Keywords: CB-183,315; Clostridium difficile; susceptibility; intestinal anaerobes

Size: px
Start display at page:

Download "Keywords: CB-183,315; Clostridium difficile; susceptibility; intestinal anaerobes"

Transcription

1 AAC Accepts, published online ahead of print on 19 December 2011 Antimicrob. Agents Chemother. doi: /aac Copyright 2011, American Society for Microbiology. All Rights Reserved In vitro activity of CB-183,315, vancomycin and metronidazole against 556 strains of Clostridium difficile, 445 other intestinal anaerobes and 56 Enterobacteriaceae species 1 Diane M. Citron*, 1 Kerin L. Tyrrell, 1 C. Vreni Merriam and 1,2 Ellie J.C. Goldstein 1 R.M. Alden Research Lab, Culver City, CA 2 Geffen School of Medicine, UCLA, Los Angeles, CA Keywords: CB-183,315; Clostridium difficile; susceptibility; intestinal anaerobes Running title: CB-183,315 against C. difficile and intestinal organisms Corresponding author: Diane M. Citron R.M. Alden Research Lab 6133 Bristol Parkway Suite 175 Culver City, CA P F d.m.citron@att.net Abstract 1

2 MICs for CB-183,315, a novel lipopeptide antibiotic, vancomycin and metronidazole were determined for intestinal anaerobes and Enterobacteriaceae. The MIC 90 for gram-negative anaerobes was >8192, 8192 and 4 µg/ml for CB-183,315, vancomycin and metronidazole, respectively. Against Enterobacteriaceae, MIC 90s were >8192 µg/ml, 1024 µg/ml and1024 µg/ml, respectively. CB-183,315 MIC 90 for C. difficile was 0.5 µg/ml. Its lack of activity against normal fecal organisms makes it a promising new agent for treating C. difficile. Clostridium difficile infection (CDI) is the most common cause of healthcare related diarrhea, usually associated with prior exposure to antimicrobial agents. The current theory is that the 2

3 antibiotics disrupt the normal fecal microbiota, changing its complexity and diversity as a primary event, with the subsequent acquisition of toxigenic C. difficile as a secondary event in the development of the disease (6,11,14). CDI has increased in prevalence and severity during the last decade, resulting in increased mortality and complications, recurrent disease and prolonged hospital stay (7,17). Non-healthcare related cases of CDI are now being reported (7,16). Treatment options have been limited by unsatisfactory efficacy of current therapeutic agents, high recurrence rates of disease, disruption of normal intestinal microbiota, and colonization by VRE (1,2,15). Although a recently introduced macrocyclic antibiotic, fidaxomicin, shows equivalent primary cure rates with reduced recurrence rates compared to vancomycin (15) it shows equivalence against REA type BI strain associated disease. CB-183,315 is a novel lipopeptide antibiotic with gram-positive activity and is bactericidal against C. difficile. To study the spectrum of its activity, including effect on the normal components of fecal microbiota, we determined MICs of CB-183,315 and vancomycin against C. difficile and other intestinal anaerobes, plus E. coli, Klebsiella spp. and Enterobacter spp. For comparison, metronidazole was tested against the gram-negative anaerobes and the Enterobacteriaceae spp. The C. difficile strains were recent clinical isolates ( ) recovered from stools of patients with CDI. Other isolates were from stool or infections containing organisms presumed to be of intestinal origin, identified by standard methods (13) and occasionally by 16S rdna sequence analysis (20), and stored in 20% skim milk at -70 o C. MIC values were determined by the agar dilution method according to CLSI procedures (4). Vancomycin and metronidazole laboratory standard powders were obtained from Sigma (St. 3

4 Louis, MO) and CB-183,315 was provided by Cubist Pharmaceuticals, Inc. (Lexington, MA). All assay media for testing CB-183,315 were supplemented with a final concentration of 50 mg/l calcium, where Ca ++ concentrations were confirmed by Laboratory Specialists, Inc. (Westlake, Ohio). The Escherichia coli, Klebsiella pneumoniae and Enterobacter spp. strains were tested using Mueller Hinton agar, and incubated at 37 o C in ambient air, except for metronidazole, which was incubated in the anaerobic chamber (4). Quality control strains included Clostridium difficile ATCC , Bacteroides fragilis ATCC 25285, Staphylococcus aureus ATCC and E. coli ATCC and were included each day of testing of the relevant set of test organisms. Time-kill studies were carried out on one restriction endonuclease analysis (REA) BI type (NAP1, ribotype 027) strain and one REA type Y (NAP4, ribotype 014) strain (3). CB-183,315 and vancomycin were prepared at 2, 4, and 8 times their MICs for each strain in supplemented Brucella broth. A drug-free growth control tube was included. Tubes were inoculated with ~ 10 6 CFU/ml, placed on a shaker and assayed at 0, 2, 4, 8, and 24h of incubation at 37 o C. Table 1 shows the range, MIC 50 and MIC 90 for the major groups of organisms. The CB-183,315 MIC range for C. difficile was µg/ml with MIC 90 of 0.5 µg/ml; other gram-positive strains were inhibited by µg/ml. The MIC 90 for CB-183,315 against the Bacteroides fragilis group, Prevotella spp., gram-negative cocci (Veillonella spp. and Acidaminococcus sp.), 4

