Journal of Integrative Agriculture 2016, 15(0): Available online at ScienceDirect

Transcription

1 Journal of Integrative Agriculture 2016, 15(0): Available online at ScienceDirect RESEARCH ARTICLE Genetic characterization of antimicrobial resistance in Staphylococcus aureus isolated from bovine mastitis cases in northwest China YANG Feng 1*, WANG Qi 2*, WANG Xu-rong 1, WANG Ling 1, LI Xin-pu 1, LUO Jin-yin 1, ZHANG Shi-dong 1, LI Hong-sheng 1 1 Key Laboratory of Veterinary Pharmaceutical Development, Ministry of Agriculture/Engineering & Technology Research Center of Traditional Chinese Veterinary Medicine of Gansu Province/Lanzhou Institute of Husbandry and Pharmaceutical Sciences, Chinese Academy of Agricultural Sciences, Lanzhou , P.R.China 2 State Key Laboratory of Applied Organic Chemistry, Lanzhou University, Lanzhou , P.R.China Abstract Staphylococcus aureus is the most common etiological pathogen of bovine mastitis. The resistant strains make the disease difficult to cure. The aim of this study was to characterize the genetic nature of the antimicrobial resistance in S. aureus cultured from bovine mastitis in northwest China in A total of 44 S. aureus were isolated for antimicrobial resistance and resistance-related genes. Antimicrobial resistance was determined by disc diffusion and the corresponding resistance genes were detected by PCR. Phenotype indicated that S. aureus isolates were resistant to penicillin (84.09%), erythromycin (20.45%), tetracycline (15.91%), gentamicin (9.09%), tobramycin (6.82%), kanamycin (6.82%) and methicillin (2.27%). 9.09% of the S. aureus isolates were classified as multidrug resistant. In addition, genotypes showed that the isolates were resistant to rifampicin (100%, rpob), penicillin (95.45%, blaz), tetracycline (22.73%, tetk, tetm, alone or in combination), erythromycin (22.73%, ermb or ermc), gentamicin/tobramycin/kanamycin (2.27%, aaca-aphd), methicillin (2.27%, meca) and vancomycin (2.27%, vana). Resistance to tetracycline was attributed to the genes tetk and tetm (r=0.558, P<0.001). This study noted high-level geno- and phenotypic antimicrobial resistance in S. aureus isolates from bovine mastitis cases in northwest China. Keywords: bovine mastitis, Staphylococcus aureus, antimicrobial resistance, phenotype, genotype 1. Introduction Received 30 December, 2015 Accepted 8 April, 2016 YANG Feng, yangfeng@caas.cn; Correspondence LI Hong-sheng, Tel: , Fax: , lihsheng@sina.com * These authors contributed equally to this study. 2016, CAAS. All rights reserved. Published by Elsevier Ltd. doi: /S (16) Bovine mastitis is the most costly disease for dairy industry. Staphylococcus aureus is frequently recognized as a major contagious pathogen in bovine mastitis (Feßler et al. 2010). This bacterium can be transmitted among cows through contact with contaminated milk and results in subclinical mastitis that is often difficult to detect at the earliest stage. This results in serious economic losses being incurred in the dairy industry (Sharif et al. 2009). Antimicrobial chemotherapy is the primary approach to

2 *** et al. Journal of Integrative Agriculture 2016, 15(0): treat staphylococcal bovine mastitis (McDougall et al. 2014) and susceptibility tests can guide the veterinarian to select the most appropriate antimicrobial agent (Moroni et al. 2006). However, due to the widespread use of antimicrobial compounds, the occurrence of antimicrobial-resistant S. aureus cultured from cows with mastitis has increased (El-Jakee et al. 2011), thereby compromising this approach to treatment (Unakal and Kaliwal 2010). S. aureus has evolved four general resistance mechanisms, including trapping of the drug, modification of the drug target, enzymatic inactivation of the drug and the activation of transmembrane efflux pumps, to fend off attack from antimicrobials (Pantosti et al. 