their implications for phylogenetic analysis. Nucleic Acids Res. 21, van Loo,I.H., van der Heide,H.G., Nagelkerke,N. J., Verhoef,J., and Mooi,F.R. (1999). Temporal trends in the population structure of Bordetella pertussis during in a highly vaccinated population. J. Infect. Dis. 179, Cummings,C.A., Brinig,M.M., Lepp,P.W., Van De,P. S., and Relman,D.A. (2004). Bordetella species are distinguished by patterns of substantial gene loss and host adaptation. J Bacteriol. 186, Reischl,U., Lehn,N., Sanden,G.N., and Loeffelholz,M. J. (2001). Real-Time PCR Assay Targeting IS481 of Bordetella pertussis and Molecular Basis for Detecting Bordetella holmesii. J. Clin. Microbiol. 39, Gerlach,G., Janzen,S., Beier,D., and Gross,R. (2004). Functional characterization of the BvgAS two-component system of Bordetella holmesii. Microbiology 150, Njamkepo,E., Delisle,F., Hagege,I., Gerbaud,G., and Guiso,N. (2000). Bordetella holmesii isolated from a patient with sickle cell anemia: analysis and comparison with other Bordetella holmesii isolates. Clin. Microbiol. Infect Mar. ;6. (3): , Gerlach,G., von Wintzingerode,F., Middendorf,B., General Introduction and Gross,R. (2001). Evolutionary trends in the genus Bordetella. Microbes and Infection 3,

30 30

31 Chapter Chapter 22 Genetic Relationships of the Mammalian Bordetellae Dimitri A. Diavatopoulos 1,2, Craig A. Cummings 3,5, Leo M. Schouls 1, Mary M. Brinig 3,5, David A. Relman 3,4,5, Frits R. Mooi 1,2 1 Laboratory for Vaccine-Preventable Diseases, National Institute of Public Health and the Environment, Bilthoven, The Netherlands; 2 Eijkman Winkler Institute, University Medical Center, Utrecht, The Netherlands; 3 Departments of Microbiology and Immunology; and of 4 Medicine, Stanford University School of Medicine, Stanford, California 94305, USA; 5 VA Palo Alto Health Care System, Palo Alto, California 94304, USA Chapter 2&3, PLoS Pathogens, 2005

32 Chapter 2 2 abstract Bordetella pertussis, Bordetella bronchiseptica, Bordetella parapertussis hu and Bordetella parapertussis ov are closely related respiratory pathogens that infect mammalian species. B. pertussis and B. parapertussis hu are exclusively human pathogens and cause whooping cough or pertussis, a disease which kills 300,000 persons annually, and is reemerging despite vaccination. Although it most often infects animals, infrequently B. bronchiseptica is isolated from humans, and these infections are thought to be zoonotic. B. pertussis and B. parapertussis hu are assumed to have evolved from a B. bronchiseptica-like ancestor independently. To determine the phylogenetic relationships among these species, a total of seven housekeeping genes and one virulence gene (coding for pertactin) were sequenced. Further, the distribution of four insertion sequence elements was determined, using a collection of 132 strains. This approach distinguished four complexes, representing B. pertussis, B. parapertussis hu and two distinct B. bronchiseptica subpopulations, designated complexes I and IV. Of the two B. bronchiseptica complexes, complex IV was more closely related to B. pertussis. Of interest, while only 32% of the complex I strains were isolated from humans, 80% of the complex IV strains were human isolates. Thus, complex IV strains may comprise a human-associated lineage of B. bronchiseptica from which B. pertussis evolved. These findings will facilitate the study of pathogen host-adaptation. Our results shed light on the origins of the disease pertussis and suggest that the association of B. pertussis with humans may be more ancient than previously assumed. 32

33 Multilocus Sequence Typing introduction Members of the genus Bordetella are predominantly pathogenic species, and three of these are presumed to be exclusively respiratory pathogens of mammalian hosts: Bordetella bronchiseptica, Bordetella pertussis and Bordetella parapertussis (henceforth referred to as the mammalian bordetellae). B. bronchiseptica causes chronic and often asymptomatic respiratory tract infections in a wide variety of mammals. It is only sporadically isolated from humans 1,2. These are usually immunocompromised individuals, and human infections have been considered to be zoonotic 3. B. parapertussis consists of two distinct lineages found in humans and sheep (B. parapertussis hu and B. parapertussis ov, respectively) 4. B. pertussis and B. parapertussis hu have been isolated exclusively from humans and cause acute and transient infections, designated whooping cough or pertussis. Whooping cough is especially severe in young, unvaccinated children and has reemerged in recent years in vaccinated populations 5-7. Previous research, based on orthologous gene pairs between genomes, indicated that B. pertussis and B. parapertussis hu independently evolved from a B. bronchiseptica-like ancestor about and million years ago, respectively 8,9. Despite their different host tropisms, the mammalian bordetellae are very closely related 9,10, which makes the mammalian bordetellae attractive candidates to study host-adaptation. Such studies are facilitated by the availability of the genome sequences of B. bronchiseptica, B. pertussis and B. parapertussis 8 hu. Thus far, only a single representative of each species has been sequenced, and it is important to determine their relationships to the Bordetella population on the whole. To that purpose, we used a combination of sequencing of housekeeping and virulence genes and the distribution of several insertion sequence elements (ISEs) to characterize 132 mammalian Bordetella strains with diverse host distributions. These studies identified four complexes, representing B. pertussis, B. parapertussis hu and two distinct B. bronchiseptica lineages, designated complex I-IV. The two B. bronchiseptica complexes, designated complex I and IV, showed different host-distributions and were isolated mainly from animals hosts and humans, respectively. Of these two complexes, B. bronchiseptica complex IV was more closely related to B. pertussis and may comprise strains that are human-adapted. Our data suggest that B. parapertussis hu evolved from an animal-associated lineage of B. bronchiseptica, while B. pertussis evolved from a distinct B. bronchiseptica lineage. Members of this newlyidentified B. bronchiseptica lineage continue to circulate today and cause human disease. This may suggest that the association of B. pertussis to humans evolved before its recent clonal expansion. 2 33

34 Chapter 2 experimental procedures 2 bacterial strains A total of 132 Bordetella isolates were used in this study: 91 B. bronchiseptica; 9 B. parapertussis hu ; 3 B. parapertussis ov and 29 B. pertussis isolates (a table with strain information is available from the authors). The three strains from which the genome sequence has been determined, B. bronchiseptica RB50, B. pertussis Tohama and B. parapertussis , were included. The collection included clinical isolates from humans and a broad range of animal species. Strains were grown on Bordet Gengou (BD, Franklin Lakes, NJ, USA) agar supplemented with 15% sheep blood at 37 C for two to five days. Chromosomal DNA was isolated using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI), according to the manufacturers protocol for Gram-negative bacteria. dna sequencing The nucleotide sequences were determined for internal regions of seven housekeeping genes for all strains ( 11 ). The nucleotide sequence of the prn region encoding the extracellular domain of the surface-associated autotransporter pertactin, P.69, was determined for 116 strains, with the exclusion of the repeat regions 1 and These regions are comprised of amino acids repeats and are highly polymorphic due to insertion or deletion of the repeat unit. Primer characteristics are listed in Table 1, and can also be found at detection of ises The distribution of IS481, IS1001, IS1002 and IS1663 was determined for all strains using PCR amplification. For PCR amplification of IS481, IS1001 and IS1002, primers were used that have been described previously 4,13. Primer characteristics are listed in Table 1. sequence data analysis Analysis of nucleotide sequence data was performed using Bionumerics software package version 4.0 beta 4 (Applied Maths, Sint-Martens-Latem, Belgium). The Bordetella MLST database can be accessed at The nucleotide sequences of pertactin have been deposited in GenBank under accession numbers DQ DQ and DQ DQ For each locus in the MLST analysis, the allele sequences for all strains were trimmed to a uniform length, and an allele number was assigned to each unique allele sequence. The combination of the allele numbers at the seven loci defines the sequence type (ST) or allelic profile of each strain. Construction of trees based on allelic profiles may not accurately reflect the true genetic distance because both single and multiple nucleotide polymorphisms 34

35 Multilocus Sequence Typing Table 1. Primer characteristics for the genes used in multilocus sequence typing, pertactin sequencing and in the detection of the insertion sequence elements Gene1 Product1 Primer Name Sequence (5-3 ) adk adenylate kinase Adk-F AGCCGCCTTTCTCACCCAACACT Adk-R TGGGCCCAGGACGAGTAGT fumc fumarate hydratase class II FumC-F CGTGAACCGGGGCCAGTCGTC FumC-R GGCCAGCCAGCGCACATCGTT icd isocitrate dehydrogenase Icd-F CTGGTCCACAAGGGCAACAT Icd-R ACACCTGGGTGGCGCCTTC glya serine hydroxymethyltransferase GlyA-F CAACCAGGGCGTGTACATGGC GlyA-R CCGCGATGACGTGCATCAG tyrb aromatic amino-acid aminotransferase TyrB-F CGAGACCTACGCTTATTACGAT TyrB-R TGCCGGCCAGTTCATTTT pepa cytosol aminopeptidase PepA-F CGCCCCAGGTTGAAGAAAATCGTC PepA-R ATCAGGCCCACCACATCCAG pgm phoshoglucomutase Pgm-F CGCCCATGTCACCAGCACCGA Pgm-R CGCCGTCTATCGTAACCAG IS481 transposase IS481-F GGGGTCACCGCGCCGACTGT IS481-R GGGCCTGATGCTCGTAGCGC IS1001 transposase IS1001-F CGCCGCTTGATGACCTTGATA IS1001-R CACCGCCTACGAGTTGGAGAT IS1002 transposase IS1002-F TCCCAGCTCCACGCACACCG IS1002-R AACAACCATAAGCATGCGCG IS1663 transposase IS1663-F2 GGGTCTGTATCACGAGCAAGCGG IS1663-R CTTTGCGATTGAGCTCACGCAAC IS1663-F22 GCGAGACACTGGACGGTATCG IS1663-R2 GGGGACAGATACCGTCTTGGC IS1663-SPF1 CAGTTCAGCCCCTCGGCGC IS1663-SPR1 CTTTGCGATTGAGCTCACGCA prn pertactin Prn-SPF1 TCCCTGTTCCATCGCGGTG Prn-SPR3 GTTGGCGGCCAATCGATAGC Prn-SPF2 ATCGCGCTCTATGTGGCCG Prn-SPR1 CCTGAGCCTGGAGACTGGCAC Prn-SPF3 CACCGCACGGCAATGTCATC Prn-SPF4 GGCGACCTTTACCCTTGCCAA Prn-SPR2 CAGCGTCGCGTCCAGGTAGA Prn-SPR4 GCAAGGTGATCGACAGGGGC Prn-SPR5 TGGACCGTGACATTGGCGC 2 ¹ Gene name and product as annotated by the Sanger Centre sequencing team ² IS1663-F and R were used only for detection of IS1663; IS1663-F2 and R2 were used for determination of the nucleotide sequence are given equal weight. Consequently, the degree of sequence difference between two alleles is not quantitatively reflected in the MLST profile. Conversely, tree construction based on concatenated allele sequences does not take into account the introduction of clustered multiple base substitutions due to a single recombinational event. As a result, trees based on MLST sequences often contain long braches, incorrectly suggesting a large genetic distance. Therefore, we used a method designated as split-mlst, in which each locus is split into a user-defined number of equally sized sub-loci (D. A. Diavatopoulos, P. Vauterin, L. Vauterin, F.R. Mooi & L.M. Schouls, unpublished data). Using this method, the sensitivity of categorical clustering could be increased, without the perturbing effect of recombination. 35

36 Chapter 2 2 The topology of the tree appeared to vary if the number of sub-loci per MLST locus was lower than five. However, above the value four, increasing the number of sub-loci had no significant effect on the topology of the tree, and we therefore selected the lowest possible split-value, five, resulting in a total of 35 sub-loci. For sequencing of the pertactin gene, the nucleotides encoding the extracellular domain of pertactin were determined (nucleotides of BP1054, of BB1366, and of BPP1150, the pertactin genes of B. pertussis Tohama, B. bronchiseptica RB50 and of B. parapertussis 12822, respectively). Based on these sequences, a UPGMA tree was constructed, with the exclusion of the polymorphic regions 1 and 2 (region 1 comprises nucleotides of BP1054, of BB1366 and of BPP1150, respectively; region 2 comprises nucleotides of BP1054, of BB1366 and of BPP1150, respectively). genetic diversity of the complexes The genetic diversity for each complex was calculated using the Shannon-Weiner index of diversity (H) using the following formula: H = P i ln Pi where P i is the frequency of the i th type 14. calculation of divergence times For estimation of divergence times between complexes, we calculated the pair wise mean distance (K s ) between alleles using DNASP The divergence time was calculated using the following formula: K s Age = r where K s is the number of synonymous substitutions per synonymous site and r is the molecular clock rate of Escherichia coli as determined by Whittam 16 or by Guttman and Dykhuizen 17. We used these two rates to calculate a range of divergence times. The divergence time was first calculated for each combination of STs between complexes, and from these the averaged age between complexes was calculated. 36

37 Multilocus Sequence Typing results population genetic relationships of the mammalian bordetellae To determine the relationships between the mammalian bordetellae, we determined partial sequences of seven housekeeping genes from 132 strains ( We observed 32 sequence types (STs) among the 132 Bordetella isolates. Allele segments were divided into five equally sized sub-loci and a minimum spanning tree algorithm was used to cluster the sub-loci 18. Complexes were defined as groups of strains differing at fewer than five of 35 sub-loci with a minimum of 2 STs per complex. Using this criterion, strains could be assigned to one of four complexes, designated complexes I-IV (Figure 1). 2 B. bronchiseptica complex I IS1001 (83%) IS1001 (100%) IS481 (40%) B. pertussis complex II IS481 (100%) IS1002 (100%) IS1663 (100%) B. bronchiseptica complex IV IS1663 (80%) B. parapertussis hu complex III IS1001 (100%) IS1002 (100%) human origin animal origin unknown STs containing sequenced strains (Tohama, RB50 or 12822) Figure 1. Minimum spanning tree of B. bronchiseptica, B. pertussis and B. parapertussis. The tree was based on the sequence of seven housekeeping genes. Individual genes were split into five sub-loci, and a categorical clustering was performed. In the minimum spanning tree, sequence types (STs) sharing the highest number of single locus variants were connected first. Each circle represents an ST, the size of which is related to the number of isolates belonging to that particular ST. Colors within circles indicate host-distribution. The numbers between connected STs represent the number of different sub-loci between those STs. The clonal complexes (I, II, III and IV) are indicated by colored strips between connected STs. ST16 (B. bronchiseptica complex I) harbors the B. parapertussis ov strains. STs containing strains of which the genome has been sequenced (B. pertussis Tohama, B. parapertussis or B. bronchiseptica RB50) are indicated by a thickset, dashed line. The distribution of the insertion sequence elements IS481, IS1001, IS1002 and IS1663 is shown in boxes; numbers between parentheses indicate the percentage of strains that contained the ISE as determined by PCR amplification. A color version of this figure is available in the appendix. 37

38 Chapter 2 2 Complexes II and III contained the B. pertussis and B. parapertussis hu isolates, respectively. Both of these complexes showed very limited genetic diversity (H=0.65 and 0.35, respectively), as described previously 9,10. B. bronchiseptica was divided into two distinct populations, designated complexes I and IV, respectively. The genetic diversity of these two complexes (H=2.16 and 2.45, respectively) was much higher than of complexes II and III. Complex I contained the majority of the B. bronchiseptica strains (76 of 91 strains), including the sequenced RB50 strain. In addition, it contained the B. parapertussis ov isolates in the study population (ST16). B. bronchiseptica complex IV was more closely related to B. pertussis than was B. bronchiseptica complex I. Furthermore, the host species associations of the two complexes were quite distinct. Of the B. bronchiseptica complex IV isolates, 80% were isolated from humans, while this was the case for only 32% of the complex I isolates. It should be noted that human B. bronchiseptica isolates were overrepresented in our strain collection, in comparison with their occurrence in naturally-occurring populations of B. bronchiseptica strains. However, the human complex IV isolates originated from different continents, comprising North America, South America, and Europe. Previously, phylogenetic analysis based on CGH suggested the existence of a distinct B. bronchiseptica lineage that was closely related to B. pertussis 19. sequencing of the pertactin gene The relationship of the mammalian bordetellae inferred by housekeeping genes was confirmed by a tree based on the pertactin gene, which codes for a surface-associated virulence factor involved in adherence 20,21. A UPGMA tree was constructed from the aligned pertactin 95% % 100 B. bronchiseptica complex IV 30% animal n=10 70% human B. pertussis complex II n=26 100% human B. bronchiseptica complex I 65% animal n=71 31% human 4% unknown Figure 2. UPGMA tree based on the analysis of the pertactin gene of Bordetella isolates used in the MLST analysis. The DNA segment coding for the extracellular domain of pertactin (P.69) was used for analysis, with the exclusion of the repeat regions 1 and 2. Bootstrap values are shown for the nodes separating the complexes and are based on 500 bootstrap replicates. The scale indicates the genetic distance along the branches. Colors of the branches indicate the four complexes as defined by MLST. The number of strains of each branch is shown in boxes, as well as the host distribution. A color version of this figure is available in the appendix. 100 B. parapertussis hu complex III n=9 100% human 38

39 Multilocus Sequence Typing sequence data, and the topology of this tree was very similar to the MLST tree (Figure 2). B. bronchiseptica strains grouped into two lineages, corresponding to complex I and IV in the MLST tree. Also, B. bronchiseptica complex IV and B. pertussis strains clustered together in one branch, which was supported by bootstrapping. B. parapertussis hu comprised a separate branch within a larger cluster that also contained the B. bronchiseptica complex I strains. As was also observed in the MLST tree, the B. parapertussis ov strains were phylogenetically indistinguishable from B. bronchiseptica complex I strains. 98% B. bronchiseptica complex IV % B0243 B2490 B2114 B0259 B2491 B1968 B2494 BP1717 BP1959 BP2721 BP3216 BP distribution of insertion sequence elements The distribution of insertion sequence elements (ISEs) has been used to reveal evolutionary relationships between the Bordetella population 9. Towards this end, we screened our strain collection for the presence of IS481, IS1001, IS1002 and IS1663 using PCR. The distribution of the ISEs was mapped onto the MST (Figure 1). IS481 was detected in all B. pertussis strains, but in no other species, with the exception of two B. bronchiseptica isolates, both from a horse (B1975, B0230, ST6), consistent with previous observations 9,22. IS1001 was detected in all B. parapertussis hu and B. parapertussis ov strains. Additionally, IS1001 was detected in most (21 out of 25) B. bronchiseptica strains belonging to ST7 in complex I, but not in other STs, B. pertussis including STs in complex II and IV. IS1002 was detected only in B. pertussis and in B. parapertussis hu strains, confirming previous observations 4,9. IS was detected in all B. pertussis isolates, but also in 10 out of 13 B. bronchiseptica complex IV strains. The three complex IV strains in which IS1663 was not detected belonged to STs 18 and 21. To determine if the IS1663 sequences of B. bronchiseptica complex IV and of B. pertussis Tohama were similar, the nucleotide sequence of IS1663 was determined from seven B. bronchiseptica complex IV strains. Figure 3 shows a UPGMA tree constructed from the BP0118 BP3243 BP0812 BP1388 BP1914 BP3230 BP1044 BP2121 BP1035 BP1365 BP3603 Figure 3. UPGMA tree based on the IS1663 sequences of seven B. bronchiseptica complex IV strains and the B. pertussis Tohama IS1663 orthologues. Bootstrap values are shown for the nodes separating the complexes, and are based on 1000 bootstrap replicates. Branch lengths are shown, the scale indicates the genetic distance along the branches. A color version of this figure is available in the appendix. 39

40 Chapter 2 2 IS1663 sequences of the complex IV strains and of each IS1663 copy in the genome of B. pertussis Tohama. IS1663 sequences of the complex IV strains showed a sequence similarity of 97% to the IS1663 copies of B. pertussis Tohama. Table 2. Calculated divergence times for combinations of complexes. Complex combination Divergence time (Mya) I & II 0.95 (+/-0.54) (+/-2.71) I & IV 1.11 (+/-0.48) (+/-2.4) IV & II 0.32 (+/-0.06) (+/-0.51) I & III 0.70 (+/-0.54) (+/-2.68) ¹ Between parentheses, the standard deviation calculated from the pair wise allele distances between STs of different complexes is shown divergence times of complexes Under the assumption that the mutation rate in prokaryotes is relatively constant, the time since descent from the last common ancestor (LCA) can be estimated using pair wise mean allele distances (K S ) 23,24. Both the clock rates described by Whittam 16 and by Guttman and Dykhuizen 17 were used to estimate a range of divergence times between complexes. Calculations indicated that B. pertussis and B. bronchiseptica complex IV separated approximately million years ago (Mya), which suggests a more recent divergence time than B. pertussis and B. bronchiseptica complex I, estimated at Mya. B. parapertussis hu and B. bronchiseptica complex I diverged between Mya according to our calculations. The divergence times of combinations of complexes is shown in Table 2. 40

41 Multilocus Sequence Typing discussion Although it has long been speculated that B. pertussis evolved from a B. bronchiseptica strain 9,10, a specific lineage has not been identified. Here we identify and characterize such a B. bronchiseptica lineage. Analysis of MLST data from the mammalian bordetellae identified four distinct complexes. Complex I and IV comprised B. bronchiseptica strains, while complex II and III comprised the human pathogens B. pertussis and B. parapertussis hu, respectively. Our results suggest that B. pertussis and B. parapertussis hu evolved from complexes I and IV, respectively, indicating that adaptation to humans occurred as two independent events, consistent with previous data 8,9. The population structure of the mammalian bordetellae inferred from MLST data largely corresponded with a maximum parsimony phylogeny derived from a previous CGH study 19, with the exception of the relationship of B. parapertussis ov and B. parapertussis hu. In the current study, B. parapertussis hu and B. parapertussis ov are clearly derived from different STs in complex I. Further, in contrast to B. parapertussis hu, B. parapertussis ov is actually part of B. bronchiseptica complex I. In contrast, CGH analyses suggested a closer relationship between the sheep- and human-derived B. parapertussis lineages. However, this may be an artifact of the CGH analyses due to long-branch attraction in the maximum parsimony tree 25. Consistent with previous studies 9,10,12, B. pertussis and B. parapertussis hu showed a relatively low degree of genetic diversity, suggesting that they evolved recently or encountered a recent evolutionary bottleneck. Of the three B. pertussis STs observed, two were found exclusively before 1960, whereas all modern strains belonged to ST2. The temporal shift in B. pertussis STs is consistent with our previous studies on antigenic shifts which show major changes in the B. pertussis population after the introduction of mass vaccination against pertussis in the 1950s and 1960s 12,26. Most human disease, by far, is caused by B. pertussis and we therefore focused on the relationship of B. bronchiseptica complex IV with B. pertussis. B. bronchiseptica complex IV strains were found to be more closely related to B. pertussis than to the complex I B. bronchiseptica strains. A tree based on prn nucleotide sequences also suggested a closer relationship of complex IV strains to B. pertussis than to complex I strains. A number of other features of complex IV strains were consistent with their close relationship with B. pertussis. Most complex IV strains were isolated from humans (80%), while the majority of complex I was of animal origin (68%). Almost all B. bronchiseptica complex IV strains were isolated from patients with whooping cough symptoms. Further, complex IV strains and B. pertussis shared an IS element, IS1663, that was not found outside these two lineages. The sharing of an IS element may be explained by either vertical or horizontal transfer. The former suggests a common ancestry, while the latter would point to niche sharing of B. pertussis and B. bronchiseptica complex IV. It seems unlikely that the association of complex IV strains is due to a sampling artifact, as the strains analyzed were from widely separated geographic regions, including North America, South America and Europe. Thus, 2 41

42 Chapter 2 2 these strains were not epidemiologically related. The high frequency of human isolates observed in complex IV may be due to the close interaction of humans with animal hosts in which these strains reside, or to the fact that complex IV strains are better adapted to a human environment than B. bronchiseptica complex I strains. In either case, the B. bronchiseptica complex IV infections of humans would be zoonotic. Another intriguing possibility is that B. bronchiseptica complex IV strains are adapted to the human host and mainly transmitted between humans. Three STs (ST12, ST23 and ST27) found in complex I also contained a high percentage of humans strains (55%, 43% and 77%, respectively). All other, non-human isolates of these STs were collected from domesticated pet animals. Thus, both complex I and IV contain B. bronchiseptica strains that are well-adapted to the human host. However, the particular relevance of the human-associated lineage in complex IV appears to be its evolutionary relationship with B. pertussis. The origin of the disease whooping cough is still a mystery. Although the disease has very typical symptoms in children and was one of the major causes of child mortality previous to the introduction of vaccination, the first written reference to the disease in Europe is found in The first description of an epidemic, which occurred in Paris, was given by Baillon in Particularly interesting are the observations made by Nils Rosen von Rosenstein in 1766 who wrote 29 The hooping cough never appeared in Europe originally, but was transported thither from other parts of the world by means of merchandise, seamen and animals. Its first appearance in Sweden cannot be determined with any certainty; but in France it began in the year In contrast, 16th and 17th century descriptions of the disease and epidemics in Europe are documented frequently in the literature 28. The absence of references to pertussis-like symptoms in the ancient literature has been taken as evidence that the association of B. pertussis with humans is of recent origin. We propose that the association of B. pertussis with humans is, in fact, ancient, but that the introduction of B. pertussis into Europe may be more recent. Complex IV strains showed a degree of diversity that was comparable to complex I strains (H = 2.16 and 2.45, respectively), and thus, assuming that complex IV strains are primarily adapted to the human host, this association must be ancient. Parkhill et al. previously estimated the time to the LCA of a B. bronchiseptica complex I strain (RB50) and B. pertussis Tohama to be Mya, based on the mean number of synonymous substitutions per synonymous site of orthologous gene pairs 8. Our data indicate that current B. pertussis strains expanded clonally from the B. pertussis-b. bronchiseptica complex IV LCA Mya, further supporting an ancient association of B. pertussis with humans. However, we cannot rule out the possibility that more recent human-associated ancestors of B. pertussis are extinct or undiscovered. Such recent ancestors would indicate a more recent origin of B. pertussis. Although it is tempting to speculate that the LCA of B. pertussis and B. bronchiseptica 42

43 Multilocus Sequence Typing complex IV was associated with humans, the possibility remains that this association emerged after the split with B. pertussis. A possible evolutionary scenario (Figure 4) involves the adaptation of an ancestral B. bronchiseptica complex I strain to humans or their hominid ancestors. From this lineage the LCA of B. bronchiseptica complex IV and B. 2 Figure 4. Model of the evolution of the mammalian bordetellae. The bar on the left indicates increasing degrees of adaptation to the human host. Arrows indicate descent. Abbreviations: LCA, last common ancestor. A color version of this figure is available in the appendix. human-adapted broad host range B. pertussis complex II LCA complex IV B. bronchiseptica complex I B. bronchiseptica complex IV B. parapertussis hu complex III pertussis evolved, subsequently giving rise to B. bronchiseptica complex IV and B. pertussis. Recent emergence of a pathogenic clone from a more ancient human-associated progenitor species has been proposed as the mechanism for the origin of Mycobacterium tuberculosis 31. Although previous genetic analysis had suggested that M. tuberculosis emerged as little as 20,000 years ago, phylogenetic analysis of M. tuberculosis and a closely related, but more diverse group of smooth tubercle bacilli indicated that this more broadly defined species has been associated with hominids for up to 3 million years. Yersinia pestis, the causative agent of plague, is a clone that evolved from Y. pseudotuberculosis 1,500 20,000 years ago, shortly before the first known pandemics of human plague 30, and its recent origin is further suggested by the complete lack of polymorphism in housekeeping genes 31. Similarly, B. pertussis also shows limited diversity. However, in contrast to Y. pestis which reveals absolutely no polymorphisms in housekeeping genes, we observed three STs in B. pertussis. This may suggest an older origin of B. pertussis compared to Y. pestis although other factors, such as population size and bottlenecks could also explain these differences. The most plausible explanation from our data is that the association of B. pertussis with humans originated in the LCA of B. pertussis and B. bronchiseptica complex IV. Based on that assumption, the apparent emergence of pertussis in Europe within the last 500 years may be attributable to import via travel or 43

44 Chapter 2 2 migration, or to the recent acquisition by B. pertussis of the ability to cause more severe, whooping cough-like symptoms. Although most of the B. bronchiseptica complex IV strains in our collection were isolated from patients suspected to have pertussis, we know little of the severity of the symptoms caused by these strains. It is conceivable that B. bronchiseptica preceded B. pertussis in Europe and that its disease was not documented because of its relatively mild and nonspecific course. The work presented here places the three sequenced mammalian Bordetella strains within a phylogenetic context, thereby facilitating rational selection of strains for further genomic sequencing. In particular, sequencing of one or more members of complex IV may shed more light on processes involved in host adaptation and immune-competition. Further, the identification of a B. bronchiseptica lineage which circulates in human populations may be important for public health. In recent years, whole cell vaccines have been replaced by acellular vaccines comprised of 1-5 antigens derived from B. pertussis 32. The acellular vaccines induce a less cross-reactive immune response compared to whole cell vaccines 33 and may therefore result in an increase in B. parapertussis and B. bronchiseptica infections in vaccinated human populations. 44

45 reference list 1. Gueirard,P., Weber,C., Le Coustumier,A., and Guiso,N. (1995). Human Bordetella bronchiseptica infection related to contact with infected animals: persistence of bacteria in host. J. Clin. Microbiol 33, Bauwens,J.E., Spach,D.H., Schacker,T.W., Mustafa,M.M., and Bowden,R.A. (1992). Bordetella bronchiseptica pneumonia and bacteremia following bone marrow transplantation. J. Clin. Microbiol 30, Woolfrey,B.F. and Moody,J.A. (1991). Human infections associated with Bordetella bronchiseptica. Clin. Microbiol. Rev. 4, van der Zee,A., Groenendijk,H., Peeters,M., and Mooi,F.R. (1996). The differentiation of Bordetella parapertussis and Bordetella bronchiseptica from humans and animals as determined by DNA polymorphism mediated by two different insertion sequence elements suggests their phylogenetic relationship. Int. J. Syst. Bacteriol. 46, Mooi,F.R., van Loo,I.H., and King,A.J. (2001). Adaptation of Bordetella pertussis to Vaccination: A Cause for Its Reemergence? Emerg. Infect. Dis ;7. (3 Suppl): , Crowcroft,N.S. and Britto,J. (2002). Whooping cough--a continuing problem. BMJ 324, Orenstein,W.A. (1999). Pertussis in adults: epidemiology, signs, symptoms, and implications for vaccination. Clin. Infect. Dis. 28 Suppl 2, S147- S Parkhill,J., Sebaihia,M., Preston,A., Murphy,L.D., Thomson,N., Harris,D.E., Holden,M.T., Churcher,C. M., Bentley,S.D., Mungall,K.L., Cerdeno-Tarraga,A. M., Temple,L., James,K., Harris,B., Quail,M.A., Achtman,M., Atkin,R., Baker,S., Basham,D., Bason,N., Cherevach,I., Chillingworth,T., Collins,M., Cronin,A., Davis,P., Doggett,J., Feltwell,T., Goble,A., Hamlin,N., Hauser,H., Holroyd,S., Jagels,K., Leather,S., Moule,S., Norberczak,H., O Neil,S., Ormond,D., Price,C., Rabbinowitsch,E., Rutter,S., Sanders,M., Saunders,D., Seeger,K., Sharp,S., Simmonds,M., Skelton,J., Squares,R., Squares,S., Stevens,K., Unwin,L., Whitehead,S., Barrell,B.G., Maskell,D. J. (2003). Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Multilocus Sequence Typing Genet. 35, van der Zee,A., Mooi,F., van Embden,J., and Musser,J. (1997). Molecular evolution and host adaptation of Bordetella spp.: phylogenetic analysis using multilocus enzyme electrophoresis and typing with three insertion sequences. J. Bacteriol. 179, Musser,J.M., Hewlett,E.L., Peppler,M.S., and Selander,R.K. (1986). Genetic diversity and relationships in populations of Bordetella spp. J. Bacteriol. 166, Jolley,K.A., Chan,M.S., and Maiden,M.C. (2004). mlstdbnet - distributed multi-locus sequence typing (MLST) databases. BMC. Bioinformatics. 5, van Loo,I.H., van der Heide,H.G., Nagelkerke,N. J., Verhoef,J., and Mooi,F.R. (1999). Temporal trends in the population structure of Bordetella pertussis during in a highly vaccinated population. J. Infect. Dis. 179, van der Zee A., Agterberg,C., Peeters,M., Schellekens,J., and Mooi,F.R. (1993). Polymerase chain reaction assay for pertussis: simultaneous detection and discrimination of Bordetella pertussis and Bordetella parapertussis. J Clin. Microbiol 31, Margalef,R. (1958). Information theory in ecology. General Systems 3, Rozas,J., Sanchez-DelBarrio,J.C., Messeguer,X., and Rozas,R. (2003). DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics. 19, Whittam,T.S. (1996). Escherichia and Salmonella Cellular and Molecular Biology, Washington, DC: Am. Soc. Microbiol. 17. Guttman,D.S. and Dykhuizen,D.E. (1994). Clonal divergence in Escherichia coli as a result of recombination, not mutation. Science 266, Schouls,L.M., van der Heide,H.G.J., Vauterin,L., Vauterin,P., and Mooi,F.R. (2004). Multiple-Locus Variable-Number Tandem Repeat Analysis of Dutch Bordetella pertussis Strains Reveals Rapid Genetic Changes with Clonal Expansion during the Late 1990s. J. Bacteriol. 186, Cummings,C.A., Brinig,M.M., Lepp,P.W., Van De,P. S., and Relman,D.A. (2004). Bordetella species are distinguished by patterns of substantial gene loss 2 45

