Keywords: CB-183,315; Clostridium difficile; susceptibility; intestinal anaerobes
|
|
- Imogene Harper
- 5 years ago
- Views:
Transcription
1 AAC Accepts, published online ahead of print on 19 December 2011 Antimicrob. Agents Chemother. doi: /aac Copyright 2011, American Society for Microbiology. All Rights Reserved In vitro activity of CB-183,315, vancomycin and metronidazole against 556 strains of Clostridium difficile, 445 other intestinal anaerobes and 56 Enterobacteriaceae species 1 Diane M. Citron*, 1 Kerin L. Tyrrell, 1 C. Vreni Merriam and 1,2 Ellie J.C. Goldstein 1 R.M. Alden Research Lab, Culver City, CA 2 Geffen School of Medicine, UCLA, Los Angeles, CA Keywords: CB-183,315; Clostridium difficile; susceptibility; intestinal anaerobes Running title: CB-183,315 against C. difficile and intestinal organisms Corresponding author: Diane M. Citron R.M. Alden Research Lab 6133 Bristol Parkway Suite 175 Culver City, CA P F d.m.citron@att.net Abstract 1
2 MICs for CB-183,315, a novel lipopeptide antibiotic, vancomycin and metronidazole were determined for intestinal anaerobes and Enterobacteriaceae. The MIC 90 for gram-negative anaerobes was >8192, 8192 and 4 µg/ml for CB-183,315, vancomycin and metronidazole, respectively. Against Enterobacteriaceae, MIC 90s were >8192 µg/ml, 1024 µg/ml and1024 µg/ml, respectively. CB-183,315 MIC 90 for C. difficile was 0.5 µg/ml. Its lack of activity against normal fecal organisms makes it a promising new agent for treating C. difficile. Clostridium difficile infection (CDI) is the most common cause of healthcare related diarrhea, usually associated with prior exposure to antimicrobial agents. The current theory is that the 2
3 antibiotics disrupt the normal fecal microbiota, changing its complexity and diversity as a primary event, with the subsequent acquisition of toxigenic C. difficile as a secondary event in the development of the disease (6,11,14). CDI has increased in prevalence and severity during the last decade, resulting in increased mortality and complications, recurrent disease and prolonged hospital stay (7,17). Non-healthcare related cases of CDI are now being reported (7,16). Treatment options have been limited by unsatisfactory efficacy of current therapeutic agents, high recurrence rates of disease, disruption of normal intestinal microbiota, and colonization by VRE (1,2,15). Although a recently introduced macrocyclic antibiotic, fidaxomicin, shows equivalent primary cure rates with reduced recurrence rates compared to vancomycin (15) it shows equivalence against REA type BI strain associated disease. CB-183,315 is a novel lipopeptide antibiotic with gram-positive activity and is bactericidal against C. difficile. To study the spectrum of its activity, including effect on the normal components of fecal microbiota, we determined MICs of CB-183,315 and vancomycin against C. difficile and other intestinal anaerobes, plus E. coli, Klebsiella spp. and Enterobacter spp. For comparison, metronidazole was tested against the gram-negative anaerobes and the Enterobacteriaceae spp. The C. difficile strains were recent clinical isolates ( ) recovered from stools of patients with CDI. Other isolates were from stool or infections containing organisms presumed to be of intestinal origin, identified by standard methods (13) and occasionally by 16S rdna sequence analysis (20), and stored in 20% skim milk at -70 o C. MIC values were determined by the agar dilution method according to CLSI procedures (4). Vancomycin and metronidazole laboratory standard powders were obtained from Sigma (St. 3
4 Louis, MO) and CB-183,315 was provided by Cubist Pharmaceuticals, Inc. (Lexington, MA). All assay media for testing CB-183,315 were supplemented with a final concentration of 50 mg/l calcium, where Ca ++ concentrations were confirmed by Laboratory Specialists, Inc. (Westlake, Ohio). The Escherichia coli, Klebsiella pneumoniae and Enterobacter spp. strains were tested using Mueller Hinton agar, and incubated at 37 o C in ambient air, except for metronidazole, which was incubated in the anaerobic chamber (4). Quality control strains included Clostridium difficile ATCC , Bacteroides fragilis ATCC 25285, Staphylococcus aureus ATCC and E. coli ATCC and were included each day of testing of the relevant set of test organisms. Time-kill studies were carried out on one restriction endonuclease analysis (REA) BI type (NAP1, ribotype 027) strain and one REA type Y (NAP4, ribotype 014) strain (3). CB-183,315 and vancomycin were prepared at 2, 4, and 8 times their MICs for each strain in supplemented Brucella broth. A drug-free growth control tube was included. Tubes were inoculated with ~ 10 6 CFU/ml, placed on a shaker and assayed at 0, 2, 4, 8, and 24h of incubation at 37 o C. Table 1 shows the range, MIC 50 and MIC 90 for the major groups of organisms. The CB-183,315 MIC range for C. difficile was µg/ml with MIC 90 of 0.5 µg/ml; other gram-positive strains were inhibited by µg/ml. The MIC 90 for CB-183,315 against the Bacteroides fragilis group, Prevotella spp., gram-negative cocci (Veillonella spp. and Acidaminococcus sp.), 4