2007). Various genetic determinants such as meca and blaz (penicillins), aaca-aphd (aminoglycosides), erma/b/c (macrolides), tetk/m (tetracyclines), vana (vancomycin), fusb (fusidic acid), iles (mupirocin) and rpob (rifampicin) are reported to be responsible for the corresponding antimicrobial resistance mechanisms in S. aureus (Jensen and Lyon 2009). These genetic determinants enable S. aureus to reside for a long time inside the host or herd environment and avoid antimicrobial therapy (Kumar et al. 2011). Few antimicrobial resistance genes detected in S. aureus had been reported in China, and little is known about the genetic background of S. aureus resistance in northwest China (Memon et al. 2013; Wang et al. 2015). The focus of this short study was to characterize the genetic nature of antimicrobial resistance among S. aureus cultured from bovine mastitis in northwest China. 2. Materials and methods 2.1. Sample collection and bacterial strains A total of 44 S. aureus strains were obtained from cows presenting mastitis in northwest China during These included 32 strains isolated from clinical cases and 12 strains isolated from subclinical cases. The regions and number of isolates included Gansu (23), Qinghai (11) and Ningxia (10). Mastitis cases were confirmed by California mastitis test (CMT). Milk samples were collected aseptically for bacteriological assay as described by Pitkälä et al. (2004). Before sampling, the first streams of milk were discarded, and teat ends were disinfected with cotton swabs soaked in 70% (v/v) alcohol and allowed to dry. Then a 5-mL secretion was collected into a sterile 10-mL tube. Any samples that were not processed immediately were kept at 4 C for microbiological examination within 18 h of collection. Bacterial identification was performed on sheep blood agar plates, Chapman s agar plate and Baird Parker agar, incubated at 37 C for h. After overnight growth, presumptive staphylococci positive for Gram staining and catalase were tested for coagulase, hemolysis, DNAse, acetoin and anaerobic fermentation of mannitol. The confirmed S. aureus strains were preserved at 79 C for subsequent study Antimicrobial susceptibility test Antimicrobial susceptibility for S. aureus was determined using disc diffusion method on Mueller-Hinton agar (Oxoid, United Kingdom) with commercial available discs (Oxoid, United Kingdom) according to Clinical and Laboratory Standards Institute (CLSI 2010). The antimicrobial agents included penicillin, cefoxitin, erythromycin, gentamicin, tobramycin, kanamycin, tetracycline, vancomycin, fusidic acid, mupirocin and rifampicin. Cefoxitin was used to investigate methicillin susceptibility of S. aureus. The minimal inhibitory concentration (MIC) for vancomycin, if needed, was determined by E-test method (Biomerieux, France). The criteria for the interpretation of zone diameter used in this study were described in Table PCR amplification of antimicrobial resistance genes Preparation of bacterial genomic DNA was performed using the Bacterial DNA Kit (Omega Bio-Tek, USA) according to the manufacturer s recommendation. All isolates were tested by simplex PCR amplification of genes that confer Table 1 Zone of inhibition diameter interpretive criteria for Staphylococcus aureus Antibiotic family Antibiotics Disc content R (mm) I (mm) S (mm) References Penicillins Penicillin 10 IU CLSI (2010) Cefoxitin 30 µg Tiwari et al. (2009) Macrolides Erythromycin 15 µg CLSI (2010) Aminoglycosides Gentamicin 10 µg CLSI (2010) Tobramycin 10 µg CLSI (2010) Kanamycin 30 µg CLSI (2010) Tetracyclines Tetracycline 30 µg CLSI (2010) Glycopeptides Vancomyci 30 µg 15 CLSI (2010) Others Fusidic acid 5 µg Skov et al. (2001) Monoxycarbolic acid Mupirocin 5 µg Finlay et al. (1997) Ansamycins Rifampicin 5 µg CLSI (2010) R, resistant; I, intermediate; S, sensitive. The same as below.