46 2 Chapter 2 and host adaptation. J Bacteriol. 186, Leininger,E., Roberts,M., Kenimer,J.G., Charles,I. G., Fairweather,N., Novotny,P., and Brennan,M. J. (1991). Pertactin, an Arg-Gly-Asp-containing Bordetella pertussis surface protein that promotes adherence of mammalian cells. Proc. Natl. Acad. Sci. U. S. A. 88, Charles,I.G., Dougan,G., Pickard,D., Chatfield,S., Smith,M., Novotny,P., Morrissey,P., and Fairweather,N.F. (1989). Molecular cloning and characterization of protective outer membrane protein P.69 from Bordetella pertussis. Proc. Natl. Acad. Sci. U. S. A 86, McLafferty,M.A., Harcus,D.R., and Hewlett,E.L. (1988). Nucleotide sequence and characterization of a repetitive DNA element from the genome of Bordetella pertussis with characteristics of an insertion sequence. J. Gen. Microbiol. 134 ( Pt 8), Jukes,T.H. and Cantor,C.R. (1969). Mammalian Protein Metabolism, New York: Academic. 24. Achtman,M., Zurth,K., Morelli,G., Torrea,G., Guiyoule,A., and Carniel,E. (1999). Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis. PNAS 96, Felsenstein,J. (1978). Cases in which parsimony or compatibility methods will be positively misleading. Systematic Biology 27, Mooi,F.R., van Oirschot,H., Heuvelman,K., van der Heide,H.G., Gaastra,W., and Willems,R.J. (1998). Polymorphism in the Bordetella pertussis virulence factors P.69/pertactin and pertussis toxin in The Netherlands: temporal trends and evidence for vaccine-driven evolution. Infect. Immun. 66, Major R.H. (1945). Classic Descriptions of Disease, Springfield, C. C. Thomas. 28. LAPIN,J.H. (1943). Whooping Cough, Springfield, Illinois: Charles C. Thomas. 29. Still,G.F. (1931). The History of Paediatrics., Oxford University Press, London. 30. Achtman,M., Zurth,K., Morelli,G., Torrea,G., Guiyoule,A., and Carniel,E. (1999). Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis. Proc. Natl. Acad. Sci. U. S. A 96, Gutierrez,M.C., Brisse,S., Brosch,R., Fabre,M., Omais,B., Marmiesse,M., Supply,P., and Vincent,V. (2005). Ancient origin and gene mosaicism of the progenitor of mycobacteriumtuberculosis. PLoS. Pathog. 1, e Edwards,K.M. and Decker,M.D. (2004). Pertussis Vaccine. In: Vaccines, ed. S.A.Plotkin and W.A.Ore nsteinphiladephia: WB Saunders Company, David,S., van,f.r., and Mooi,F.R. (2004). Efficacies of whole cell and acellular pertussis vaccines against Bordetella parapertussis in a mouse model. Vaccine 22,

47 33 Chapter Chapter Genetic Changes Associated with the Adaptation of a B. bronchiseptica Lineage to the Human Host Dimitri A. Diavatopoulos 1,2, Craig A. Cummings 3,5, Leo M. Schouls 1, Mary M. Brinig 3,5, David A. Relman 3,4,5, Frits R. Mooi 1,2 1 Laboratory for Vaccine-Preventable Diseases, National Institute of Public Health and the Environment, Bilthoven, The Netherlands; 2 Eijkman Winkler Institute, University Medical Center, Utrecht, The Netherlands; 3 Departments of Microbiology and Immunology; and of 4 Medicine, Stanford University School of Medicine, Stanford, California 94305, USA; 5 VA Palo Alto Health Care System, Palo Alto, California 94304, USA Chapter 2&3, PLoS Pathogens, 2005

48 Chapter 3 3 abstract The population structure of the mammalian bordetellae, as defined by multilocus sequence typing, suggested that B. parapertussis hu evolved from an animal-associated lineage of B. bronchiseptica, while B. pertussis and B. bronchiseptica complex IV evolved from a distinct B. bronchiseptica lineage. Extant members of B. bronchiseptica complex IV were mainly isolated from humans suspected to have whooping cough. Comparative analysis of the genomes of single isolates of B. bronchiseptica, B. parapertussis hu and B. pertussis indicated a significant genome reduction in the human-adapted species B. pertussis and B. parapertussis hu, and it was suggested that DNA acquisition has played little or no role in the evolution of B. pertussis and B. parapertussis hu. A comparative genomic hybridization (CGH) study of a large collection of Bordetella strains provided further indication of genome decay in B. pertussis and B. parapertussis hu, although it is still unknown how this process commenced. The identification of B. bronchiseptica complex IV provides an opportunity to study host adaptation by comparing the genomes of B. pertussis to that of B. bronchiseptica complex IV and B. bronchiseptica complex I. In this study, the genomes of 26 B. bronchiseptica complex I, 13 B. bronchiseptica complex IV strains and 12 B. pertussis isolates were compared by CGH to a whole-genome Bordetella microarray, in order to elucidate the host-adaptation of B. pertussis and B. bronchiseptica complex IV. Comparison of gene content identified the absence of the pertussis toxin locus and dermonecrotic toxin gene, as well as a polymorphic LPS biosynthesis locus, as associated with adaptation of complex IV strains to the human host. LPS structural diversity among these strains was confirmed by gel electrophoresis. CGH analysis suggested genome reduction in B. bronchiseptica complex IV strains, and it may be possible that this process may have started well before the evolution of B. pertussis. We hypothesize that the differences in key virulence genes between these two lineages may reflect immune competition in the human host. 48

49 Comparative Genomic Hybridization introduction Bordetella pertussis and Bordetella parapertussis, both of which cause whooping cough in humans, have independently evolved from a Bordetella bronchiseptica-like ancestor (Chapter 2, 1-3 ). B. bronchiseptica has been isolated from many different mammalian species, but only rarely from humans 4,5. The three species are very closely related, but display different clinical manifestations 6. Generally, B. bronchiseptica causes chronic infections, while B. pertussis and B. parapertussis cause acute disease. Analysis of the population structure of these three species by MLST revealed four distinct complexes (see Chapter 2). B. pertussis and B. parapertussis hu comprised complexes II and III, respectively. Interestingly, B. bronchiseptica strains were divided into two complexes, I and IV. Complex I was isolated mainly from animals (67%) and included the B. bronchiseptica strain (RB50, ST12) of which the complete genome sequence was determined. The majority of complex IV strains was of human origin (80%), and these strains were more closely related to B. pertussis than B. bronchiseptica complex I strains. A tree inferred from the nucleotide sequences of the virulence factor pertactin (prn) showed a similar clustering as the MLST, B. pertussis and B. bronchiseptica complex IV strains comprised one branch while B. bronchiseptica complex I and B. parapertussis strains comprised another. The close genetic relationship of B. bronchiseptica complex IV to B. pertussis and the fact that a high percentage of these strains was isolated from humans suggested that these strains may comprise human-adapted pathogens. The fact that the mammalian bordetellae are so closely related but differ significantly in host tropism and clinical manifestations makes them very suitable to study host adaptation. Comparison of the complete genome sequences of single isolates of B. bronchiseptica, B. pertussis and B. parapertussis hu showed that the evolution of B. pertussis and B. parapertussis hu has been accompanied by genome decay 2. To identify genetic differences that may be associated with host adaptation or host restriction, B. bronchiseptica complex I and B. bronchiseptica complex IV were compared using comparative genomic hybridization (CGH) to a microarray representing the genomes of B. bronchiseptica, B. parapertussis and B. pertussis. This approach resulted in the identification of several major virulence factors that were absent from B. bronchiseptica complex IV compared to B. bronchiseptica complex I. Differences between these complexes were also observed in the biosynthesis of LPS. These differences may have been driven by immune-mediated competition between the humanassociated lineages B. parapertussis hu, B. pertussis and B. bronchiseptica complex IV. 3 49

50 Chapter 3 experimental procedures 3 bacterial strains A total of 26 B. bronchiseptica complex I and 13 complex IV isolates (see Chapter 1) were used in this study. Routine culturing of strains was performed on Bordet Gengou (BG) agar supplemented with 15% sheep blood (BD, Franklin Lakes, NJ, USA) at 37 C for two to five days. Chromosomal DNA was isolated using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI), according to the manufacturers protocol for Gram-negative bacteria. Strain characteristics are listed in Table 1. lps sds-page and western blotting BG-agar grown bacteria were harvested, boiled in 1x sample buffer (7.5% glycerol, 0.125M Tris-HCl, ph 6.8, 1.5% SDS), and treated with proteinase K 7. Tricine-SDS-PAGE was then performed in 4% stacking and 16% separating gels, as previously described by Lesse et al. 8. Silver staining was performed as described by Tsai and Frasch 9. LPS was transferred to PVDF membranes (Amersham Biosciences, Buckinghamshire, UK) and blocked with 0.5% (w/v) Protifar nonfat dried milk, 0.5% bovine serum albumin (w/v) and 0.1% Tween-20 in PBS. Immunoblotting was performed with monoclonal antibodies (mabs) 36G3 and BL-8, directed against band A and band B LPS, respectively 10,11. dna microarrays Bordetella PCR product-based DNA microarrays were prepared largely as described by Cummings et al. 3. This study also employed a new array design that contained all of the probes from the first array plus 1,417 additional probes that brought the theoretical ORF coverage of these arrays up to 97.4% for B. pertussis Tohama, 98.5% for B. bronchiseptica RB50 and 97.9% for B. parapertussis Like the previously used array probes, these additional probes were PCR products with a size of less than 300 bp and amplified from the sequenced reference genomes with ORF-specific oligonucleotides (Illumina, San Diego, CA) designed with MicroarrayArchitect (C.A. Cummings and D.A. Relman, unpublished data). comparative genomic hybridization The genomic DNA of B. bronchiseptica was labeled with Cy5 and hybridized to the array in conjunction with a Cy3 labeled genomic DNA reference comprising the three sequenced mammalian Bordetella genomes (B. pertussis Tohama, B. parapertussis and B. bronchiseptica RB50). CGH was carried out essentially as described by Cummings et al. 3, with minor modifications. Labeled probes were purified using the Cyscribe GFX Purification Kit (Amersham Biosciences, Freiburg, Germany) following the manufacturer s 50

51 Comparative Genomic Hybridization Table 1. Strain characteristics Strain Number Species Complex ST Host Country Year Original name B0084 BB I 31 dog unknown unknown PB383 B0189 BB I 27 dog South Africa B0223 BB I 14 guinea pig Australia B0224 BB I 6 guinea pig Germany unknown 396 B0226 BB I 5 cat Netherlands unknown 373 B0227 BB I 23 cat Netherlands unknown 385 B0230 BB I 6 horse Denmark unknown 406 B0237 BB I 12 rabbit Denmark unknown 405 B0238 BB I 27 dog Netherlands unknown 207 B0242 BB I 7 pig USA unknown 688 B0251 BB I 23 dog Netherlands unknown 355 B0254 BB I 7 rabbit Netherlands B0258 BB I 10 rabbit USA unknown 705 B0260 BB I 23 cat Denmark unknown 723 B0505 BB I 12 human Netherlands B1965 BB I 10 dog unknown unknown 590 B1966 BB I 27 dog unknown unknown 599 B1967 BB I 4 dog unknown unknown 601 B1972 BB I 5 cat unknown unknown 782 B1975 BB I 6 horse unknown unknown 982 B1985 BB I 6 seal North Sea 1988 M861/99/1 B1986 BB I 6 seal North Sea 1997 M2936/97/3 B1987 BB I 33 seal Caspian Sea 2000 M85/00/1 B2104 BB I 23 human Netherlands B2112 BB I 7 human Netherlands B2116 BB I 4 human Netherlands B0006 BP II 1 human Netherlands B0213 BP II 1 human Japan 1952 Tohama I B0336 BP II 2 human Netherlands 1952 Hp291 B0352 BP II 2 human Netherlands B0441 BP II 1 human Netherlands B0540 BP II 2 human Netherlands B0558 BP II 2 human Netherlands 1949 Hp53 B0564 BP II 1 human Netherlands 1950 Hp199 B0604 BP II 2 human Netherlands B0782 BP II 2 human Netherlands B0939 BP II 2 human Netherlands B1121 BP II 24 human USA B0232 BB IV 18 human Germany unknown 397 B0243 BB IV 28 pig Ukraine unknown 654 B0259 BB IV 29 turkey USA unknown 707 B1968 BB IV 22 dog unknown unknown 591 B1969 BB IV 18 human unknown unknown 675 B2114 BB IV 25 human Netherlands B2490 BB IV 9 human USA unknown SBL-F6116 B2491 BB IV 8 human USA unknown SBL-F6368 B2492 BB IV 21 human USA 1996 GA96-01 B2494 BB IV 15 human USA unknown MO149 B2495 BB IV 17 human USA unknown MO211 B2496 BB IV 3 human USA unknown MO275 B2506 BB IV 34 human USA P-2730 B2586 BB IV 3 human Argentina > B2588 BB IV 35 human Argentina > Abbreviations: BB= B. bronchiseptica; BPP-OV= B. parapertussis ov ; BPP-HU= B. parapertussis hu ; BP= B. pertussis 51

52 Chapter 3 3 protocol for probes produced by the CyScribe First-Strand cdna Labelling Kit. After purification, the test and reference labeled DNA samples were concentrated to <8.5 μl using a Savant SpeedVac SVC-100H. The test and reference samples were combined and 150 μg of yeast trna (Invitrogen Life Technologies, San Diego, CA) was added to block nonspecific binding. The probe volume was adjusted to 24 μl with water, and then 5.1 μl of 20x SSC (1x SSC is 0.15M NaCl plus 0.015M sodium citrate) and 0.9 μl of 10% sodium dodecyl sulfate (SDS) were added. Thirty μl of the probe were added to the array and covered with a 25x40 mm no.1 glass coverslip. Hybridization was performed in GeneMachines Hybchambers (Genomic Solutions, Ann Arbor, MI) with 2x30 μl of 3x SSC to maintain humidity and incubated at 65 C overnight. Arrays were washed in 0.5x SSC, 0.03% SDS for 30 s, 0.1x SSC, 0.01% SDS for 30 s, 0.05x SSC, 0.005% SDS for 1 min and 0.025x SSC for 1 min. The first wash was performed at 65 C, the remaining washes at room temperature. Slides were dried using a Quick- Dry Filtered Air Gun (Matrix Technologies Corporation, Hudson, NH). Images were acquired on a PerkinElmer ScanArray 4000XL scanner using ScanaArray Express software (PerkinElmer Life and Analytical Sciences, Inc., Boston, MA). Images were analyzed with GenePix Pro software (Axon Instruments, Union City, CA). microarray data analysis Processed two-color array image data were submitted to an in-house microarray database. Data were extracted using filters to eliminate automatically and manually flagged spots and spots with very low background subtracted signal intensity (<150) in the reference channel. B. bronchiseptica complex I and complex IV enriched sequences were identified using the Significance Analysis for Microarrays software (SAM) 12. The probes were analyzed using 26 complex I and 13 complex IV strains that were hybridized to the arrays. SAM analysis was run using the two-class option with KNN missing value imputation. In addition to a statistically significant difference, a 2-fold difference in mean signal intensity ratio for each probe was also required. 52

53 Comparative Genomic Hybridization results comparative genomic hybridization of b. bronchiseptica complexes i and iv Based on housekeeping gene and pertactin sequence data, a close relationship was observed between B. pertussis and B. bronchiseptica complex IV (Chapter 2). Complex IV strains were also more frequently isolated from human hosts (80%) compared to complex I strains (33%), suggesting that these strains may be better adapted to humans. To identify genetic events that may have played a role in host adaptation or host restriction, we used comparative genomic hybridization (CGH) to Bordetella DNA microarrays. Genomic DNA from 26 B. bronchiseptica complex I and 13 complex IV strains was hybridized to microarrays, representing 97.4%, 98.5% and 97.9% of the open reading frames of B. pertussis Tohama, B. bronchiseptica RB50 and B. parapertussis 12822, respectively (CGH data files have been deposited in ArrayExpress, accession E-TABM-32). Significance Analysis of Microarrays (SAM) was used to identify probes with statistically significant log intensity ratio differences between the two complexes. This approach detected sequences that have been deleted more often in one of the two complexes, as well as DNA sequences diverging from the reference sequences in one of the two complexes (a table with microarray data is available from the authors). Thirty-one probes, representing 29 genes and IS1663, hybridized more strongly or frequently to the genomes of complex IV than to those of complex I. Two of these represented the B. pertussis alleles of the virulence genes prn and tcfa, encoding pertactin and tracheal colonization factor, respectively. Sequence analysis confirmed that the B. bronchiseptica complex IV prn sequences were more similar to B. pertussis than to B. bronchiseptica complex I (see Chapter 2). Sixteen of these 31 probes had been identified previously as B. pertussisspecific 3. In most cases, these probes hybridized to nine or more complex IV strains, but not to any complex I or III strain (see CGH data). The genes represented by these probes encode diverse functions such as metabolism, transport, regulation and transposition. With the possible exception of BP0703, which encodes a TonB-dependent iron receptor, no obvious virulence genes were observed among the 30 genes. In B. pertussis Tohama, BP0703 is interrupted by an IS481 element 2. Most of the 30 genes were located in small clusters along the B. pertussis Tohama chromosome, indicating that absence or presence were due to events (deletions or insertions) involving multiple genes. The presence of the 30 genes in B. bronchiseptica complex IV and B. pertussis but not in B. bronchiseptica complex I or B. parapertussis hu suggested that they were acquired by the common ancestor of B. pertussis and B. bronchiseptica complex IV. We also identified 248 probes, representing 237 genes, that exhibited significantly stronger hybridization to complex I genomes compared to complex IV genomes, suggesting they were divergent or absent in B. bronchiseptica complex IV strains. Sixty-eight (27%) of these corresponded to genes associated with mobile elements such as prophages, while many of 3 53

54 Chapter 3 3 the other probes represented metabolic, transport and regulatory genes. Surprisingly, several virulence-associated genes were found to be missing or divergent in the complex IV strains. These included the B. bronchiseptica alleles of tcfa and prn, the Bvg-regulated intermediate phase gene A (bipa), the alcaligin biosynthesis locus (alca/e), the pertussis toxin synthesis and transport locus (ptx/ptl), the dermonecrotic toxin gene (dnt) and the lipopolysaccharide B. pertussis Tohama B. bronchiseptica RB50 Complex I B0084 ST31 B0189 ST27 B0224 ST6 B0227 ST23 B0230 ST6 B0238 ST27 B0242 ST7 B0251 ST23 B0258 ST10 B1975 ST6 B1985 ST6 B1986 ST6 B2112 ST7 Complex IV B0232 ST18 B0243 ST28 B0259 ST29 B1968 ST22 B1969 ST18 B2114 ST25 B2490 ST9 B2491 ST8 B2492 ST21 B2494 ST15 B2495 ST17 B2496 ST3 B2506 ST34 ptxa ptxb ptxb ptxd ptxe ptxc ptxc ptla ptlb ptlc ptld ptli ptle ptlf ptlg ptlh dnt tcfa (BP) prn (BP) prn (BB/BPP) prn (BB/BPP) alca alcb alcc alcd alce alcr alcs faua pertussis toxin pertussis toxin secretion dermonecrotic toxin tracheal colonization factor A pertactin alcaligin Figure 1. Gene content of the differentially hybridizing virulence loci between B. bronchiseptica complex I and IV, as determined by SAM analysis of CGH data. Each column represents one strain. Strain numbers and sequence types (ST) are indicated above the columns. Each row represents one ORF (in B. bronchiseptica RB50 gene order), ORF designations are shown to the right of the rows. In the case of tcfa and prn, the origins of the probes are indicated between parentheses. The BP probe of tcfa was 100% similar to B. pertussis Tohama and 85.1% similar to B. bronchiseptica RB50. The BP prn probe was 100% similar to B. pertussis Tohama and 86% similar to B. parapertussis and B. bronchiseptica RB50. The BB/BPP prn probes were both 100% similar to B. parapertussis (BPP) and B. bronchiseptica RB50 (BB) and 86% similar to B. pertussis Tohama. The yellow-black-blue color scale indicates the hybridization value relative to the reference; references are B. bronchiseptica RB50, B. parapertussis and B. pertussis Tohama. For B. bronchiseptica RB50 and B. pertussis Tohama, the data in the figure are based on the genomic sequences. Yellow, black and blue indicate decreased hybridization, hybridization values comparative to the references, and increased hybridization (e.g. due to gene duplication), respectively. Intermediate values indicate partial deletions or sequence divergence. Missing data are represented in grey. A color version of this figure is available in the appendix. 54

55 Comparative Genomic Hybridization (LPS) biosynthetic locus (see Figure 1). Interestingly, 10 out of 13 complex IV strains harbored deletions in the adjacent ptx and ptl loci, which encode pertussis toxin (Ptx) and its secretion machinery, respectively 13,14 (Figure 1). While conditions under which Ptx is expressed by either B. parapertussis or B. bronchiseptica have not been identified, the structural genes are generally conserved among these species 15, suggesting selective pressure to retain the ability to produce functional Ptx under certain circumstances. The complex IV strains in which ptx/ptl was still present (ST3/17/29) were tested for expression of Ptx by immunoblotting, and these strains were found not to express Ptx under the growth conditions used (unpublished data). Another distinguishing characteristic of the complex IV strains was the deletion of the dermonecrotic toxin gene (dnt) in eight out of 13 strains. In contrast, this gene was detected in all B. pertussis, B. parapertussis hu, B. parapertussis ov and B. bronchiseptica complex I strains 3. CGH showed that the genomes of the complex IV strains hybridized stronger to the B. pertussis-derived probes of tcfa and prn than to the B. bronchiseptica/b. parapertussis-derived probes. The genes tcfa and prn encode two autotransporters of the same family, that are involved in adhesion of the bacterium to the epithelium 16. Of these two, prn is expressed by B. bronchiseptica, B. parapertussis and by B. pertussis 17,18, but tcfa has been suggested to be expressed exclusively by B. pertussis 19. Conversely, the genomes of the B. bronchiseptica complex I strains hybridized stronger to the B. bronchiseptica-derived probes of tcfa and prn, which are virtually identical to B. parapertussis. Sequencing of prn showed that the complex IV strains indeed had a prn gene that is more similar to B. pertussis than to B. bronchiseptica complex I (Chapter 2). Hybridization patterns suggested that the genomic sequence of the complex IV alcaligin biosynthetic locus, encoding a siderophore, might differ from that of complex I and B. pertussis (Figure 1). Complex IV strains hybridized less well to alcabcders and faua, with particularly weak hybridization to the alce probe, of which the exact function in alcaligin synthesis has not yet been determined. Probably, complex IV B. bronchiseptica strains are competent to produce alcaligin, but these genes may be divergent compared to B. pertussis and B. bronchiseptica complex I strains. 3 lps polymorphism The genetic structure of the LPS biosynthesis locus also differed substantially between complex I and IV strains. The LPS molecules of Gram-negative bacteria usually consist of three, covalently linked, major domains: the lipid A, the branched chain oligosaccharide core and the hydrophilic O-antigen. A number of genetic loci have been implicated in the synthesis of these domains in Bordetella, such as the lpx locus (lipid A), the waa locus (inner core), the wlb locus (trisaccharide) and the wbm locus (O-antigen) B. pertussis usually produces a lipo-oligosaccharide (LOS) that consists of the lipid A and the inner core, to 55

56 Chapter 3 A. Complex I Complex IV 3 BP Tohama BB RB50 B0084 ST31 B0189 ST27 B0224 ST6 B0227 ST23 B0230 ST6 B0238 ST27 B0242 ST7 B0251 ST23 B0258 ST10 B1975 ST6 B1985 ST6 B1986 ST6 B2112 ST7 B0232 ST18 B0243 ST28 B0259 ST29 B1968 ST22 B1969 ST18 B2114 ST25 B2490 ST9 B2491 ST8 B2492 ST21 B2494 ST15 B2495 ST17 B2496 ST3 B2506 ST34 O-antigen band A band B O-antigen band A band B B LPS genetic profile pagp pagl lpxa lpxb lpxc lpxd lpxh lpxk lpxk waaa waac wlba wlbb wlbc wlbd wlbe wlbf wlbg wlbh wlbi wlbjk wlbl wbma wbmb wbmc wbmd wbme wbmf wbmg wbmh wbmi wbmj wbmk wbml wbmm wbmn wbmo wbmr wbms BB0124 BB0125 BB0126 BB0127 BB0127 wbmu wbmt wbms wbmr wbmq wbmp (de)acylation lipida lipida inner core trisaccharide O-antigen alternative O-antigen

57 Comparative Genomic Hybridization Figure 2. Expression of LPS by B. bronchiseptica complex I and complex IV strains and gene content variation at the LPS biosynthesis locus. A. Top panel: Electrophoretic LPS profiles obtained by tricine-sds-page and silver staining. Middle panel: Western blot of the same samples with mab 36G3, which detects band A. Bottom panel: Western blot of the same samples with mab BL8, which detects band B. B. Gene content of the LPS biosynthesis locus as determined by CGH. See Figure 1 for details. For B. bronchiseptica RB50 and B. pertussis Tohama, the data in the figure are based on the genomic sequences. The genes wbmpqrstu represent an alternative LPS O-antigen biosynthesis sublocus that is orthologous to the genes found in B. parapertussis [2] and B. bronchiseptica C7635E [21]. LPS genetic profiles as described in the text are indicated at the top of the columns. Color scale as in Figure 1. Missing data are represented in grey. A color version of this figure is available in the appendix. 3 which the outer core (a trisaccharide) is attached; also referred to as band A. The genes wlba-l encode the biosynthesis of this trisaccharide and the transport to the inner core 25. Certain B. pertussis strains produce a LOS molecule that is identical to band A except that it lacks the trisaccharide; this structure is called band B 26. The O-antigen, which is added to the trisaccharide, is only found in B. bronchiseptica and B. parapertussis. This structure is missing in B. pertussis due to the deletion of the genes wbma-u 21. In Figure 2, the gene content of the LPS locus is shown for 13 complex I and 13 complex IV strains, and for B. pertussis Tohama and B. bronchiseptica RB50. Four LPS gene content profiles, designated LPS 1 4, could be distinguished among the B. bronchiseptica strains. Strains with the LPS 1 profile had an LPS gene composition similar to RB50, characterized by the absence of wbmpqrstu. The LPS 2 profile was characterized by the absence of the genes wbmors and BB0124-BB0127 and the presence of an alternative O-antigen locus, comprising wbmpqrstu, orthologous to the B. parapertussis genes 2. Both of these genotypes appear competent for the production of a full length LPS. Strains with the LPS 3 profile lacked wbmd-u and BB0124-BB0127, suggesting that they may not produce O- antigen. The LPS 4 profile was similar to the LPS 3 profile but additionally lacked wbmabc and wlbd-l, suggesting that strains of this genotype may be deficient for the production of trisaccharide (wlb locus) as well as O-antigen (wbm locus). The deletion in the O-antigen genes of LPS 4 strains was similar to that observed in the O-antigen genes of B. pertussis Tohama. All complex I strains displayed either an LPS 1 or an LPS 2 profile. Nine of 13 complex IV strains had either an LPS 1 or an LPS 2 profile, while four complex IV strains showed more extensive deletions, resulting in LPS 3 and LPS 4 profiles. To study the effect of these deletions on LPS production, proteinase K-treated cell lysates were analyzed by Tricine-SDS-PAGE, followed by silver staining or immunoblotting with monoclonal antibodies directed against either band A or band B (mabs 36G3 and BL-8, respectively 10,11, Figure 2). Silver-staining showed that all complex I strains produced a band co-migrating with band A of B. pertussis, except for B1985 and B2112, which produced a band co-migrating with B. pertussis band B and a band migrating at a position between bands A and B, respectively. This was confirmed by immunoblotting with mab 36G3, which further showed that these strains also produced O-antigen, again with the exception of B1985 and B2112. The 57

58 Chapter 3 3 epitope recognized by mab 36G3 is also present in the O-antigenic repeats, as was described previously 7. Further, most strains that produced band A and O-antigen also produced an additional band just above band A, which was also recognized by mab 36G3 and is therefore likely derived from band A. Finally, immunoblotting with mab BL8, directed against B. pertussis band B, showed that only five of the complex I strains produced band B (B0189, B0258, B1975, B1985 and B1986); and these strains also produced amounts of band B detectable by silver-staining. B1985 and B2112 showed no obvious deletions at their wlb locus, and the fact that they did not produce band A may be attributed to point mutations, e.g. in their wlb locus, or to regulatory effects. B1985 is thus the only complex I strain that produces exclusively band B, which has also been described for certain B. pertussis strains 26. All complex IV strains produced band B as detected by immunoblotting with mab BL8. The nine complex IV strains with the LPS 1 or 2 profile all produced band A and O- antigen as detected by silver-staining and immunoblotting with mab 36G3. However, the two strains with the LPS 4 profile, B2490 and B2506, produced a band smaller than band A, which failed to be recognized by mab 36G3. Further, these strains produced no O- antigen detectable by immunoblotting. Of the two strains with a LPS 3 profile, one strain (B0243) produced only band B. Unexpectedly, the other strain, B2494 produced both band A and O-antigen as detected by immunoblotting with mab 36G3, indicating that this strain contains as yet unknown O-antigen biosynthesis genes. Silver-staining suggested that the two LPS 4 strains may also produce O-antigen, although the O-antigen failed to be recognized by mab 36G3. Van den Akker et al. previously observed that the epitope in band A that is recognized by mab 36G3 was also present in the O-antigen 7, and an explanation for the lack of O-antigen recognition by mab 36G3 in these strains may thus be the observed change in band A. 58

59 Comparative Genomic Hybridization discussion Multilocus enzyme electrophoresis (MLEE) studies and the comparison of the genomes of the mammalian bordetellae previously indicated that B. parapertussis hu and B. pertussis adapted to humans independently 1,2. The genesis of B. pertussis was further refined by MLST, which identified a B. bronchiseptica lineage, designated complex IV, from which this human pathogen evolved (Chapter 2). Until now it was assumed that B. bronchiseptica strains are mainly animal pathogens, and that human infections are zoonotic. Further, transmission of B. bronchiseptica between humans was assumed not to occur. Therefore, it was intriguing that B. bronchiseptica complex IV strains were mainly isolated from humans, suggesting that they may be comprised of human-adapted strains. To identify genes or genetic events associated with host adaptation, we used comparative genomic hybridization (CGH) to microarrays. Both B. pertussis and B. parapertussis cause brief, transient infections in humans, with an infectious period of three weeks or more 6. Infection with B. pertussis initiates a response by the adaptive immune system, and antibodies are developed against a large number of B. pertussis antigens, such as Ptx, filamentous haemagglutinin, pertactin, fimbriae and the LPS. However, due to the short infectious period of B. pertussis and of B. parapertussis hu, their transmission will likely be primarily affected by the innate immune system in the absence of vaccine-induced protective immunity. Evasion of the host immune system occurs through adenylate cyclase, Ptx, FHA, LPS, the type III secretion system and likely also by other virulence factors. The paroxysmal coughing, characteristic of whooping cough and essential for transmission, is probably the result of damage to the epithelia, caused by toxins such as tracheal cytotoxin, dermonecrotic toxin and possibly adenylate cyclase. As opposed to B. pertussis and B. parapertussis hu, B. bronchiseptica usually causes chronic infections in many mammalian species, including humans, that often remain unnoticed. The long infectious period of B. bronchiseptica compared to the other mammalian bordetellae indicates that, in addition to the innate immune system, B. bronchiseptica must be affected by the adaptive immune system as well. Thus, the three species probably interact differently with the innate and adaptive arms of the immune system, and this will likely affect their transmission in different ways. This may also be reflected in the differential expression of major virulence factors such as Ptx and LPS. For example, B. pertussis expresses Ptx, but not B. parapertussis hu and B. bronchiseptica. Further, B. bronchiseptica, B. parapertussis hu and B. pertussis produce significantly different LPS molecules 27. Even the generally highly conserved lipid A is polymorphic in these species 28,29. The variability in these virulence factors may reflect a different role in their transmission. With respect to well-characterized virulence factors, differences between B. bronchiseptica complex I, complex IV and B. pertussis were observed in Ptx, Dnt and LPS. CGH analyses indicated that, although the ptx/ptl genes were conserved in B. bronchiseptica complex I strains, the complete ptx/ptl locus, with the exception of ptld, was deleted in 10 of the

60 Chapter 3 3 complex IV strains analyzed. No expression of Ptx was observed in the three complex IV strains that retained the ptx/ptl locus when cultured in vitro. Although conditions under which the Ptx genes are expressed in B. bronchiseptica complex I strains have not been identified, their conservation suggests that they may confer a selective advantage at some stage in the transmission cycle. Another characteristic that set the complex IV strains apart from all other mammalian bordetellae studied is that in 8 out of 13 strains the gene for dermonecrotic toxin (dnt) was deleted. Further, the LPS genetic locus was generally more polymorphic in complex IV than in complex I, and deletions were observed in the O- antigen and trisaccharide biosynthesis genes in some complex IV strains. In complex IV strains with the LPS 4 profile, the extent of deletion in the O-antigen genes was very similar to B. pertussis Tohama. Like B. pertussis, four complex IV strains lacked the O-antigen genes known to be present in the sequenced genomes of B. bronchiseptica and B. parapertussis hu. However, despite carrying apparent large deletions in the LPS O-antigen biosynthesis locus, silver staining suggested that at least one, and possibly three of these strains did produce an O-antigen, suggesting that these strains may carry LPS genes distinct from those in RB50. Two of these strains, both isolated from humans, also lacked many genes required for the biosynthesis of the trisaccharide, and failed to produce trisaccharide detectable by immunoblotting. The trisaccharide is encoded by the wlb locus, and functional wlb genes were present in all three Bordetella species and are required to add a trisaccharide to the lipid A core 24. Strains with a deletion in this locus miss the trisaccharide and the O-antigen 27. The absence of the trisaccharide is intriguing in view of the fact that it was found to be otherwise conserved in all other mammalian Bordetella strains analyzed. Most of the above described virulence factors play complex and multiple roles in the transmission of these species, and often their exact role has not been determined. Ptx is an ADP-ribosylating toxin composed of five subunits, encoded by the genes ptxabcde 30,31. Secretion of the toxin is mediated by the associated Ptl system, consisting of nine proteins 14,32, which are encoded by the ptl genes that are located within the same transcriptional unit as the ptx genes. The properties and effects of Ptx have been studied extensively, both in vitro and in mouse and rat models. Ptx interferes with many mammalian cell signaling pathways, possibly leading to a cascade of biological effects, including insulinemia, histamine sensitization and both immunosuppression and stimulation Ptx was found to play an important role especially in the early phases of respiratory tract infection of mice by B. pertussis, presumably by inhibiting neutrophil influx 36. Further, Ptx was also shown to suppress the antibody response to B. pertussis 37,38. Thus Ptx targets both the innate and adaptive immune system. Finally, Ptx has also been suggested to function as an adhesin 39,40. Ptx is thought to be expressed and produced exclusively by B. pertussis. Intriguingly, the coding sequences for these genes appear to be largely intact and conserved in B. parapertussis hu, B. parapertussis ov and most B. bronchiseptica. Replacement of the ptx/ptl promoter sequence in a B. parapertussis hu and B. bronchiseptica strain with the B. pertussis 60