5 as well as E. coli, Enterobacter spp., and Klebsiella spp. was greater than 8192 µg/ml. Against fusobacteria, and Porphyromonas spp., the MIC 90 was 8192 µg/ml and 2048 µg/ml, respectively. In contrast, vancomycin had equally high MICs of >8192 µg/ml only against the fusobacteria and the gram-negative cocci; the B. fragilis group was inhibited by vancomycin at MIC 90 of 128 µg/ml (range µg/ml), Porphyromonas by 4 µg/ml, and Prevotella spp. by 256 µg/ml of vancomycin. Vancomycin MICs ranged from µg/ml for E. coli and µg/ml for Enterobacter and Klebsiella species. Metronidazole was active against the gram-negative anaerobes at 0.06 to 8 µg/ml, but showed poor activity against the Enterobacteriaceae, with MICs ranging from 32 to1024 µg/ml. The time-kill studies showed that CB-183,315 at 4 and 8 times the MIC resulted in a 3 log 10 reduction in colony count after 24h incubation against both REA types tested. Vancomycin produced a similar result.. CB-183,315 reaches concentrations of μg/g of feces after a 1g bid dose at day 5 of a 14 day course (Cubist Pharmaceuticals data on file) which is lower than the high MICs (>8192 µg/ml) demonstrated for Bacteroides and other groups of organisms of the intestinal anaerobes, thus CB-183,315 is likely to spare many of these important members of the normal microbiota. In contrast, vancomycin at a dose of 250 mg qid results in fecal levels that are generally above 2,000 μg/ml (12). Vancomycin thus has the potential for killing or inhibiting much of the normal aerobic and anaerobic fecal microbiota. Moreover, oral vancomycin was shown to decrease or suppress Bacteroides in volunteers while increasing occurrence of vancomycin-resistant enterococci (8,14). In contrast, fidaxomicin, a narrow spectrum 5
6 macrocycle, displayed less impact on the Bacteroides populations in patients treated for CDI (14), which has been postulated as one reason for the associated lower relapse rate. Using temporal temperature gradient electrophoresis and fluorescent in situ hybridization and flow cytometry, Tannock et al.(19) compared the impact of fidaxomicin and vancomycin on seven phylogenetic groups, including clostridial clusters IV and XIVa, Bacteroides-Prevotella, Bifidobacterium, Atopobium, enterobacteria, and the Enterococcaceae-Lactobacillaceae group. Minimal changes were seen in these groups for the fidaxomicin treated patients while the vancomycin treated patients showed a marked decrease in Clostridium clusters IV and XIVa, Bacteroides and Bifidobacterium, and an increase in the Enterococcus-Lactobacillus and the enterobacteria groups. MICs for CB-183,315 against clostridia were similar to those reported for fidaxomicin (10), showing decreased activity against several species in Clostridium clusters XIVa, XVI, and XVIII, although unlike fidaxomicin, decreased activity of CB-183,315 was also present against several species in cluster I (5,9,18). MIC 90 for the C. clostridioforme group (cluster XIVa), was 16 µg/ml; for C. innocuum (cluster XVI) 4 µg/ml; for C. ramosum (Cluster XVIII) 8 µg/ml; and C. sphenoides, 1 strain, (cluster XIVa) 16 µg/ml. These findings suggest that CB-183,315 would show a similar lack of impact as fidaxomicin on the composition of the major groups of bowel microbiota. With its excellent activity against C. difficile and its narrower spectrum and lack of activity against other colonic aerobic and anaerobic microbiota, with the potential for fewer relapses, CB- 183,315 is a promising new drug treatment for CDI. 6
7 Acknowledgement This study was sponsored by a grant from Cubist Pharmaceuticals, Inc. We thank Eliza Leoncio for excellent technical assistance. Downloaded from on October 1, 2018 by guest 7
8 148 Reference List Al-Nassir, W. N., A. K. Sethi, Y. Li, M. J. Pultz, M. M. Riggs, and C. J. Donskey Both oral metronidazole and oral vancomycin promote persistent overgrowth of vancomycin-resistant enterococci during treatment of Clostridium difficile-associated disease. Antimicrob.Agents Chemother. 52: Bhalla, A., N. J. Pultz, A. J. Ray, C. K. Hoyen, E. C. Eckstein, and C. J. Donskey Antianaerobic antibiotic therapy promotes overgrowth of antibiotic-resistant, gramnegative bacilli and vancomycin-resistant enterococci in the stool of colonized patients. Infect.Control Hosp.Epidemiol. 24: Clabots, C. R., S. Johnson, K. M. Bettin, P. A. Mathie, M. E. Mulligan, D. R. Schaberg, L. R. Peterson, and D. N. Gerding Development of a rapid and efficient restriction endonuclease analysis typing system for Clostridium difficile and correlation with other typing systems. J.Clin.Microbiol. 31: Clinical and Laboratory Standards Institute Methods for antimicrobial susceptibility testing of anaerobic bacteria, 7th ed. Approved standard M11-A7. Clinical and Laboratory Standards Institute, Wayne, PA. 5. Collins, M. D., P. A. Lawson, A. Willems, J. J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J. A. Farrow The phylogeny of the genus 8
9 Clostridium: proposal of five new genera and eleven new species combinations. Int.J.Syst.Bacteriol. 44: Dethlefsen, L., S. Huse, M. L. Sogin, and D. A. Relman The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rrna sequencing. PLoS.Biol. 6:e Dubberke, E. R. and A. I. Wertheimer Review of current literature on the economic burden of Clostridium difficile infection. Infect.Control Hosp.Epidemiol. 30: Edlund, C., L. Barkholt, B. Olsson-Liljequist, and C. E. Nord Effect of vancomycin on intestinal flora of patients who previously received antimicrobial therapy. Clin.Infect.Dis. 25: Finegold, S. M., D. Molitoris, M. L. Vaisanen, Y. Song, C. Liu, and M. Bolanos In vitro activities of OPT-80 and comparator drugs against intestinal bacteria. Antimicrob.Agents Chemother. 48: Finegold, S. M., D. Molitoris, M. L. Vaisanen, Y. Song, C. Liu, and M. Bolanos In vitro activities of OPT-80 and comparator drugs against intestinal bacteria. Antimicrob.Agents Chemother. 48:
10 Gerding, D. N. and S. Johnson Management of Clostridium difficile infection: thinking inside and outside the box. Clin.Infect.Dis. 51: Gonzales, M., J. Pepin, E. H. Frost, J. C. Carrier, S. Sirard, L. C. Fortier, and L. Valiquette Faecal pharmacokinetics of orally administered vancomycin in patients with suspected Clostridium difficile infection. BMC.Infect.Dis. 10: Jousimies-Somer, H. R., P. Summanen, D. M. Citron, E. J. Baron, H. M. Wexler, and S. M. Finegold Wadsworth-KTL Anaerobic Bacteriology Manual. Star Publishing, Belmont, CA. 14. Louie, T. J., J. Emery, W. Krulicki, B. Byrne, and M. Mah OPT-80 eliminates Clostridium difficile and is sparing of bacteroides species during treatment of C. difficile infection. Antimicrob.Agents Chemother. 53: Miller, M., L. Bernard, M. Thompson, D. Grima, and J. Pepin Lack of increased colonization with vancomycin-resistant enterococci during preferential use of vancomycin for treatment during an outbreak of healthcare-associated Clostridium difficile infection. Infect.Control Hosp.Epidemiol. 31: Rouphael, N. G., J. A. O'Donnell, J. Bhatnagar, F. Lewis, P. M. Polgreen, S. Beekmann, J. Guarner, G. E. Killgore, B. Coffman, J. Campbell, S. R. Zaki, and L. C. McDonald Clostridium difficile-associated diarrhea: an emerging threat to pregnant women. Am.J.Obstet.Gynecol. 198:
11 Rupnik, M., M. H. Wilcox, and D. N. Gerding Clostridium difficile infection: new developments in epidemiology and pathogenesis. Nat.Rev.Microbiol. 7: Stackebrandt, E., I. Kramer, J. Swiderski, and H. Hippe Phylogenetic basis for a taxonomic dissection of the genus Clostridium. FEMS Immunol.Med.Microbiol. 24: Tannock, G. W., K. Munro, C. Taylor, B. Lawley, W. Young, B. Byrne, J. Emery, and T. Louie A new macrocyclic antibiotic, fidaxomicin (OPT-80), causes less alteration to the bowel microbiota of Clostridium difficile-infected patients than does vancomycin. Microbiology 156: Warren, Y. A., K. L. Tyrrell, D. M. Citron, and E. J. Goldstein Clostridium aldenense sp. nov. and Clostridium citroniae sp. nov. isolated from human clinical infections. J.Clin.Microbiol. 44:
12 Table 1. In vitro activity of CB-183,315, Vancomycin and Metronidazole against Intestinal Organisms (μg/ml) CB-183,315 Vancomycin Metronidazole Group N Range MIC 50 MIC 90 Range MIC 50 MIC 90 Range MIC 50 MIC 90 Actinomyces species a NT Bifidobacterium species b NT Eggerthella lenta NT Eubacterium limosum NT Eubacterium group (other) c NT Lactobacillus species, VAN-R d >32 - >32 >32 >32 NT Lactobacillus species, VAN-S e NT Propionibacterium species f NT Clostridium clostridioforme NT grp g (CL. XIVa) Clostridium difficile (Cl. XI) NT Clostridium innocuum (Cl.XV) NT Clostridium perfringens (Cl.I) NT Clostridium ramosum (Cl. NT XVIII) Clostridium species (other) h NT Anaerobic gram-positive cocci i 49 < NT Bacteroides fragilis group j > > Fusobacterium species k > > > Porphyromonas species l Prevotella species m > > Gram-negative cocci n >8192 >8192 >8192 > > >8192 > E. coli >
13 >8192- >8192 >8192 Enterobacter species o 18 > >8192 >8192 > Klebsiella species p Cl, phylogenetic cluster a Actinomyces israelii (2), A. meyeri (2), A. naeslundii (1), A. neuii ss anitratus (2), A. neuii ss neuii (1), A. odontolyticus (2), A. turicensis (2), and A. viscosus (3). b Bifidobacterium adolescentis (2), B. bifidum (1), B. breve (4), B. catenulatum (2), B. dentium (1), B. longum (2), B. pseudocatenulatum (1), and B. urinalis (1). c Collinsella aerofaciens (6), Eubacterium biforme (1), E. contortum (1), E. cylindroides (1), E. timidum (3), Pseudoramibacter alactolyticum (4) and Eubacterium species (19). d Lactobacillus brevis (1), L. casei (7), L. fermentum (2), L. rhamnosus (6), and Lactobacillus GG (4). e Atopobium parvulum (1), Lactobacillus acidophilus (2), L. catenaformis (3), L. crispatus (1), L. gasseri (3), L. iners (1), L. jensenii (4), and L. leichmannii (2 ) f Propionibacterium acnes (7), P. avidum (4), and P. granulosum (4). g Clostridium aldenense (4), C. bolteae (5), C. citroniae (3), C. clostridioforme (2), and C. hathewayi (6). h Clostridium bifermentans (1), C. butyricum (5), C. cadaveris (3), C. cochlearium (2), C. fallax (1), C. glycolicum (3), C. hastiforme (1), C. hylemonae (1), C. indolis (1), C. leptum (2), C. nexile (1), C. paraputrificum (4), C. sartagoforme (1), C. scindens (1), C. sordelli (2), C. sphenoides (1), C. sporogenes (2), C. subterminale (1), C. symbiosum (4), and C. tertium (2). 13
14 i Anaerococcus lactolyticus (2), A. octavius (1), A. prevotii (6), A. tetradius (5), A. vaginalis (4) ; Finegoldia magna (7) ; Peptoniphilus asaccharolyticus (5), P. harei (2), P. indolicus (2), P. ivorii (3), and P. lacrimalis (2); Peptostreptococcus anaerobius (5) and Parvimonas micra (5). j Bacteroides caccae (1), B. distasonis (1), B. fragilis (11), B. nordii (1), B. ovatus (3), B. thetaiotaomicron (3), B. vulgatus (1). k Fusobacterium gonidiaformans (1), F. mortiferum-varium group (6), F. necrophorum (2), F. nucleatum (10), and F. russii (1). l Porphyromonas asaccharolytica (9), P. gingivalis (4), P. somerae (6), P. uenonis (2). m Prevotella bivia (10), P. disiens (3), P. intermedia/nigrescens (1), P. loeschii (3), and P. melaninogenica (3). n Acidaminococcus fermentans (8), Veillonella species (13). o Enterobacter aerogenes (6), Enterobacter cloacae (11), Enterobacter sp. (1) p Klebsiella oxytoca (3), Klebsiella pneumoniae (17) 14
ANTI-ANAEROBIC ACTIVITIES OF SULOPENEM COMPARED TO SIX OTHER. Departments of Pathology, Hershey Medical Center, Hershey, PA 17033
AAC Accepts, published online ahead of print on 17 February 2009 Antimicrob. Agents Chemother. doi:10.1128/aac.01557-08 Copyright 2009, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationIn Vitro Activities of OPT-80 and Comparator Drugs against Intestinal Bacteria