5 as well as E. coli, Enterobacter spp., and Klebsiella spp. was greater than 8192 µg/ml. Against fusobacteria, and Porphyromonas spp., the MIC 90 was 8192 µg/ml and 2048 µg/ml, respectively. In contrast, vancomycin had equally high MICs of >8192 µg/ml only against the fusobacteria and the gram-negative cocci; the B. fragilis group was inhibited by vancomycin at MIC 90 of 128 µg/ml (range µg/ml), Porphyromonas by 4 µg/ml, and Prevotella spp. by 256 µg/ml of vancomycin. Vancomycin MICs ranged from µg/ml for E. coli and µg/ml for Enterobacter and Klebsiella species. Metronidazole was active against the gram-negative anaerobes at 0.06 to 8 µg/ml, but showed poor activity against the Enterobacteriaceae, with MICs ranging from 32 to1024 µg/ml. The time-kill studies showed that CB-183,315 at 4 and 8 times the MIC resulted in a 3 log 10 reduction in colony count after 24h incubation against both REA types tested. Vancomycin produced a similar result.. CB-183,315 reaches concentrations of μg/g of feces after a 1g bid dose at day 5 of a 14 day course (Cubist Pharmaceuticals data on file) which is lower than the high MICs (>8192 µg/ml) demonstrated for Bacteroides and other groups of organisms of the intestinal anaerobes, thus CB-183,315 is likely to spare many of these important members of the normal microbiota. In contrast, vancomycin at a dose of 250 mg qid results in fecal levels that are generally above 2,000 μg/ml (12). Vancomycin thus has the potential for killing or inhibiting much of the normal aerobic and anaerobic fecal microbiota. Moreover, oral vancomycin was shown to decrease or suppress Bacteroides in volunteers while increasing occurrence of vancomycin-resistant enterococci (8,14). In contrast, fidaxomicin, a narrow spectrum 5

6 macrocycle, displayed less impact on the Bacteroides populations in patients treated for CDI (14), which has been postulated as one reason for the associated lower relapse rate. Using temporal temperature gradient electrophoresis and fluorescent in situ hybridization and flow cytometry, Tannock et al.(19) compared the impact of fidaxomicin and vancomycin on seven phylogenetic groups, including clostridial clusters IV and XIVa, Bacteroides-Prevotella, Bifidobacterium, Atopobium, enterobacteria, and the Enterococcaceae-Lactobacillaceae group. Minimal changes were seen in these groups for the fidaxomicin treated patients while the vancomycin treated patients showed a marked decrease in Clostridium clusters IV and XIVa, Bacteroides and Bifidobacterium, and an increase in the Enterococcus-Lactobacillus and the enterobacteria groups. MICs for CB-183,315 against clostridia were similar to those reported for fidaxomicin (10), showing decreased activity against several species in Clostridium clusters XIVa, XVI, and XVIII, although unlike fidaxomicin, decreased activity of CB-183,315 was also present against several species in cluster I (5,9,18). MIC 90 for the C. clostridioforme group (cluster XIVa), was 16 µg/ml; for C. innocuum (cluster XVI) 4 µg/ml; for C. ramosum (Cluster XVIII) 8 µg/ml; and C. sphenoides, 1 strain, (cluster XIVa) 16 µg/ml. These findings suggest that CB-183,315 would show a similar lack of impact as fidaxomicin on the composition of the major groups of bowel microbiota. With its excellent activity against C. difficile and its narrower spectrum and lack of activity against other colonic aerobic and anaerobic microbiota, with the potential for fewer relapses, CB- 183,315 is a promising new drug treatment for CDI. 6

7 Acknowledgement This study was sponsored by a grant from Cubist Pharmaceuticals, Inc. We thank Eliza Leoncio for excellent technical assistance. Downloaded from on October 1, 2018 by guest 7