61 Comparative Genomic Hybridization promoter actually resulted in the production and secretion of biologically active Ptx 41. Dnt is an intracellular toxin that activates the small GTPase Rho through deamidation or polyamination 42. It has been shown that Dnt is important for turbinate atrophy and the colonization of the upper respiratory tract in pigs 43, but its role in pertussis pathogenesis has not been elucidated. For B. bronchiseptica, it was shown that the O-antigen was not required for initial colonization of mice, however, mutants lacking O-antigen showed decreased colonization rates at the long-term 44. Thus, the O-antigen is important for B. bronchiseptica for establishing chronic infections. It was also shown that B. bronchiseptica strains deficient in O-antigen elicited equal amounts of specific antibodies to the wild-type B. bronchiseptica strains 44. Although the O-antigen did not affect the amount of antibodies raised against B. bronchiseptica, it did provide protection against the innate immune system by inhibiting activation of the complement system 44. Long stretches of O-antigenic repeats may interfere with the function of other virulence factors. For Shigella, it was shown that shortening of the O-antigen significantly enhanced the function of the type III secretion system, without losing protection by the LPS. Thus, partial loss of O-antigen may increase virulence of bacteria, possibly by enhancing accessibility to host tissues of other virulence factors such as adhesins, toxins or immunomodulatory factors, while allowing the bacteria to express a basal level of O-antigen level for protection against host defenses such as complementmediated killing. Interestingly, Van den Akker showed that the LPS of the mammalian bordetella are modified in a Bvg-dependent matter 7, suggesting that LPS modification is important for virulence. It was previously shown that, for B. bronchiseptica, wlb-dependent LPS modification was not required for initial infection of the lungs, but it was required for persistence. Further, the trisaccharide was apparently only required when adaptive immunity exists 27. The trisaccharide also protected Bordetella species against the bactericidal lung surfactants SP-A and SP-D of the innate immune system 45,46. Thus, the trisaccharide is important for resistance against both the innate and the adaptive immune system. This is possibly especially important for establishing persistent infections. Thus, both LPS and Ptx play a complex role in the ecology of the mammalian bordetellae, as they may at the same time protect against innate and adaptive immunity, and yet also activate these arms of the immune system. Various hypotheses can be put forward to explain the observed differences in major virulence factors between B. bronchiseptica complex I and complex IV. One possible explanation could be redundancy of virulence factors. For example, Dnt may not be required for B. bronchiseptica complex IV strains to infect their host, as the function of this toxin may be compensated for by other toxins in the genome, or by the type III secretion system. Alternatively, the genetic differences at the virulence loci may be explained by the adaptation to different niches. Variation in LPS structures may for example reflect adaptation to host receptors that are involved in innate immunity, such as the Toll-like receptor 4, which is critical to innate host defense against infections 3 61

62 Chapter 3 3 with mammalian bordetellae Another possibility is that these differences have arisen in response to immune-competition between B. bronchiseptica complex IV strains and B. pertussis. Bjørnstad & Harvill hypothesized that, since B. pertussis and B. parapertussis hu both infect humans, they may have evolved to evade cross-immunity by the other pathogen 50,51. The authors propose that immune-competition provides an explanation for differences observed between B. pertussis and B. parapertussis hu. For example, B. pertussis but not B. parapertussis hu expresses Ptx although both contain the required genes. Conversely, B. Figure 3. Model of the evolution of the mammalian bordetellae. The bar on the left indicates increasing degrees of adaptation to the human host. Arrows indicate descent; double arrows between complexes indicate possible withinhost immune-competition. In boxes, genetic events are shown that may have played a role in speciation and niche adaptation. See text for details. Abbreviations: LCA, last common ancestor. A color version of this figure is available in the appendix. human-adapted broad host range B. pertussis complex II Ptx expression Type III secretion off Deleted or inactivated O-antigen locus Autotransporters Type II capsule Acquired IS481, IS1002 Genome decay LCA complex IV Acquired BP0072 transposase IS lineage-specific genes Genome decay B. bronchiseptica complex I B. bronchiseptica complex IV Deleted Ptx Dnt LPS polymorphism Genome decay Immune competition B. parapertussis hu complex III No Ptx expression Type III secretion off Deleted or inactivated Type II capsule Acquired IS1002 Genome decay parapertussis hu expresses O-antigen, while the corresponding genes have been deleted from B. pertussis. Similarly, the deletion of the genes for Ptx, Dnt and genes involved in trisaccharide syntheses by complex IV strains may have been driven by immune competition with B. pertussis and possibly also B. parapertussis hu. In Figure 3, the mammalian bordetellae evolutionary model from Chapter 2 is shown. The evolution and adaptation to humans of B. bronchiseptica complex IV and B. pertussis is shown, as well as the evolution of B. parapertussis hu. Additional to the model described 62

63 Comparative Genomic Hybridization in Chapter 2, genetic events that may have played an important role in the evolution of these lineages are indicated, such as the polymorphism in the LPS and the species-specific expression of Ptx. Potential immune-competition is indicated between species occupying the same host. Microarray-based CGH of B. pertussis, B. bronchiseptica complex I and complex IV identified many genomic differences between these lineages. CGH revealed 29 genes and the insertion sequence element IS1663 that were more frequently present in B. bronchiseptica complex IV compared to complex I strains. Of these genes, 16 were shared only by B. pertussis and B. bronchiseptica complex IV, suggesting they were acquired after the last common ancestor of complex IV and B. pertussis diverged from complex I. Conversely, 237 genes were absent or divergent in complex IV compared to complex I strains, suggesting that the B. bronchiseptica complex IV genome is decaying, as has been observed for B. pertussis and B. parapertussis hu. Because putative complex IV-specific sequences were not represented on the microarray used here, we were unable to address the possibility that complex IV strains have acquired, through lateral transfer, genetic loci that may have promoted host restriction. However, gene acquisition appears to have been a rare event in the evolution of B. pertussis and B. parapertussis from B. bronchiseptica complex I 2 (see also Chapter 4). This study uses the phylogenetic framework phylogeny of the mammalian bordetellae provided in Chapter 2 as the basis for a more detailed analysis of the genomic changes that may be associated with the adaptation of B. bronchiseptica complex IV and B. pertussis to humans. Differences are observed in various major virulence factors that may be the result of immune-competition within the same hosts, to avoid cross-reactivity. Further, the genomes of B. bronchiseptica complex IV strains seem to have undergone genome reduction in comparison to B. bronchiseptica complex I strains, although the possibility remains that the complex IV strains have acquired DNA elements that are important for host-adaptation. Sequencing of the genomes of one or more members of complex IV may shed more light on processes involved in host adaptation and immune-competition. 3 63

64 Chapter 3 3 acknowledgments We are grateful to Dr. Geoffrey Foster (SAC Veterinary Science Division, Inverness) and to Dr. Gary Sanders (Centers for Disease Control and Prevention, Atlanta, Georgia, United States) for providing B. bronchiseptica strains. We thank Dr. Eric Harvill (Penn State University, Pennsylvania, United States) for sharing unpublished data and discussions and Ing. Marjolein van Gent, Ing. Betsy Kuipers, and Ing. Hendrik-Jan Hamstra for assistance and introduction to LPS work. We also thank Dr. Martin Maiden and Dr. Keith Jolley for assistance with setting up the Bordetella MLST database. This work was supported by a travel grant from the Netherlands Organization for Scientific Research (NWO). 64

65 Comparative Genomic Hybridization reference list 1. van der Zee,A., Mooi,F., van Embden,J., Musser,J. (1997). Molecular evolution and host adaptation of Bordetella spp.: phylogenetic analysis using multilocus enzyme electrophoresis and typing with three insertion sequences. The Journal of Bacteriology 179, Parkhill,J., Sebaihia,M., Preston,A., Murphy,L.D., Thomson,N., Harris,D.E., Holden,M.T., Churcher,C. M., Bentley,S.D., Mungall,K.L., Cerdeno-Tarraga,A. M., Temple,L., James,K., Harris,B., Quail,M.A., Achtman,M., Atkin,R., Baker,S., Basham,D., Bason,N., Cherevach,I., Chillingworth,T., Collins,M., Cronin,A., Davis,P., Doggett,J., Feltwell,T., Goble,A., Hamlin,N., Hauser,H., Holroyd,S., Jagels,K., Leather,S., Moule,S., Norberczak,H., O Neil,S., Ormond,D., Price,C., Rabbinowitsch,E., Rutter,S., Sanders,M., Saunders,D., Seeger,K., Sharp,S., Simmonds,M., Skelton,J., Squares,R., Squares,S., Stevens,K., Unwin,L., Whitehead,S., Barrell,B.G., Maskell,D. J. (2003). Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet. 35, Cummings,C.A., Brinig,M.M., Lepp,P.W., Van De,P. S., Relman,D.A. (2004). Bordetella species are distinguished by patterns of substantial gene loss and host adaptation. J Bacteriol. 186, Gueirard,P., Weber,C., Le Coustumier,A., Guiso,N. (1995). Human Bordetella bronchiseptica infection related to contact with infected animals: persistence of bacteria in host. J.Clin.Microbiol 33, Bauwens,J.E., Spach,D.H., Schacker,T.W., Mustafa,M. M., Bowden,R.A. (1992). Bordetella bronchiseptica pneumonia and bacteremia following bone marrow transplantation. J.Clin.Microbiol 30, Mattoo,S., Cherry,J.D. (2005). Molecular Pathogenesis, Epidemiology, and Clinical Manifestations of Respiratory Infections Due to Bordetella pertussis and Other Bordetella Subspecies. Clinical Microbiology Reviews 18, van den Akker,W.M. (1998). Lipopolysaccharide expression within the genus Bordetella: influence of temperature and phase variation. Microbiology 144 ( Pt 6), Lesse,A.J., Campagnari,A.A., Bittner,W.E., Apicella,M.A. (1990). Increased resolution of lipopolysaccharides and lipooligosaccharides utilizing tricine-sodium dodecyl sulfatepolyacrylamide gel electrophoresis. J.Immunol Methods 126, Tsai,C.M., Frasch,C.E. (1982). A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels. Anal.Biochem. 119, Martin,D., Peppler,M.S., Brodeur,B.R. (1992). Immunological characterization of the lipooligosaccharide B band of Bordetella pertussis. Infection and Immunity 60, Poolman,J.T., Kuipers,B., Vogel,M.L., Hamstra,H.J., Nagel,J. (1990). Description of a hybridoma bank towards Bordetella pertussis toxin and surface antigens. Microb.Pathog. 8, Tusher,V.G., Tibshirani,R., Chu,G. (2001). Significance analysis of microarrays applied to the ionizing radiation response. Proc.Natl.Acad.Sci. U.S.A 98, Kotob,S.I., Hausman,S.Z., Burns,D.L. (1995). Localization of the promoter for the ptl genes of Bordetella pertussis, which encode proteins essential for secretion of pertussis toxin. Infection and Immunity 63, Weiss,A.A., Johnson,F.D., Burns,D.L. (1993). Molecular characterization of an operon required for pertussis toxin secretion. Proc.Natl.Acad.Sci. U.S.A 90, Arico,B., Rappuoli,R. (1987). Bordetella parapertussis and Bordetella bronchiseptica contain transcriptionally silent pertussis toxin genes. The Journal of Bacteriology 169, Leininger,E., Roberts,M., Kenimer,J.G., Charles,I.G., Fairweather,N., Novotny,P., Brennan,M.J. (1991). Pertactin, an Arg-Gly-Asp-containing Bordetella pertussis surface protein that promotes adherence of mammalian cells. Proc.Natl.Acad.Sci.U.S.A. 88, Li,L.J., Dougan,G., Novotny,P., Charles,I.G. (1991). P.70 pertactin, an outer-membrane protein from Bordetella parapertussis: cloning, nucleotide sequence and surface expression in Escherichia coli. Mol.Microbiol. 5, Li,J., Fairweather,N.F., Novotny,P., Dougan,G., Charles,I.G. (1992). Cloning, nucleotide sequence 3 65

66 3 Chapter 3 and heterologous expression of the protective outer-membrane protein P.68 pertactin from Bordetella bronchiseptica. J.Gen.Microbiol. 138 ( Pt 8), Finn,T.M., Stevens,L.A. (1995). Tracheal colonization factor: a Bordetella pertussis secreted virulence determinant. Mol.Microbiol. 16, Isobe,T., White,K.A., Allen,A.G., Peacock,M., Raetz,C. R., Maskell,D.J. (1999). Bordetella pertussis waaa encodes a monofunctional 2-keto-3-deoxy-Dmanno-octulosonic acid transferase that can complement an Escherichia coli waaa mutation. The Journal of Bacteriology 181, Preston,A., Allen,A.G., Cadisch,J., Thomas,R., Stevens,K., Churcher,C.M., Badcock,K.L., Parkhill,J., Barrell,B., Maskell,D.J. (1999). Genetic basis for lipopolysaccharide O-antigen biosynthesis in bordetellae. Infection and Immunity 67, Preston,A., Maskell,D. (2001). The molecular genetics and role in infection of lipopolysaccharide biosynthesis in the Bordetellae. J.Endotoxin.Res. 7, Allen,A.G., Isobe,T., Maskell,D.J. (1998). Identification and cloning of waaf (rfaf) from Bordetella pertussis and use to generate mutants of Bordetella spp. with deep rough lipopolysaccharide. The Journal of Bacteriology 180, Allen,A., Maskell,D. (1996). The identification, cloning and mutagenesis of a genetic locus required for lipopolysaccharide biosynthesis in Bordetella pertussis. Mol Microbiol 19, Allen,A.G., Thomas,R.M., Cadisch,J.T., Maskell,D.J. (1998). Molecular and functional analysis of the lipopolysaccharide biosynthesis locus wlb from Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Mol Microbiol 29, Peppler,M.S. (1984). Two physically and serologically distinct lipopolysaccharide profiles in strains of Bordetella pertussis and their phenotype variants. Infection and Immunity 43, Harvill,E.T., Preston,A., Cotter,P.A., Allen,A.G., Maskell,D.J., Miller,J.F. (2000). Multiple roles for Bordetella lipopolysaccharide molecules during respiratory tract infection. Infection and Immunity 68, Caroff,M., Aussel,L., Zarrouk,H., Martin,A., Richards,J.C., Therisod,H., Perry,M.B., Karibian,D. (2001). Structural variability and originality of the Bordetella endotoxins. J Endotoxin.Res. 7, Caroff,M., Karibian,D., Cavaillon,J.M., Haeffner- Cavaillon,N. (2002). Structural and functional analyses of bacterial lipopolysaccharides. Microbes.Infect. 4, Locht,C., Keith,J.M. (1986). Pertussis toxin gene: nucleotide sequence and genetic organization. Science 232, Nicosia,A., Perugini,M., Franzini,C., Casagli,M.C., Borri,M.G., Antoni,G., Almoni,M., Neri,P., Ratti,G., Rappuoli,R. (1986). Cloning and sequencing of the pertussis toxin genes: operon structure and gene duplication. Proc.Natl.Acad.Sci.U.S.A 83, Farizo,K.M., Cafarella,T.G., Burns,D.L. (1996). Evidence for a ninth gene, ptli, in the locus encoding the pertussis toxin secretion system of Bordetella pertussis and formation of a PtlI-PtlF complex. Journal of Biological Chemistry 271, Morse,S.I., Morse,J.H. (1976). Isolation and properties of the leukocytosis- and lymphocytosispromoting factor of Bordetella pertussis. J.Exp. Med. 143, Munoz,J.J., Arai,H., Bergman,R.K., Sadowski,P. L. (1981). Biological activities of crystalline pertussigen from Bordetella pertussis. Infection and Immunity 33, Pittman,M. (1979). Pertussis toxin: the cause of the harmful effects and prolonged immunity of whooping cough. A hypothesis. Rev.Infect.Dis. 1, Carbonetti,N.H., Artamonova,G.V., Mays,R.M., Worthington,Z.E. (2003). Pertussis toxin plays an early role in respiratory tract colonization by Bordetella pertussis. Infection and Immunity 71, Carbonetti,N.H., Artamonova,G.V., Andreasen,C., Dudley,E., Mays,R.M., Worthington,Z.E. (2004). Suppression of Serum Antibody Responses by Pertussis Toxin after Respiratory Tract Colonization by Bordetella pertussis and Identification of an Immunodominant Lipoprotein. Infection and Immunity 72, Mielcarek,N., Riveau,G., Remoue,F., Antoine,R., Capron,A., Locht,C. (1998). Homologous and 66

67 Comparative Genomic Hybridization heterologous protection after single intranasal administration of live attenuated recombinant Bordetella pertussis. Nat.Biotechnol. 16, Relman,D., Tuomanen,E., Falkow,S., Golenbock,D.T., Saukkonen,K., Wright,S.D. (1990). Recognition of a bacterial adhesion by an integrin: macrophage CR3 (alpha M beta 2, CD11b/CD18) binds filamentous hemagglutinin of Bordetella pertussis. Cell 61, Tuomanen,E., Weiss,A. (1985). Characterization of two adhesins of Bordetella pertussis for human ciliated respiratory-epithelial cells. J.Infect.Dis. 152, Hausman,S.Z., Cherry,J.D., Heininger,U., Wirsing Von Konig,C.H., Burns,D.L. (1996). Analysis of proteins encoded by the ptx and ptl genes of Bordetella bronchiseptica and Bordetella parapertussis. Infection and Immunity 64, Kashimoto,T., Katahira,J., Cornejo,W.R., Masuda,M., Fukuoh,A., Matsuzawa,T., Ohnishi,T., Horiguchi,Y. (1999). Identification of functional domains of Bordetella dermonecrotizing toxin. Infection and Immunity 67, Brockmeier,S.L., Register,K.B., Magyar,T., Lax,A. J., Pullinger,G.D., Kunkle,R.A. (2002). Role of the Dermonecrotic Toxin of Bordetella bronchiseptica in the Pathogenesis of Respiratory Disease in Swine. Infection and Immunity 70, Burns,V.C., Pishko,E.J., Preston,A., Maskell,D.J., Harvill,E.T. (2003). Role of Bordetella o antigen in respiratory tract infection. Infection and Immunity 71, Schaeffer,L.M., McCormack,F.X., Wu,H., Weiss,A.A. (2004). Interactions of pulmonary collectins with Bordetella bronchiseptica and Bordetella pertussis lipopolysaccharide elucidate the structural basis of their antimicrobial activities. Infection and Immunity 72, Edwards,J.A., Groathouse,N.A., Boitano,S. (2005). Bordetella bronchiseptica Adherence to Cilia Is Mediated by Multiple Adhesin Factors and Blocked by Surfactant Protein A. Infection and Immunity 73, Miller,S.I., Ernst,R.K., Bader,M.W. (2005). LPS, TLR4 and infectious disease diversity. Nat Rev.Microbiol 3, Mann,P.B., Kennett,M.J., Harvill,E.T. (2004). Toll-Like Receptor 4 Is Critical to Innate Host Defense in a Murine Model of Bordetellosis. J Infect.Dis. 189, Mann,P.B., Elder,K.D., Kennett,M.J., Harvill,E. T. (2004). Toll-like receptor 4-dependent early elicited tumor necrosis factor alpha expression is critical for innate host defense against Bordetella bronchiseptica. Infection and Immunity 72, Bjornstad,O.N., Harvill,E.T. (2005). Evolution and emergence of Bordetella in humans. Trends Microbiol. 51. Gupta,S., Maiden,M.C.J. (2001). Exploring the evolution of diversity in pathogen populations. Trends in Microbiology 9,

68 68

69 44 Chapter Chapter Identification and Characterization of B. bronchiseptica Complex IV- Specific Sequences Dimitri A. Diavatopoulos 1,2, Marjolein van Gent 1, Frits R. Mooi 1,2 1 Laboratory for Vaccine-Preventable Diseases, National Institute of Public Health and the Environment, Bilthoven, The Netherlands; 2 Eijkman Winkler Institute, University Medical Center, Utrecht, The Netherlands Manuscript in preparation

70 Chapter 4 4 abstract Comparative genomics previously showed significant genome reduction in the humanadapted species B. parapertussis hu and B. pertussis compared to B. bronchiseptica. MLST suggested a close relationship of B. pertussis and B. bronchiseptica complex IV strains, and gene content comparison by hybridization to microarrays suggested that the genomes of B. bronchiseptica complex IV had also undergone reduction compared to B. bronchiseptica complex I. Although DNA acquisition seems to have played a minor role in the evolution of both B. pertussis and B. parapertussis, based on microarray genome comparison, the possibility that DNA acquisition by horizontal transfer may also have played a role in host adaptation of B. bronchiseptica complex IV cannot be ruled out completely. To identify horizontally acquired genes specific for B. bronchiseptica complex IV, we used subtractive hybridization. To this purpose, the genome of a complex I strain (RB50) was subtracted from a mixture of the genomes of five B. bronchiseptica complex IV strains, and the distribution of sequences not present in B. bronchiseptica RB50 was determined over a collection of complex I and IV strains. A limited number of complex IV-specific sequences were detected, suggesting that large scale gene acquisition by horizontal transfer has not played a major role in the evolution of complex IV strains. 70

71 Subtractive Hybridization introduction Bordetella pertussis and Bordetella parapertussis hu, the causative agents of whooping cough in humans, have independently evolved from a Bordetella bronchiseptica-like ancestor ( 1,2, chapter 2). Genome comparison indicated that the evolution and host-adaptation of B. pertussis and B. parapertussis hu was accompanied by extensive genome decay 3. Especially the genome of B. pertussis contains a very high percentage of pseudogenes (9.4%), and extensive reshuffling has occurred relative to B. bronchiseptica RB50 through IS481- mediated transposition events. The genome reduction is also reflected in the genome sizes of B. bronchiseptica RB50, B. parapertussis hu 12822, and of B. pertussis Tohama, which are 5.3, 4.8 and 4.1 million bases, respectively. The genome of B. pertussis Tohama contains 1,161 less predicted genes than the genome of B. bronchiseptica RB50. Further, there are no indications of large-scale gene acquisition in B. pertussis compared to B. bronchiseptica RB50, and based on that observation, Parkhill et al. 3 suggested that host adaptation of B. pertussis and B. parapertussis hu was associated with of genome reduction. It was shown by multilocus sequence typing (MLST) that B. bronchiseptica comprised two distinct lineages, designated complex I and complex IV (Chapter 2), isolated mainly from animals and humans, respectively. Based on MLST and pertactin sequence data, B. pertussis was more closely related to B. bronchiseptica complex IV than to B. bronchiseptica complex I. Comparative genomic hybridization (CGH) to microarrays identified 30 genes that were overrepresented in the complex IV strains compared to complex I (Chapter 3). Sixteen of these 30 genes were previously believed to be unique to B. pertussis 3,4. Conversely, a total of 237 genes were identified to be underrepresented in B. bronchiseptica complex IV strains compared to complex I, and these genes were in most cases absent from the genome of B. pertussis Tohama as well. These observation further underline the closer relationship of B. pertussis to complex IV strains compared to complex I strains. Because gene acquisition has been suggested to have played a minor role in the evolution and host-adaptation of B. pertussis and B. parapertussis 3, the analysis of CGH data may suggest that the genomes of B. bronchiseptica complex IV have decayed compared to B. bronchiseptica complex I. However, CGH analysis is limited to genes that are represented on the array. To identify horizontally acquired genes specific for B. bronchiseptica complex IV, we used subtractive hybridization. To this purpose, the genome of a complex I strain (RB50) was subtracted from a mixture of the genomes of five B. bronchiseptica complex IV strains. The B. bronchiseptica RB50 strain was chosen because its genome has been sequenced 3. Subsequently, the distribution of the identified sequences, which were potentially unique for complex IV strains, was determined by PCR. This approach identified a limited number of unique complex IV specific sequences, suggesting that large scale gene acquisition by horizontal transfer has not played a major role in the evolution of complex IV strains. 4 71

72 Chapter 4 experimental procedures 4 bacterial strains To identify sequences specific to complex IV in comparison to complex I, five B. bronchiseptica complex IV strains (B0232 (ST18), B2114 (ST25), B2494 (ST15), B2495 (ST17) and B2496 (ST3)) were compared to B. bronchiseptica RB50 (B1976, ST12) by subtractive hybridization. For strain characteristics, see Table 1. Strains were cultured on Bordet Gengou agar supplemented with 15% sheep blood (BD, Franklin Lakes, NJ) at 37 C for one to two days. Chromosomal DNA was isolated using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI), according to the manufacturers protocol for Gram-negative bacteria. Table 1. Characteristics of the strains used in the subtractive hybridization. Number Species1 Complex ST IS481 IS1001 IS1002 IS1663 Host Original name B1976 BB I rabbit RB50 B0232 BB IV human 397 B2114 BB IV human B2494 BB IV human MO149 B2495 BB IV human MO211 B2496 BB IV human MO275 ¹Abbreviations: BB= B. bronchiseptica; BPP-OV= B. parapertussis ov ; BPP-HU= B. parapertussis hu ; BP= B. pertussis subtractive hybridization To identify complex IV-specific sequences, the genome of B. bronchiseptica RB50 (B1976; driver) was subtracted from the genomes of five pooled B. bronchiseptica complex IV strains (consisting of equimolar amounts of B0232, B2114, B2494, B2495 and B2496; tester). B. bronchiseptica B1976 is a complex I strain, and its genome has been published 3. For each experiment, the PCR-Select Bacterial Genome Subtraction Kit (BD Biosciences Clontech) was used, with modifications to the standard protocol. First, 2 μg of genomic DNA of both tester and driver DNA was digested to completion in One-Phor-All Buffer (Amersham) with Alu I (Invitrogen), a four base pair cutter that generates restriction fragments in B. bronchiseptica RB50, with an average restriction fragment size of 323 nucleotides. Digestion with Alu I does not lead to restoration of the restriction site when the adaptors are ligated to the restriction fragments. After phenol extraction and ethanol precipitation, the tester DNA sample was divided into two samples. Adaptor 1 and 2R were ligated to 150 ng of each Tester DNA sample, respectively. An unsubtracted sample was generated as well, which served as a negative control for subtraction and consisted of 1.5 μl of Tester DNA Ligation mix with Adaptor 1 and 1.5 μl of Tester DNA Ligation mix with Adaptor 2R. The ligation mixture was incubated at 16 C for 16 hr. After incubation, 1 μl of 0.2 M EDTA (ethylenediaminetetraacetic acid) was added to stop the ligation reaction, followed by 5 min at 72 C to inactivate the ligase. A PCR control was performed to 72

73 Subtractive Hybridization determine the ligation efficiency. In this PCR, a primer designed to hybridize to a randomly selected Alu I restriction fragment was combined to a primer designed to hybridize to the adaptors (supplied in the kit). Two hybridization rounds were performed with the ligated tester DNA. In the first hybridization round, the two ligated tester DNA samples were each hybridized to a 27 times excess of driver DNA (400 ng of driver DNA to 15 ng of tester DNA) at 65 C for 1.5 hr. In this hybridization round, non-specific tester DNA sequences hybridize to the driver DNA, thereby enriching for tester-specific sequences. The second hybridization round was performed directly following the first round; the two tester DNA samples to which the different adaptors were ligated were hybridized to each other in the presence of newly added, freshly denatured driver DNA. This step was performed to further enrich for tester-specific sequences. Hybridization was performed for 16 hr at 65 C. After the second hybridization, 150 μl of dilution buffer (Clontech) were added to the sample, and incubated for 7 min at 63 C to prevent non-specific hybridization. Selective amplification of tester-specific sequences was performed by PCR. The mixture of the primary PCR consisted of 2.5 μl 10x BD Advantage 2 PCR buffer (Clontech), 0.5 μl 50x dntp mix, 0.5 μl 50x BD Advantage 2 polymerase mix, 5 μl 5M betain (Sigma- Aldrich), 1.3% dimethylsulfoxide (DMSO), 10 pmol PCR primer 1, 12.2 μl dh 2 O and 3 μl of the diluted subtracted sample. Thermal cycling was as follows: 3 min 30 s at 72 C to extend the adaptors, 25 cycles of 1 min at 4 C, 30 s at 60 C, 2 min at 72 C. A final extension was performed for 7 min at 72 C. A secondary (nested) PCR was performed to increase the amount of tester-specific sequences, consisting of 12.5 μl of HotStar Taq Master Mix (Qiagen), 1 μl of nested primer 1, 1 μl of nested primer 2R, 5 μl of 5M betain (Sigma-Aldrich), 1.3% DMSO, 4.2 μl dh 2 O and 1 μl of the 10x diluted primary PCR sample. Cycling conditions were: 15 min at 95 C, 20 cycles of 1 min at 94 C, 30 s at 62 C, 2 min at 72 C. A final extension step was performed for 30 min at 72 C, which generates the 3 A overhang that was used to clone the PCR fragments into the TOPO TA cloning vector (Invitrogen). 4 cloning and sequencing of pcr fragments PCR fragments were purified with the Qiaquick PCR purification kit (Qiagen). Subsequently, the PCR fragments were cloned into the TOPO-TA cloning vector (Invitrogen) and transformed into One Shot Chemically Competent Cells (Invitrogen), according to the manufacturer s protocol. Blue-white screening was performed to identify clones with inserts. Colony PCR was performed on white colonies using M13 primers (5 -GTT-GTA-AAA- CGA-CGG-CCA-GT-3 and 5 -CAG-GAA-ACA-GCT-ATG-ACC-3 ) and PCR products were analyzed by agarose gel electrophoresis. PCR products were purified using ExoSAP- IT (USB, Cleveland, OH). All sequencing was performed with the M13 forward using standard dye-terminator chemistry. 73

74 Chapter 4 data analysis Sequence trace data were analyzed using Kodon version 2.5 (Applied Maths, Sint-Martens- Latem, Belgium). Contigs were assembled using Kodon and SeqMan (DNASTAR, Inc., Madison, WI). 4 distribution of tester-specific sequences For sequences that were potentially specific to complex IV, the distribution was determined over six complex I (B0188, B0194, B0251, B1976, B2499 and B2501) and six complex IV strains (B0259, B2114, B2490, B2494, B2495 and B2506) by PCR. For these sequences, primers were designed and PCR amplification was performed with genomic DNA from various strains (a list with primer information is available from the authors). 74

75 Subtractive Hybridization results Gene content comparison of B. bronchiseptica complex IV and complex I strains by CGH suggested that the complex IV strains have undergone genome reduction compared to complex I (Chapter 3). However, one of the limitations of CGH is that it can detect only sequences that are represented on the array. Here we investigated whether complex IV strains contain additional DNA sequences compared to complex I. To enrich for sequences shared by multiple complex IV strains, the DNA of five distinct complex IV (B0232, B2114, B2494, B2495 and B2496) strains was combined and from this, the genome of the B. bronchiseptica complex I strain RB50 was subtracted by hybridization. By using B. bronchiseptica RB50 as the driver strain in the subtractive hybridization, identification of non-rb50 sequences was facilitated, due to the fact that the genome of RB50 has been sequenced completely. Following subtractive hybridization, tester-specific sequences were further enriched by suppression PCR and PCR products were transformed into competent cells. The nucleotide sequences of 305 clones were determined. For the identification of sequences present in the genome of RB50, a BLASTN search against the non-redundant GenBank database was performed. Nucleotide analysis showed that the 305 sequences contained 183 unique and 122 redundant sequences. Based on overlap of flanking sequences, contigs were assembled. Out of the 183 unique sequences, 33 sequences could be assembled into 12 contigs; for the remaining 150 sequences, no overlap with other sequences could be detected. Fifty-six % of the 183 sequences (5 contigs representing 10 sequences and 92 unique sequences) showed >99% identity to genes present in the genome of B. bronchiseptica RB50. The average GC-content of these sequences was 60.9%, which is significantly lower than the average GC-content of the B. bronchiseptica RB50 genome (68.1%) 3. We also identified 4 contigs (14 sequences) and 2 sequences not assigned to a contig that showed homology to IS1663, which was previously shown to be present in complex IV strains (Chapter 2 and 3). Analysis of sequences adjacent to these IS1663 elements yielded seven different RB50-encoded genes, as well as two sequences with no significant homology to known genes. Previously, it was reported that B. pertussis Tohama contains 17 IS1663 copies 3, and comparison of the genes adjacent to IS1663 in B. bronchiseptica complex IV and B. pertussis Tohama indicated that the sequences flanking IS1663 were different in these two lineages. For 65 sequences, no homologous sequence could be identified in the genome of B. bronchiseptica RB50, although for one contig (containing three clone sequences) and four single sequences, homologous genes were detected in B. pertussis Tohama (>99% sequence identity), including BP0207, which was previously shown to be specific to B. pertussis 4 and was shown to be overrepresented in complex IV strains by CGH analysis (Chapter 3). Five clone sequences showed homology to B. parapertussis genes (>99%), and three of these were related to O-antigen biosynthesis. In chapter 3, polymorphism in the O-antigen biosynthesis locus of complex IV strains was demonstrated by CGH analysis. It was shown 4 75