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Dec. 2004, p. 4898 4902 Vol. 48, No. 12 0066-4804/04/$08.00 0 DOI: 10.1128/AAC.48.12.4898 4902.2004 Copyright 2004, American Society for Microbiology. All Rights
More informationAAC Revised. Activity of a Novel Cyclic Lipopeptide, CB-183,315 Against Resistant Clostridium difficile
AAC Accepts, published online ahead of print on 5 March 2012 Antimicrob. Agents Chemother. doi:10.1128/aac.06257-11 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 AAC06257-11
More informationSESSION XVI NEW ANTIBIOTICS
SESSION XVI NEW ANTIBIOTICS New Antibiotics to Treat Anaerobic Infections 2 Goldstein, E.J.C.;* Citron, D.M. Antibiotic Pharmacodynamics 3 Stein, G.E.* Targeting Selenium Metabolism in Stickland Fermentors:
More informationR. M. Alden Research Laboratory, Santa Monica, California 90404, 1 and David Geffen School of Medicine at UCLA, Los Angeles, California
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 2006, p. 2875 2879 Vol. 50, No. 8 0066-4804/06/$08.00 0 doi:10.1128/aac.00286-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. In Vitro
More informationon February 12, 2018 by guest
AAC Accepted Manuscript Posted Online 12 February 2018 Antimicrob. Agents Chemother. doi:10.1128/aac.00047-18 Copyright 2018 Stapert et al. This is an open-access article distributed under the terms of
More informationAntimicrobial Susceptibility Patterns of Anaerobic Bacterial Clinical Isolates From 2014 to 2016, Including Recently Named or Renamed Species
Original Article Clinical Microbiology Ann Lab Med 2019;39:190-199 https://doi.org/10.3343/alm.2019.39.2.190 ISSN 2234-3806 eissn 2234-3814 Antimicrobial Susceptibility Patterns of Anaerobic Bacterial
More informationMulticenter Study of Antimicrobial Susceptibility of Anaerobic Bacteria in Korea in 2012
Original Article Clinical Microbiology Ann Lab Med 2015;35:479-486 http://dx.doi.org/10.3343/alm.2015.35.5.479 ISSN 2234-3806 eissn 2234-3814 Multicenter Study of Antimicrobial Susceptibility of Anaerobic
More informationAntimicrobial Susceptibility of Clinically Relevant Gram-Positive Anaerobic Cocci Collected over a Three-Year Period in the Netherlands
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Mar. 2011, p. 1199 1203 Vol. 55, No. 3 0066-4804/11/$12.00 doi:10.1128/aac.01771-09 Copyright 2011, American Society for Microbiology. All Rights Reserved. Antimicrobial
More informationPiperacillin-Tazobactam, and Cefoxitin
ANTiMICROBLAL AGENTS AND CHEMOTHERAPY, Aug. 1993, p. 1649-1654 0066-4804/93/081649-06$00/0 Copyright 1993, American Society for Microbiology Vol. 37, No. 8 Susceptibilities of 428 Gram-Positive and -Negative
More informationTitle: Effect of fidaxomicin versus vancomycin on susceptibility to intestinal
AAC Accepted Manuscript Posted Online 18 April 2016 Antimicrob. Agents Chemother. doi:10.1128/aac.02590-15 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 2 3 Title: Effect of
More informationPatterns of Susceptibility to Fluoroquinolones Among Anaerobic Bacterial Isolates in the United States
S377 Patterns of Susceptibility to Fluoroquinolones Among Anaerobic Bacterial Isolates in the United States Ellie J. C. Goldstein From R. M. Alden Research Laboratory, Santa Monica Hospital Medical Center,
More informationThird Belgian multicentre survey of antibiotic susceptibility of anaerobic bacteria
Journal of Antimicrobial Chemotherapy (2007) 59, 132 139 doi:10.1093/jac/dkl458 Advance Access publication 9 November 2006 Third Belgian multicentre survey of antibiotic susceptibility of anaerobic bacteria
More informationPresent Status of Therapy for Anaerobic Infections
89 Present Status of Therapy for Anaerobic Infections Sydney M. Finegold and Hannah M. Wexler From the Medical and Research Services, Veterans Affairs Medical Center West Los Angeles, and the Department
More informationAs presented at 112th General Meeting of the American Society for Microbiology, Session C-173 June 16 19, 2012, San Francisco, California
As presented at 112th General Meeting of the American Society for Microbiology, Session C-173 June 16 19, 2012, San Francisco, California Evaluation of the Analytical Reactivity (Inclusivity) and Analytical
More informationShould we test Clostridium difficile for antimicrobial resistance? by author
Should we test Clostridium difficile for antimicrobial resistance? Paola Mastrantonio Department of Infectious Diseases Istituto Superiore di Sanità, Rome,Italy Clostridium difficile infection (CDI) (first
More informationAnaerobic bacteria in 118 patients with deepspace head and neck infections from the University Hospital of Maxillofacial Surgery, Sofia, Bulgaria
Journal of Medical Microbiology (2006), 55, 1285 1289 DOI 10.1099/jmm.0.46512-0 Anaerobic bacteria in 118 patients with deepspace head and neck infections from the University Hospital of Maxillofacial
More informationLabeled Uses: Acute Skin & Skin Structure Infections caused by susceptible bacteria 1,2,4
Brand Name: Generic Name: Teflaro Ceftaroline fosamil Manufacturer: Forest Pharmaceuticals, Inc 1,2 Drug Class: Cephalosporin, Fifth Generation 2,3 Uses: Labeled Uses: Acute Skin & Skin Structure Infections
More informationUSA Product Label CLINTABS TABLETS. Virbac. brand of clindamycin hydrochloride tablets. ANADA # , Approved by FDA DESCRIPTION
VIRBAC CORPORATION USA Product Label http://www.vetdepot.com P.O. BOX 162059, FORT WORTH, TX, 76161 Telephone: 817-831-5030 Order Desk: 800-338-3659 Fax: 817-831-8327 Website: www.virbacvet.com CLINTABS
More informationIn vitro activity of surotomycin against contemporary clinical isolates of toxigenic Clostridium difficile strains obtained in Spain