3 4 *** et al. Journal of Integrative Agriculture 2016, 15(0): resistance to penicillin (blaz), methicillin (meca), erythromycin (erma, ermb, ermc), gentamicin/tobramycin/kanamycin (aaca-aphd), tetracycline (tetk, tetm), vancomycin (vana), fusidic acid (fusb), mupirocin (iles), rifampicin (rpob). Primers for these resistance genes were used as Table 2. The PCR mixtures (25 µl) used to detect the antimicrobial resistance genes in all strains contained 12.5 µl reaction mixtures (Premix Ex Taq TM ver. 2.0, TaKaRa, China), 0.5 µl primer 1, 0.5 µl primer 2, 2 µl genomic DNA and 9.5 µl ddh 2 O. PCR products (5 µl) were analysed by electrophoresis on a 1.2% agarose gel and stained with ethidium bromide Statistical analysis SPSS.17.0 (Bivariate correlations) was used to analyze the associations between phenotypic and genotypic resistance patterns. The intermediate isolates were considered to be resistant. 3. Results 3.1. Antimicrobial susceptibility The antimicrobial resistances of S. aureus cultured from bovine mastitis were shown in Table 3. Most were resistant to penicillin (84.09%). Less than half of these isolates expressed resistance to erythromycin (20.45%) and tetracycline (15.91%). Few were resistant to gentamicin (9.09%), tobramycin (6.82%), kanamycin (6.82%) and methicillin (2.27%). None of these isolates were found to be resistant to fusidic acid, mupirocin, rifampicin and vancomycin. Five of the 44 isolates were susceptible to all antimicrobial compounds tested, while the remaining strains were resistant to various combinations Antimicrobial resistance genes As shown in Table 4, all S. aureus included in this study contained drug-specific resistance gene for rifampicin (rpob). Most carried the penicillin-resistant gene (blaz, 95.45%) % of the isolates in the collection possessed the erythromycin-resistant genes (ermb, 9.09%; ermc, 13.64%, alone), while erma was not detected in any of the isolates. Also 22.73% strains contained tetracycline-resistant genes (tetk, 22.73%; tetm, 2.27%, alone or in combination), and 2.27% possessed the aminoglycoside-resistant gene (aaca-aphd), methicillin-resistant gene (meca) mupirocin-resistant gene (iles) and vancomycin-resistant gene (vana), respectively. None of the tested strains were positive for fusidic acid-resistant gene (fusb) The association between phenotypic and genotypic resistance In this study, the correlation between phenotypic and genotypic resistance was moderate for penicillin (r=0.558, P<0.001). Whereas for the other 12 tested antimicrobials, no correlations were observed (Table 4). Table 2 Target genes and oligonucleotide primers used to amplify antimicrobial resistance genes of S. aureus isolates Target genes Forward and reverse primers (5 3 ) Amplimer size (bp) Annealing temp ( C) References blaz TAAGAGATTTGCCTATGCTT Olsen et al. (2006) TTAAAGTCTTACCGAAAGCAG meca GTGAAGATATACCAAGTGATT Choi et al. (2003) ATGCGCTATAGATTGAAAGGAT erma TCTAAAAAGCATGTAAAAGAA Sutcliffe et al. (1996) CTTCGATAGTTTATTAATATTAGT ermb GAAAAGGTACTCAACCAAATA Sutcliffe et al. (1996) AGTAACGGTACTTAAATTGTTTAC ermc TCAAAACATAATATAGATAAA Sutcliffe et al. (1996) GCTAATATTGTTTAAATCGTCAAT aaca-aphd GAAGTACGCAGAAGAGA Strommenger et al. (2003) ACATGGCAAGCTCTAGGA tetk GTAGCGACAATAGGTAATAGT Strommenger et al. (2003) GTAGTGACAATAAACCTCCTA tetm AGTGGAGCGATTACAGAA Strommenger et al. (2003) CATATGTCCTGGCGTGTCTA vana GGGAAAACGACAATTGC Dutka-Malen et al. (1995) GTACAATGCGGCCGTTA fusb ATTCAATCGGAAACCTATATGATA O Neill et al. (2004) TTATATATTTCCGATTTGATGCAAG iles TATATTATGCGATGGAAGGTTGG Anthony et al. (1999) AATAAAATCAGCTGGAAAGTGTTG rpob AGTCTATCACACCTCAACAA TAATAGCCGCACCAGAATCA Aubry-Damon et al. (1998)