76 Chapter 4 4 that some complex IV strains contained an alternative O-antigen biosynthesis locus. We identified 47 sequences that showed no homology to any of the mammalian bordetellae, and the average GC-content was 55.7%, significantly lower than that of any of the sequenced Bordetella species. As these 47 sequences were potentially specific to complex IV, their presence in six complex I (B0188, B0194, B0251, B1976, B2499 and B2501) and six complex IV strains (B0259, B2114, B2490, B2494, B2495 and B2506) was determined by PCR amplification. The distribution was performed for two contigs (six sequences) as well as for 34 single sequences. For one of two contigs (three sequences) and four out of 34 sequences, PCR screening indicated that these sequences were present in five of six complex IV strains, and absent from all tested complex I strains. For the other sequences of which the distribution was determined, PCR indicated the sequence was present in a single B. bronchiseptica complex IV strain only. BLASTN indicated no significant homology to known genes for these sequences, with the exception of one sequence that showed homology (E = 1e-111) to a hypothetical cytosolic protein encoding gene involved in arsenite oxidation in the species Alcaligenes faecalis, which is closely related to the genus Bordetella 5. For the remaining sequences of which the distribution was not determined, a putative function could not be identified by homology search to known genes or proteins. 76

77 Subtractive Hybridization discussion Although comparative genomics of B. bronchiseptica complex IV strains and complex I strains suggested genome reduction of the complex IV strains, the possibility remained that acquisition of DNA may also have contributed to the evolution of B. bronchiseptica complex IV. In this study, the extent of DNA acquisition in complex IV strains in comparison to B. bronchiseptica complex I was investigated by comparing their genomes using subtractive hybridization. The RB50 strain was chosen as driver strain because of the availability of its genome sequence, which facilitated the identification of sequences specific to B. bronchiseptica complex IV. Screening of 305 clone sequences showed that 56% showed nearly 100% homology to genes in B. bronchiseptica RB50. The GC-content of these sequences was significantly lower than the average GC-content of RB50, suggesting that sequences with divergent GC-content are possibly preferentially enriched using this method. Sequencing of 305 clones detected a high level of redundancy, and after removal of the redundant clones, 183 unique clones remained, which could be clustered into 12 contigs and 150 clones that, based on lack of overlap, could not be assigned to a contig. Of the 183 clones, 56% showed homology (>99%) to genes in B. bronchiseptica RB50. The relatively low GC-content (60.9%) of these clones suggested that sequences with a divergent GCcontent may be more easily detected than sequences with a GC-content similar to the driver strain. Besides genes with homology to B. bronchiseptica RB50, we also isolated 10 clones with homology to genes in B. pertussis Tohama and B. parapertussis Most of the genes assumed to be specific to B. pertussis and B. parapertussis based on genome comparison 3, were later shown to be present in many other (non-rb50) B. bronchiseptica strains by CGH 4. The majority of the genes in B. parapertussis that were homologous to the clones obtained with subtractive hybridization were related to O-antigen biosynthesis. This can be explained by the differences at the O-antigen biosynthesis locus between B. bronchiseptica RB50 and B. bronchiseptica complex IV (see Chapter 3). Of the 183 unique clones, 47 showed no homology to genes in the genomes of the mammalian bordetellae. In only five clones (one contig and four unique clones), PCR amplification showed that the sequences were present in multiple complex IV strains. In most cases, a putative function for these clones could not be determined, due to lack of homology with nucleotide and protein databases. Thus, the majority of the clones that were found to be present in B. bronchiseptica complex IV and absent in RB50 were detected only in a single complex IV isolate. This suggested that (small) genomic differences exist between the complex IV strains, which may be expected due to the previously observed high genetic diversity in complex IV (discussed in Chapter 2). However, the failure to detect a high amount of sequences specific to complex IV strains suggests that large-scale DNA acquisition by horizontal transfer has not likely played a major role in the evolution of the B. bronchiseptica complex IV strains. 4 77

78 Chapter 4 4 In Chapter 2 and 3, it was shown that the B. pertussis insertion sequence element IS1663 was also present in the majority of B. bronchiseptica complex IV isolates. The subtractive hybridization experiment resulted in 33 IS1663-containing clones. Eight of these clones were found to contain sequences flanking IS1663. Seven of these flanking sequences showed homology to genes in B. bronchiseptica RB50, and for one sequence, no homology was found. However, none of the flanking sequences showed homology to sequences adjacent to the 17 B. pertussis Tohama IS1663 copies. This lack of homology may argue for lateral transfer of IS1663 between B. pertussis and B. bronchiseptica complex IV instead of common descent. However, this issue requires further investigation, e.g. by analyzing all IS1663 flanking sequences in both B. bronchiseptica complex IV and B. pertussis. In summary, we detected limited DNA acquisition in complex IV strains compared to B. bronchiseptica RB50 (25.6% of the clones isolated by subtractive hybridization), and in most cases these sequences were strain-specific and not shared by the whole complex. Therefore, it seems unlikely that DNA acquisition has played an important role in the evolution of complex IV, although it may still have been important for niche-adaptation at the strain-level. Although our data suggest that the genomes of B. bronchiseptica complex IV strains have been reduced compared to B. bronchiseptica complex I strains, the ultimate proof lies in the sequencing of members of B. bronchiseptica complex IV and comparison of these sequences to the genome sequences of B. bronchiseptica complex I strains. 78

79 Subtractive Hybridization reference list 1. van der Zee,A., Mooi,F., van Embden,J., Musser,J. (1997). Molecular evolution and host adaptation of Bordetella spp.: phylogenetic analysis using multilocus enzyme electrophoresis and typing with three insertion sequences. The Journal of Bacteriology 179, Musser,J.M., Hewlett,E.L., Peppler,M.S., Selander,R. K. (1986). Genetic diversity and relationships in populations of Bordetella spp. The Journal of Bacteriology 166, Parkhill,J., Sebaihia,M., Preston,A., Murphy,L.D., Thomson,N., Harris,D.E., Holden,M.T., Churcher,C. M., Bentley,S.D., Mungall,K.L., Cerdeno-Tarraga,A. M., Temple,L., James,K., Harris,B., Quail,M.A., Achtman,M., Atkin,R., Baker,S., Basham,D., Bason,N., Cherevach,I., Chillingworth,T., Collins,M., Cronin,A., Davis,P., Doggett,J., Feltwell,T., Goble,A., Hamlin,N., Hauser,H., Holroyd,S., Jagels,K., Leather,S., Moule,S., Norberczak,H., O Neil,S., Ormond,D., Price,C., Rabbinowitsch,E., Rutter,S., Sanders,M., Saunders,D., Seeger,K., Sharp,S., Simmonds,M., Skelton,J., Squares,R., Squares,S., Stevens,K., Unwin,L., Whitehead,S., Barrell,B.G., Maskell,D. J. (2003). Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet. 35, Cummings,C.A., Brinig,M.M., Lepp,P.W., Van De,P. S., Relman,D.A. (2004). Bordetella species are distinguished by patterns of substantial gene loss and host adaptation. J Bacteriol. 186, Gerlach,G., von Wintzingerode,F., Middendorf,B., Gross,R. (2001). Evolutionary trends in the genus Bordetella. Microbes and Infection 3,

80 80

81 55 Chapter Chapter Transfer of an Iron-Uptake Island From Bordetella pertussis to Bordetella holmesii Dimitri A. Diavatopoulos 1,2, Craig A. Cummings 3,4, Han van der Heide 1, Marjolein van Gent 1, Sin-Yee Liew 3,4, David A. Relman 3,4,5, Frits R. Mooi 1,2 These authors contributed equally to this work 1 Laboratory for Vaccine-Preventable Diseases, National Institute of Public Health and the Environment, Bilthoven, The Netherlands; 2 Eijkman Winkler Institute, University Medical Center, Utrecht, The Netherlands; 3 Departments of Microbiology and Immunology; and of 4 Medicine, Stanford University School of Medicine, Stanford, California 94305, USA; 5 VA Palo Alto Health Care System, Palo Alto, California 94304, USA Submitted for publication

82 Chapter 5 5 abstract The recent discovery of Bordetella holmesii from the blood and airways of patients suggests that this species may represent a newly emerged human bacterial pathogen. However, the mechanism by which B. holmesii may have acquired the ability to infect humans is not understood. Furthermore, although the B. holmesii 16S rrna sequence is most similar to that of B. pertussis, other evidence suggests a more distant relationship of these species. In order to address these questions, several B. holmesii genomes were analyzed by multilocus sequence analysis, and by comparative genome hybridization (CGH) using a microarray representing B. pertussis, B. parapertussis and B. bronchiseptica. Sequencing of housekeeping genes indicated that B. holmesii is more closely related to B. hinzii and B. avium than to B. pertussis, and that B. holmesii strains are very closely related to each other. Overall, CGH indicated substantial sequence divergence between the genomes of B. pertussis and B. holmesii. However, we identified a putative pathogenicity island, encoding the biosynthesis, export, and uptake of the siderophore alcaligin, that showed near sequence identity to the orthologous B. pertussis genes, and that contained IS481 elements, suggesting that it may have been laterally acquired from B. pertussis. Expression of alcaligin biosynthesis and uptake genes in B. holmesii was induced in the absence of iron, and secreted alcaligin was detected, suggesting that this locus is functional. The B. holmesii locus also contains a fecirlike locus adjacent to the alc operon that may have been acquired through a transposonmediated recombination event, and that may contribute to transcriptional regulation of iron uptake. A possible role for this pathogenicity island in the evolution and emergence of B. holmesii as a human pathogen is proposed. Horizontal gene transfer between B. pertussis and B. holmesii may also explain the unusually high sequence identity of their 16S rrna genes, and explain the failure of the 16S-based phylogeny to recapitulate the phylogeny based on housekeeping gene sequences. 82

83 Acquisition of Iron-Uptake Genes introduction Bordetella holmesii is a recently described human pathogen originally isolated from the blood of septicemic patients. Although most B. holmesii systemic infections occur in immunocompromised individuals 1, a serious systemic infection of a healthy adolescent has also been described 2. More recently, B. holmesii has also been isolated from the respiratory tracts of immunocompetent patients with coughing symptoms. For example, 0.6% of nasopharyngeal swab samples collected from patients with cough by the Massachusetts State Laboratory in 1998 tested positive for B. holmesii 3. In addition to B. holmesii, the genus Bordetella contains a number of other pathogenic species. Bordetella pertussis is the causative agent of pertussis, which, in spite of widespread vaccination, is re-emerging in countries with traditionally high vaccination coverage. B. pertussis is very closely related to B. bronchiseptica and B. parapertussis, which also cause respiratory disease in mammalian hosts. Together, these three species are designated the mammalian, or classical, bordetellae. The non-classical Bordetella species include B. avium, B. hinzii, B. petrii and B. trematum, which form a genetically diverse group that is clearly distinct from the mammalian bordetellae 4. B. avium is the most thoroughly studied non-classical Bordetella species, due to the fact that it is an important respiratory pathogen of fowl 5. Comparative analysis of 16S rrna sequences suggested that B. holmesii is very closely related to B. pertussis 6, a hypothesis that was supported by the discovery of the B. pertussisspecific insertion sequence element IS481 in B. holmesii 7. However, subsequent sequencing of housekeeping genes, analysis of cellular fatty acid composition, and characterization of the bvgas locus suggested that B. holmesii may not be as closely related to B. pertussis as was first assumed 6,8. In order to assess the sequence similarity of B. holmesii to the mammalian bordetellae at a high resolution, genome-wide level, B. holmesii strains were analyzed by comparative genome hybridization (CGH) to a classical Bordetella microarray. These data indicated that the majority of B. holmesii genes did not hybridize to the Bordetella microarray, suggesting significant sequence divergence between B. holmesii and the mammalian bordetellae. However, CGH detected a highly conserved genomic region of 66 kb that is proposed to have been transferred from B. pertussis to B. holmesii. This iron-uptake island (IUI) encoded the biosynthesis, export, and uptake of the siderophore alcaligin, as well as several IS481 elements. Further characterization of the island identified a transposase-mediated insertion adjacent to the alcaligin operon that encoded a FecIR-like system that may be involved in regulation of iron-uptake. Transcription of the alcaligin operon and the production of secreted alcaligin were demonstrated under iron-depleted conditions. Sequencing of housekeeping genes indicated that B. holmesii is a uniform group that is more closely related to the non-classical B. hinzii and B. avium than to the mammalian bordetellae. The presence of 16S rrna genes similar to those in B. pertussis in the genome of B. holmesii may be explained by horizontal gene transfer between B. pertussis and B. 5 83

84 Chapter 5 holmesii. Horizontal gene transfer may also be a plausible explanation for the presence of similar 16S rrna genes in the genomes of B. pertussis and B. holmesii. 5 84

85 Acquisition of Iron-Uptake Genes experimental procedures bacterial strains and culture conditions Characteristics of the strains used in this study are listed in Table 1. Strains were isolated either from the blood or from the respiratory tract of patients from Europe or the United States. Strains were routinely grown on BG agar, supplemented with 15% sheep blood (BD, Franklin Lakes, NJ, USA) at 37 C for 3-5 days. Genomic DNA was isolated using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI) following the protocol for gram-negative bacteria. For iron depletion tests, a previously described chemically defined medium 9 was adapted by adding 330 μm L-cysteine, 114 μm ascorbic acid, 33 μm niacin, and 325 μm reduced glutathione. Chelex-100 resin was used for iron depletion, as described previously 9. Iron-replete media was made by adding 66 μm ferrous sulfate to iron-depleted media. 5 Table 1. B. holmesii strain characteristics Strain Original Name Source Isolation site Country City Isolation Year B Institut Pasteur unknown unknown unknown unknown B Institut Pasteur unknown unknown unknown unknown B1850 C690 Pam Cassiday Nasopharynx USA Massachusetts 1994 B1851 C691 Pam Cassiday Blood USA Massachusetts 1995 B1852 C692 Pam Cassiday Blood USA Ohio unknown B1853 C693 Pam Cassiday Blood USA Colorado unknown B1854 C694 Pam Cassiday Blood USA North Carolina unknown B1855 USA 8/8/00 Cathy Canthaboo unknown unknown unknown unknown B2738 BP Norman Fry Blood United Kingdom Newport, Isle of Wight 2001 B2739 BP Norman Fry Blood United Kingdom London 2001 B2767 RR Norman Fry Blood United Kingdom unknown 2003 B2768 HO Norman Fry Blood United Kingdom Oxford 2004 Bho29 G8350 Robbin Weyant Blood Switzerland unknown unknown comparative genomic hybridization Experiments utilized a comprehensive classical Bordetella genome-wide DNA microarray, based on the microarray described in 10, but with the inclusion of additional ORF probes and resulting, improved genome coverage. With 5,670 PCR products, 97.4% of the B. pertussis Tohama I ORFs and 98.5% of the B. bronchiseptica RB50 ORFs are represented. Probes were printed in duplicate on poly-l-lysine-coated glass slides as previously reported 10. B. holmesii genomic DNA was labeled with Cy5, and hybridized to arrays with Cy3-labeled reference DNA (equimolar amounts of B. pertussis Tohama I, B. bronchiseptica RB50 and B. bronchiseptica genomic DNA) as described in 10. Arrays were scanned using a GenePix 4000B scanner (Axon Instruments, Union City, CA) and analyzed with GenePix Pro version 6 (Axon Instruments). Data were filtered to include only spots containing more than 30 pixels and with a mean background-subtracted Cy3 signal above 150 U. 85

86 Chapter 5 Table 2. Characteristics of the ORFs in the B. holmesii IUI region. Gene name B. pertussis ORF B. avium 1 Gene product 5 rpso, secc BP0794 yes 30S ribosomal protein S15 BP0793 BP0793 yes putative lipoprotein pssa BP0792 yes putative CDP-diacylglycerol-serine O-phosphatidyltransferase protein ilvc BP0791 yes ketol-acid reductoisomerase ilvh, brnp BP0790 yes acetolactate synthase small subunit ilvi BP0789 yes acetolactate synthase large subunit BP0787/ BP2450 BP0787/BP2450 yes N-and C-terminal regions of a putative membrane protein BP2451 BP2451 no putative membrane transport protein BP2452 BP2452 yes conserved hypothetical protein IS481 BP2453 no transposase for IS481 element BP2454 BP2454 yes putative oxidoreductase BP2455 BP2455 no putative membrane efflux protein alca BP2456 no alcaligin biosynthesis enzyme alcb BP2457 no alcaligin biosynthesis protein alcc BP2458 no alcaligin biosynthesis protein alcd BP2459 no hypothetical protein alce BP2460 yes 2 putative iron-sulfur protein alcr BP2461 no transcriptional regulator alcs BP2462 no alcaligin exporter faua BP2463 no ferric alcaligin siderophore receptor mar BP2464 no possible membrane efflux protein bhoa n/d no putative IS3-family transposase bhob n/d no uncharacterized protein UPF0065 [Ralstonia metallidurans CH34] bhoc n/d no D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding [Ralstonia metallidurans CH34] bhod n/d no σ 70 factor (ECF subfamily), FecI protein bhoe n/d no FecR protein BP2465 BP2465 yes hypothetical protein BP2466 BP2466 yes hypothetical protein BP2467 BP2467 no hypothetical protein vrg-6 BP2468 yes B. pertussis Bvg-repressed gene of unknown function BP2469 BP2469 yes hypothetical protein BP2470 BP2470 yes seryl-trna synthetase BP2471 BP2471 yes conserved hypothetical protein BP2472 BP2472 yes putative exported protein ftsk BP2473 yes putative cell division protein trxb BP2474 yes thioredoxin reductase BP2475 BP2475 yes hypothetical protein BP2476 BP2476 yes putative membrane transport protein IS481 3 BP2477 no transposase for IS481 element BP2478 BP2478 yes putative membrane transport protein BP2479 BP2479 yes putative integral membrane protein kdpa BP2480 yes potassium-transporting ATPase A chain kdpb BP2481 yes potassium-transporting ATPase B chain kdpc BP2482 yes potassium-transporting ATPase C chain kdpd BP2483 yes two component sensor protein kdpe BP2484 yes two component system transcriptional regulatory protein BP2486 BP2486 no putative exported protein BP2487 BP2487 no hypothetical protein icd, icda, icde BP2488 yes isocitrate dehydrogenase [NADP] BP2489 BP2489 yes conserved hypothetical protein BP2490 BP2490 no putative cytochrome 86

87 Acquisition of Iron-Uptake Genes Gene name B. pertussis ORF B. avium1 Gene product BP2490 BP2490 no putative cytochrome BP2491 BP2491 no putative cytochrome BP2493 BP2493 yes putative ATP-binding protein BP2494 BP2494 yes conserved hypothetical protein BP2495 BP2495 no conserved hypothetical protein BP2496 BP2496 yes hypothetical protein BP2497 BP2497 yes putative zinc protease dnaj BP2498 yes molecular chaperone dnak BP2499 yes molecular chaperone ¹Orthologue in the genome of B.avium identified by BLASTN ²Homologue found outside the B. avium IUI syntenic region. 3 Variably present among B. holmesii strains 5 Background-subtracted Cy5/Cy3 ratios were averaged for replicate probes. Because most of the probes only had signal in the reference channel for the B. holmesii hybridizations, data could not be normalized by setting the mean Cy5/Cy3 ratio, or the mode of the ratios for detected genes, equal to 1. Instead, normalization was achieved by calculating the mean background-subtracted Cy5/Cy3 ratio for 16 probes within the IUI that were verified by sequencing to be at least 99% identical to the B. holmesii genome, then dividing the background-subtracted Cy5/Cy3 ratio for each probe by this value. pcr and dna sequencing methodology PCR primer pairs were designed using Primer3 11 and Kodon 2.5 (Applied Maths, Sint-Martens-Latem, Belgium). PCR products were purified prior to sequencing using the QIAquick PCR purification Kit (Qiagen, Valencia, CA), or by ExoSAP-IT (USB Corporation, Cleveland, OH), according to the manufacturer s instructions. All sequencing was performed using standard dye-terminator chemistry. Unless otherwise indicated, sequencing was performed directly from PCR products using one of the amplification primers as the sequencing primer. DNA sequence data were analyzed using Kodon software package version 2.5 (Applied Maths, Sint-Martens-Latem, Belgium) and Sequencher version 4.2 (Gene Codes, Ann Arbor, MI). All amplification and sequencing primers used in this study are listed in Table 3. organization of iui Primers were designed, based on the B. pertussis Tohama I sequence, to amplify overlapping 5-10 kb DNA fragments of IUI. PCR reactions were carried out on all B. holmesii isolates and Tohama I. PCR samples were analyzed by agarose gel electrophoresis to compare the fragment sizes. If the size of the PCR amplicons was similar to Tohama I, and the presence of these genes was confirmed by CGH, the ORF organization of that particular amplicon was assumed to be similar between Tohama I and the tested B. holmesii strain. It should be noted that small insertions or deletions, or point mutations resulting in premature stop codons cannot be detected by CGH or comparison of PCR fragment sizes by agarose gel 87

88 Chapter 5 5 electrophoresis. Therefore, the possibility remains that some of the genes in IUI are actually pseudogenes. A total of 21 genes in IUI were partially sequenced from three B. holmesii isolates. Primer pairs used to amplify and sequence these genes were the same as those used to amplify the corresponding microarray probes. Mapping of IUI in B. holmesii by PCR identified a 4.8 kb insert in all B. holmesii strains examined. The nucleotide sequence of this DNA insert was determined by genome walking inwards from the adjacent genes. In order to assess the organization of the BB3888 homologue in B. pertussis and B. holmesii, PCR primers were designed in BB3888 that span the IS481 insertion and rearrangement point from B. pertussis Tohama I. determination of sequences flanking iui Nucleotide sequence data adjacent to the 5 breakpoint of IUI was obtained by PCR using one primer inside IUI, in BB0794, and one primer outside IUI, in BB0795, which was not detected by CGH. The outside primer was designed in a region that is identical between all four sequenced Bordetella genomes as assessed by multiple sequence alignment with ClustalW. To obtain nucleotide sequences adjacent to the 3 breakpoint of IUI, the TOPO Walker Kit (Invitrogen) was used. Genomic DNA from isolate B2768 was digested with the restriction enzyme Sph I, and concentrated by ethanol precipitation. The adaptor supplied in the kit was ligated to the restriction fragments according to the manufacturer s instructions. Primer extension was performed using a gene-specific primer designed to hybridize to the 5 region of BP2499. Sequence data were obtained for 555 nucleotides downstream of BP2499. To determine the exact location of the breakpoint, PCR was performed using one primer in the 3 region of BP2499, and one primer in the region downstream of BP2499, and the PCR product was sequenced by genome walking. phylogenetic analysis PCR primers for the phylogenetic analysis were designed to hybridize to conserved regions of the atpd, rpob, tuf and rnpb genes, as determined by multiple sequence alignment of B. bronchiseptica RB50, B. pertussis Tohama I, B. parapertussis 12822, and B. avium 197N sequences with ClustalW 12 (Table 3). Amplification of the expected products was confirmed in each of the four genomes from which the primers were designed. Most primer pairs also amplified a product of similar size from all seven B. holmesii strains tested, as well as single isolates of the related species, B. hinzii, B. trematum, B. petrii, and Achromobacter xylosoxidans. In cases where PCR yielded a product from all strains examined, the nucleotide sequences of these PCR products were determined. Concatenated sequences of atpd, rpob, tuf and rnpb genes were aligned using ClustalW 12 and used to construct trees with the NEIGHBOR program of the PHYLIP suite, which was run with the only aligned 88

89 Table 3. Characteristics of primers and probes used in this study. Acquisition of Iron-Uptake Genes Purpose and target1 Primer name Sequence (5-3 ) Purpose Sequencing genes in the IUI BP BP0789 intergenic region BP BP0789 IR1 - F GTGACTATCCGAAGCCGGT A, S BP BP0789 IR1 - R GCTGGAGGTCGAAATGGAAG A, S BP BP2480 intergenic region BP BP2480 IR2 - F CGGAACATTTACCCCGTTTT A, S BP BP2480 IR2 - R ATTTCTCCGGATTGAACAGC A, S BP0787 BP F ATATTCTCGGTGTTCGGCAA A, S BP R CTTCACATCTAGGTCGGCGT A, S BP0792 BP F CCATCCACGACAGCATCAT A, S BP R CATGCCATCACCACCCAG A, S BP0794 BP F AAAAATCCGAAATCGTCGC A, S BP R CCGAGTTTTTCGATCAGTGC A, S BP2452 BP F ACCTGGCCTCCGAAGAGTAT A, S BP R GGAACACCAGCTTGTCGG A, S BP2456 BP F TAATTACGCCATTGACCACG A, S BP R GTGGATGTCCATCAAGGGTC A, S BP2457 BP F TGGGCATGCATCTTCTCAT A, S BP R GCGTGCAGAAGGCAAGACT A, S BP2458 BP F TGGTTGAGACGGAACTGATG A, S BP R CGATAGGGTTGGGCAGATT A, S BP2462 BP F GCTTTATTCACCTGCGGATT A, S BP R CTCGATAAATGCTGCAACCA A, S BP2463 BP F CTCTACACCACGTACCGCCT A, S BP R CTGGCTGTAGAAGCCGATCT A, S BP2465 BP F ACCAGCGACGACCTGTGC A, S BP R ATCAGGTGCAGGCGATTCTT A, S BP2468 BP F AAAAAGTGGTTCGTTGCTGC A, S BP R ATGGCCCTTGTAGTAGCGG A, S BP2469 BP F CTGGTAAGAAACCTGGCCC A, S BP R CGCTTTTGGCAGGTAATCTC A, S BP2470 BP F CCAAGACCTACGACCTGGAG A, S BP R AGGTTCGAGAACGGTCAGG A, S BP2472 BP F CAGCTGAGCCAGGCGTTT A, S BP R GGTGAACTGGAATTCGGAGG A, S BP2476 BP F GAAATCATCGCCACCAGC A, S BP R GAACACGTTCATGACCACCA A, S BP2482 BP F CCAGTCGTTCACCGATCC A, S BP R GTTGAGGGCAAGCACATTG A, S BP2486 BP F GCGAACCCCACAATGATTT A, S BP R ACCAGCGTGGCACTGTAGAT A, S BP2491 BP F CGTGACAAGGTGTCGATGTG A, S BP R AGATGAGTAGTAGGCCGCCA A, S 5 Real-time RT-PCR BP2456 (alca) AlcA-fw GGATCTGGGCTTCTGCTGC A AlcA-rev CGCGGTGGATGTCCATCAA A AlcA-FL CATCGAGACACGAACCGCCTTGC-F H AlcA-LC GGAGTTCTCTCCACCAGCAGACGG-L H BP2463 (faua) FauA-fw CTGACGACCAGCGTGGAG A FauA-as CGGTACACATGTTTCATGAGATAGC A FauA-FL GCAGGATACCGAAGCCACCACCTA-F H FauA-LC TTCGTGGACCTCACGCACCGC-L H BP0015 (rpob) RpoB-se CCCGAAGACTTCCTCTTTGGTC A RpoB-rev TCGTAGGACTCTTCGCTGTAGAA A 89

90 Chapter 5 Purpose and target1 Primer name Sequence (5-3 ) Purpose RpoB-FL ATGCCAAGGTGCTGGATCTGCAG-F H RpoB-LC CACTCTACACCAACGATCTGGAC- CGC-L H Southern blot hybridization bhoa bhoa-1 B-CGCAGGGACAAGAACCAGTGC H 16S rrna (B. pertussis, B. holmesii) 16S-BP-BH-2 B-AACGGCACGGGCTAATATCCT- GTG H 5 Phylogenetic analysis BP3288 (atpd) pan-bord_atpd_5 -for GCCGTGGTGGATATTCAGTT A, S pan-bord_atpd_5 -rev CCATCATGTTGACGGTCTTG A, S BP0015 (rpob) pan-bord_rpob_1-for AAAGCGCATCCGCAAAAG A, S pan-bord_rpob_1-rev GAAGAACAGCACGTCCTTGG A, S pan-bord_rpob_2-for GAAGGCCATCGGCATGA A, S pan-bord_rpob_2-rev GAGATCGGCTTGGAGTTGAT A, S pan-bord_rpob_3-for GATCGAAACGCCGGAAG A, S pan-bord_rpob_3-rev GGCGTGAGCTGGGTTTC A, S BP0007 (tuf) pan-bord_tuf_5 -for GAACGTGGGTACGATTGGTC A, S pan-bord_tuf_5 -rev CTTCACGATCGGCGTGTC A, S pan-bord_tuf_3 -for GACACGCCGATCGTGAAG A, S pan-bord_tuf_3 -rev TAGAACTGCGGACGATAGCC A, S rnpb pan-bord_rnpb-for AGGAACAGGGCCACAGAGAC A, S pan-bord_rnpb-rev GCAGATCTATAGGCCGGATTC A, S Screening for IS481 elements BP BP2450 BB f CTTCAGCCGCCTGTTCTG A,S BB r CATGACCCGGTCGTCTTC A,S BP2453-BP2452 IS out GGCTTACGCTCACACCTACC A BP2452-screen-b TGAGGGTTTCCTTGGATTTG A BP2477-BP2478 IS out see above A BP2478-screen CGATTATCGTGGTGTCGTTG A BP2485-BP2484 IS out see above A BP-kdpE-screen GCTACCTGCTGACGGAAATC A BP2492-BP2493 IS out see above A BP2493-screen ATGGTCTTGCGGCAATTATC A Mapping genomic island BP0790-BP0794 BP F see above A BP R see above A BP0790-BP2450 BP BR GGTGACGTCGATGATGCGCCC A BP CR GCACCGCGAACAGGATGGTCG A BP2450-BP2452 BP BF GACGGAGAAGCACCAGGCC A BP F see above A BP2452-BP2457 BP R see above A BP R see above A BP2456-BP2458 BP F see above A BP R see above A BP2458-BP2463 BP F see above A BP R see above A BP2463-BP2465 BP F see above A BP R see above A BP2465-BP2472 BP F see above A BP F see above A BP2472-BP2476 BP R see above A BP R see above A BP2475-BP2479 BP F see above A BP F see above A 90

91 Acquisition of Iron-Uptake Genes Purpose and target1 Primer name Sequence (5-3 ) Purpose BP2475-BP2479 BP F see above A BP F see above A BP2479-BP2482 BP R see above A BP R see above A BP2482-BP2486 BP BF TGGCGCTGGTCAGCAAAGG A BP BR TGGTCTATGGACTGGGCGGG A BP2486-BP2494 BP R see above A BP R see above A BP2493-BP2499 BP F see above A BP F see above A Screening and sequencing bhoabcde BP BP2465 BP F see above A,S BP R see above A,S faua-3 -out AGGTCGAGGGGATAGACCTG A Bho-specific-out CTGGCGAGTCGAGTACAACA A mar-bp2465-intergenic ACCTACCCGCCCCTGTGT A Bho-specific-out see above A BP SEQ1 GGCGCTCAACGCGATGTTC S BP SEQ2 CCGCCCCTGTGTGCAAAATAA S BP SEQ3 TCGCTTGTGATTTGCTTGCCA S BP SEQ4 GAGCAAATCATCGGCGTGCTC S BP SEQ5 CTACACTCGCGAATGCCTGGC S BP SEQ6 GCCGCATCTGGAGACCCAAG S BP SEQ7 AAGACGAAGGCCAGGCCCA S BP SEQ1 CTGCACCTGGCCATTGCTGTT S BP SEQ2 GCGGGACAGGAAATCGACCA S BP SEQ3 CCACGATGACCGCATGCTG S BP SEQ4 CTGATGAAGGAGGCGAACGCTT S BP SEQ5 TGCCAAAACCCGCAAGGAAC S BP SEQ6 AGCAGGCCTTCGACATTGCCT S BP SEQ7 TCTCTCCAGCGCCCGACTG S BP SEQ8 CCTTGCGGCAGGTCATTGC S BP SEQ9 CACGCCCCTTTGTGGTGCTTA S 5 Determining flanking sequences BP BP0795 rpso-screen1 GACGCATGTCCGTAGAGGTC A,S pnp-screen2 GCGGTACTCGCCCATCAG A,S BP BP2500 BP2499-GSP1 CATCTTGCGCAGCACTTCGG A,S BP flank-F CGCTATGGCAATCCGTCGGT A,S BP2499-GSP2 GCCAGCTTCTTGCCGCGCA A BP2499-GSP3 TGTCGGCCTTGACGATCGAGT A BP2499-A1 TTCCACCTTGGCGTCGATCTC A,S BP2499-B1 CGGCGTTGGTCGTGGTCTC A,S BP2499-B2 CGTCAAGCGCCTCATCGGT S BP2498-A1 GAAGCCTCGAACTGGCGCA A,S BP2498-B1 GATGTACGCCGACATGCAGGC A,S Broad-range ribosomal RNA PCR 16S rdna 8F (broad-range) AGAGTTTGATCCTGGCTCAG A 806R (broad-range) GGACTACCAGGGTATCTAAT A 23S rdna MS37 (broad-range) AGGATGTTGGCTTAGAAGCAGCCA A MS38 (broad-range) CCCGACAAGGAATTTCGCTACCTTA A Bb_16S-23S_1515-for CGGCTGGATCACCTCCTTTA A,S Bb_16S-23S_1751-rev CTCTCCCAGCTGAGCTACAC A,S Bb_16S-23S_1780-for GTTCGATCCCGTTCACCTC A,S 91