J Antimicrob Chemother 2015; 70: 2311 2315 doi:10.1093/jac/dkv092 Advance Access publication 15 April 2015 In vitro activity of surotomycin against contemporary clinical isolates of toxigenic Clostridium
More informationEffect of dalbavancin on the normal intestinal microflora
Journal of Antimicrobial Chemotherapy (00), 1 doi:10.109/jac/dkl1 Advance Access publication 1 July 00 Effect of dalbavancin on the normal intestinal microflora Carl Erik Nord*, Gundars Rasmanis and Elisabeth
More informationMoxifloxacin resistance is prevalent among Bacteroides and Prevotella species in Greece
Journal of Antimicrobial Chemotherapy (2008) 62, 137 141 doi:10.1093/jac/dkn134 Advance Access publication 1 April 2008 Moxifloxacin resistance is prevalent among Bacteroides and Prevotella species in
More informationECOLOGICAL IMPACT OF NARROW SPECTRUM ANTIMICROBIAL AGENTS COMPARED TO BROAD SPECTRUM AGENTS ON THE HUMAN INTESTINAL MICROFLORA CARL ERIK NORD
Old Herborn University Seminar Monograph 3: Consequences of antimicrobial therapy for the composition of the microflora of the digestive tract. Editors: Carl Erik Nord, Peter J. Heidt, Volker Rusch, and
More informationReply to Fabre et. al
Reply to Fabre et. al L. Clifford McDonald, 1 Stuart Johnson, 2,3 Johan S. Bakken, 4 Kevin W. Garey, 5 Ciaran Kelly, 6 Dale N. Gerding, 2 1 Centers for Disease Control and Prevention, Atlanta, Georgia;
More informationINFECTIOUS DISEASES DIAGNOSTIC LABORATORY NEWSLETTER
INFECTIOUS DISEASES DIAGNOSTIC LABORATORY NEWSLETTER University of Minnesota Health University of Minnesota Medical Center University of Minnesota Masonic Children s Hospital May 2017 Printed herein are
More informationSurveillance of susceptibility patterns in 1297 European and US anaerobic and capnophilic isolates to co-amoxiclav and five other antimicrobial agents
Journal of Antimicrobial Chemotherapy (2004) 53, 1039 1044 DOI: 10.1093/jac/dkh248 Advance Access publication 5 May 2004 Surveillance of susceptibility patterns in 1297 European and US anaerobic and capnophilic
More informationTel: Fax:
CONCISE COMMUNICATION Bactericidal activity and synergy studies of BAL,a novel pyrrolidinone--ylidenemethyl cephem,tested against streptococci, enterococci and methicillin-resistant staphylococci L. M.
More informationCiprofloxacin, Enoxacin, and Ofloxacin against Aerobic and
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 1988, p. 1143-1148 Vol., No. 8 0066-4804/88/081143-06$00/0 Copyright 1988, American Society for Microbiology Comparative Activities of, Amoxicillin-Clavulanic
More informationThis article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and
This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution
More informationAberdeen Hospital. Antibiotic Susceptibility Patterns For Commonly Isolated Organisms For 2015
Aberdeen Hospital Antibiotic Susceptibility Patterns For Commonly Isolated s For 2015 Services Laboratory Microbiology Department Aberdeen Hospital Nova Scotia Health Authority 835 East River Road New
More informationSusceptibility Testing of Anaerobic Bacteria: Evaluation of the Redesigned (Version 96) biomérieux ATB ANA Device
JOURNAL OF CLINICAL MICROBIOLOGY, June 1999, p. 1824 1828 Vol. 37, No. 6 0095-1137/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Susceptibility Testing of Anaerobic
More informationAntimicrobial Resistance in Human Oral and Intestinal Anaerobic Microfloras
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 1993, p. 1665-1669 Vol. 37, No. 8 0066-4804/93/081665-05$02.00/0 Copyright X 1993, American Society for Microbiology Antimicrobial Resistance in Human Oral and
More informationClassification of Bacteria
Classification of Bacteria MICROBIOLOGY -TAXONOMY Taxonomy is the system to classify living organisms Seven groups kingdom, phylum or div, class, order, family, genus, species Binomial system of nomenclature
More informationClostridium difficile infection: The Present and the Future
Clostridium difficile infection: The Present and the Future Carlos E. Figueroa Castro, MD Assistant Professor, Division of Infectious Diseases Medical College of Wisconsin November 2014 I have made this
More informationACCEPTED. Anaerobe Reference Laboratory, Department of Bacterial and Inflammatory Diseases, National
AAC Accepts, published online ahead of print on April 00 Antimicrob. Agents Chemother. doi:./aac.000-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationResistance pattern of anaerobic bacteria isolated in a general hospital during a two-year period
Journal of Antimicrobial Chemotherapy (9), Supp. D, 9 6 Resistance pattern of anaerobic bacteria isolated in a general hospital during a two-year period J. F. Acar, F. W. Goldstein, M. D. Kitzis and M.
More informationIntra-abdominal infections: review of the bacteriology, antimicrobial susceptibility and the role of ertapenem in their therapy
Journal of Antimicrobial Chemotherapy (2004) 53, Suppl. S2, ii29 ii36 DOI: 10.1093/jac/dkh201 Intra-abdominal infections: review of the bacteriology, antimicrobial susceptibility and the role of ertapenem
More information11/2/2015. Update on the Treatment of Clostridium difficile Infections. Disclosure. Objectives
Update on the Treatment of Clostridium difficile Infections Spencer H. Durham, Pharm.D.,BCPS (AQ-ID) Assistant Clinical Professor of Pharmacy Practice Auburn University Harrison School of Pharmacy Kurt
More informationOverview of C. difficile infections. Kurt B. Stevenson, MD MPH Professor Division of Infectious Diseases
Overview of C. difficile infections Kurt B. Stevenson, MD MPH Professor Division of Infectious Diseases Conflicts of Interest I have no financial conflicts of interest related to this topic and presentation.