4 *** et al. Journal of Integrative Agriculture 2016, 15(0): Discussion The resistance of S. aureus to antimicrobial agents is an increasing global problem. Determining the antimicrobial susceptibility profiles in a study collection is required not Table 3 Antimicrobial susceptibility of S. aureus (n=44) from bovine mastitis Antimicrobial susceptibility Antimicrobials R I S n % n % n % Penicillin Methicillin Erythromycin Gentamicin Tobramycin Kanamycin Tetracycline Vancomycin Fusidic acid Mupirocin Rifampicin only for effective therapy but also for monitoring the spread of resistant strains in defined ecological niches (Hogan and Smith 2003; Coelho et al. 2009). In this study, the antimicrobial susceptibility profiles of S. aureus were determined and high levels of resistance to penicillin followed by erythromycin and tetracycline were detected. These data are similar to that contained in other reports (De Oliveira et al. 2000; Rajala-Schultz et al. 2004). In particular, more than half of the S. aureus isolates were resistant to penicillin (84.09%), a feature that was similar to other data previously reported in China (Shi et al. 2010). In contrast, this observation differed from trends being reported in other countries (Güler et al. 2005; Bengtsson et al. 2009). Most of isolates in this study were resistant to at least one antimicrobial compound and 9.09% (4/44) of the isolates in the collection were defined as being multidrug resistance according to the definition proposed by Magiorakos et al. (2012). It is tempting to speculate that these findings may arise from the frequent use of these antimicrobial agents in intramammary infections in China. The presences of resistance-associated genes in S. Table 4 Comparison of phenotypic and genotypic testing for antimicrobial resistance in S. aureus from bovine mastitis Characteristics of S. aureus isolates 1) Association 2) Antimicrobials Gene(s) P + /G + P /G P + /G P /G + G + n n n n % r P Penicillin Any blaz Methicillin Any meca Erythromycin Any erma 0 0 ermb ermc Gentamicin Any aaca-aphd Tobramycin Any aaca-aphd Kanamycin Any aaca-aphd Tetracycline Any <0.001 tetk tetm Vancomycin Any NT NT vana Fusidic Acid Any NT NT fusb 0 0 Mupirocin Any NT NT iles Rifampicin Any NT NT rpob ) P +, phenotypic resistance; P, phenotypic susceptibility; G +, resistant gene positive, G, resistant gene negative. 2) Association between resistant phenotypes and resistance genes. Values of P less than 0.05 were considered significant. NT correlation coefficients (r value) cannot be calculated (at least one variable is constant).

5 6 *** et al. Journal of Integrative Agriculture 2016, 15(0): aureus were detected in this study. All carried rifampicin-resistant gene rpob. However, this gene was been shown to have little impact in terms of its contribution to relevant phenotypic resistance. Indeed, all isolates were sensitive to rifampicin. This can be attributed to the lack of expression of the resistance gene, which need to be activated (Hammad and Shimamoto 2014). A high percentage of resistance genes associated with penicillin (blaz), erythromycin (ermb, ermc) and tetracycline (tetk, tetm) were noted, and these most likely contribute to the high resistance rates recorded for these antimicrobials compounds. However, association analysis showed moderate correlation between geno- and phenotypic resistance for tetracycline alone. Frey et al. (2013) reported similar data in coagulase-negative staphylococci. Memon et al. (2013) also reported that high resistance rates against methicillin were found but no S. aureus isolate was positive for the meca gene. In addition, genes aaca-aphd, meca, iles vana, and fusb that conferred resistance to clinically relevant antimicrobials (gentamicin, tobramycin, kanamycin, methicillin, mupirocin, vancomycin and fusidic acid) were also detected. No associations were observed for these antimicrobials. Resistance genes were detected in some susceptible isolates, while no resistance genes could be detected in some resistant isolates, which agreed with the results reported by Gao et al. (2012). In some isolates, phenotypic resistance may be caused by point mutations rather than gene acquisition. Additionally, except for the general resistance mechanisms, other factors such as biofilm formation may be the main resistance mechanism (Pantosti et al. 2007; Croes et al. 2009). Mechanisms of resistance to antibacterials are so complex that the presence or absence of a certain resistance gene does no certainly indicate that the particular isolate is resistant or sensitive to the corresponding antimicrobial agent (Gow et al. 2008). 