92 Chapter 5 5 Purpose and target1 Primer name Sequence (5-3 ) Purpose Bb_16S-23S_1949-rev ACGTTGTGCTTCTTCCAAAT A,S Bb_16S-23S_1928-for CAATTTGGAAGAAGCACAACG A,S Bb_16S-23S_2166-rev GATCGCCAAGGCATCCAC A,S Abbreviations: A, amplification; S, sequencing; H, hybridization; F, fluorescein; L, LC Red 640; B, biotin ¹ORF numbers as annotated by the Sanger Centre sequencing team positions option (Felsenstein, J PHYLIP (Phylogeny Inference Package) version 3.6a3. Distributed by the author. Department of Genome Sciences, University of Washington, Seattle). The unrooted phylogeny was drawn using Phylodendron ( edu/treeapp/treeprint-form.html). broad-range rdna pcr B. holmesii 16S rdna was amplified by broad-range PCR using the 8F and 806R primers 13, and 23S rdna was amplified using the MS37 and MS38 primers 14. PCR products were cloned using the Topo TA Cloning Kit (Invitrogen, Carlsbad, CA). Twelve clones were picked for each strain, and plasmids were purified using the Wizard miniprep kit (Promega, Madison, WI) and sequenced using M13 forward and reverse primers. southern blot hybridization The genomic DNA of B. holmesii, B. pertussis and B. avium isolates was digested with the restriction enzymes Cla I and Nco I. Southern blotting and hybridization with biotinlabeled oligonucleotide probes was performed essentially as described by Schouls et al. 15. Table 3 shows a list of the probes that were hybridized to the genomes of the Bordetella isolates. transcription of alcaligin genes B. holmesii strains were grown to mid-late logarithmic phase (OD , approximately equivalent to cells per ml) in iron-depleted or iron-replete medium (see above). Total RNA was isolated using the Qiagen RNeasy Kit (Qiagen Inc, Valencia, CA), according to the manufacturer s instructions for the isolation of total RNA from bacteria. For each experiment several controls were included, a DNAse treatment, a RNAse treatment and a DNAse plus RNAse treatment. RNA was reverse transcribed with 40 pmol of antisense gene-specific primers and heated at 94 C for 5 min. Real-time PCR experiments were performed on the LightCycler (Roche) using the LightCycler DNA Master Hybridization Probe kit (Roche). Oligonucleotide primers and hybridization probes were designed by TIB MolBiol (Berlin, Germany) for the genes alca, faua and rpob (see Table 3). rpob, which encodes the DNA-directed RNA polymerase beta chain, was presumed to be unregulated and was used as an internal reference to compare expression induction. PCR was performed in 20-μl reaction volumes, containing 2 μl of LightCycler DNA Master HybProbe, 0.32 μl TaqStart antibody (1.1 μg/μl, BD 92

93 Acquisition of Iron-Uptake Genes Biosciences, Heidelberg, Germany), 1 M Betain (Sigma-Aldrich Chemie Zwijndrecht, The Netherlands), 3 mm MgCl 2, 10 pmol of each forward and reverse primer and 4 pmol of the FL530 and of the LC640 hybridization probes. LightCycler RNase free water was added to bring the volume up to 18 μl. For template, 2 μl of cdna was added to the mixture. Each run consisted of an initial denaturation of 2 min at 95 C to activate the polymerase, followed by 45 cycles of 95 C for 10 s, 55 C for 10 s and 72 C for 20 s. Melting curve analysis was used to analyze and optimize the PCR conditions. Real-time PCR experiments were analyzed using LightCycler software version 4.0. alca and faua transcript levels were compared to rpob transcript levels in the iron-depleted and the non-depleted samples, and this was used as a measure to determine the induction of expression. 5 detection of alcaligin Liquid chromatography and mass spectrometry (LC/MS) was used to determine whether alcaligin was produced by the B. holmesii strains. LC/MS: Samples were analyzed by nanoscale reversed phase-liquid chromatography (HP1100 LC system, Hewlett Packard Gmbh, Waldbronn, Germany) coupled to electrospray mass spectrometry (LCQ Classic ion trap), essentially as described by Meiring et al. 16. Briefly, 10 μl of culture supernatant was injected on a trapping column packed with AQUA C18 (5 μm, Phenomenex) at a flow rate of 5 μl/min and by using 100% solvent A (0.1M acetic acid in water) as eluent for 5 min. Analytes were subsequently separated by reversed phase chromatography using a 44-cm long x 50 μm inner diameter analytical column with Pepmap (5 μm; Dionex) at a flow rate of 125 nl/min. A linear gradient was started from 10% solvent B (0.1M acetic acid in acetonitrile) to 60% solvent B in 35 min. Next, the columns were equilibrated in 100% solvent A for 10 min. Analytes were measured in the MS1 mode (m/z ) to determine the molecular weight and retention time. A second LC/MS measurement was performed to obtain detailed structural information by collision-induced dissociation of the MH+-ion (406 Da). The collision energy was set to 35%. 93

94 Chapter 5 results 5 comparative genome hybridization The genomes of 12 epidemiologically unrelated B. holmesii strains were hybridized to a microarray representing the nearly complete gene complement of B. pertussis Tohama I, B. parapertussis 12822, and B. bronchiseptica RB Although most microarray probes failed to hybridize significantly to the B. holmesii genomic DNA, 1.2% to 1.6% of the probes hybridized as strongly to the B. holmesii genomes as they did to the reference sample (Figure 1A; microarray data have been deposited at ArrayExpress, accession number E-TABM- 55). Most of these positive probes mapped to two contiguous regions in the Tohama I genome: BP0787 BP0794 and BP2450 BP2499 (Figure 1B). In the genomes of B. bronchiseptica RB50 and B. parapertussis 12822, the orthologous sequences are present in a single contiguous region, suggesting that the region has been rearranged in B. pertussis Tohama I. The rearrangement in the Tohama I genome appears to have been mediated by recombination within an IS481 element located in the gene for a putative membrane protein encoded by BB3888 and BPP3438 in B. bronchiseptica and B. parapertussis, respectively. In B. pertussis Tohama I, the orthologous gene is split into two ORFs, BP0787 and BP2450 with remnants of IS481 adjacent to both ORFs (Figure 2A). Hybridization of B. holmesii genomic DNA to a probe for IS481 was consistent with previous work indicating the presence of eight IS481 copies in the B. holmesii genome 7. The genomic region shared by the classical bordetellae and B. holmesii contained a virulenceassociated locus comprising alcabcders, encoding the alcaligin biosynthetic pathway (AlcABCDE), the exporter for alcaligin (AlcS), a transcriptional activator of the locus (AlcR) and the alcaligin uptake receptor (FauA) Alcaligin is a siderophore produced by B. pertussis, B. bronchiseptica, and Alcaligenes denitrificans 22 that scavenges free iron from the extracellular milieu. It is important for the acquisition of iron in the eukaryotic host environment in which free iron is sequestered by host factors. Accordingly, we designated this genomic fragment the B. holmesii iron-uptake island (IUI). No other genes in the Tohama I IUI region had sequence features suggesting a role in virulence, with the possible exception of the B. pertussis virulence-repressed gene, vrg-6, for which a function has not been determined 23 (Table 2). molecular characterization of iui in b. holmesii Partial nucleotide sequences of 21 genes in the IUI that were indicated to be present by CGH were obtained from B. holmesii isolates B0436, B1850 and B1852 after PCR amplification using B. pertussis primer pairs (submitted to Genbank). All of these sequences were over 99.3% similar to the B. pertussis sequence, with the exception of BP0794 (94.1%), located at the putative right end of IUI. In B. pertussis Tohama I, the BB3888 orthologue is split into two partial ORFs, BP0787 and 94

95 Acquisition of Iron-Uptake Genes A. B. log 2 (B. holmesii intensity/reference intensity) BP0001 B holmesii BP Tohama B0436 B1855 B0437 B2739 B2738 B1851 B1853 B1850 B1854 B2767 B1852 B2768 BP0783 BP0787 BP0794 BP0798 BP2447 BP alcabcders faua mar intergenic region BP2465 vrg-6 BP2475 BP2476 kdpabcde BP2499 BP2502 IS481 IS1001 insertion IS1002 IS1663 elements BB Figure 1A. CGH of 12 B. holmesii isolates to a microarray comprising the genomes of B. pertussis Tohama, B. parapertussis and B. bronchiseptica RB50. The running average (window = 3) of the mean log 2 (Cy5/Cy3) of 12 B. holmesii genomes is plotted on the X-axis. Microarray probes are arranged on the Y-axis in B. pertussis Tohama genome order. B. Probes that hybridized to the B. holmesii genome with comparable strength to the reference, and adjacent non-hybridizing probes, are shown in detail for individual B. holmesii strains and for B. pertussis Tohama. A selection of probes, representing insertion sequence elements are also shown. Strain numbers are indicated above the columns. Each row represents one probe in B. pertussis Tohama gene order. ORF and gene designations are shown for a selection of probes. The relative hybridization value (log 2 (Cy5/Cy3)) is indicated by the yellow-black-blue color scale. Missing data are represented in grey. A color version of this figure is available in the appendix. BP2450 (Figure 2A). PCR amplification using one primer in BP0787 and one in BP2450 yielded a product from all B. holmesii strains, but it was approximately 1 kb longer than the product from B. bronchiseptica RB50. Nucleotide sequencing of this product confirmed that both halves of the gene were adjacent in B. holmesii, but, unlike the intact RB50 gene, were interrupted by an IS481 element at the same position as the Tohama I breakpoint (Figure 2A). Screening of 45 B. pertussis strains by PCR with this primer pair identified only 95

96 Chapter 5 5 one strain, 18323, that carried the same IS481-inactivated allele as B. holmesii (submitted to Genbank). The genomic organization of IUI in the B. holmesii isolates was further characterized by PCR analysis and DNA sequencing. PCR primers were designed to amplify 14 overlapping fragments, covering the B. pertussis Tohama I sequence contained in the B. holmesii IUI. PCR screening was carried out on 12 B. holmesii isolates and B. pertussis Tohama I, and the products were compared by agarose gel electrophoresis (Table 4). In most cases PCR amplicons from B. holmesii and B. pertussis were identical in size, suggesting that the genomic organization was conserved between B. holmesii and B. pertussis Tohama I. However, size differences were observed in four PCR fragments. In the case of two polymorphic fragments, which were approximately 1 kb smaller in B. holmesii, Table 4. Mapping of the IUI by overlapping PCR fragments. sequencing indicated that the IS481 elements BP2485 and BP2492 were missing from the B. holmesii IUI. Similar to B. holmesii, B. pertussis also lacked these two IS481 elements. A third IS481 element, BP2477, was variably present among the B. holmesii strains. PCR amplification of a genomic region, downstream of the alc operon revealed a 4.8 kb PCR Forward primer Reverse primer PCR product size (nt) BH BP 1 BP F BP R BP BR BP CR ~5000 a no fragment 3 BP BF BP F 3160 no fragment 4 BP F BP R BP F BP R BP F BP R BP F BP R BP F BP F BP R BP R BP F BP F BP R BP R 5558 b BP BF BP BR ~ BP R BP R ~ BP F BP F a Expected size: 3,972 kb b PCR amplicon not detected in B. holmesii isolate B2767 Abbreviations: BH, B. holmesii; BP, B. pertussis insertion in the B. holmesii IUI (Figure 2B). Nucleotide sequencing of this region indicated that the left terminus of the insert was located 237 nucleotides downstream of the stop codon of BP2464, and its right terminus in BP2465, which has been partially deleted (submitted to Genbank). A BLASTX search of the 4.8 kb B.holmesii sequence against the GenBank non-redundant protein database identified five putative genes with highly significant hits (E < 1x10-21 ) to known proteins, which were designated bhoabcde (Table 5). The first putative gene, bhoa, is predicted to encode an IS3-family transposase. A frameshift was detected in bhoa, resulting in two overlapping ORFs (orfa and orfb). The presence of two out-of-frame overlapping ORFs has been previously described for IS3 transposases 24. The 3 ORF of this gene contains a second frameshift mutation that may render the putative transposase non- 96

97 Acquisition of Iron-Uptake Genes functional. The top GenBank BLASTN hit to bhoa was BB2492, which encodes a singlecopy transposase pseudogene in B. bronchiseptica RB Southern blot hybridization with a bhoa-specific probe showed that this sequence was present in copies in the genome of B. holmesii (data not shown). The ORFs bhob and bhoc are homologous to adjacent genes (RmetDRAFT_1101 and RmetDRAFT_1100, respectively) from the Ralstonia metallidurans CH34 genome (GenBank accession NZ_ AAAI ). These genes encode a hypothetical protein with a Bug domain and a D-isomer specific 2-hydroxyacid dehydrogenase, respectively. bhod encodes a putative extracytoplasmic function (ECF) sigma factor, and bhoe encodes a homologue of FecR/PupR proteins (Table 1). The GC-content of the insert is 62%, similar to the average GC-content of B. holmesii ( %), but lower than that of B. pertussis (67.7%) 6,25. 5 Table 5. Homologies of putative ORFs in the DNA insertion in B. holmesii as determined by TBLASTX. Gene Orientation Homologies Species E-value bhoa1 orfa - Putative IS3 family transposases, orfa many 6e-27 orfb - Putative IS3 family transposases, orfb many 4e-31 bhob + Uncharacterized protein UPF0065 Ralstonia metallidurans 8e-72 bhoc + Putative dehydrogenases Ralstonia metallidurans & many other 3e-77 bhod + ECF σ 70 factors, FecI many 1e-21 bhoe + FecR many 2e-22 ¹Putative pseudogene due to two frameshifts The IUI sequence was also compared to the unpublished complete genome sequence of B. avium 197N (produced by the B. avium Sequencing Group at the Sanger Institute and obtained from ftp://ftp.sanger.ac.uk/pub/pathogens/ba/). Pairwise comparison identified a region in the B. avium genome syntenic to the IUI region of the other Bordetella genomes (Figure 2A). The region of synteny extends beyond the ends of IUI as defined by CGH, to include genes that were not detected by B. holmesii CGH. Sequences near the putative left and right ends of IUI have higher sequence identity to the B. avium genome (at least 88%) than sequences in the middle. Although gene order in the syntenic region is conserved, the B. avium genome shows no detectable homology to the alcabcders, faua, bhoabcde and IS481 loci (Figure 2A, Table 2). To determine the left breakpoint of IUI in B. holmesii, a PCR primer pair was designed with a forward primer in the B. pertussis BP0794 (rpso) gene, which was detected in B. holmesii by CGH, and a reverse primer in a region, completely conserved in the classical Bordetella and B. avium genomes, of the adjacent undetected gene, BP0795 (pnp). PCR amplification with this primer pair yielded a 1.4 kb product from B. pertussis, B. avium, and B. holmesii. Sequencing of the B. holmesii product (submitted to Genbank) and comparison to the B. pertussis sequence by BLASTN indicated that the BP0794 sequence is identical to B. 97

98 Chapter 5 5 A. B. avium BP2499 BP2477 BP0794 BP0787/2450 BP2453 B. holmesii * BP2485 BP2492 BP2499 BP2477 BP2450 BP2453 BP0794 BP0787 B. pertussis B. bronchiseptica 5 kb Orthologs not found in all species Orf replaced by bhoabcde Conserved IUI-flanking ORFs Variably present in B. holmesii isolates * Alcaligin operon B. holmesii insertion IS481 elements BP0787/2450 orthologs Orthologs found in all species B. BP2465 Fe-alcaligin receptor BhoA FecIR marc alcabcde regulation + alcaligin export alcaligin biosynthesis BP2455 orfb orfa bhob bhoc bhod bhoe alca alcb alca alcc alcd alce alcr alcs faua Fur binding site σ 70 binding site Figure 2. Comparative analysis of the genomic organization of the iron-uptake island (IUI) in B. avium, B. holmesii, B. pertussis and B. bronchiseptica. A. Representation of the ORF organization of the IUI in B. holmesii and comparison to orthologous regions in the genomes of B. bronchiseptica RB50, B. pertussis Tohama and B. avium 197N. Deletions or insertions between species are indicated by grey surfaces. Dashed lines connect the ORFs at the borders of the orthologous sequences. The ORF composition of B. holmesii IUI was deduced from PCR and CGH data, while the ORF organization of B. avium, B. pertussis and B. bronchiseptica was derived from the published genome sequences. B. Detailed organization of the alcaligin locus and putative ORFs in the 4.8 kb DNA insertion detected in B. holmesii IUI. Arrows above ORFs indicate the putative function of these ORFs. A color version of this figure is available in the appendix. 98

99 Acquisition of Iron-Uptake Genes pertussis for the first 93 nt, but slightly divergent downstream, placing the IUI breakpoint at or near codon 31 of BP0794. The reading frames of BP0794 and BP0795 are intact within the region spanned by this sequence, with 98% and 91% amino acid identity to the B. pertussis protein sequences, respectively. To determine the right breakpoint of IUI, the TOPO Walker kit was used. Sequence data were obtained for the 5 region of BP2499, extending 555 nucleotides downstream of BP2499 (dnak) (submitted to Genbank). BLASTN indicated that the B. holmesii sequences downstream of BP2499 were orthologous to B. pertussis BP2500 and BP2501. The breakpoint of IUI was expected to be located between the array probes BP2499 (at the 3 end of BP2499) and BP2500 (at the 3 end of BP2500). Therefore, a PCR primer pair was designed with a forward primer in the 3 array probe region of BP2499 and the reverse primer in the B. holmesii BP2500 sequence. Sequencing of this PCR product indicated 99% sequence identity to B. pertussis in the 3 region of BP2499, but only 90% identity to B. pertussis in the the 5 region of BP2499 (up until codon 276) (submitted to Genbank). This places the right breakpoint approximately at codon 276 of BP2499. The sequence in the immediate vicinity of the breakpoint was 91% identical to B. avium. Conservation of gene order around the breakpoints of IUI among the classical and nonclassical Bordetella genomes suggests that the transferred island may have integrated into the orthologous location in the B. holmesii genome by a homologous recombination event. Furthermore, no evidence was found at either end of IUI for the presence of phage, plasmid, or IS sequences, indicating that integration of IUI into the genome was not mediated by a mobile DNA element. 5 alcaligin expression and detection To determine whether the IUI-encoded alcaligin biosynthesis, export and uptake locus is expressed in B. holmesii, transcript levels of alca and faua were measured by quantitative RT- PCR. Because this locus is repressed in the presence of free iron by the Fur transcriptional repressor in B. pertussis and B. bronchiseptica 26, expression of these genes was determined under iron-depleted and iron-replete conditions. The transcript abundance of both alca and faua was 10-fold higher in the iron-depleted sample compared to the non-depleted sample (data not shown), indicating that the locus is expressed and iron-regulated. To determine if the expression of these genes resulted in the synthesis and secretion of alcaligin, we employed nanoscale capillary liquid chromatography-mass spectrometry (LC-MS) to analyze the supernatants of iron-starved B. holmesii strains for the presence of alcaligin 16,22. This approach detected a compound in the iron-depleted supernatant, but not in the iron-replete supernatant, with m/z 405 (M + H) + (Figure 3), corresponding to the mass of desferri-alcaligin as described by Moore et al. 22. MS fragmentation analysis detected two fragment ions with m/z 283 and 387, corresponding to previously described alcaligin fragment ions

100 Chapter 5 A. Relative Abundance Fe Relative Abundance Time (min) 100 +Fe Time (min) B. a ab N a b b 283 OH O 100 OH O NH Relative Abundance HN b O O HO OH N a Alcaligin m/z=405 -H 2 O m/z Figure 3. LC/MS spectra of B. holmesii supernatants cultured in iron-depleted and iron-replete medium. A. LC/MS spectra of iron-depleted and iron-replete B. holmesii supernatants, depicting ions with m/z 405 (corresponding to alcaligin), with retention times between 0 and 45 min. B. Fragment ions detected after collisional activation (35% energy) of the peak from (A) with retention time t=36.99 min. After measurement of the reference standard, the calibration deviated approximately 1.5 mass units, explaining the difference in m/z values compared to the fragment ions as detected by 22. Nomenclature of fragment ions is according to 22. phylogeny of b. holmesii In contrast to 16S rrna gene sequencing data that suggested a close phylogenetic relationship between B. pertussis and B. holmesii, our CGH data suggested substantial sequence divergence between the two species. To determine the phylogenetic position of B. holmesii within the 100

101 Acquisition of Iron-Uptake Genes Burkholderia pseudomallei Figure 4. Neighbor-joining phylogeny of Bordetella and related β-proteobacteria. The unrooted tree is based on 3,559 fully informative nucleotides from an alignment of concatenated sequences of atpd, rpob, tuf and rnpb from B. holmesii, B. pertussis, B. parapertussis, B. bronchiseptica, B. avium, B. hinzii, B. trematum, B. petrii, Achromobacter xylosoxidans, and Burkholderia pseudomallei. Bootstrapping values greater than 50% (based on 1000 resamplings) are indicated at branches. B. petrii 89 B. bronchiseptica B. parapertussis B. pertussis Achromobacter xylosoxidans B. hinzii B. trematum B. avium B. holmesii 0.1 Bordetella genus, conserved regions of the atpd, rpob, tuf and rnpb genes, which have been used for multilocus sequence typing of other organisms, were sequenced from seven B. holmesii strains and from representative isolates of B. hinzii, B. trematum, B. petrii, and the closely related β-proteobacterial species, Achromobacter xylosoxidans (submitted to GenBank). Orthologous sequences from the classical Bordetella species, B. avium, and another β-proteobacterial species, Burkholderia pseudomallei, were obtained from available genome sequence data. A neighbor-joining tree, based on 3,559 fully informative characters in the alignment of concatenated nucleotide sequences of these genes, indicated that B. holmesii is more closely related to B. avium and B. hinzii than to the mammalian bordetellae (Figure 4). The exclusion of B. holmesii from the mammalian Bordetella clade was supported by all individual gene trees. Comparison of atpd, rpob, tuf and rnpb sequences from seven independent B. holmesii strains revealed only two single nucleotide polymorphisms (one synonymous and one non-synonymous) among 3,666 aligned bases, both of which were variant only in Bho29. 5 molecular characterization of the 16s rrna loci in b. holmesii In light of the phylogeny determined above, the near identity of the B. pertussis and B. holmesii 16S rrna genes (99.7%) is anomalous. For comparison, the B. pertussis 16S rrna sequence is 98.5% and 99.2% identical to the 16S rrna sequences of B. avium and B. hinzii, respectively. One possible explanation for this discrepancy is that the 16S rrna gene, like the IUI, was laterally transferred from B. pertussis to B. holmesii. If such a transfer has occurred, it is possible that B. holmesii harbors one or more copies of a divergent native 16S rrna gene in addition to the proposed B. pertussis-derived locus, although the presence of heterogeneous rrna loci within a genome is rather limited 27. No alternate B. 101

102 Chapter 5 B. pertussis/b. holmesii 16S probe Broad-range 16S probe MW Marker B. pertussis (Tohama) B. holmesii (B0436) B. avium (B0021) B. pertussis (Tohama) B. holmesii (B0436) B. avium (B0021) B. pertussis (Tohama) B. holmesii (B0436) B. avium (B0021) B. pertussis (Tohama) B. holmesii (B0436) B. avium (B0021) Cla I Nco I Cla I Nco I 5 9,416 6, ,027 Figure 5. Southern blot hybridizations of B. pertussis Tohama, B. holmesii B0436 and B. avium B0021 with 16S rdna probes. Genomic DNA was hybridized to a B. pertussis-specific probe (left panel) and a broad-range 16S rdna probe (B-16S8F; right panel) (2). For each hybridization experiment, the probe was stripped off the membrane, and the membrane was re-used. Biotinylated DNA markers are in the first lane. holmesii 16S rrna sequences have been reported to date. To determine the number of B. pertussis-like 16S rrna gene copies and search for divergent 16S rrna genes, Southern blot hybridization was performed using 16S rdna probes. A B. pertussis-specific 16S rdna probe that did not hybridize to the B. avium genome detected three copies in the B. holmesii genome (Figure 5). A broad-range 16S rdna probe 15 that hybridized equally well to B. pertussis and B. avium did not detect any additional bands in B. holmesii, suggesting that the only 16S rrna loci are the three B. pertussis-like copies (Figure 5). 16S rrna broad-range PCR was also employed to identify possible variant 16S rrna sequences. Twelve cloned PCR products from each of three B. holmesii strains were sequenced. All were at least 99.5% identical to the B. pertussis 16S rrna, further suggesting that all copies of the 16S rrna in B. holmesii are essentially identical to the B. pertussis gene (submitted to GenBank). No copies of the 16S rrna gene were identified within the boundaries of the IUI as defined above, suggesting that this gene was not transferred in the same recombination event. To further test whether a 16S rrna gene was located near either end of IUI in B. holmesii, PCR amplification was attempted using primers in the 16S rrna gene and in the putative 5 and 3 termini of IUI. PCR amplification was unsuccessful, suggesting that no 102

103 Acquisition of Iron-Uptake Genes 16S rrna genes are in close proximity to IUI. Most of the region between the 16S and 23S rrna genes, including two trna genes, was also amplified and sequenced (submitted to GenBank). This region is more variable among the sequenced bordetellae than the structural rrna genes; for example, B. pertussis is only 96.4% identical to B. bronchiseptica and 72.5% identical to B. avium over the 550 nucleotides examined in this study. However, sequences from seven B. holmesii strains, all of which were identical to each other, were 99.6% identical to B. pertussis, but only 72.2% identical to B. avium. Partial sequence of the 23S rrna gene (B. pertussis bases ) was also determined following broad-range PCR from three B. holmesii strains. Nine sequences (three from each strain) were identical except single-nucleotide differences, possibly due to PCR errors, that were each restricted to a single clone (submitted to GenBank). Over 882 bases the B. holmesii consensus sequence was identical to B. pertussis at 857 positions and to B. avium at 869 positions. For comparison, B. pertussis and B. bronchiseptica vary at only a single nucleotide in this region. These data suggest that this fragment of the 23S rrna gene has not been replaced by a B. pertussis-like sequence, placing the right breakpoint of the proposed gene transfer and recombination event within the first 1000 bases of the 23S rrna gene

104 Chapter 5 discussion 5 evolutionary relationships of b. holmesii to other bordetella species The evolutionary relationship of B. holmesii to other members of the Bordetella genus has been controversial. Although 16S rrna sequencing and clinical criteria placed B. holmesii close to B. pertussis, other evidence, including sequencing of protein coding genes and analysis of cellular fatty acid composition, suggested a more distant evolutionary relationship between these species 4,6,8. In this work, we provide a possible explanation for these discrepancies. Our microarray-based CGH analysis indicated that, with the exception of part of the rrna operon, and a highly conserved genomic island, the B. holmesii genomic sequences diverge considerably from those of the mammalian bordetellae, B. pertussis, B. parapertussis and B. bronchiseptica. Likewise, our multilocus sequence analysis suggested that B. holmesii is phylogenetically more closely related to B. hinzii and B. avium than to the mammalian bordetellae. We propose that lateral transfer of the 16S rrna gene from B. pertussis is the most likely explanation for the presence of a highly similar gene in B. holmesii. This exchange may have occurred in conjunction with transfer of IUI, but failure to identify a 16S rrna gene inside or in close proximity to IUI suggests that it may have been independently transferred from B. pertussis, or that the 16S rrna gene has been transposed after horizontal exchange. Southern blot hybridization and sequencing of individual 16S rrna genes showed that the genome of B. holmesii contained three B. pertussis-like 16S rrna genes. The presence of only B. pertussis-like 16S rrna genes in B. holmesii suggests that putative endogenous copies have either been lost or converted by recombination after acquisition of the B. pertussis-like 16S rrna gene. Relatively low sequence identity between the B. pertussis and B. holmesii 23S rrna genes suggests that the proposed exchange may have involved only the 16S rrna gene and the sequence upstream of the 23S rrna gene, including two trna genes. Only two out of 3,666 nucleotide positions in the housekeeping genes were polymorphic among seven B. holmesii strains. This high degree of sequence conservation among geographically distinct isolates argues for the recent emergence of a clonal B. holmesii population. For comparison, B. pertussis, which diverged and expanded clonally from the last common ancestor of B. bronchiseptica and B. pertussis two million to five million years ago ( 25, Diavatopoulos et al.)), differs from B. bronchiseptica at only three bases in this sequence sample. evidence for transfer of a genomic island from b. pertussis to b. holmesii Comparative genomic hybridization identified a 66 kb DNA region, IUI, which, in contrast to the rest of the B. holmesii genome, was highly conserved in B. pertussis, B. bronchiseptica, and B. parapertussis. This observation could be explained by the transfer to B. holmesii of a 104

105 Acquisition of Iron-Uptake Genes genomic fragment from any of these three species. But, the presence in IUI of IS481 elements, which have only been found in B. pertussis and B. holmesii, argues that a B. pertussis strain was the donor in the putative DNA transfer event. Because the IUI region is rearranged in B. pertussis Tohama I relative to B. holmesii and the other mammalian bordetellae, transfer from this strain to B. holmesii would have required two independent events, which seems unlikely. However, chromosome order is known to be highly variable in B. pertussis 28. One strain, 18323, had a genomic architecture and an IS481 element distribution very similar to those observed in the B. holmesii IUI, suggesting that the B. holmesii IUI may have been derived from an like B. pertussis strain. Several genotyping methods have shown that is genetically distinct from other B. pertussis strains 10,29, but related strains have been isolated from pertussis patients as recently as 1993, indicating that they still circulate in the human population 30. B. pertussis and B. holmesii have both been isolated from the respiratory tract of humans, making the human airway the most likely environment in which transfer of IUI could have occurred. At the level of resolution of CGH and PCR analysis, the genomic composition of IUI was identical, with the exception of a variably present IS481 element, in all B. holmesii isolates examined. This result suggests that IUI was acquired recently, or alternatively, that IUI has been under selective pressure to maintain its genomic organization. A region syntenic to the B. holmesii IUI was detected in the genome of the avian pathogen B. avium (Figure 2A). The region of synteny between B. avium, B. holmesii, and the classical bordetellae extended beyond the boundaries of IUI, suggesting that the backbone of this chromosomal region is conserved across distantly related Bordetella species. This finding, together with the failure to identify signatures of mobile elements (e.g., phage or conjugative transposon genes) at the ends of IUI, suggests that the most likely mechanism for the proposed integration of IUI into the B. holmesii genome is homologous recombination between the laterally transferred IUI and the ancestral B. holmesii genome. The degree of nucleotide sequence similarity between the B. holmesii IUI and the orthologous sequences in B. avium is highest in the vicinity of the left and right insertion breakpoints, indicating that these genes may be more conserved across the Bordetella genus than the average gene. BP0794, located at the left end of IUI, encodes the 30S ribosomal protein S15, which is highly conserved in the Bordetellae. At the right end of IUI, dnak is located, which encodes a chaperone that is also highly conserved across bacterial species. These conserved sequences are proposed to have served as the substrates for the putative double homologous recombination event that replaced the B. holmesii sequence with the transferred B. pertussis fragment. 5 iron-acquisition function conferred by iui Sequestration of free iron by the eukaryotic host creates a hostile environment for bacterial pathogens. Consequently, most, if not all bacterial pathogens have evolved various strategies 105

106 Chapter 5 5 to obtain iron from the host. B. pertussis and B. bronchiseptica possess a number of different iron acquisition systems with specificities for different environmental iron sources, but their key mechanism for scavenging free iron is production of the siderophore, alcaligin. Production of alcaligin by B. bronchiseptica has been shown to be required for maximal virulence in a piglet model of infection 31. In bacteria, expression of iron acquisition genes is negatively regulated by the Fur transcriptional repressor (reviewed in 32. In B. pertussis and B. bronchiseptica, Fur regulates expression of the alc operon, as well as several other iron acquisition loci 26,33. Interestingly, the complete locus encoding alcaligin biosynthesis (alcabcde), export (alcs), uptake (faua), and regulation (alcr), was present in the B. holmesii IUI Reverse transcriptase real-time PCR experiments demonstrated that alca and faua transcription in B. holmesii was induced 10-fold in the absence of iron. Furthermore, detection of alcaligin in the supernatant of iron-limited B. holmesii cultures indicated that the alcaligin biosynthesis and export locus was functional in B. holmesii. Alcaligin production has not been detected in B. avium, and its genome does not appear to encode an alcaligin biosynthesis locus (data not shown), indicating that not all Bordetella species possess the ability to produce this siderophore. Therefore, prior to IUI acquisition, the hypothetical progenitor of B. holmesii may not have been competent to produce alcaligin. Wholesale acquisition of this function by lateral transfer from B. pertussis could have provided B. holmesii with a new, highly efficient iron uptake system, leading to an immediate enhancement of its ability to colonize a eukaryotic host. In many cases, maximal expression of iron-uptake loci requires the activity of a transcriptional activator in addition to de-repression by Fur 34. An example of such a system is the FecIRA regulatory system in Escherichia coli K12, which controls the expression of the ferric citrate transport (fec) locus FecA is an outer membrane protein that responds to environmental signals and transmits these signals to the cytoplasmic membrane protein FecR. FecR in turn transmits this signal to the σ 70 factor, FecI, which then regulates the transcription of fecabcde 35,36. Homologous FecIR regulatory systems (with or without a FecA homologue) have been identified in a large number of bacterial genomes including B. bronchiseptica, B. pertussis and B. avium, in which they control expression of the heme uptake locus The products of the two putative ORFs in the 3 region of the insert, bhod and bhoe, are homologous to ECF sigma factors (σ 70 ) and FecR family proteins, respectively. We hypothesize that the ORFs bhod and bhoe encode a FecIR-like regulatory system. Although we did not identify an obvious FecA-homologue in the insertion, FauA may fulfill this role, as FecIR systems are able to associate with one or more FecA-like partners, sometimes from distal genomic loci 37. Consistent with this model, FauA is highly similar to FpvA, the Pseudomonas aeruginosa ferripyoverdine receptor, which is an established member of a FecIRA system, FpvIRA. Expression of alcaligin in B. bronchiseptica and B. pertussis is assumed to be regulated solely 106