More informationEffect of Lactobacillus F19 on the emergence of antibioticresistant microorganisms in the intestinal microflora
Journal of Antimicrobial Chemotherapy (2004) 54, 791 797 DOI: 10.1093/jac/dkh406 Advance Access publication 25 August 2004 Effect of Lactobacillus F19 on the emergence of antibioticresistant microorganisms
More informationTaking Action to Prevent and Manage Multidrug-resistant Organisms and C. difficile in the Nursing Home: Part 1 Reviewing the organisms
Taking Action to Prevent and Manage Multidrug-resistant Organisms and C. difficile in the Nursing Home: Part 1 Reviewing the organisms Nimalie D. Stone, MD,MS Division of Healthcare Quality Promotion National
More informationMICHAEL J. RYBAK,* ELLIE HERSHBERGER, TABITHA MOLDOVAN, AND RICHARD G. GRUCZ
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 2000, p. 1062 1066 Vol. 44, No. 4 0066-4804/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. In Vitro Activities of Daptomycin,
More informationSpecificity (target gene) Primer name Sequence Product length[bp] GGATTAGATACCCTGGTAGTC TACCTTGTTACGACTT
Supplementary material for Beneficial Microbes DOI: http://dx.doi.org/10.3920/bm2013.0021 Individual responses of mother sows to a probiotic Enterococcus faecium strain lead to different microbiota composition
More informationEvaluation of a computerized antimicrobial susceptibility system with bacteria isolated from animals
J Vet Diagn Invest :164 168 (1998) Evaluation of a computerized antimicrobial susceptibility system with bacteria isolated from animals Susannah K. Hubert, Phouc Dinh Nguyen, Robert D. Walker Abstract.
More informationHelp with moving disc diffusion methods from BSAC to EUCAST. Media BSAC EUCAST
Help with moving disc diffusion methods from BSAC to EUCAST This document sets out the main differences between the BSAC and EUCAST disc diffusion methods with specific emphasis on preparation prior to
More informationChapter Anaerobic infections (individual fields): intraperitoneal infections (acute peritonitis, hepatobiliary infections, etc.
J Infect Chemother (2011) 17 (Suppl 1):84 91 DOI 10.1007/s10156-010-0146-5 GUIDELINES Chapter 2-5-4. Anaerobic infections (individual fields): intraperitoneal infections (acute peritonitis, hepatobiliary
More informationThe prevalence of antibiotic resistance in anaerobic bacteria isolated from patients with skin infections Research Article
Gene Therapy and Molecular Biology Vol 9, page 263 Gene Ther Mol Biol Vol 9, 263-268, 2005 The prevalence of antibiotic resistance in anaerobic bacteria isolated from patients with skin infections Research
More informationEcological impact of the des-f(6)-quinolone, BMS , on the normal intestinal microflora C. E. Nord 1, D. A. Gajjar 2 and D. M.
ORIGINAL ARTICLE Ecological impact of the des-f(6)-quinolone, BMS-284756, on the normal intestinal microflora C. E. Nord 1, D. A. Gajjar 2 and D. M. Grasela 2 1 Department of Microbiology, Pathology and
More informationNON-SPORING ANAEROBES
36 NON-SPORING ANAEROBES 36.1 INTRODUCTION Anaerobic bacteria are widespread and very important. They do not require oxygen for growth, which is often toxic for them. They lack the enzymes superoxide dismutase,
More informationClindamycin Palmitate Hydrochloride for Oral Solution, USP (Pediatric)
Clindamycin Palmitate Hydrochloride for Oral Solution, USP (Pediatric) To reduce the development of drug-resistant bacteria and maintain the effectiveness of clindamycin palmitate hydrochloride (HCl) for
More informationETX0282, a Novel Oral Agent Against Multidrug-Resistant Enterobacteriaceae
ETX0282, a Novel Oral Agent Against Multidrug-Resistant Enterobacteriaceae Thomas Durand-Réville 02 June 2017 - ASM Microbe 2017 (Session #113) Disclosures Thomas Durand-Réville: Full-time Employee; Self;
More information2015 Antibiogram. Red Deer Regional Hospital. Central Zone. Alberta Health Services
2015 Antibiogram Red Deer Regional Hospital Central Zone Alberta Health Services Introduction. This antibiogram is a cumulative report of the antimicrobial susceptibility rates of common microbial pathogens
More informationEpidemiology and Antimicrobial Susceptibility of Anaerobic Bloodstream Infections: A 10 Years Study
JMID/ 2018; 8 (4):135-139 Journal of Microbiology and Infectious Diseases doi: 10.5799/xxxxx RESEARCH ARTICLE Epidemiology and Antimicrobial Susceptibility of Anaerobic Bloodstream Infections: A 10 Years
More informationagainst Clinical Isolates of Gram-Positive Bacteria
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Feb. 993, p. 366-370 Vol. 37, No. 0066-0/93/00366-05$0.00/0 Copyright 993, American Society for Microbiology In Vitro Activity of CP-99,9, a New Fluoroquinolone,
More informationTitle: N-Acetylcysteine (NAC) Mediated Modulation of Bacterial Antibiotic
AAC Accepts, published online ahead of print on June 00 Antimicrob. Agents Chemother. doi:0./aac.0070-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationIn Vitro Antibacterial Properties of Pexiganan, an Analog of Magainin
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 1999, p. 782 788 Vol. 43, No. 4 0066-4804/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. In Vitro Antibacterial Properties
More informationTest Method Modified Association of Analytical Communities Test Method Modified Germicidal Spray Products as Disinfectants
Study Title Antibacterial Activity and Efficacy of E-Mist Innovations' Electrostatic Sprayer Product with Multiple Disinfectants Method Modified Association of Analytical Communities Method 961.02 Modified
More information2016 Antibiogram. Central Zone. Alberta Health Services. including. Red Deer Regional Hospital. St. Mary s Hospital, Camrose
2016 Antibiogram Central Zone Alberta Health Services including Red Deer Regional Hospital St. Mary s Hospital, Camrose Introduction This antibiogram is a cumulative report of the antimicrobial susceptibility
More informationLearning Objectives 6/1/18
Gulf Coast Multidisciplinary Pharmacotherapy Conference Kelly R. Reveles, PharmD, PhD, BCPS College of Pharmacy, The University of Texas at Austin School of Medicine, UT Health San Antonio Email: kdaniels46@utexas.edu
More informationIntra-abdominal anaerobic infections. Diagnostics and therapy