5. Conclusion Our study demonstrated that S. aureus from bovine mastitis in northwest China are generally resistant to many of the antimicrobial compounds commonly used for treatment of mastitis, especially penicillin. Susceptibility testing as part of the diagnosis is therefore recommended to guide the selection of the most appropriate chemotherapeutic agent. Our data also revealed that S. aureus isolates carry several genetic determinants. Although these determinants make little contribution to relevant resistance, they are potential threat to antimicrobial treatment. Acknowledgements This study was supported by the Central Public-Interest Scientific Institution Basal Research Fund, China ( ), the Key Technology R&D Program of China during the 12th Five-Year Plan period (2012BAD12B03) and the Natural Science Foundation of Gansu Province, China (145RJYA311). References Anthony R M, Connor A M, Power E G M, French G L Use of the polymerase chain reaction for rapid detection of high-level mupirocin resistance in staphylococci. European Journal of Clinical Microbiology and Infectious Diseases, 18, Aubry-Damon H, Soussy C J, Courvalin P Characterization of mutations in the rpob gene that confer rifampin resistance in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy, 42, Bengtsson B, Unnerstad H E, Ekman T, Artursson K, Nilsson- Öst M, Waller K P Antimicrobial susceptibility of udder pathogens from cases of acute clinical mastitis in dairy cows. Veterinary Microbiology, 136, Choi S M, Kim S H, Kim H J, Lee D G, Choi J H, Yoo J H, Kang J H, Shin W S, Kang M W Multiplex PCR for the detection of genes encoding aminoglycoside modifying enzymes and methicillin resistance among Staphylococcus species. Journal of Korean Medical Science, 18, CLSI (Clinical and Laboratory Standards Institute) Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. CLSI document M , Clinical and Laboratory Standards Institute, Wayne, PA, USA. Coelho S M O, Reinoso E, Pereira I A, Soares L C, Demo M, Bogni C, Souza M Virulence factors and antimicrobial resistance of Staphylococcus aureus isolated from bovine mastitis in Rio de Janeiro. Pesquisa Veterinaria Brasileira, 29, Croes S, Deurenberg R H, Boumans M L L, Beisser P S, Neef C, Stobberingh E E Staphylococcus aureus biofilm formation at the physiologic glucose concentration depends on the S. aureus lineage. BMC Microbiology, 9, 229. Dutka-Malen S, Evers S, Courvalin P Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. Journal of Clinical Microbiology, 33, El-Jakee J K, Atta N S, Samy A A, Bakry M A, Elgabry E A, Kandil M M, El-Said W A G Antimicrobial resistance in clinical isolates of Staphylococcus aureus from bovine and human sources in Egypt. Global Veterinary, 7, Feßler A, Scott C, Kadlec K, Ehricht R, Monecke S, Schwarz S Characterization of methicillin-resistant Staphylococcus aureus ST398 from cases of bovine mastitis. Journal of Antimicrobial Chemotherapy, 65, Finlay J E, Miller L A, Poupard J A Interpretive criteria for testing susceptibility of staphylococci to mupirocin.

6 *** et al. Journal of Integrative Agriculture 2016, 15(0): Antimicrobial Agents and Chemotherapy, 41, Frey Y, Rodriguez J P, Thomann A, Schwendener S, Perreten V Genetic characterization of antimicrobial resistance in coagulase-negative staphylococci from bovine mastitis milk. Journal of Dairy Science, 96, Gao J, Yu F Q, Luo L P, He J Z, Hou R G, Zhang H Q, Li S M, Su J L, Han B Antibiotic resistance of Streptococcus agalactiae from cows with mastitis. Veterinary Journal, 194, Gow S P, Waldner C L, Harel J, Boerlin P Associations between antimicrobial resistance genes in fecal generic Escherichia coli isolates from cow-calf herds in western Canada. Applied and Environmental Microbiology, 74, Güler L, Ok G, Gülcü K, Gülcü Y, Hadimli H H Antimicrobial susceptibility and coagulase gene typing of Staphylococcus aureus isolated from bovine clinical mastitis cases in Turkey. Journal of Dairy Science, 88, Hammad A M, Shimamoto