107 Acquisition of Iron-Uptake Genes by Fur and the AraC-like regulator AlcR. Interestingly, we identified a putative Fur-binding site centered 43 nucleotides upstream of the start codon of bhod, suggesting that bhode is Fur-regulated. This FecIR system could, in turn, regulate transcription of the alc operon. Although this has not been described to be the case for B. pertussis or B. bronchiseptica, the possibility that transcriptional regulators besides AlcR may participate in activation of the alc operon cannot be ruled out. In fact, detailed analysis of the B. pertussis region upstream of the alcaligin operon indicated the presence of a putative σ 70 recognition site 75 nucleotides upstream of the transcriptional start site of alca, although it should be mentioned that the typical ECF sigma factor box is located at 35 nucleotides upstream of the start codon, so the possibility remains that the σ 70 recognition site is too far upstream to affect transcription of alcabcde. By enhancing transcription of the alcaligin operons under iron-limiting conditions, BhoDE could further increase the ability of B. holmesii to acquire iron in the host environment. The effects of IUI acquisition on the evolution of virulence and transmission of B. holmesii in humans are unknown, but it is reasonable to propose that the ability to produce alcaligin would improve the colonization rates of B. holmesii. Experimental testing of this hypothesis using B. holmesii mutants awaits the development of an appropriate animal model. B. holmesii was identified as a pathogen in humans relatively recently 6. The first cases concerned immunocompromised patients with septicemia, although it was shown more recently that B. holmesii may also cause pertussis-like disease 3. The results discussed here strongly suggest that the acquisition of B. pertussis DNA, by conferring an increased capacity to scavenge free iron in the host environment, has played a key role in the emergence of B. holmesii and its adaptation to humans

108 Chapter 5 acknowledgements We would like to thank Ir. J. ten Hove and Dr. A. de Jong (NVI, Unit Research and Development) for assistance with LC/MS experiments and analysis. This work was supported by a travel grant from the Netherlands Organization for Scientific Research (NWO)

109 Acquisition of Iron-Uptake Genes reference list 1. Shepard,C.W., Daneshvar,M.I., Kaiser,R.M., Ashford,D.A., Lonsway,D., Patel,J.B., Morey,R. E., Jordan,J.G., Weyant,R.S., Fischer,M. (2004). Bordetella holmesii bacteremia: a newly recognized clinical entity among asplenic patients. Clin.Infect. Dis. 38, Russell,F.M., Davis,J.M., Whipp,M.J., Janssen,P.H., Ward,P.B., Vyas,J.R., Starr,M., Sawyer,S.M., Curtis,N. (2001). Severe Bordetella holmesii Infection in a Previously Healthy Adolescent Confirmed by Gene Sequence Analysis. Clin Infect Dis 33, Yih,W.K., Silva,E.A., Ida,J., Harrington,N., Lett,S. M., George,H. (1999). Bordetella holmesii-like organisms isolated from Massachusetts patients with pertussis-like symptoms. Emerg.Infect.Dis. 5, Gerlach,G., von Wintzingerode,F., Middendorf,B., Gross,R. (2001). Evolutionary trends in the genus Bordetella. Microbes and Infection 3, Skeeles,J.K., Arp,L.H. (1997). Bordetellosis (Turkey Coryza). In: Diseases of poultry., ed. B.W.Chalnek, H.J.Barnes, C.W.Beard, L.R.McDougal, Y.M.SaifAmes: Iowa State University Press, Weyant,R.S., Hollis,D.G., Weaver,R.E., Amin,M. F., Steigerwalt,A.G., O Connor,S.P., Whitney,A.M., Daneshvar,M.I., Moss,C.W., Brenner,D.J. (1995). Bordetella holmesii sp. nov., a new gram-negative species associated with septicemia. Journal of Clinical Microbiology 33, Reischl,U., Lehn,N., Sanden,G.N., Loeffelholz,M. J. (2001). Real-Time PCR Assay Targeting IS481 of Bordetella pertussis and Molecular Basis for Detecting Bordetella holmesii. Journal of Clinical Microbiology 39, Gerlach,G., Janzen,S., Beier,D., Gross,R. (2004). Functional characterization of the BvgAS twocomponent system of Bordetella holmesii. Microbiology 150, Connell,T.D., Dickenson,A., Martone,A.J., Militello,K. T., Filiatraut,M.J., Hayman,M.L., Pitula,J. (1998). Iron starvation of Bordetella avium stimulates expression of five outer membrane proteins and regulates a gene involved in acquiring iron from serum. Infection and Immunity 66, Cummings,C.A., Brinig,M.M., Lepp,P.W., Van De,P. S., Relman,D.A. (2004). Bordetella species are distinguished by patterns of substantial gene loss and host adaptation. J Bacteriol. 186, Rozen,S., Skaletsky,H. (2000). Primer3 on the WWW for general users and for biologist programmers. Methods Mol.Biol. 132, Chenna,R., Sugawara,H., Koike,T., Lopez,R., Gibson,T.J., Higgins,D.G., Thompson,J.D. (2003). Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res. 31, Relman,D.A., Schmidt,T.M., MacDermott,R.P., Falkow,S. (1992). Identification of the uncultured bacillus of Whipple s disease. N.Engl.J.Med. 327, Kotilainen,P., Jalava,J., Meurman,O., Lehtonen,O.P., Rintala,E., Seppala,O.P., Eerola,E., Nikkari,S. (1998). Diagnosis of meningococcal meningitis by broadrange bacterial PCR with cerebrospinal fluid. J.Clin. Microbiol 36, Schouls,L.M., Schot,C.S., Jacobs,J.A. (2003). Horizontal transfer of segments of the 16S rrna genes between species of the Streptococcus anginosus group. The Journal of Bacteriology 185, Meiring,H.D., van der Heeft,E., ten Hove,G.J., de Jong,A.P.J.M. (2002). Nanoscale LC-MS(n): technical design and applications to peptide and protein analysis. J.Sep.Sci. 25, Kang,H.Y., Brickman,T.J., Beaumont,F.C., Armstrong,S.K. (1996). Identification and characterization of iron-regulated Bordetella pertussis alcaligin siderophore biosynthesis genes. J Bacteriol. 178, Beaumont,F.C., Kang,H.Y., Brickman,T.J., Armstrong,S.K. (1998). Identification and characterization of alcr, a gene encoding an AraClike regulator of alcaligin siderophore biosynthesis and transport in Bordetella pertussis and Bordetella bronchiseptica. The Journal of Bacteriology 180, Pradel,E., Guiso,N., Locht,C. (1998). Identification of AlcR, an AraC-type regulator of alcaligin siderophore synthesis in Bordetella bronchiseptica and Bordetella pertussis. The Journal of Bacteriology 180, Brickman,T.J., Armstrong,S.K. (1999). Essential role of the iron-regulated outer membrane receptor FauA in alcaligin siderophore-mediated 5 109

110 5 Chapter 5 iron uptake in Bordetella species. The Journal of Bacteriology 181, Brickman,T.J., Armstrong,S.K. (2005). Bordetella AlcS Transporter Functions in Alcaligin Siderophore Export and Is Central to Inducer Sensing in Positive Regulation of Alcaligin System Gene Expression. The Journal of Bacteriology 187, Moore,C.H., Foster,L.A., Gerbig,D.G., Jr., Dyer,D.W., Gibson,B.W. (1995). Identification of alcaligin as the siderophore produced by Bordetella pertussis and B. bronchiseptica. J Bacteriol. 177, Knapp,S., Mekalanos,J.J. (1988). Two trans-acting regulatory genes (vir and mod) control antigenic modulation in Bordetella pertussis. The Journal of Bacteriology 170, Sekine,Y., Eisaki,N., Ohtsubo,E. (1994). Translational control in production of transposase and in transposition of insertion sequence IS3. J.Mol.Biol. 235, Parkhill,J., Sebaihia,M., Preston,A., Murphy,L.D., Thomson,N., Harris,D.E., Holden,M.T., Churcher,C. M., Bentley,S.D., Mungall,K.L., Cerdeno-Tarraga,A. M., Temple,L., James,K., Harris,B., Quail,M.A., Achtman,M., Atkin,R., Baker,S., Basham,D., Bason,N., Cherevach,I., Chillingworth,T., Collins,M., Cronin,A., Davis,P., Doggett,J., Feltwell,T., Goble,A., Hamlin,N., Hauser,H., Holroyd,S., Jagels,K., Leather,S., Moule,S., Norberczak,H., O Neil,S., Ormond,D., Price,C., Rabbinowitsch,E., Rutter,S., Sanders,M., Saunders,D., Seeger,K., Sharp,S., Simmonds,M., Skelton,J., Squares,R., Squares,S., Stevens,K., Unwin,L., Whitehead,S., Barrell,B.G., Maskell,D. J. (2003). Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet. 35, Brickman,T.J., Armstrong,S.K. (1995). Bordetella pertussis fur gene restores iron repressibility of siderophore and protein expression to deregulated Bordetella bronchiseptica mutants. J Bacteriol. 177, Coenye,T., Vandamme,P. (2003). Intragenomic heterogeneity between multiple 16S ribosomal RNA operons in sequenced bacterial genomes. FEMS Microbiol.Lett. 228, Stibitz,S., Yang,M.S. (1999). Genomic plasticity in natural populations of Bordetella pertussis. The Journal of Bacteriology 181, van der Zee,A., Mooi,F., van Embden,J., Musser,J. (1997). Molecular evolution and host adaptation of Bordetella spp.: phylogenetic analysis using multilocus enzyme electrophoresis and typing with three insertion sequences. The Journal of Bacteriology 179, Boursaux-Eude,C., Thiberge,S., Carletti,G., Guiso,N. (1999). Intranasal murine model of Bordetella pertussis infection: II. Sequence variation and protection induced by a tricomponent acellular vaccine. Vaccine 17, Register,K.B., Ducey,T.F., Brockmeier,S.L., Dyer,D. W. (2001). Reduced virulence of a Bordetella bronchiseptica siderophore mutant in neonatal swine. Infection and Immunity 69, Escolar,L., Perez-Martin,J., de Lorenzo,V. (1999). Opening the Iron Box: Transcriptional Metalloregulation by the Fur Protein. The Journal of Bacteriology 181, Beall,B.W., Sanden,G.N. (1995). Cloning and initial characterization of the Bordetella pertussis fur gene. Curr.Microbiol. 30, Venturi,V., Weisbeek,P., Koster,M. (1995). Gene regulation of siderophore-mediated iron acquisition in Pseudomonas: not only the Fur repressor. Mol.Microbiol. 17, Van Hove,B., Staudenmaier,H., Braun,V. (1990). Novel two-component transmembrane transcription control: regulation of iron dicitrate transport in Escherichia coli K-12. The Journal of Bacteriology 172, Enz,S., Mahren,S., Stroeher,U.H., Braun,V. (2000). Surface signaling in ferric citrate transport gene induction: interaction of the FecA, FecR, and FecI regulatory proteins. The Journal of Bacteriology 182, Visca,P., Leoni,L., Wilson,M.J., Lamont,I.L. (2002). Iron transport and regulation, cell signalling and genomics: lessons from Escherichia coli and Pseudomonas. Mol.Microbiol. 45, Braun,V., Mahren,S., Ogierman,M. (2003). Regulation of the FecI-type ECF sigma factor by transmembrane signalling. Curr.Opin.Microbiol. 6, Pradel,E., Locht,C. (2001). Expression of the putative siderophore receptor gene bfrz is controlled by the extracytoplasmic-function sigma factor BupI in Bordetella bronchiseptica. The Journal of Bacteriology 183,

111 Acquisition of Iron-Uptake Genes 40. Vanderpool,C.K., Armstrong,S.K. (2001). The Bordetella bhu locus is required for heme iron utilization. The Journal of Bacteriology 183, Vanderpool,C.K., Armstrong,S.K. (2004). Integration of environmental signals controls expression of Bordetella heme utilization genes. J Bacteriol. 186, Kirby,A.E., Metzger,D.J., Murphy,E.R., Connell,T. D. (2001). Heme utilization in Bordetella avium is regulated by RhuI, a heme-responsive extracytoplasmic function sigma factor. Infection and Immunity 69,

112 112

113 66 Chapter Chapter Evolution of the Bordetella Autotransporter Pertactin: Identification of Regions Subject to Positive Selection Dimitri A. Diavatopoulos 1,2, Marcel Hijnen 1,2, Frits R. Mooi 1,2 These authors contributed equally to this work 1 Laboratory for Vaccine-Preventable Diseases, National Institute of Public Health and the Environment, Bilthoven, The Netherlands; 2 Eijkman Winkler Institute, University Medical Center, Utrecht, The Netherlands Submitted for publication

114 Chapter 6 6 abstract The virulence factor Pertactin is expressed by all of the closely related bacterial pathogens Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. B. pertussis and B. parapertussis both cause whooping cough in humans, which kills 300,000 people annually. B. bronchiseptica is usually an animal pathogen, but recently it was shown that a humanassociated lineage also exists. Pertactin is an autotransporter that is involved in adherence of Bordetellae to the lung epithelium. It is an important component of most current acellular pertussis vaccines, which are based on B. pertussis. These three species produce immunologically distinct pertactin molecules, and it has been shown that the acellular pertussis vaccines do not provide protection against B. parapertussis and probably also not against B. bronchiseptica. Extensive variation has been observed in the Pertactin repeat regions 1 and 2, as well as in other regions of the protein, and this variation has been associated with the recent resurgence of pertussis. This variation is not only inter-specific, but also occurs between isolates from the same species. Knowledge about codons that are under positive selection could possibly facilitate the development of more broadly protective vaccines. In this study, a large number of Pertactin genes from B. bronchiseptica, B. parapertussis hu, B. parapertussis ov and B. pertussis were compared using different nucleotide substitutions models, and positively selected codons were identified using an empirical Bayesian approach. This approach yielded 15 codons subject to diversifying selection pressure. The results were interpreted in an immunological context and may help in improving future pertussis vaccines. 114

115 Evolution of Pertactin introduction The very closely related pathogens Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica (referred to as the mammalian bordetellae) express a similar array of virulence factors, including Pertactin. B. pertussis is a strictly human pathogen that causes pertussis or whooping cough. B. parapertussis comprises two distinct lineages, found in humans and sheep, designated B. parapertussis hu and B. parapertussis ov, respectively. B. bronchiseptica has been isolated from a large number of mammalian host species, and recently it was shown that a human-associated lineage also exists (Diavatopoulos et al., PLoS pathogens, 2005). It was further shown that B. pertussis and B. parapertussis hu evolved from distinct branches of a B. bronchiseptica-like ancestor 1,2 (Diavatopoulos et al., PLoS Pathogens, 2005). Pertactin (Prn) belongs to the type V autotransporter protein family 3-5, and these proteins are characterized by the ability to catalyze their own transport through the outer membrane. After secretion, autoproteolytic activities reduce the 69-kDa protein to its final or kda forms 6, which remain non-covalently bound to the bacterial cell surface 7. X-ray crystallography indicated that Prn consists of a 16-stranded parallel β-helix with a V-shaped cross-section 8. From this helix, several loops protrude, one of which contains the Arg-Gly- Asp (RGD) motif that is associated with adherence to host tissues The protein further contains two hyper-variable regions, designated region 1 (R1) and region 2 (R2), which are comprised of amino acid (AA) repeats (Gly-Gly-X-X-Pro and Pro-Gln-Pro, respectively). R1 is located proximal to the N-terminus and directly adjacent to the RGD motif, and R2 is located at the C-terminus. One of the known biological functions of Prn is that it serves as an adhesin to the epithelium 12. The exact host receptor to which Prn binds is unknown. Pertactin elicits high antibody titers, and anti-prn antibodies (Abs) have been shown to confer protective immunity 13 (Hijnen et al., submitted). Furthermore, anti-prn Abs, but not anti-ptx, anti-fimbriae, or anti-fha antibodies, were found to be crucial for B. pertussis phagocytosis 14, indicating an important role of Prn in immunity to pertussis. Especially polymorphism in R1 and R2 has been suggested to be important for evasion of antibody responses 13,15. Mice vaccinated with B. pertussis Prn1 were less well protected against B. pertussis Prn2 strains then to B. pertussis Prn1 strains 13, and the only difference between these Prn types is the presence of an additional repeat unit in R1 in Prn2. Further, vaccination of mice with B. pertussis Prn1 did not protect against infection with B. parapertussis 16,17, suggesting a lack of Prn cross-reactivity between these species. These observations indicate that anti-prn Abs significantly affect transmission of the Bordetellae, at least for B. pertussis. A new light has been cast on the observed variation in Prn with the recent identification of a Bordetella phage (BPP-1, Bvg Plus tropic Phage 1) 18. The mammalian bordetellae can switch between Bvg-phases (Bordetella virulence gene), depending on environmental stimuli. Phase switching results in a different expression of surface-associated molecules, 6 115

116 Chapter 6 6 including Prn, which is specifically expressed in the Bvg + phase 19. BPP-1 showed a marked tropism for the Bvg + phase of B. pertussis, B. parapertussis, and B. bronchiseptica 18, and its primary receptor for BPP-1 was shown to be Prn. Phase switching of the bacteria would expectedly result in the loss of the receptor for BPP-1. However, BPP-1 has been shown to specifically generate polymorphism in its ligand-binding domain, resulting in phages with increased binding capacity to alternative surface receptors for host cell entry 18,20,21. Extensive variation has been observed in the Prn repeat regions 1 and 2, as well as in other regions of the protein, both between species but also between strains belonging to the same species. Prn is an important component of many current acellular pertussis vaccines. Therefore, knowledge about codons that are under positive selection could possibly facilitate the development of more broadly protective vaccines. Our aim was to identify regions in Prn that are subject to positive selection within the Prn gene and to put this into an immunological framework. Pertactin genes of the mammalian bordetellae were compared using different models of nucleotide substitutions, and positively selected codons were identified using an empirical Bayesian approach. The location of positively selected sites was visualized in the crystal structure of B. pertussis Prn and compared to the location of epitopes. 116

117 Evolution of Pertactin experimental procedures sequence data and alignment In this study, the nucleotide sequence encoding the extracellular domain of Prn was used, represented by AAs 1-Asp to 677-Gly in the B. pertussis Tohama sequence. Regions 1 (232- Gly to 256-Pro) and 2 (545-Pro to 566-Pro), which contain repeats, were excluded from the positive selection analysis, which resulted in 1908 nucleotides in total (or 636 codons). Nucleotide sequences were obtained from a previous study (Diavatopoulos et al., PLOS pathogens, 2005), and additionally the Genbank database was searched for Prn nucleotide sequences that included the region encoding the extracellular domain. This search yielded 147 prn sequences, of which 25 were unique (Figure 1). Nucleotide sequences were aligned using Kodon 2.5 (Applied Maths, Sint-Martens-Latem, Belgium) and alignment gaps were omitted. 6 detection of selection Detection of selective pressures acting on individual codons within genes is generally estimated from varying ratios (ω) of non-synonymous (d N ) to synonymous mutations (d S ). In the case of positive selection, ω is expected to be >1. However, positive selection often occurs only at a limited number of codons and therefore, the ω for the complete gene may be <1, although the ω for individual codons can still be >1. A maximum-likelihood approach can be used to estimate varying ω-values across sequences using different models of codon evolution 22. These models assume a certain statistical distribution of ω and estimate the likelihood for the model, thereby also accounting for the phylogenetic relationships of the sequences. The following models are commonly compared to estimate the distribution of ω: model M1A to M2A and model M7 to M8. The first nested model pair consists of the nearly neutral model M1A and the positive selection model M2A 23. In M1A, codons are assigned to two classes of ω of which the value is between 0 and 1, thus always assuming essentially neutral evolution. This model is compared to the positive selection model M2A, which has exactly the same codon classes as the M1A model, but in this model an additional class of codons is allowed with ω free to assume a value >1. The second nested pair consists of models M7 and M8. M7 assumes eight codon classes that are distributed in a β-shaped manner with 0<ω<1. Model M8 is similar to model M7, but differs in the existence of an additional codon class with ω>1. A likelihood ratio test respectively compares each nested model pair, and this gives an estimation of the extent of positive selection acting on the sequences under investigation. If M1A is rejected in favor of M2A, positive selection may be concluded. Similarly, positive selection can also be concluded if M7 is rejected in favor of M8. In the case of positive selection, individual positively selected codons can be identified using a Bayes empirical Bayes approach 24. Likelihood ratio tests were performed using the CODEML program from the PAML software package 117

118 Chapter Statistical significance for the fit of the models to the actual data was obtained using a χ 2 -test. Twice the difference in log-likelihood (2Δl=2(l 1 -l 0 ) with l the log-likelihood of a model was calculated, and this was compared to a χ 2 distribution with two degrees of freedom and a 95% confidence interval. Maximum likelihood trees were reconstructed from the aligned 25 prn sequences using Treefinder (Jobb, G Treefinder version of June 2005, Munich, Germany, under the general-time-reversible (GTR) model of nucleotide substitution, with 1000 bootstrap replicates. 6 epitopes in pertactin In previous studies, a Pepscan was used to map the location of linear epitopes recognized by mabs 26, and site-directed mutagenesis (SDM) was used to identify the location of conformational epitopes recognized by monoclonal antibodies (mabs) (Hijnen et al, submitted). In addition to these experimentally identified epitopes, the location of additional, putative discontinuous epitopes was determined using the Conformational Epitope Prediction (CEP) server ( 27. CEP predicts the location of conformational epitopes, based on the exposure of stretches of AAs that are located in a 6Å proximity of each other. For this analysis, the crystal structure of B. pertussis Prn (1DAB.pdb) was used 8,28. solvent exposure and secondary structure The solvent accessibility of AAs is a measure for their surface exposure; AAs with very high solvent accessibility are thus more likely targets for e.g. the immune system while AAs with low solvent accessibility will not likely come into contact with antibodies. The solvent accessibility was determined for each AA in Prn 1DAB.pdb with the program Getarea Since Getarea1.1 was only able to determine the exposure of the AAs present in the crystal structure, we also used the PredictProtein server to determine the solvent accessibility for the remainder of Prn 30. The secondary structure of the entire Pertactin protein was determined with the PredictProtein server as well. visualization of sites The coordinates of Prn were downloaded from the Protein Data Bank, under code 1DAB. pdb 8,28. The location of epitopes identified by the above described methods and the location of positively selected sites were visualized in Chimera

119 results Evolution of Pertactin Based on housekeeping gene sequence data, comparative genomic hybridization and Pertactin sequence data, it was previously shown that B. pertussis forms a separate branch with B. bronchiseptica complex IV, and B. parapertussis clusters together with B. bronchiseptica complex I (Diavatopoulos et al., PLoS Pathogens, 2005). Interestingly, B. bronchiseptica complex I strains and B. parapertussis hu cannot be discriminated based on their prn genes, 21 G ~ Q 24 P ~ G 213 Q~ D 270 S ~ T 334 H ~ R 358 D ~ Q 488 A ~ G 376 I ~ S 330 Q~ R 187 S ~ F 438 V ~ C B. bronchiseptica (DQ141702) 100 B. bronchiseptica (DQ141714) 1.7 B. bronchiseptica (DQ141701) 100 B. bronchiseptica (DQ141768) 31.5 B. parapertussis ov (DQ141780) 91.6 B. bronchiseptica (DQ141722) 0 B. bronchiseptica I B. bronchiseptica (DQ141751) and 0 B. parapertussishu III B. parapertussis hu (DQ141779) 41.5 B. bronchiseptica (AJ245927) 83.2 B. bronchiseptica (DQ141771) 84.7 B. bronchiseptica (AY376325) 88.9 B. bronchiseptica (X54815) 6 B. pertussis (AF456357; prn6) 98.6 B. pertussis (AJ133245; prn8) 87.3 B. pertussis (AF218785; prn9) R ~ L B. pertussis (AJ007362) 398 S ~ A 350 K ~ Q B. bronchiseptica (DQ141764) 86.1 B. bronchiseptica (DQ141719) 87.8 B. bronchiseptica IV B. bronchiseptica (DQ141725) and 96.9 B. pertussis II B. bronchiseptica (DQ141765) 83.2 B. bronchiseptica (DQ141732) 98.5 B. bronchiseptica (DQ141762) 85.3 B. bronchiseptica (DQ141741) 75.9 B. bronchiseptica (DQ141766) 77.7 B. bronchiseptica (DQ141774) Figure 1. Maximum likelihood tree of 25 unique prn sequences, encoding the exposed domain of Prn, with the exclusion of regions 1 and 2 and alignment gaps. Accession numbers are indicated between parentheses. Positively selected amino acids and their substitutions are indicated in boxes. Numbers near the branches indicate the bootstrap values, based on 1,000 bootstrap replicates. The scale indicates the evolutionary distance in substitutions per site. 119

120 Chapter 6 while the housekeeping gene tree does allow distinction between the two complexes. A Genbank search yielded 25 unique prn sequences, out of a total of 147 sequences that included the nucleotide region encoding the surface-exposed domain. These sequences included ten B. bronchiseptica complex I, nine B. bronchiseptica complex IV, four B. pertussis, one B. parapertussis ov and one B. parapertussis hu sequences. A maximum-likelihood tree of these sequences is shown in Figure 1. 6 sequences coding for prn are subject to positive selection Positive selection can be estimated from the ratio (ω) of non-synonymous substitutions (d N ) to synonymous substitutions (d S ). For genes and codons evolving under positive selection pressure, ω is expected to be larger than one, indicating that mutations in those codons resulting in amino acid (AA) changes are selected for. We used a likelihood ratio test (LRT) to determine if Prn was evolving under positive selection pressure. In the LRT, the likelihood of a model assuming positive selection is compared to a model that assumes a different (non-positive) selection. The LRT indicated that for Prn, both models M2A and M8 had a significantly better likelihood (p>0.95) than models M1A and M7, respectively. This suggests that positive selection could be detected for some codons in Prn. Although the average ω for Prn was 0.29, the ω-values for the additional codon class in M2A and M8 were well above 1. An empirical Bayesian approach identified 11 codons in model M2A and 15 codons in model M8 to be under positive selection. The 15 codons identified in model M8 also contained the 11 codons that were identified under the M2A model (Table 1). Of the 15 positively selected codons in Prn, all but one (codon 22) resulted in an AA change. Interestingly, although the first two nucleotides of codon 22 had been substituted, this did not result in an AA change. characterization of positively selected codons in prn In Figure 2, the positively selected codons are indicated on the primary structure of Prn. Of the 15 sites predicted to be positively selected for, the majority was located in the N- terminus or in the center (87%). Only two (13%) positively selected sites could be identified in the C-terminus of Prn, and these were only detected using the M8 model, which has been described to be less conserved than the M2A model 23,24. Amino acids may be part of a putative conformational or discontinuous epitope if they are within a 6Å proximity, and their solvent accessibility is more than 25% 27. Positively selected codons that correspond to these criteria may be recognized by a single antibody species and were therefore designated regions. In total, we identified four regions (A-D), representing 11 codons. Four codons could not be assigned to a region under these criteria (Fig. 2, 3 and Table 1). 120

121 Evolution of Pertactin Region A Region B Region C Region D Not characterized by X-ray crystallography 21, 22, RGD Asp N' R1 R2 C' 677-Gly Gly to 256-Pro 545-Pro to 566-Pro Figure 2. Location of positively selected codons and regions on the primary structure of Tohama Prn. Positively selected codons are indicated by black triangles. AAresidues with a maximal distance of 6Å and a minimum solvent accessibility of 25% have been designated as regions, indicated by the connecting lines. Numbering starts with the first amino acid of the mature protein. Green boxes indicate the location of conformational epitopes co-localized with positively selected codons. Yellow boxes indicate the co-localization of both conformational and linear epitopes with positively selected codons. Red, white and green triangles indicate loops that after mutation by SDM showed respectively a decrease, no effect or increase in binding with mabs. A color version of this figure is available in the appendix. Table 1. Characteristics of positively selected sites in the different Bordetella complexes 21G 22S 24P 187S 1 213Q 270S 330Q 334H 350K 358D 376I 398S 438V 1 488A 1 498R 1 BP (4; 60) L BB-4 (9; 9) Q - S A BPP-hu (1; 10) Q - G F D T - R - Q S - - G - BPP-ov (1; 3) Q - G - D T - R - Q S - - G - BB-1 (10) Q - G - D T R R - Q S - C G - Solvent exposure (%) Located in C C C β C β β-c β-c β-c β-c C β β-c C C CEP Yes Yes Yes No No No Yes Yes No Yes Yes No No Yes Yes SDM/PEPSCAN S+P S+P S+P No No No P P S No f-p No No No S a Positively selected codons identified only by model M8 b Numbers between brackets indicate the number of unique Prn sequences and the total number of represented Prn sequences, respectively Abbreviations: BP, B. pertussis; BB-4, B. bronchiseptica complex IV; BPP-hu B. parapertussis hu ; BPP-ov B. parapertussis ov ; BB-1; B. bronchiseptica complex I, C, loop or coil; β, β-sheet; β-c, β-sheet adjacent to coil; CEP, conformational epitope prediction; SDM, site-directed mutagenesis; S+P, ; f-p, flanks pepscan epitope 6 121

122 Chapter 6 6 Region D +350-Lys Gln +376-Ile Ser Region A Region B +213-Gln Asp +270-Ser Thr +21-Gly Ser +22-Ser Silent +24-Pro Gly +398-Ser Ala +498-Leu Arg +488-Ala Gly +187-Ser Phe +358-Asp Gln +330-Gln Arg +334-His Gly +438-Val Cys Region C Figure 3. Projection of the positively selected codons and regions on the crystal structure of B. pertussis Prn1 (1DAB.pdb). Numbers indicate the positively selected codons. Codons that are part of a region are colored in red, and regions are indicated by black rectangles. Positively selected codons not present in a region are colored in blue. A color version of this figure is available in the appendix. 122

123 Evolution of Pertactin positively selected regions in prn Region A, located in the N-terminus of Prn, consisted of three positively selected codons that were in very close proximity (AAs 21, 22 and 24) and located in an exposed loop of Prn, designated loop 2 (Fig. 3). In a previous report we described that the N-terminus contained a number of conformational epitopes (Hijnen et al., submitted), and one of these N-terminal conformational epitopes was found to co-localize with Region A. The highly variable loop 2 contains 6 codons (20-Gln to 25-Gly), and 12 of the respective 18 nucleotides were found to be polymorphic between B. pertussis and B. bronchiseptica complex IV on the one hand and B. parapertussis and B. bronchiseptica complex I on the other hand. The solvent accessibility of the AAs in loop two was also very high, suggesting they are all well exposed (Table 1). Region B comprised two codons (213-Gln and 270-Ser), located partially in the N-terminus and partially in the center of Prn. Although separated by 57 AAs in the primary sequence, they are within a 4Å radius of each other in the crystal structure. Of these two AAs, 213- Gln is well exposed (59.9%), but 270-Ser is only 26.2% exposed to solvent. In the -sheet where 270-Ser is located (AAs ), only three AAs (including 270-Ser) are exposed to solvent. Both codons were not part of previously identified epitopes 26 (Hijnen et al., submitted), or epitopes predicted by CEP. Three positively selected codons comprise region C (330-Gln, 334-His and 358-Asp). The solvent accessibility of these three AAs indicates they are all well exposed to the environment. Further, these residues were predicted to co-localize with a putative conformational epitope, as predicted by CEP. In the center of Prn, three closely located positively selected codons were identified within a 6Å radius (Region D; 350-Lys, 376-Ile and 398-Ser). Although 350-Lys and 398-Ser are well exposed, 376-Ile is only 25.2% exposed. In contrast, the α-helix adjacent to 376-Ile (373-Gly to 375-Ser) is well exposed. It is likely that the mutation of the hydrophobic 376- Ile to a hydrophilic serine may have an effect on the tertiary structure, or on the location of the adjacent α-helix. 6 positively selected codons in prn not assigned to a region Located in the N-terminus of Prn, 187-Ser was predicted to be under positive selection. Although 187-Ser was in a 6Å radius of Region B (see above), the β-sheet in which 187- Ser is located is inaccessible to solvent, suggesting that this β-sheet does not constitute an epitope. The mutation of the hydrophilic 187-Ser to a bulky aromatic phenylalanine, as observed in a number of Prn variants, will likely affect the local tertiary structure of the protein, possibly indirectly affecting the exposure of adjacent epitopes or leading to a change in receptor binding. This may suggest an indirect role of this loop in antigenic variation. Positively selected residue 438-Val was mutated into a cysteine in two B. bronchiseptica 123

124 Chapter 6 6 Prn sequences. This mutation is very unusual, as cysteine residues are not normally present in Prn. Residue 488-Ala, located in the beginning of the C-terminus, was also predicted to be under positive selection. The loop in which this AA resides was predicted to be part of five distinct putative conformational epitopes, suggesting that it is well exposed and possibly very immunogenic. Two of these predicted epitopes also contained the loop that is comprised of AAs This loop is flanked by residue 438-Val (see above) which was also found to be under positive selection. It is likely that these two mutations affect the structure and location of several of these conformational epitopes. The last C-terminally located positively selected site was the well exposed residue 498-Leu, which was predicted by CEP to be part of two conformational epitopes. In a previous study, we also identified this residue as part of a conformational epitope recognized by both human and mouse Abs (Hijnen et al., submitted). analysis of repeat regions 1 and 2 R1 and R2 are located in the N-terminus and in the C-terminus, respectively. R1 is comprised of repeats of five AA in length, which may also vary in composition (GXXXP), and it is located adjacent to the RGD-site. The RGD site has been implicated in adherence of the bacterium to host cells 9, but it is likely that other, uncharacterized domains may also be involved. R1 has been shown to induce Prn-specific Abs and variation in this region affected the efficacy of the Dutch whole cell vaccine 13,32. This suggests that variation in R1 is important for evasion of host immunity. Diversity in R1 and R2 was also observed in prn sequences which were otherwise conserved (Table 2). The length of R1 was found to be statistically significantly associated with the length of R2. Longer R1 sequences were associated with shorter R2 sequences, and vice versa (Pearson correlation P<10e -16 ). Further, the ratio of R1 to R2 length was found to be phylogenetically associated. Long R1 sequences and short R2 sequences Table 2. Region 1 and 2 characteristics Length in amino acids Complex Region 1 Region 2 I 16.7 (± 3.1) (±2.9) II 26.5 (± 3.3) 14.6 (± 1) III 20 (± 0) 31.4 (±1.3) IV 25 (± 6.6) 22.2 (± 2.4) 1 Numbers between parentheses indicate the standard deviation were found almost exclusively in the human-associated B. pertussis and B. bronchiseptica complex IV strains. In contrast, short R1 sequences combined with long R2 sequences were observed predominantly in the B. parapertussis and B. bronchiseptica complex I strains (Table 2). 124