Intra-abdominal anaerobic infections. Diagnostics and therapy Elisabeth Nagy MD. PhD. DSc. Institute of Clinical Microbiology, Faculty of Medicine, University of Szeged 4th ESCMID School, Szeged, Hungary
More information2017 Antibiogram. Central Zone. Alberta Health Services. including. Red Deer Regional Hospital. St. Mary s Hospital, Camrose
2017 Antibiogram Central Zone Alberta Health Services including Red Deer Regional Hospital St. Mary s Hospital, Camrose Introduction This antibiogram is a cumulative report of the antimicrobial susceptibility
More informationEffect of Antibiotic Treatment on Establishment and Elimination of Intestinal Colonization by KPC-Producing Klebsiella pneumoniae in Mice
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, June 2011, p. 2585 2589 Vol. 55, No. 6 0066-4804/11/$12.00 doi:10.1128/aac.00891-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Effect
More informationSecondary bacterial infections complicating skin lesions
J. Med. Microbiol. Vol. 51 (2002), 808 812 # 2002 Society for General Microbiology ISSN 0022-2615 REVIEW ARTICLE Secondary bacterial infections complicating skin lesions ITZHAK BROOK Department of Pediatrics,
More informationAn evaluation of the susceptibility patterns of Gram-negative organisms isolated in cancer centres with aminoglycoside usage
Journal of Antimicrobial Chemotherapy (1991) 27, Suppl. C, 1-7 An evaluation of the susceptibility patterns of Gram-negative organisms isolated in cancer centres with aminoglycoside usage J. J. Muscato",
More informationPDF hosted at the Radboud Repository of the Radboud University Nijmegen
PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/26062
More informationSusceptibility of Respiratory Tract Anaerobes to Orally Administered Penicillins and Cephalosporins
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Oct. 1976, p. 713-720 Copyright 0 1976 American Society for Microbiology Vol. 10, No. 4 Printed in U.S.A. Susceptibility of Respiratory Tract Anaerobes to Orally
More informationAnaerobic and microaerophilic gram-positive cocci Peptococcus species, Peptostreptococcus species, Microaerophilic streptococci
CLINDACIN Composition Each capsule contains Clindamycin (as hydrochloride) 150 mg Capsule Action Clindamycin bind exclusively to the 50S subunit of bacterial ribosomes and suppress protein synthesis. Clindamycin
More information1/30/ Division of Disease Control and Health Protection. Division of Disease Control and Health Protection
Surveillance, Outbreaks, and Reportable Diseases, Oh My! Assisted Living Facility, Nursing Home and Surveyor Infection Prevention Training February 2015 A.C. Burke, MA, CIC Health Care-Associated Infection
More informationAlfonso Torress-Cook, Dr.P.H. Director of Epidemiology/Patient Safety Pacific Hospital of Long Beach
Alfonso Torress-Cook, Dr.P.H. Director of Epidemiology/Patient Safety Pacific Hospital of Long Beach Historical overview The myriad causes of hospital acquired diarrhea Microbiology and ecology of Clostridium
More information(c) 2016, Freeman et al. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license.
This is a repository copy of In vitro activities of MCB3681 and 8 comparators against Clostridium difficile isolates with known ribotypes and diverse geographical spread. White Rose Research Online URL
More informationFluoroquinolones and Anaerobes
REVIEWS OF ANTI-INFECTIVE AGENTS Louis D. Saravolatz, Section Editor INVITED ARTICLE Fluoroquinolones and Anaerobes Gary E. Stein 1,2 and Ellie J. C. Goldstein 3,4 Departments of 1 Medicine and 2 Pharmacology,
More informationLessons Learned from the Anaerobe Survey: Historical Perspective and Review of the Most Recent Data ( )
SUPPLEMENT ARTICLE Lessons Learned from the Anaerobe Survey: Historical Perspective and Review of the Most Recent Data (2005 2007) David R. Snydman, 1,2 Nilda V. Jacobus, 1 Laura A. McDermott, 1 Yoav Golan,
More informationESCMID Online Lecture Library. by author
Anaerobic Bacteria in Intra-Abdominal Infections and Bacteremia Maria Hedberg, Umeå University, Umeå, Sweden Anaerobic Bacteria: Next Generation Technology Meets Anaerobic Diagnostics ESCMID Postgraduate
More informationPathogens commonly isolated from selected diseases
Pathogens commonly isolated from selected diseases Equine pneumonia/pleuropneumonia -hemolytic Strep. Clostridium Pasteurella E. coli Klebsiella pneumoniae Bacteroides Equine enteric pathogens Salmonella
More informationBacteriology of Moderate-to-Severe Diabetic Foot Infections and In Vitro Activity of Antimicrobial Agents
JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 2007, p. 2819 2828 Vol. 45, No. 9 0095-1137/07/$08.00 0 doi:10.1128/jcm.00551-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Bacteriology
More informationClostridium difficile Colitis
Update on Clostridium difficile Colitis Fredrick M. Abrahamian, D.O., FACEP Associate Professor of Medicine UCLA School of Medicine Director of Education Department of Emergency Medicine Olive View-UCLA
More informationafter trauma in children
6 Department of Pediatrics, Navy Hospital, Bethesda, Maryland, USA Brook Correspondence to: Dr tzhak Brook, PO Box 704, Chevy Chase, MD 08-04, USA. Accepted for publication November 997 Table JAccid Emerg
More informationBACTERIOLOGY PROFICIENCY TESTING PROGRAM
BACTERIOLOGY PROFICIENCY TESTING PROGRAM Comprehensive Category January 20, 2015 If you have any questions or comments, please contact either: Dr. Wendy Archinal Dr. Kimberlee Musser Phone: (518) 474-4177
More informationIn vitro susceptibility to 17 antimicrobials of clinical Clostridium difficile isolates collected in in Sweden
ORIGINAL ARTICLE BACTERIOLOGY In vitro susceptibility to 17 antimicrobials of clinical Clostridium difficile isolates collected in 1993 2007 in Sweden T. Norén 1,2, I. Alriksson 2,T.Åkerlund 3, L. G. Burman
More informationESBL Producers An Increasing Problem: An Overview Of An Underrated Threat
ESBL Producers An Increasing Problem: An Overview Of An Underrated Threat Hicham Ezzat Professor of Microbiology and Immunology Cairo University Introduction 1 Since the 1980s there have been dramatic
More informationMark Your Calendars Now! Next Event Ships: September 14, 2015
www.wslhpt.org 2601 Agriculture Drive Madison, WI 53718 (800) 462-5261 (608) 265-1111 Shipment Date: June 15, 2015 Questions or comments should be directed to Amanda Weiss at 800-462-5261 x51 or amanda.weiss@slh.wisc.edu.