T Genetic characterization of antibiotic resistance and virulence factors in Enterococcus spp. from Japanese retail ready-to-eat raw fish. Food Microbiology, 38, Hogan J, Smith K L Coliform mastitis. Veterinary Research, 34, Jensen S O, Lyon B R Genetics of antimicrobial resistance in Staphylococcus aureus. Future Microbiology, 4, Kumar R, Yadav B R, Anand S K, Singh R S Molecular surveillance of putative virulence factors and antibiotic resistance in Staphylococcus aureus isolates recovered from intra-mammary infections of river buffaloes. Microbial Pathogenesis, 51, Magiorakos A P, Srinivasan A, Carey R B, Carmeli Y, Falagas M E, Giske C G, Harbarth S, Hindler J F, Kahlmeter G, Olsson-Liljequist B, Paterson D L, Rice L B, Stelling J, Struelens M J, Vatopoulos A, Weber J T, Monnet D L Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clinical Microbiology and Infection, 18, McDougall S, Hussein H, Petrovski K Antimicrobial resistance in Staphylococcus aureus, Streptococcus uberis and Streptococcus dysgalactiae from dairy cows with mastitis. New Zealand Veterinary Journal, 62, Memon J, Yang Y, Kashifa J, Yaqoob M, Buriroa R, Soomroa J, Liping W, Hongjie F Genotypes, virulence factors and antimicrobial resistance genes of Staphylococcus aureus isolated in bovine subclinical mastitis from Eastern China. Pakistan Veterinary Journal, 33, Moroni P, Pisoni G, Antonini M, Villa R, Boettcher P, Carli S Short Communication: Antimicrobial drug susceptibility of Staphylococcus aureus from subclinical bovine mastitis in Italy. Journal of Dairy Science, 89, De Oliveira A P, Watts J L, Salmon S A, Aarestrup F M Antimicrobial susceptibility of Staphylococcus aureus isolated from bovine mastitis in europe and the united states. Journal of Dairy Science, 83, Olsen J E, Christensen H, Aarestrup F M Diversity and evolution of blaz from Staphylococcus aureus and coagulase-negative staphylococci. Journal of Antimicrobial Chemotherapy, 57, O Neill A J, Larsen A R, Henriksen A S, Chopra I A fusidic acid-resistant epidemic strain of Staphylococcus aureus carries the fusb determinant, whereas fusa mutations are prevalent in other resistant isolates. Antimicrobial Agents and Chemotherapy, 48, Pantosti A, Sanchini A, Monaco M Mechanisms of antibiotic resistance in Staphylococcus aureus. Future Microbiology, 2, Pitkälä A, Haveri M, Pyörälä S, Myllys V, Honkanen-Buzalski T Bovine mastitis in Finland Prevalence, distribution of bacteria, and antimicrobial resistance. Journal of Dairy, 87, Rajala-Schultz P J, Smith K L, Hogan J S, Love B C Antimicrobial susceptibility of mastitis pathogens from first lactation and older cows. Veterinary Microbiology, 102, Sharif A, Umer M, Muhammad G Mastitis control in dairy production. Journal of Agriculture and Social Sciences, 5, Shi D, Hao Y, Zhang A, Wulan B, Fan X Antimicrobial resistance of Staphylococcus aureus isolated from bovine mastitis in China. Transboundary and Emerging Diseases, 57, Skov R, Frimodt-Møller N, Espersen F Correlation of MIC methods and tentative interpretive criteria for disk diffusion susceptibility testing using NCCLS methodology for fusidic acid. Diagnostic Microbiology and Infectious Disease, 40, Strommenger B, Kettlitz C, Werner G, Witte W Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus. Journal of Clinical Microbiology, 41, Sutcliffe J, Grebe T, Tait-Kamradt A, Wondrack L Detection of erythromycin-resistant determinants by PCR. Antimicrobial Agents and Chemotherapy, 40, Tiwari H K, Sapkota D, Dad A K, Sen M R Assessment of different tests to detect methicillin resistant Staphylococcus aureus. Southeast Asian Journal of Tropical Medicine and Public Health, 40, Unakal C G, Kaliwal B B Prevalence and antibiotic susceptibility of Staphylococcus aureus from bovine mastitis. Veterinary World, 3, Wang D, Wang Z, Yan Z, Wu J, Ali T, Li J, Lv Y, Han B Bovine mastitis Staphylococcus aureus: Antibiotic susceptibility profile, resistance genes and molecular typing of methicillin-resistant and methicillin-sensitive strains in China. Infection, Genetics and Evolution, 31, (Managing editor ZHANG Juan)