125 discussion Evolution of Pertactin In this study, we provide evidence for the presence of positively selected codons in the autotransporter protein Pertactin. The majority of these codons were well exposed to solvent and located in linear or conformational epitopes, suggesting that adaptive changes in these codons may lead to immune escape, decreased phage-recognition or a better fit with the host receptor. Further, the length of repeat region 1 was found to be significantly associated to that of region 2, and possible explanations are put forward for this association. characterization of positively selected codons An analysis of Prn from which the hyper-variable R1 and R2 were excluded resulted in 25 unique Prn sequences. These sequences were analyzed for positive selection using a likelihood ratio test and empirical Bayes estimates. This approach identified 15 codons that were subject to positive selection. Out of these 15 codons, 14 were exposed for more than 25% to solvent, indicating they are surface exposed and therefore likely to be affected by the immune system or phage binding. The majority of the positively selected codons was located in (n=6), or directly adjacent to a loop (n=5). In contrast, only three positively codons were located in a β-sheet, including the only non-exposed codon (Table 1). These data indicate that in Prn, amino acids located in or near loops are more amenable to diversifying selection than those in β-sheets. The backbone of Prn is comprised of mainly β-sheets and variation in the composition of these sheets may result in structural changes and thus possibly loss of biological function. Variation in the exposed loops however, is not likely to affect the overall structure and function of the protein, and thus these loops may be important for immune evasion. The majority of positively selected codons (n=10) co-localized with linear and conformational epitopes that were predicted by CEP or experimentally identified previously (Hijnen et al., submitted) 26,27. A total of six codons were located in linear epitopes recognized by human Abs to B. pertussis Prn (Table 1) 26. Further, we recently modified exposed loops of B. pertussis Prn by site-directed mutagenesis (SDM), after which the binding of well-characterized monoclonal antibodies (mabs) to these Prn variants was investigated (Hijnen et al., submitted). Several of these Prn variants showed a decreased affinity for a number of mabs, indicating that mutations in these loops may be important for immune evasion. Out of the 15 positively selected codons, five were located in loops of which modification by SDM resulted in decreased affinity to at least three mabs. In the same study, several loops in Prn were identified that upon SDM showed an increase in binding with mabs (Hijnen et al., submitted). We hypothesized that these mutations affected the conformation of the loop, thereby unmasking epitopes. Since these loops could be important for masking of epitopes, they are possibly under purifying selection pressure. Consistent with this hypothesis, none of the codons that we identified to be under positive selection in this work were located in these loops. The majority of the positively selected codons were found to be different between B. bronchiseptica complex I 6 125

126 Chapter 6 6 and B. parapertussis versus B. bronchiseptica complex IV and B. pertussis. Previously, it was shown that, although vaccination with B. pertussis Prn1 protected at least partially against B. pertussis strains (including those with different Prn sequences) 13,33, it did not protect against B. parapertussis 16,17. The latter observation is consistent with an important role of the variable codons in immune evasion. We previously provided evidence that B. pertussis and B. bronchiseptica complex IV strains were subject to immune competition resulting in antigenic divergence between these two species (Diavatopoulos et al., PLoS Pathogens, 2005). This analysis was based on the presence or absence of genes coding for dermonecrotic toxin, pertussis toxin and LPS. Here we looked for more subtle changes due to amino acid substitutions in Prn. Two substitutions, in the codons 350 and 398, were found that may have been caused by immune competition between B. pertussis and B. bronchiseptica complex IV strains. In B. pertussis en B. bronchiseptica complex I strains, these codons code for Lys and Ser, respectively. In contrast, in B.bronchiseptica complex IV strains, the residues Gln and Ala are found at these positions, respectively. Similarly, the polymorphism in codon 187 may be due to immune competition between B. pertussis and B. parapertussis hu. All Bordetella species code for Ser at this position, except for B. parapertussis hu in which Phe is found at this position. Although data about the location of epitopes were available, functional data concerning receptor specificity and residues possibly involved in this interaction were unavailable. We therefore compared the location of the positively selected AA residues present in human adapted strains with the animal adapted strains, in order to locate residues possibly involved in host receptor specificity. This approach yielded two residues, 213 and 270 that could possibly play a role in host receptor specificity. Both residues are identical in B. pertussis and B. bronchiseptica complex IV strains, but different in B. parapertussis hu and B. bronchiseptica complex I strains. Furthermore, both residues were not previously identified as an epitope, or predicted to be part of an epitope. Both residues are located closely together in between two large loops (Fig. 3). This creates a groove that could be a potential receptor binding site. The subtle variations observed for these residues (Q>D and S>T), which are located on the bottom of the groove, could potentially enhance the affinity or the fit to the human receptor. The fact that B. parapertussis hu and B. pertussis Prn are distinct at these two positions may reflect the more recent adaptation of B. parapertussis hu to humans. polymorphism in repeat regions 1 and 2 Comparison of R1 and R2 sequences between the 147 isolates revealed a striking correlation between the length of R1 and R2. Long R1 sequences were found to be accompanied with short R2 sequences, and vice versa (Pearson correlation P<10e -16 ). This association was correlated to the phylogenetic tree, high R1 to R2 ratios were found almost exclusively in the human-associated B. pertussis and B. bronchiseptica complex IV isolates; low R1:R2 ratios were observed mainly in the B. bronchiseptica complex I and B. parapertussis isolates. We 126

127 Evolution of Pertactin previously provided evidence that one of the roles of R1 was masking of epitopes (Hijnen et al., submitted). Further, we observed that R1 and R2 may be part of a single discontinuous epitope, implicating close proximity of these regions. In the light of these observations, it is plausible that variation in the length of R1 is compensated by variation in the length of R2 to maintain the close proximity of the variable epitope, or to maintain masking of underlying epitopes. In this study we have identified codons of Prn that are under diversifying selection. The results we obtained are largely consistent with immunological and structural data. Our analyses may facilitate the development of more effective vaccines against pertussis by identifying regions which induce an effective immune response and are not subject to diversifying selection. It should be noted that variation in Prn may not only be driven by the interaction with the host. Recently, phage BBP-1 was described that infects Bvg + bordetellae via Prn as its main receptor. It is likely that this phage has had a diversifying effect on Prn

128 6 Chapter 6 reference list 1. Musser,J.M., Hewlett,E.L., Peppler,M.S., and Selander,R.K. (1986). Genetic diversity and relationships in populations of Bordetella spp. J. Bacteriol. 166, van der Zee,A., Mooi,F., van Embden,J., and Musser,J. (1997). Molecular evolution and host adaptation of Bordetella spp.: phylogenetic analysis using multilocus enzyme electrophoresis and typing with three insertion sequences. J. Bacteriol. 179, Henderson,I.R., Navarro-Garcia,F., and Nataro,J.P. (1998). The great escape: structure and function of the autotransporter proteins. Trends Microbiol. 6, Henderson,I.R., Cappello,R., and Nataro,J.P. (2000). Autotransporter proteins, evolution and redefining protein secretion. Trends Microbiol. 8, Henderson,I.R. and Nataro,J.P. (2001). Virulence functions of autotransporter proteins. Infect. Immun. 69, Gotto,J.W., Eckhardt,T., Reilly,P.A., Scott,J.V., Cowell,J.L., Metcalf,T.N., III, Mountzouros,K., Gibbons,J.J., Jr., and Siegel,M. (1993). Biochemical and immunological properties of two forms of pertactin, the 69,000-molecular-weight outer membrane protein of Bordetella pertussis. Infect. Immun. 61, Miller,E. (1999). Overview of recent clinical trials of acellular pertussis vaccines. Biologicals 27, Emsley,P., Charles,I.G., Fairweather,N.F., and Isaacs,N.W. (1996). Structure of Bordetella pertussis virulence factor P.69 pertactin. Nature 381, Leininger,E., Roberts,M., Kenimer,J.G., Charles,I. G., Fairweather,N., Novotny,P., and Brennan,M. J. (1991). Pertactin, an Arg-Gly-Asp-containing Bordetella pertussis surface protein that promotes adherence of mammalian cells. Proc. Natl. Acad. Sci. U. S. A. 88, Roberts,M., Fairweather,N.F., Leininger,E., Pickard,D., Hewlett,E.L., Robinson,A., Hayward,C., Dougan,G., and Charles,I.G. (1991). Construction and characterization of Bordetella pertussis mutants lacking the vir-regulated P.69 outer membrane protein. Mol. Microbiol. 5, Leininger,E., Ewanowich,C.A., Bhargava,A., Peppler,M.S., Kenimer,J.G., and Brennan,M.J. (1992). Comparative roles of the Arg-Gly-Asp sequence present in the Bordetella pertussis adhesins pertactin and filamentous hemagglutinin. Infect. Immun. 60, Everest,P., Li,J., Douce,G., Charles,I., De Azavedo,J., Chatfield,S., Dougan,G., and Roberts,M. (1996). Role of the Bordetella pertussis P.69/pertactin protein and the P.69/pertactin RGD motif in the adherence to and invasion of mammalian cells. Microbiology 142 ( Pt 11), King,A.J., Berbers,G., van Oirschot,H.F., Hoogerhout,P., Knipping,K., and Mooi,F.R. (2001). Role of the polymorphic region 1 of the Bordetella pertussis protein pertactin in immunity. Microbiology 147, Hellwig,S.M., Rodriguez,M.E., Berbers,G.A., Van De Winkel,J.G., and Mooi,F.R. (2003). Crucial Role of Antibodies to Pertactin in Bordetella pertussis Immunity. J. Infect. Dis. 188, Mooi,F.R., van Loo,I.H., and King,A.J. (2001). Adaptation of Bordetella pertussis to Vaccination: A Cause for Its Reemergence? Emerg. Infect. Dis ;7. (3 Suppl): , Khelef,N., Danve,B., Quentin-Millet,M.J., and Guiso,N. (1993). Bordetella pertussis and Bordetella parapertussis: two immunologically distinct species. Infect. Immun. 61, David,S., van,f.r., and Mooi,F.R. (2004). Efficacies of whole cell and acellular pertussis vaccines against Bordetella parapertussis in a mouse model. Vaccine 22, Liu,M. et al. (2002). Reverse transcriptase-mediated tropism switching in Bordetella bacteriophage. Science 295, Kinnear,S.M., Boucher,P.E., Stibitz,S., and Carbonetti,N.H. (1999). Analysis of BvgA activation of the pertactin gene promoter in Bordetella pertussis. J. Bacteriol. 181, Doulatov,S., Hodes,A., Dai,L., Mandhana,N., Liu,M., Deora,R., Simons,R.W., Zimmerly,S., and Miller,J.F. (2004). Tropism switching in Bordetella bacteriophage defines a family of diversitygenerating retroelements. Nature 431, Liu,M. et al. (2004). Genomic and genetic analysis of Bordetella bacteriophages encoding reverse transcriptase-mediated tropism-switching cassettes. J Bacteriol. 186, Yang,Z. (2000). Maximum likelihood estimation 128

129 Evolution of Pertactin on large phylogenies and analysis of adaptive evolution in human influenza virus A. J. Mol. Evol. 51, Wong,W.S., Yang,Z., Goldman,N., and Nielsen,R. (2004). Accuracy and power of statistical methods for detecting adaptive evolution in protein coding sequences and for identifying positively selected sites. Genetics 168, Sequence variation in pertussis S1 subunit toxin and pertussis genes in Bordetella pertussis strains used for the whole-cell pertussis vaccine produced in Poland since 1960: efficiency of the DTwP vaccine-induced immunity against currently circulating B. pertussis isolates. Vaccine 22, Yang,Z., Wong,W.S., and Nielsen,R. (2005). Bayes empirical bayes inference of amino acid sites under positive selection. Mol. Biol. Evol. 22, Yang,Z. (1997). PAML: a program package for phylogenetic analysis by maximum likelihood. Comput Appl. Biosci. 13, Hijnen,M., Mooi,F.R., van Gageldonk,P.G., Hoogerhout,P., King,A.J., and Berbers,G.A. (2004). Epitope structure of the Bordetella pertussis protein P.69 pertactin, a major vaccine component and protective antigen. Infect. Immun. 72, Kulkarni-Kale,U., Bhosle,S., and Kolaskar,A.S. (2005). CEP: a conformational epitope prediction server. Nucleic Acids Res. 33, W168-W Berman,H.M., Westbrook,J., Feng,Z., Gilliland,G., Bhat,T.N., Weissig,H., Shindyalov,I.N., and Bourne,P. E. (2000). The Protein Data Bank. Nucleic Acids Res. 28, Fraczkiewicz,R. and Braun,W. (1998). Exact and efficient analytical calculation of the accessible surface areas and their gradients for macromolecules. J Comput Chem 19, Rost,B., Yachdav,G., and Liu,J. (2004). The PredictProtein server. Nucleic Acids Res. 32, W321- W Pettersen,E.F., Goddard,T.D., Huang,C.C., Couch,G. S., Greenblatt,D.M., Meng,E.C., and Ferrin,T.E. (2004). UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem 25, He,Q., Makinen,J., Berbers,G., Mooi,F.R., Viljanen,M. K., Arvilommi,H., and Mertsola,J. (2003). Bordetella pertussis protein pertactin induces type-specific antibodies: one possible explanation for the emergence of antigenic variants? J. Infect. Dis. 187, Gzyl,A., Augustynowicz,E., Gniadek,G., Rabczenko,D., Dulny,G., and Slusarczyk,J. (2004). 129

130 130

131 77 Chapter Chapter General Discussion

132 Chapter 7 7 summarizing discussion The Bordetella genus comprises a diverse group of bacterial species, most of which are pathogens. The mammalian (or classical ) bordetellae are comprised of the closely related species B. bronchiseptica, B. parapertussis and B. pertussis. Historically, these are the most thoroughly studied Bordetella species, due to the fact that they are important pathogens to humans, and farm and domestic animals. Although these species are very closely related, they are also remarkably different with respect to their host tropism and clinical course. B. bronchiseptica comprises a genetically diverse lineage that has been isolated from many different mammalian hosts and causes chronic respiratory tract diseases such as kennel cough in dogs and atrophic rhinitis in pigs 1. The genetically limited human pathogen B. pertussis is the etiological agent of the acute respiratory disease known as whooping cough, against which is widely vaccinated. For B. parapertussis, two distinct clonal lineages have been described, a human-specific lineage (B. parapertussis hu ) and a lineage found exclusively in sheep (B. parapertussis ov ), with no evidence of exchange between the two reservoirs 2. Both B. pertussis and B. parapertussis hu cause whooping cough in humans, a highly contagious respiratory tract infection with an infectious period of three weeks or more 3. In general, B. parapertussis hu infections are less severe than B. pertussis infections. In contrast to B. pertussis and B. parapertussis hu, B. bronchiseptica usually causes chronic infections in many mammalian species, including humans, which often remain unnoticed. Further, B. bronchiseptica but not B. pertussis and B. parapertussis has been shown to be able to survive in the environment for a prolonged period of time 4,5. Recently, a third species has presumably causes pertussis-like symptoms, Bordetella holmesii. It was first described in 1995 as a human pathogen that was isolated from the blood of septicemic, immunocompromised patients 6,7. More recently however, B. holmesii has also been isolated from the respiratory tracts of immunocompetent patients with pertussis-like symptoms 8. B. holmesii has been suggested to be very closely related to B. pertussis, based on the presence of B. pertussis-like 16S rrna genes and the B. pertussis-specific insertion sequence element IS481 6,9, although other evidence suggests that it may not be closely related to B. pertussis 10. Not much is known about the biology and epidemiology of B. holmesii. The origin of the disease pertussis remains an enigma. Pertussis, which has very typical symptoms, was one of the major causes of childhood mortality prior to the introduction of vaccines in the 1940s and 1950s. However, no historical descriptions have been found in the European literature prior to the Middle Ages 11. In comparison, numerous descriptions have been found in the ancient Greek literature for diseases such as diphtheria and tetanus, which also had a major impact on child mortality and cause diseases with characteristic symptoms. Due to the lack of references to pertussis-like symptoms in the ancient (European) literature and the limited genetic diversity of B. pertussis, it has been assumed that B. pertussis only recently adapted to humans. 132

133 General Discussion Previous studies indicated that the human-specific pathogens B. pertussis and B. parapertussis hu are derived from distinct B. bronchiseptica-like lineages 2,12, although a specific ancestral lineage for both species has not yet been described. Recently, the complete genome sequences of the mammalian bordetellae have been published, and it was shown that the humanrestricted pathogens B. pertussis and B. parapertussis hu have undergone significant genome reduction compared to B. bronchiseptica 13. It was suggested that this genome reduction was associated with host restriction of B. pertussis and B. parapertussis hu, although the key molecular events are unknown. The phylogenetic position of B. holmesii in the Bordetella genus is still controversial, and it is unknown if and how this species emerged as a human pathogen. The goal of this thesis was to elucidate the phylogenetic relationships between the Bordetella species causing respiratory infections in mammals, and to identify genetic factors that are important for adaptation to the human host in order to further the understanding of hostadaptation in general and that of B. pertussis in particular. 7 In chapter 2, the genetic diversity and evolutionary relationships between B. bronchiseptica, B. parapertussis and B. pertussis are studied by sequencing of housekeeping genes from a large collection of strains. The results supported a phylogeny with four distinct complexes, representing B. pertussis (complex II), B. parapertussis hu (complex III), and two distinct B. bronchiseptica populations (complexes I and IV). Sequencing of the pertactin virulence gene provided further support for this newly-described population structure. The distribution of four insertion sequence elements was determined, and it was shown that B. bronchiseptica complex IV and B. pertussis shared IS1663, implying either common descent or horizontal exchange. Divergence times were calculated for combinations of complexes from the housekeeping gene sequence data. These calculations indicated that B. pertussis and B. bronchiseptica complex IV separated approximately million years ago (Mya), which suggested a more recent divergence time than B. pertussis and B. bronchiseptica complex I, estimated at Mya. The results also suggested that B. parapertussis hu evolved from an animal-associated lineage of B. bronchiseptica (complex I), while B. pertussis evolved from a distinct B. bronchiseptica lineage (complex IV) that may already had a preference for hominids up to 2.5 million years ago. Extant members of this newly-identified B. bronchiseptica lineage were found to circulate in human populations and cause pertussislike disease. The most plausible explanation from these data is that the association of B. pertussis with humans originated in the last common ancestor (LCA) of B. pertussis and B. bronchiseptica complex IV, although it should be noted that the adaptation of B. bronchiseptica complex IV strains to humans is not absolute. Therefore, the possibility remains that the association of B. bronchiseptica complex IV to humans emerged 133

134 Chapter 7 independently after the divergence of B. bronchiseptica complex IV and B. pertussis. Based on the assumption that the LCA of B. bronchiseptica and B. pertussis had an increased preference to humans, the apparent emergence of pertussis in Europe within the last 500 years may be attributable to import via travel or migration; or to the recent acquisition by B. pertussis of the ability to cause more severe, whooping cough-like symptoms. The newly-proposed evolutionary model provides a framework to investigate adaptation to the human host by comparison of B. pertussis to B. bronchiseptica complex I and complex IV. 7 In chapter 3, the gene content of B. bronchiseptica complex I, complex IV and B. pertussis strains were compared at a high resolution genome-wide level using comparative genomic hybridization (CGH) to a Bordetella microarray 14, in order to identify genetic events that are associated with adaptation of B. bronchiseptica complex IV and B. pertussis to the human host. The results of the CGH are interpreted in the context of the mammalian bordetellae evolutionary scenario as proposed in chapter 2. CGH analysis identified the absence of the complete pertussis toxin locus and dermonecrotic toxin gene, as well as a polymorphic LPS biosynthesis locus in B. bronchiseptica complex IV strains compared to B. bronchiseptica complex I and B. pertussis. The observed differences in gene content of the LPS biosynthesis locus were further investigated by LPS gel electrophoresis. In a similar vein to Gupta et al. 15 and Harvill et al. [15], it was proposed that differences between the human-associated Bordetella complexes with regard to these major virulence factors are the result of competition to avoid cross-immunity. Although immunecompetition provides an attractive explanation for the observed differences, the possibility that these genetic differences may reflect differences in niche-occupation or transmission cannot be ruled out. In addition to the observed gene content differences in various major virulence loci, analysis of CGH data also suggested a genome reduction of the genomes of B. bronchiseptica complex IV strains relative to B. bronchiseptica complex I strains. It should be noted that the possibility remains that the complex IV strains have acquired DNA elements, not covered by the microarray, that are important for host-adaptation. Gene content comparison identified a total of 30 genes (including IS1663) that were statistically significantly overrepresented in B. bronchiseptica complex IV strains compared to B. bronchiseptica complex I strains, and 16 of these 30 genes were previously shown to be specific to B. pertussis 14. In contrast, 237 genes were found to be absent or divergent in complex IV strain relative to complex I strains. These results suggest that the genome of B. bronchiseptica complex IV is decreasing in size, as was also observed for the human-adapted pathogens B. pertussis and B. parapertussis hu. Genome reduction has been implied in host-restriction or a change of niche in a number of pathogens 16-18, including B. pertussis and B. parapertussis hu 13, and our results suggest that this process may have already started before the divergence of B. bronchiseptica complex IV and B. pertussis. 134

135 General Discussion Based on CGH analysis, it was suggested that the genomes of B. bronchiseptica complex IV strains may have undergone genome reduction (chapter 3). Although DNA uptake seems to have played an insignificant role in the evolution of the human-adapted species B. pertussis and B. parapertussis hu, the possibility remains that horizontally acquired DNA elements may have been important for host-adaptation and evolution of B. bronchiseptica complex IV strains. In order to identify putative horizontally acquired DNA sequences in B. bronchiseptica complex IV, the genome of the complex I strain B. bronchiseptica RB50, of which the complete genome sequence has been described 13, was subtracted from a mixture of five B. bronchiseptica complex IV genomes by subtractive hybridization (chapter 4), and the distribution of sequences specific to complex IV was determined over complexes I and IV. Our results suggested that limited DNA acquisition has occurred in complex IV strains compared to complex I, and it seems unlikely that uptake of DNA elements has been pivotal to the evolution of B. bronchiseptica complex IV strains. Sequencing of the complete genomes of several members of complex IV may provide the ultimate proof to determine the extent of genome reduction. 7 In chapter 5, the phylogenetic relationship between B. holmesii and the mammalian bordetellae was investigated using a combination of CGH to Bordetella microarrays and sequencing of multiple housekeeping genes. Analysis of CGH data indicated that the majority of the B. holmesii genome diverged significantly from the mammalian Bordetella genomes, suggesting a more distant relationship than was previously assumed from comparison of 16S rrna genes between these species. This was confirmed by analysis of housekeeping gene sequence data, which demonstrated that B. holmesii was in fact much closer related to B. avium, an important pathogen of fowl, and B. hinzii than to the mammalian bordetellae. In spite of the relatively distant phylogenetic relationship between B. holmesii and the mammalian bordetellae, CGH detected a genomic region of 66 kb in the genome of B. holmesii, designated iron-uptake island (IUI) that was highly conserved in the mammalian bordetellae. Partial sequencing of genes in the IUI-region from several B. holmesii strains indicated near-identity to the orthologous sequences in the genomes of the mammalian bordetellae. Due to the presence of several IS481 elements in IUI, it was proposed that B. holmesii acquired this genomic island from B. pertussis. Screening of B. pertussis strains for B. holmesii IUI-specific features identified the lineage to which the atypical B. pertussis strain belonged as a potential donor. By sequencing of 16S rrna genes and Southern blot hybridization with 16S rrna probes, it was shown that B. holmesii contained three 16S rrna gene copies, which were all nearly identical to B. pertussis. The near identity of their 16S rrna genes was proposed to be the result of horizontal gene transfer between B. pertussis and B. holmesii, possibly in conjunction with IUI. 135

136 Chapter 7 7 Comparative genomic analysis identified a region syntenic to the B. holmesii IUI in the genome of the avian pathogen B. avium. Using genome walking, it was shown that the region of synteny between B. avium, B. holmesii, and the classical bordetellae extended beyond the boundaries of IUI, suggesting that the backbone of this chromosomal region is conserved across distantly related Bordetella species. The presence of highly conserved sequences at the 5 and 3 borders of IUI were proposed to have served as the substrates for homologous recombination. The IUI contained all genes necessary for the biosynthesis, export, and uptake of the siderophore alcaligin, which is involved in iron scavenging in a eukaryotic environment. The alcaligin locus was shown to be transcriptionally activated under iron-depleted conditions, and under these conditions, alcaligin production was demonstrated as well. Characterization of IUI in 12 B. holmesii strains identified a transposase-mediated insertion adjacent to the alcaligin operon that encoded a Fur-regulated FecIR-like system that is presumably involved in regulation of iron-uptake. Detailed analysis of the region upstream of the alcaligin biosynthetic locus identified a putative σ 70 (FecI) binding site in the promoter region of alcabcde, suggesting that this locus may also be regulated by the FecIR system, thereby shedding a new light on regulation of alcaligin production, which has been assumed to be solely regulated by Fur and the AraC-like regulator AlcR Alcaligin production has not been detected in B. avium, and its genome does not appear to encode an alcaligin biosynthesis locus, indicating that not all Bordetella species possess the ability to produce this siderophore. Therefore, prior to IUI acquisition, the progenitor of B. holmesii may not have been competent to produce alcaligin. Acquisition of this function by lateral transfer from B. pertussis may have provided B. holmesii with a new, highly efficient iron uptake system, leading to an immediate enhancement of its ability to colonize a eukaryotic host. These results suggest that the acquisition of B. pertussis DNA, by conferring an increased capacity to scavenge free iron in the host environment, has played a key role in the emergence of B. holmesii and its adaptation to humans. In chapter 6, evidence is provided for the presence of 15 positively selected codons in the autotransporter protein pertactin (Prn). Prn is a virulence factor, produced by all mammalian bordetellae, which is used in many current acellular vaccines. The location of these positively selected codons was compared to the location of previously identified epitopes, as well as to putative conformational epitopes as predicted by in silico analysis. The majority of these codons were shown to be located in linear or conformational epitopes (60%), and well exposed to solvent (93%). It is proposed that adaptive changes in these codons may result in immune escape. Possibly, variation in these codons may also reflect adaptation to host receptors or evasion of recognition by BPP-1. These results could also explain the previously described lack of cross-protection of Abs between B. pertussis and B. parapertussis Prn 22,

137 General Discussion Prn contains two amino acid repeat regions (region 1 and 2, or R1 and R2), which have been implicated in evasion of host immunity 24. A statistically significant inversed correlation was found between the length of R1 and R2. Prn sequences with a long R1 sequence combined with a short R2 sequence were found almost exclusively in the human-associated B. pertussis and B. bronchiseptica complex IV strains, while Prn sequences with short R1 and long R2 sequence lengths were found predominantly in B. bronchiseptica complex I and B. parapertussis. Previously, it was observed that R1 and R2 may be part of a single discontinuous epitope (Hijnen et al., unpublished), implicating close proximity of these regions. It is proposed that sequence length variation in R1 may be compensated for by variation in the length of R2, and vice versa, to maintain the close proximity of the variable epitope, or to maintain masking of underlying epitopes. In summary, our data provide a model for the evolution of the Bordetella species that cause respiratory infections in mammalians, and we show that the pertussis-causing humanspecific lineages B. pertussis, B. parapertussis hu and B. holmesii have evolved through different means and from different lineages. The results presented in this thesis have improved our understanding of how Bordetella species have adapted to the human host, and provide a framework for further studies on host adaptation in general and of the Bordetella species in particular

138 7 Chapter 7 reference list 1. Goodnow,R.A. (1980). Biology of Bordetella bronchiseptica. Microbiol.Rev. 44, van der Zee,A., Mooi,F., van Embden,J., Musser,J. (1997). Molecular evolution and host adaptation of Bordetella spp.: phylogenetic analysis using multilocus enzyme electrophoresis and typing with three insertion sequences. The Journal of Bacteriology 179, Mattoo,S., Cherry,J.D. (2005). Molecular Pathogenesis, Epidemiology, and Clinical Manifestations of Respiratory Infections Due to Bordetella pertussis and Other Bordetella Subspecies. Clinical Microbiology Reviews 18, Porter,J.F., Parton,R., Wardlaw,A.C. (1991). Growth and survival of Bordetella bronchiseptica in natural waters and in buffered saline without added nutrients. Applied and Environmental Microbiology 57, Porter,J.F., Wardlaw,A.C. (1993). Long-term survival of Bordetella bronchiseptica in lakewater and in buffered saline without added nutrients. FEMS Microbiol.Lett. 110, Weyant,R.S., Hollis,D.G., Weaver,R.E., Amin,M. F., Steigerwalt,A.G., O Connor,S.P., Whitney,A.M., Daneshvar,M.I., Moss,C.W., Brenner,D.J. (1995). Bordetella holmesii sp. nov., a new gram-negative species associated with septicemia. Journal of Clinical Microbiology 33, Shepard,C.W., Daneshvar,M.I., Kaiser,R.M., Ashford,D.A., Lonsway,D., Patel,J.B., Morey,R. E., Jordan,J.G., Weyant,R.S., Fischer,M. (2004). Bordetella holmesii bacteremia: a newly recognized clinical entity among asplenic patients. Clin.Infect. Dis. 38, Mazengia,E., Silva,E.A., Peppe,J.A., Timperi,R., George,H. (2000). Recovery of Bordetella holmesii from Patients with Pertussis-Like Symptoms: Use of Pulsed-Field Gel Electrophoresis To Characterize Circulating Strains. Journal of Clinical Microbiology 38, Loeffelholz,M.J., Thompson,C.J., Long,K.S., Gilchrist,M.J.R. (2000). Detection of Bordetella holmesii Using Bordetella pertussis IS481 PCR Assay. Journal of Clinical Microbiology 38, Gerlach,G., Janzen,S., Beier,D., Gross,R. (2004). Functional characterization of the BvgAS twocomponent system of Bordetella holmesii. Microbiology 150, Major R.H. (1945). Classic Descriptions of Disease. Springfield, C. C. Thomas. 12. Musser,J.M., Hewlett,E.L., Peppler,M.S., Selander,R. K. (1986). Genetic diversity and relationships in populations of Bordetella spp. The Journal of Bacteriology 166, Parkhill,J., Sebaihia,M., Preston,A., Murphy,L.D., Thomson,N., Harris,D.E., Holden,M.T., Churcher,C. M., Bentley,S.D., Mungall,K.L., Cerdeno-Tarraga,A. M., Temple,L., James,K., Harris,B., Quail,M.A., Achtman,M., Atkin,R., Baker,S., Basham,D., Bason,N., Cherevach,I., Chillingworth,T., Collins,M., Cronin,A., Davis,P., Doggett,J., Feltwell,T., Goble,A., Hamlin,N., Hauser,H., Holroyd,S., Jagels,K., Leather,S., Moule,S., Norberczak,H., O Neil,S., Ormond,D., Price,C., Rabbinowitsch,E., Rutter,S., Sanders,M., Saunders,D., Seeger,K., Sharp,S., Simmonds,M., Skelton,J., Squares,R., Squares,S., Stevens,K., Unwin,L., Whitehead,S., Barrell,B.G., Maskell,D. J. (2003). Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nat Genet. 35, Cummings,C.A., Brinig,M.M., Lepp,P.W., Van De,P. S., Relman,D.A. (2004). Bordetella species are distinguished by patterns of substantial gene loss and host adaptation. J Bacteriol. 186, Gupta,S., Maiden,M.C., Feavers,I.M., Nee,S., May,R. M., Anderson,R.M. (1996). The maintenance of strain structure in populations of recombining infectious agents. Nat.Med. 2, Parkhill,J., Wren,B.W., Thomson,N.R., Titball,R.W., Holden,M.T., Prentice,M.B., Sebaihia,M., James,K. D., Churcher,C., Mungall,K.L., Baker,S., Basham,D., Bentley,S.D., Brooks,K., Cerdeno-Tarraga,A.M., Chillingworth,T., Cronin,A., Davies,R.M., Davis,P., Dougan,G., Feltwell,T., Hamlin,N., Holroyd,S., Jagels,K., Karlyshev,A.V., Leather,S., Moule,S., Oyston,P.C., Quail,M., Rutherford,K., Simmonds,M., Skelton,J., Stevens,K., Whitehead,S., Barrell,B.G. (2001). Genome sequence of Yersinia pestis, the causative agent of plague. Nature 413, Chain,P.S.G., Carniel,E., Larimer,F.W., Lamerdin,J., Stoutland,P.O., Regala,W.M., Georgescu,A.M., Vergez,L.M., Land,M.L., Motin,V.L., Brubaker,R.R., Fowler,J., Hinnebusch,J., Marceau,M., Medigue,C., Simonet,M., Chenal-Francisque,V., Souza,B., 138