More informationCipro for gram positive cocci in urine
Buscar... Cipro for gram positive cocci in urine 20-6-2017 Pneumonia can be generally defined as an infection of the lung parenchyma, in which consolidation of the affected part and a filling of the alveolar
More informationESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED
ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED Caroline Pissetti 1, Jalusa Deon Kich 2, Heather K. Allen 3, Claudia Navarrete
More informationCleocin Pediatric clindamycin palmitate hydrochloride for oral solution, USP
To reduce the development of drug-resistant bacteria and maintain the effectiveness of CLEOCIN PEDIATRIC and other antibacterial drugs, CLEOCIN PEDIATRIC should be used only to treat or prevent infections
More informationCLEOCIN HCl Capsules contain clindamycin hydrochloride equivalent to 75 mg, 150 mg, or 300 mg of clindamycin.
CLEOCIN HCl clindamycin hydrochloride capsules, USP To reduce the development of drug-resistant bacteria and maintain the effectiveness of CLEOCIN HCl and other antibacterial drugs, CLEOCIN HCl should
More informationPreventing Multi-Drug Resistant Organism (MDRO) Infections. For National Patient Safety Goal
Preventing Multi-Drug Resistant Organism (MDRO) Infections For National Patient Safety Goal 07.03.01 2009 Methicillin Resistant Staphlococcus aureus (MRSA) About 3-8% of the population at large is a carrier
More information2 0 hr. 2 hr. 4 hr. 8 hr. 10 hr. 12 hr.14 hr. 16 hr. 18 hr. 20 hr. 22 hr. 24 hr. (time)
Key words I μ μ μ μ μ μ μ μ μ μ μ μ μ μ II Fig. 1. Microdilution plate. The dilution step of the antimicrobial agent is prepared in the -well microplate. Serial twofold dilution were prepared according
More informationAntibacterials. Recent data on linezolid and daptomycin
Antibacterials Recent data on linezolid and daptomycin Patricia Muñoz, MD. Ph.D. (pmunoz@micro.hggm.es) Hospital General Universitario Gregorio Marañón Universidad Complutense de Madrid. 1 GESITRA Reasons
More informationMulti-Drug Resistant Organisms (MDRO)
Multi-Drug Resistant Organisms (MDRO) 2016 What are MDROs? Multi-drug resistant organisms, or MDROs, are bacteria resistant to current antibiotic therapy and therefore difficult to treat. MDROs can cause
More informationEllie JC Goldstein Diane M. Citron C. Vreni Merriam Kerin L Tyrrell
AAC Accepts, published online ahead of print on 1 October 2012 Antimicrob. Agents Chemother. doi:10.1128/aac.01794-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 1 2 3 4 5
More informationIn Vitro Activity of Netilmicin, Gentamicin, and Amikacin
ANTIMICROBIAL AGzNTS AND CHEMOTHERAPY, Jan. 1977, p. 126-131 Copyright X 1977 American Society for Microbiology Vol. 11, No. 1 Printed in U.S.A. In Vitro Activity of Netilmicin, Gentamicin, and Amikacin
More informationFlorida Health Care Association District 2 January 13, 2015 A.C. Burke, MA, CIC
Florida Health Care Association District 2 January 13, 2015 A.C. Burke, MA, CIC 11/20/2014 1 To describe carbapenem-resistant Enterobacteriaceae. To identify laboratory detection standards for carbapenem-resistant
More informationChildrens Hospital Antibiogram for 2012 (Based on data from 2011)
Childrens Hospital Antibiogram for 2012 (Based on data from 2011) Prepared by: Department of Clinical Microbiology, Health Sciences Centre For further information contact: Andrew Walkty, MD, FRCPC Medical
More informationIn Vitro Susceptibility to Pexiganan of Bacteria Isolated from Infected Diabetic Foot Ulcers
In Vitro Susceptibility to Pexiganan of Bacteria Isolated from Infected Diabetic Foot Ulcers Yigong Ge, Dorothy MacDonald, Marietta M. Henry, Howard I. Hait, Kimberly A. Nelson, Benjamin A. Lipsky, Michael
More information6.0 ANTIBACTERIAL ACTIVITY OF CAROTENOID FROM HALOMONAS SPECIES AGAINST CHOSEN HUMAN BACTERIAL PATHOGENS
6.0 ANTIBACTERIAL ACTIVITY OF CAROTENOID FROM HALOMONAS SPECIES AGAINST CHOSEN HUMAN BACTERIAL PATHOGENS 6.1 INTRODUCTION Microorganisms that cause infectious disease are called pathogenic microbes. Although
More informationRunning head: CLOSTRIDIUM DIFFICILE 1
Running head: CLOSTRIDIUM DIFFICILE 1 Clostridium difficile Infection Christy Lee Fenton Mountainland Applied Technology College CLOSTRIDIUM DIFFICILE 2 Clostridium difficile Infection Approximately 200,000
More informationClostridium difficile Infection Prevention. Basics of Infection Prevention 2-Day Mini-Course 2012
Clostridium difficile Infection Prevention Basics of Infection Prevention 2-Day Mini-Course 2012 2 Objectives Describe the etiology and epidemiology of C. difficile infection (CDI) Review evidence-based
More informationavailable. and P. aeruginosa resistant to gentamicin by standardized disk testing (1) in the Microbiology Laboratory
ANTimICROBIAL AGENTh AND CHEMOTHERAPY, OCt. 1976, p. 677-681 Copyright 1976 American Society for Microbiology Vol. 10, No. 4 Printed in U.S.A. In Vitro Susceptibility of Gentamicin-Resistant Enterobacteriaceae
More information6. STORAGE INSTRUCTIONS
VRESelect 63751 A selective and differential chromogenic medium for the qualitative detection of gastrointestinal colonization of vancomycin-resistant Enterococcus faecium () and vancomycin-resistant Enterococcus
More information03/09/2014. Infection Prevention and Control A Foundation Course. Talk outline
Infection Prevention and Control A Foundation Course 2014 What is healthcare-associated infection (HCAI), antimicrobial resistance (AMR) and multi-drug resistant organisms (MDROs)? Why we should be worried?
More information