139 General Discussion Dacheux,D., Elliott,J.M., Derbise,A., Hauser,L.J., Garcia,E. (2004). Insights into the evolution of Yersinia pestis through whole-genome comparison with Yersinia pseudotuberculosis. Proceedings of the National Academy of Sciences Nierman,W.C., DeShazer,D., Kim,H.S., Tettelin,H., Nelson,K.E., Feldblyum,T., Ulrich,R.L., Ronning,C. M., Brinkac,L.M., Daugherty,S.C., Davidsen,T.D., Deboy,R.T., Dimitrov,G., Dodson,R.J., Durkin,A. S., Gwinn,M.L., Haft,D.H., Khouri,H., Kolonay,J. F., Madupu,R., Mohammoud,Y., Nelson,W.C., Radune,D., Romero,C.M., Sarria,S., Selengut,J., Shamblin,C., Sullivan,S.A., White,O., Yu,Y., Zafar,N., Zhou,L., Fraser,C.M. (2004). Structural flexibility in the Burkholderia mallei genome. Proceedings of the National Academy of Sciences Beaumont,F.C., Kang,H.Y., Brickman,T.J., Armstrong,S.K. (1998). Identification and characterization of alcr, a gene encoding an AraClike regulator of alcaligin siderophore biosynthesis and transport in Bordetella pertussis and Bordetella bronchiseptica. The Journal of Bacteriology 180, Brickman,T.J., Kang,H.Y., Armstrong,S.K. (2001). Transcriptional activation of Bordetella alcaligin siderophore genes requires the AlcR regulator with alcaligin as inducer. The Journal of Bacteriology 183, Pradel,E., Guiso,N., Locht,C. (1998). Identification of AlcR, an AraC-type regulator of alcaligin siderophore synthesis in Bordetella bronchiseptica and Bordetella pertussis. The Journal of Bacteriology 180, Khelef,N., Danve,B., Quentin-Millet,M.J., Guiso,N. (1993). Bordetella pertussis and Bordetella parapertussis: two immunologically distinct species. Infect.Immun. 61, David,S., van,f.r., Mooi,F.R. (2004). Efficacies of whole cell and acellular pertussis vaccines against Bordetella parapertussis in a mouse model. Vaccine 22, King,A.J., Berbers,G., van Oirschot,H.F., Hoogerhout,P., Knipping,K., Mooi,F.R. (2001). Role of the polymorphic region 1 of the Bordetella pertussis protein pertactin in immunity. Microbiology 147,

140 140

141 Samenvatting Nederlandse Samenvatting Nederlandse

142 Dutch Summary A Het genus Bordetella bestaat uit een negental aanverwante bacteriesoorten, waarvan de meeste infectieziektes kunnen veroorzaken. Drie soorten veroorzaken frequent luchtweginfecties in verschillende zoogdieren, te weten Bordetella bronchiseptica, Bordetella parapertussis en Bordetella pertussis. Deze drie bacteriesoorten worden samen ook wel de klassieke of zoogdier bordetellae genoemd. Ze zijn zeer nauw aan elkaar verwant, maar desondanks vertonen ze toch ook opmerkelijke verschillen wat betreft hun gastheerbereik en ziekteverloop. B. bronchiseptica heeft een wijd uiteenlopend gastheerbereik en veroorzaakt voornamelijk chronische infecties die vaak onopgemerkt kunnen blijven. Zo veroorzaakt hij bijvoorbeeld kennelhoest bij honden, maar daarnaast kan B. bronchiseptica ook mensen infecteren. Algemeen wordt echter aangenomen dat deze mensen geïnfecteerd raken als gevolg van een verminderde weerstand. Als enige van de zoogdier bordetellae kan B. bronchiseptica ook buiten de gastheer overleven en zich zelfs daar vermenigvuldigen, bijvoorbeeld in het drinkwater van besmet vee. B. pertussis is de belangrijkste veroorzaker van kinkhoest in de mens, een zeer ernstige en besmettelijke ziekte van de bovenste luchtwegen. In Nederland wordt vrijwel ieder kind gevaccineerd tegen B. pertussis. Naast B. pertussis kan ook B. parapertussis kinkhoest veroorzaken in mensen, al zijn B. parapertussis infecties in het algemeen minder ernstig. B. parapertussis bestaat eigenlijk uit twee verschillende groepen, waarvan de één exclusief in mensen voorkomt (B. parapertussis hu ) en de ander uitsluitend in schapen (B. parapertussis ov ). Kinkhoest is vooral zeer ernstig in jonge, niet (volledig) gevaccineerde kinderen, al kunnen ook volwassenen ernstige ziektesymptomen vertonen. Geïnfecteerde personen zijn gedurende drie of meer weken besmettelijk. Besmetting vindt plaats via aërosolen die vrijkomen tijdens hevige, repeterende hoestaanvallen. Vrij recent is een nieuwe Bordetella soort beschreven waarvan wordt aangenomen dat deze ook mogelijk kinkhoest kan veroorzaken, Bordetella holmesii. Deze soort werd voor het eerst in 1995 ontdekt, in eerste instantie in het bloed van patiënten met een verzwakt immuunsysteem, maar later ook in de luchtwegen van voorheen gezonde patiënten met kinkhoest-symptomen. Er is tot op heden niet veel bekend over de transmissie en epidemiologie van B. holmesii. Er is veel onduidelijkheid over de origine van kinkhoest. De symptomen van kinkhoest zijn zeer karakteristiek, en voordat er op grote schaal werd gevaccineerd, kreeg vrijwel ieder kind kinkhoest. Daarom is het verrassend dat er vóór de Middeleeuwen geen enkele historische beschrijving is terug te vinden van kinkhoest in de Europese literatuur. Ter illustratie, van andere ziektes met zeer karakteristieke symptomen en een grote mortaliteit onder kinderen, zoals difterie en tetanus, zijn referenties terug gevonden tot in de Oudgriekse literatuur. Door het ontbreken van pré-middeleeuwse beschrijvingen van kinkhoest en het homogene karakter van B. pertussis wordt algemeen aangenomen dat deze soort zich pas zeer recent heeft aangepast aan de mens. Verschillende studies hebben aangetoond dat zowel B. pertussis als B. parapertussis hu zijn 142

143 Nederlandse Samenvatting geëvolueerd uit B. bronchiseptica, al is onduidelijk hoe dit precies is gebeurd. Uit een vergelijking van hun genomen blijkt dat zowel de genomen van B. pertussis als van B. parapertussis hu aan verval onderhevig zijn. In beide genomen vindt grootschalige inactivatie van genen plaats door het accumuleren van zogenaamde insertie-elementen, dit zijn mobiele DNA-elementen die door het genoom kunnen springen en zodoende genen kunnen inactiveren. Dit verval wordt toegeschreven aan de verregaande aanpassing aan de mens, waardoor veel genen niet meer nodig zijn, waaronder bijvoorbeeld genen die belangrijk zijn voor overleving in het milieu. Het is echter onbekend wat de belangrijkste genetische veranderingen zijn geweest die invloed hebben gehad op hun aanpassing aan de mens. De relatie van B. holmesii ten opzichte van de andere zoogdier bordetellae is nog steeds aan discussie onderhevig, en het is onbekend of, en hoe deze soort als menselijke pathogeen is ontstaan. Het doel van dit onderzoek was om inzicht te verkrijgen in de onderlinge relaties van de Bordetella soorten die luchtweginfecties in zoogdieren veroorzaken, teneinde genetische factoren te identificeren die belangrijk zijn geweest voor hun aanpassing aan de mens. Dit kan belangrijke inzichten geven over hoe bacteriën zich aanpassen aan de mens. A In hoofdstuk 2 worden de evolutionaire relaties tussen de drie zoogdier bordetellae bestudeerd. Voor dit doel is van een groot aantal bacteriestammen de DNA volgordes van verschillende genen bepaald; daarnaast is ook de distributie van verschillende insertieelementen over deze stammen bepaald. Dit resulteerde in een opdeling van de populatie in vier verschillende groepen (complexen), B. pertussis (complex II), B. parapertussis hu (complex III) en twee afzonderlijke B. bronchiseptica complexen, complex I en IV. B. bronchiseptica stammen uit complex IV bleken vooral uit mensen te zijn geïsoleerd en waren nauw verwant aan B. pertussis. Mogelijk vertegenwoordigt B. bronchiseptica complex IV de evolutionaire voorouder van B. pertussis. Aan de hand van de populatiestructuur zoals bepaald in hoofdstuk 2, is in hoofdstuk 3 een gedetailleerde genoom-analyse gedaan van B. bronchiseptica complex I en IV en B. pertussis. Hierbij werden verschillende belangrijke genetische factoren geïdentificeerd die waarschijnlijk belangrijk kunnen zijn geweest bij de aanpassing van B. bronchiseptica complex IV aan de mens. De uitkomst van dit onderzoek suggereerde dat de genomen van de complex IV stammen aan verval onderhevig zijn. In hoofdstuk 4 wordt verder bestudeerd of de genomen van complex IV inderdaad aan verval onderhevig zijn. De genomen van de twee B. bronchiseptica complexen, complex I en IV, zijn met elkaar vergeleken om genen te identificeren die uniek zijn voor complex IV stammen en niet voorkomen in complex I. Doordat deze genen vrijwel niet ontdekt werden, 143

144 Summary in Dutch werd bevestigd dat complex IV stammen inderdaad aan genoomverval onderhevig zijn. Om de evolutionaire positie van B. holmesii op te helderen is in hoofdstuk 5 gekeken naar de relatie van B. holmesii ten opzichte van B. bronchiseptica, B. pertussis en B. parapertussis. Hieruit bleek dat B. holmesii, in tegenstelling tot wat eerst werd aangenomen, niet nauw verwant is met B. pertussis. Wel werd er een groot DNA element (genomisch eiland) geïdentificeerd dat waarschijnlijk van B. pertussis naar B. holmesii is overgedragen. Dit eiland bevat genen die betrokken zijn bij actieve opname van ijzer onder omstandigheden met lage concentraties vrij ijzer. In mensen (en andere zoogdieren) wordt de hoeveelheid vrij ijzer kunstmatig laag gehouden door fixatie met bijvoorbeeld hemoglobine, zodat bacteriën zich niet vrij kunnen vermenigvuldigen in de mens. Dit eiland kan bij hebben gedragen aan de aanpassing van B. holmesii aan de mens. A In hoofdstuk 6 is onderzocht welke regio s van het eiwit pertactine aan selectieve druk bloot staan om te veranderen. Pertactine is een eiwit dat betrokken is bij aanhechting van de bacterie aan epitheelcellen in de luchtwegen, en is een belangrijke component van veel huidige kinkhoest vaccins. Na vergelijking van een groot aantal pertactine sequenties is met behulp van modellering een aantal regio s en aminozuren geïdentificeerd die belangrijk kunnen zijn voor ontwijking van het immuunsysteem. Daarnaast werd een correlatie gevonden tussen de lengtes van twee variabele regio s in pertactine. Dit kan invloed hebben op het afschermen van bepaalde delen van het eiwit en zodoende herkenning door het immuunsysteem te voorkomen. Het onderzoek beschreven in dit proefschrift geeft inzichten in hoe bacteriën zich aanpassen aan de menselijke gastheer in het algemeen, en in het bijzonder hoe de Bordetella soorten die luchtweginfecties in mensen veroorzaken zich genetisch hebben aangepast aan de mens. Tenslotte kunnen de in dit proefschrift afgeleide fylogenetische verwantschappen tussen stammen die een verschillende gastheerspecificiteit vertonen, gebruikt worden om de processen betrokken bij gastheeradaptatie te onderzoeken. 144

145 Dankwoord Dankwoord

146 Word of Gratitude So long and thanks for all the fish!!!! Zoals Arthur Dent in The Hitchhiker s Guide to the Galaxy een rondreis door het heelal begon, is mijn AIO-tijd voor mij, wellicht op een iets kleinere schaal, ook een reis geweest, met veel ontdekkingen en verrassingen. Tijdens deze reis heb ik veel dingen bijgeleerd, over mijzelf en ook over het omgaan met moeilijke situaties in je werk en daarbuiten. Er zijn een aantal mensen geweest die tijdens deze reis voor mij een speciale betekenis hebben gehad, en ik wil graag deze gelegenheid benutten om hun persoonlijk bedanken. Ik zal ongetwijfeld ook mensen vergeten, maar ik ben hun ook zeker dankbaar. Frits, het moet met momenten moeilijk zijn geweest om niet één, maar twee eigenwijze jonge AIO s onder je hoede te hebben gehad. Ik wil je graag bedanken voor al je hulp en begeleiding, en vooral voor het feit dat je altijd tijd over had voor mij. Hopelijk breekt er nu een rustigere periode aan! B Leo, toen ik na twee jaar weer terugkwam op het RIVM, heb ik erg veel gehad aan onze discussies, en ik heb het erg op prijs gesteld dat ik vaak zomaar even binnen kon lopen om met je te overleggen over het één of het ander. Ik kijk er naar uit om met je samen te gaan werken! Marjolein en Han, ik heb het ontzettend fijn gevonden dat jullie de afgelopen twee jaar zoveel klusjes hebben opgeknapt voor mij! Ik heb in die tijd veel van jullie geleerd, zowel op persoonlijk vlak als op de labvloer. De rest van de kinkhoestgroep, Kees en Audrey, dank jullie voor alles, de WOL s zullen straks een stuk korter duren denk ik. De rest van S2: Sanne, Ingrid, Sandra, Corrie, bedankt voor alle mooie momenten op het RIVM. Het zal straks een stuk rustiger worden tijdens de lunchpauzes denk ik! De rest van het LTR, bedankt voor een mooie tijd, ik heb me altijd erg thuis gevoeld op het LTR. Het ga jullie goed! Betsy, bedankt voor het inwerken in het LPS werk, ik heb onze discussies laat op de avond altijd ontzettend leuk gevonden. Als al onze plannen met het RIVM nu eens werkelijkheid zouden worden... Ik ga er van uit dat je je volleybalploeg gewoon weer afbelt op 10 februari! Mijn studenten, Miranda en Zena, wil ik bij deze ook graag bedanken voor hun inzet. Zena, ik wens je veel succes de komende tijd, en ga vooral niet aan jezelf twijfelen, dat is altijd het laatste wat je moet gaan doen! 146

147 Dankwoord Mijn kamergenootjes van G Toen ik nog in mijn eentje de complete kinkhoestgroep vormde, heb ik altijd erg veel steun gehad aan jullie! Suzan en Noortje, die lunchafspraak is er dan toch nog van gekomen! Niki, je Griekse bijles heeft helaas niet veel geholpen, maar hopelijk leer ik straks vanzelf wat meer Grieks bij. Bent en Pieter-Jan, we hebben samen een geweldige tijd gehad! BBQ-en bij -10 C, tijdens een windhoos, of gewoon bij een hittegolf, BBQ-en kan altijd! Horror Night moeten we zeker een keer overdoen, dan kunnen we gelijk die Soccaroos laten zien hoe het echt moet! Jullie zijn in ieder geval altijd welkom! Los Passionatos was voor mij altijd heel bijzonder, met zijn 10-en voetballen op 20 vierkante meter, maar wel altijd met passie! Ik heb er van genoten! De rest van het EWI, ik heb mijn tijd bij jullie erg fijn gevonden! I would also like to thank all the people in the Relman lab, I ve really enjoyed my time in your lab, and you have always made me feel at home. Elies, thanks for taking care of me. I always enjoyed our weekendtrips. I really should more often! Craig, thanks for introducing me into the world of microarrays, and for always being critical about our manuscripts. Mary, thanks for all the help when this tall Dutch guy came over from Europe to work on Bordetella microarrays. David, thanks for giving me the opportunity to work in your lab, I have really enjoyed our collaboration, and who knows, we may meet again in the future! B Dan kom ik nu bij de mensen die voor mij een extra speciale betekenis hebben (gekregen). Peter en Tineke (en Ben en Loes), jullie ook bedankt voor alle steun. Nu ga ik dan toch echt afstuderen! Marcel, ik ken je eigenlijk pas vijf jaar, maar het feit dat je mijn getuige was tijdens mijn bruiloft spreekt denk ik voor zich. Jij en Candida zijn in de afgelopen vijf jaar erg goede vrienden van ons geworden. Bedankt voor je steun in alle momenten dat ik het even niet meer zag zitten. Ach, 15 km is niet zo ver, toch?! Tineke, zoals je pas geleden nog zo mooi zei, ik ken je al mijn hele leven. Onze tijd in Wageningen heeft ons denk ik pas echt dicht bij elkaar gebracht als broer en zus, en een paar 147

148 Word of Gratitude jaar aan de andere kant van de wereld gaat dat echt niet veranderen! Je zult altijd mijn grote zus(je) blijven! Bedankt voor alle steun, en we komen elkaar zeker opzoeken! Pap, mam, zonder jullie steun, belangstelling en liefde zou ik dit alles niet hebben kunnen doen. Nu weten jullie net wat ik nu doe, ga ik weer aan iets anders met een moeilijke naam werken! Ik hoop dat jullie trots op me kunnen blijven in de toekomst. Bedankt voor alles! Tenslotte... lieve Cecile, hoe zou ik ooit in woorden kunnen uitdrukken wat jij voor mij betekent en wat voor steun ik aan je heb gehad? Ik weet heel goed wat dit allemaal voor jou heeft betekent, elke keer als ik s avonds laat en in het weekend weer aan mijn proefschrift zat te werken. B Ik wil je ontzettend bedanken voor alles wat je voor me hebt gedaan. Jij bent vanaf het begin mijn guide geweest! Zonder jou zou ik verdwaald zijn in die eindeloze ruimte. 148

149 Vitae Curriculum Vitae Curriculum

150 Curriculum Vitae Dimitri Diavatopoulos was born on December 4th, 1976 in Lage Zwaluwe, the Netherlands, where he grew up. He graduated from high school (Nassau College) in Breda in In the same year he went to study Bioprocess Engineering at Wageningen University. He did a seven month internship at the Department of Virology (Wageningen University), during which he worked on the White Spot Syndrome Virus, under the supervision of Prof. Dr. J.M. Vlak and Dr. M.C. van Hulten. This was followed by a second internship of seven months at the Department of Cell Biology and Immunology, during which he studied aspects of crustacaean immunology to the White Spot Syndrome Virus, supervised by Dr. R.J. Stet. After this he did a final internship of six months at the Laboratory for Vaccine-Preventable Diseases (National Institute for Public Health and the Environment, Bilthoven, The Netherlands), during which he first studied whooping cough (supervised by Prof. Dr. F.R. Mooi and Dr. I.H. van Loo). After receiving his Master of Science degree in 2000, he commenced his graduate training at the Eijkman-Winkler Institute (University Medical Center Utrecht) and the Laboratory for Vaccine-Preventable Diseases, under the supervision of Prof. Dr. F.R. Mooi and Dr. L.M. Schouls. During that time, he also spent three months at the Relman Laboratory at Stanford University. After his graduation, he hopes to continue his career in Australia to work on pneumococci. C 150

151 Curriculum Vitae Dimitri Diavatopoulos werd op 4 december 1976 geboren in Lage Zwaluwe. In 1995 behaalde hij het VWO diploma aan het Nassau College te Breda. In hetzelfde jaar ging hij Bioprocestechnologie studeren aan Wageningen Universiteit, waar in 1996 het propedeuse werd behaald. Na een zeven maanden durende afstudeerstage bij de vakgroep Virologie in Wageningen aan het White Spot Syndrome Virus (onder begeleiding van Prof. Dr. J.M. Vlak en Dr. M.C. van Hulten) werd een afstudeerstage van zeven maanden gevolgd bij de vakgroep Celbiologie en Immunologie, waarbij de immunologische aspecten van het White Spot Syndrome Virus werden bestudeerd (begeleid door Dr. R.J. Stet). Hierna werd een stage gevolgd bij Prof. Dr. F.R. Mooi en Dr. I.H. van Loo, waarbij hij kennismaakte met kinkhoest. Na het behalen van het doctoraal in 2000 werd direct begonnen met zijn promotieonderzoek, wat plaats heeft gevonden onder begeleiding van Prof. Dr. F.R. Mooi en Dr. L.M. Schouls. Dit onderzoek vond plaats aan twee instanties, het Laboratorium ter Toetsing van het Rijksvaccinatieprogramma (Rijksinstituut voor Volksgezondheid en het Milieu, Bilthoven) en aan het Eijkman-Winkler Instituut (Universitair Medisch Centrum Utrecht). In het kader van zijn promotieonderzoek werd in 2003 een bezoek van drie maanden gebracht aan het Relman Laboratorium (Stanford University, CA, USA). Hij hoopt zijn loopbaan te vervolgen in Australië om daar te gaan werken aan pneumokokken. C 151

152 152

153 Appendix Appendix

154 Color Figures Chapter 1 D Figure 1. Respiratory tract infection model of humans by Bordetella bronchiseptica, Bordetella parapertussis and Bordetella pertussis. Bacteria enter the host through inhalation of aerosols. Adherence takes place in the nasal cavity, followed by colonization of the pharynx and the trachea and in rare cases the lungs. They subsequently pass through different Bvg phases during infection, depending on the level of phosphorylation of BvgA, which is modulated by environmental signals such as temperature. The Bvg - phase (the avirulent phase) is thought to be important for survival outside the host, and in this phase the virulence-repressed genes (vrgs) are expressed. B. bronchiseptica expresses flagella for motility and urease in the bvg - phase. The Bvg i phase is thought to be important for initial colonization of the nasopharynx, and is characterized by optimal expression of BipA. In the Bvg + phase, the virulence-activated genes are expressed (vags), including adhesins and toxins. This phase may be divided in an early and a late phase. In the early Bvg + phase, adhesins are expressed but not toxins, and this phase is associated with colonization of the upper respiratory tract. The late Bvg + phase is characterized by expression of toxins in addition to adhesins, and these toxins may modulate the immune system of the host for <26 C Bvg - Flagella O-antigen Urease vrgs Bordetella BvgA-phosphorylation Larynx Primary bronchi 35 C 37 C Bvg i Bvg + BipA BrkA/BrkB Early genes TTSS FHA Prn Fim TcfA Dnt Late genes vags Ptx CyA Nasal cavity Pharynx Trachea Upper respiratory tract survival and may contribute to induction of disease symptoms that are important for transmission. The list of virulence factors is incomplete, and only represents the most studied virulence factors. Other virulence factors, either controlled by BvgAS or not, may be important for transmission as well. Abbreviations: Bvg, Bordetella virulence gene; vrgs, virulence-repressed genes; BipA, Bvg intermediate phase protein A; BrkA/B, Bordetella resistance to killing A/B; TTSS, type III secretion system; Prn, pertactin; TcfA, tracheal colonization factor A; Dnt, dermonecrotic toxin; FHA, filamentous haemagglutinin; Fim, fimbriae; Ptx, pertussis toxin; CyA, adenylate cyclase. Lungs Lower respiratory tract 154

155 Color Figures Chapter 2 B. bronchiseptica complex I 3 IS1001 (100%) B. parapertussis hu complex III IS1001 (100%) IS1002 (100%) IS481 (40%) B. pertussis complex II IS481 (100%) IS1002 (100%) IS1663 (100%) B. bronchiseptica complex IV IS1663 (80%) human origin animal origin unknown STs containing sequenced strains (Tohama, RB50 or 12822) IS1001 (83%) D Figure 1. Minimum spanning tree of B. bronchiseptica, B. pertussis and B. parapertussis. The tree was based on the sequence of seven housekeeping genes. Individual genes were split into five sub-loci, and a categorical clustering was performed. In the minimum spanning tree, sequence types (STs) sharing the highest number of single locus variants were connected first. Each circle represents an ST, the size of which is related to the number of isolates belonging to that particular ST. Colors within circles indicate hostdistribution. The numbers between connected STs represent the number of different sub-loci between those STs. The clonal complexes (I, II, III and IV) are indicated by colored strips between connected STs. ST16 (B. bronchiseptica complex I) harbors the B. parapertussis ov strains. STs containing strains of which the genome has been sequenced (B. pertussis Tohama, B. parapertussis or B. bronchiseptica RB50) are indicated by a thickset, dashed line. The distribution of the insertion sequence elements IS481, IS1001, IS1002 and IS1663 is shown in boxes; numbers between parentheses indicate the percentage of strains that contained the ISE as determined by PCR amplification. 155

156 Color Figures Chapter 2 95% % 100 B. bronchiseptica complex IV 30% animal n=10 70% human B. pertussis complex II n=26 100% human B. bronchiseptica complex I 65% animal n=71 31% human 4% unknown Figure 2. UPGMA tree based on the analysis of the pertactin gene of Bordetella isolates used in the MLST analysis. The DNA segment coding for the extracellular domain of pertactin (P.69) was used for analysis, with the exclusion of the repeat regions 1 and 2. Bootstrap values are shown for the nodes separating the complexes and are based on 500 bootstrap replicates. The scale indicates the genetic distance along the branches. Colors of the branches indicate the four complexes as defined by MLST. The number of strains of each branch is shown in boxes, as well as the host distribution. 100 D B. parapertussis hu complex III n=9 100% human Figure 4. Model of the evolution of the mammalian bordetellae. The bar on the left indicates increasing degrees of adaptation to the human host. Arrows indicate descent. Abbreviations: LCA, last common ancestor. human-adapted broad host range B. pertussis complex II LCA complex IV B. bronchiseptica complex I B. bronchiseptica complex IV B. parapertussis hu complex III 156

157 Color Figures Chapter 3 B. pertussis Tohama B. bronchiseptica RB50 Complex I B0084 ST31 B0189 ST27 B0224 ST6 B0227 ST23 B0230 ST6 B0238 ST27 B0242 ST7 B0251 ST23 B0258 ST10 B1975 ST6 B1985 ST6 B1986 ST6 B2112 ST7 Complex IV B0232 ST18 B0243 ST28 B0259 ST29 B1968 ST22 B1969 ST18 B2114 ST25 B2490 ST9 B2491 ST8 B2492 ST21 B2494 ST15 B2495 ST17 B2496 ST3 B2506 ST34 ptxa ptxb ptxb ptxd ptxe ptxc ptxc ptla ptlb ptlc ptld ptli ptle ptlf ptlg ptlh dnt tcfa (BP) prn (BP) prn (BB/BPP) prn (BB/BPP) alca alcb alcc alcd alce alcr alcs faua pertussis toxin pertussis toxin secretion dermonecrotic toxin tracheal colonization factor A pertactin alcaligin D Figure 1. Gene content of the differentially hybridizing virulence loci between B. bronchiseptica complex I and IV, as determined by SAM analysis of CGH data. Each column represents one strain. Strain numbers and sequence types (ST) are indicated above the columns. Each row represents one ORF (in B. bronchiseptica RB50 gene order), ORF designations are shown to the right of the rows. In the case of tcfa and prn, the origins of the probes are indicated between parentheses. The BP probe of tcfa was 100% similar to B. pertussis Tohama and 85.1% similar to B. bronchiseptica RB50. The BP prn probe was 100% similar to B. pertussis Tohama and 86% similar to B. parapertussis and B. bronchiseptica RB50. The BB/BPP prn probes were both 100% similar to B. parapertussis (BPP) and B. bronchiseptica RB50 (BB) and 86% similar to B. pertussis Tohama. The yellow-black-blue color scale indicates the hybridization value relative to the reference; references are B. bronchiseptica RB50, B. parapertussis and B. pertussis Tohama. For B. bronchiseptica RB50 and B. pertussis Tohama, the data in the figure are based on the genomic sequences. Yellow, black and blue indicate decreased hybridization, hybridization values comparative to the references, and increased hybridization (e.g. due to gene duplication), respectively. Intermediate values indicate partial deletions or sequence divergence. Missing data are represented in grey. 157

158 Color Figures Chapter 3 A. Complex I Complex IV BP Tohama BB RB50 B0084 ST31 B0189 ST27 B0224 ST6 B0227 ST23 B0230 ST6 B0238 ST27 B0242 ST7 B0251 ST23 B0258 ST10 B1975 ST6 B1985 ST6 B1986 ST6 B2112 ST7 B0232 ST18 B0243 ST28 B0259 ST29 B1968 ST22 B1969 ST18 B2114 ST25 B2490 ST9 B2491 ST8 B2492 ST21 B2494 ST15 B2495 ST17 B2496 ST3 B2506 ST34 O-antigen band A band B O-antigen band A D B band B LPS genetic profile pagp pagl lpxa lpxb lpxc lpxd lpxh lpxk lpxk waaa waac wlba wlbb wlbc wlbd wlbe wlbf wlbg wlbh wlbi wlbjk wlbl wbma wbmb wbmc wbmd wbme wbmf wbmg wbmh wbmi wbmj wbmk wbml wbmm wbmn wbmo wbmr wbms BB0124 BB0125 BB0126 BB0127 BB0127 wbmu wbmt wbms wbmr wbmq wbmp (de)acylation lipida lipida inner core trisaccharide O-antigen alternative O-antigen

159 Color Figures Chapter 3 Figure 2. Expression of LPS by B. bronchiseptica complex I and complex IV strains and gene content variation at the LPS biosynthesis locus. A. Top panel: Electrophoretic LPS profiles obtained by tricine-sds-page and silver staining. Middle panel: Western blot of the same samples with mab 36G3, which detects band A. Bottom panel: Western blot of the same samples with mab BL8, which detects band B. B. Gene content of the LPS biosynthesis locus as determined by CGH. See Figure 1 for details. For B. bronchiseptica RB50 and B. pertussis Tohama, the data in the figure are based on the genomic sequences. The genes wbmpqrstu represent an alternative LPS O-antigen biosynthesis sublocus that is orthologous to the genes found in B. parapertussis [2] and B. bronchiseptica C7635E [21]. LPS genetic profiles as described in the text are indicated at the top of the columns. Color scale as in Figure 1. Missing data are represented in grey. Figure 3. Model of the evolution of the mammalian bordetellae. The bar on the left indicates increasing degrees of adaptation to the human host. Arrows indicate descent; double arrows between complexes indicate possible withinhost immune-competition. In boxes, genetic events are shown that may have played a role in speciation and niche adaptation. See text for details. Abbreviations: LCA, last common ancestor. human-adapted broad host range B. pertussis complex II Ptx expression Type III secretion off Deleted or inactivated O-antigen locus Autotransporters Type II capsule Acquired IS481, IS1002 Genome decay LCA complex IV Acquired BP0072 transposase IS lineage-specific genes Genome decay B. bronchiseptica complex I B. bronchiseptica complex IV Deleted Ptx Dnt LPS polymorphism Genome decay Immune competition B. parapertussis hu complex III No Ptx expression Type III secretion off Deleted or inactivated Type II capsule Acquired IS1002 Genome decay D 159

160 Color Figures Chapter 5 A. B. log 2 (B. holmesii intensity/reference intensity) BP0001 B holmesii BP Tohama B0436 B1855 B0437 B2739 B2738 B1851 B1853 B1850 B1854 B2767 B1852 B2768 BP0783 BP0787 BP0794 BP0798 BP2447 BP2450 alcabcders faua mar intergenic region BP2465 vrg-6 BP2475 BP2476 kdpabcde D BP2499 BP2502 IS481 IS1001 insertion IS1002 IS1663 elements BB Figure 1A. CGH of 12 B. holmesii isolates to a microarray comprising the genomes of B. pertussis Tohama, B. parapertussis and B. bronchiseptica RB50. The running average (window = 3) of the mean log 2 (Cy5/Cy3) of 12 B. holmesii genomes is plotted on the X-axis. Microarray probes are arranged on the Y-axis in B. pertussis Tohama genome order. B. Probes that hybridized to the B. holmesii genome with comparable strength to the reference, and adjacent non-hybridizing probes, are shown in detail for individual B. holmesii strains and for B. pertussis Tohama. A selection of probes, representing insertion sequence elements are also shown. Strain numbers are indicated above the columns. Each row represents one probe in B. pertussis Tohama gene order. ORF and gene designations are shown for a selection of probes. The relative hybridization value (log 2 (Cy5/Cy3)) is indicated by the yellow-black-blue color scale. Missing data are represented in grey. 160

161 Color Figures Chapter 5 A. B. avium BP2499 BP2477 BP0794 BP0787/2450 BP2453 B. holmesii * BP2485 BP2492 BP2499 BP2477 BP2450 BP2453 BP0794 BP0787 B. pertussis B. bronchiseptica 5 kb Orthologs not found in all species Orf replaced by bhoabcde Conserved IUI-flanking ORFs Variably present in B. holmesii isolates * Alcaligin operon B. holmesii insertion IS481 elements BP0787/2450 orthologs Orthologs found in all species B. BP2465 Fe-alcaligin receptor BhoA FecIR marc alcabcde regulation + alcaligin export alcaligin biosynthesis BP2455 orfb orfa bhob bhoc bhod bhoe alca alcb alca alcc alcd alce alcr alcs faua Fur binding site σ 70 binding site Figure 2. Comparative analysis of the genomic organization of the iron-uptake island (IUI) in B. avium, B. holmesii, B. pertussis and B. bronchiseptica. A. Representation of the ORF organization of the IUI in B. holmesii and comparison to orthologous regions in the genomes of B. bronchiseptica RB50, B. pertussis Tohama and B. avium 197N. Deletions or insertions between species are indicated by grey surfaces. Dashed lines connect the ORFs at the borders of the orthologous sequences. The ORF composition of B. holmesii IUI was deduced from PCR and CGH data, while the ORF organization of B. avium, B. pertussis and B. bronchiseptica was derived from the published genome sequences. B. Detailed organization of the alcaligin locus and putative ORFs in the 4.8 kb DNA insertion detected in B. holmesii IUI. Arrows above ORFs indicate the putative function of these ORFs. D 161

162 Color Figures Chapter 6 D Region A Region B Region C Region D Not characterized by X-ray crystallography 21, 22, RGD Asp N' R1 R2 C' 677-Gly Gly to 256-Pro 545-Pro to 566-Pro Figure 2. Location of positively selected codons and regions on the primary structure of Tohama Prn. Positively selected codons are indicated by black triangles. AAresidues with a maximal distance of 6Å and a minimum solvent accessibility of 25% have been designated as regions, indicated by the connecting lines. Numbering starts with the first amino acid of the mature protein. Green boxes indicate the location of conformational epitopes co-localized with positively selected codons. Yellow boxes indicate the co-localization of both conformational and linear epitopes with positively selected codons. Red, white and green triangles indicate loops that after mutation by SDM showed respectively a decrease, no effect or increase in binding with mabs. 162

163 Color Figures Chapter 6 Region D +350-Lys Gln +376-Ile Ser Region A Region B +213-Gln Asp +270-Ser Thr +21-Gly Ser +22-Ser Silent +24-Pro Gly +398-Ser Ala +498-Leu Arg +488-Ala Gly +187-Ser Phe +358-Asp Gln +330-Gln Arg +334-His Gly +438-Val Cys Region C Figure 3. Projection of the positively selected codons and regions on the crystal structure of B. pertussis Prn1 (1DAB.pdb). Numbers indicate the positively selected codons. Codons that are part of a region are colored in red, and regions are indicated by black rectangles. Positively selected codons not present in a region are colored in blue. D 163