8 148 Reference List Al-Nassir, W. N., A. K. Sethi, Y. Li, M. J. Pultz, M. M. Riggs, and C. J. Donskey Both oral metronidazole and oral vancomycin promote persistent overgrowth of vancomycin-resistant enterococci during treatment of Clostridium difficile-associated disease. Antimicrob.Agents Chemother. 52: Bhalla, A., N. J. Pultz, A. J. Ray, C. K. Hoyen, E. C. Eckstein, and C. J. Donskey Antianaerobic antibiotic therapy promotes overgrowth of antibiotic-resistant, gramnegative bacilli and vancomycin-resistant enterococci in the stool of colonized patients. Infect.Control Hosp.Epidemiol. 24: Clabots, C. R., S. Johnson, K. M. Bettin, P. A. Mathie, M. E. Mulligan, D. R. Schaberg, L. R. Peterson, and D. N. Gerding Development of a rapid and efficient restriction endonuclease analysis typing system for Clostridium difficile and correlation with other typing systems. J.Clin.Microbiol. 31: Clinical and Laboratory Standards Institute Methods for antimicrobial susceptibility testing of anaerobic bacteria, 7th ed. Approved standard M11-A7. Clinical and Laboratory Standards Institute, Wayne, PA. 5. Collins, M. D., P. A. Lawson, A. Willems, J. J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J. A. Farrow The phylogeny of the genus 8

9 Clostridium: proposal of five new genera and eleven new species combinations. Int.J.Syst.Bacteriol. 44: Dethlefsen, L., S. Huse, M. L. Sogin, and D. A. Relman The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rrna sequencing. PLoS.Biol. 6:e Dubberke, E. R. and A. I. Wertheimer Review of current literature on the economic burden of Clostridium difficile infection. Infect.Control Hosp.Epidemiol. 30: Edlund, C., L. Barkholt, B. Olsson-Liljequist, and C. E. Nord Effect of vancomycin on intestinal flora of patients who previously received antimicrobial therapy. Clin.Infect.Dis. 25: Finegold, S. M., D. Molitoris, M. L. Vaisanen, Y. Song, C. Liu, and M. Bolanos In vitro activities of OPT-80 and comparator drugs against intestinal bacteria. Antimicrob.Agents Chemother. 48: Finegold, S. M., D. Molitoris, M. L. Vaisanen, Y. Song, C. Liu, and M. Bolanos In vitro activities of OPT-80 and comparator drugs against intestinal bacteria. Antimicrob.Agents Chemother. 48:

10 Gerding, D. N. and S. Johnson Management of Clostridium difficile infection: thinking inside and outside the box. Clin.Infect.Dis. 51: Gonzales, M., J. Pepin, E. H. Frost, J. C. Carrier, S. Sirard, L. C. Fortier, and L. Valiquette Faecal pharmacokinetics of orally administered vancomycin in patients with suspected Clostridium difficile infection. BMC.Infect.Dis. 10: Jousimies-Somer, H. R., P. Summanen, D. M. Citron, E. J. Baron, H. M. Wexler, and S. M. Finegold Wadsworth-KTL Anaerobic Bacteriology Manual. Star Publishing, Belmont, CA. 14. Louie, T. J., J. Emery, W. Krulicki, B. Byrne, and M. Mah OPT-80 eliminates Clostridium difficile and is sparing of bacteroides species during treatment of C. difficile infection. Antimicrob.Agents Chemother. 53: Miller, M., L. Bernard, M. Thompson, D. Grima, and J. Pepin Lack of increased colonization with vancomycin-resistant enterococci during preferential use of vancomycin for treatment during an outbreak of healthcare-associated Clostridium difficile infection. Infect.Control Hosp.Epidemiol. 31: Rouphael, N. G., J. A. O'Donnell, J. Bhatnagar, F. Lewis, P. M. Polgreen, S. Beekmann, J. Guarner, G. E. Killgore, B. Coffman, J. Campbell, S. R. Zaki, and L. C. McDonald Clostridium difficile-associated diarrhea: an emerging threat to pregnant women. Am.J.Obstet.Gynecol. 198:

11 Rupnik, M., M. H. Wilcox, and D. N. Gerding Clostridium difficile infection: new developments in epidemiology and pathogenesis. Nat.Rev.Microbiol. 7: Stackebrandt, E., I. Kramer, J. Swiderski, and H. Hippe Phylogenetic basis for a taxonomic dissection of the genus Clostridium. FEMS Immunol.Med.Microbiol. 24: Tannock, G. W., K. Munro, C. Taylor, B. Lawley, W. Young, B. Byrne, J. Emery, and T. Louie A new macrocyclic antibiotic, fidaxomicin (OPT-80), causes less alteration to the bowel microbiota of Clostridium difficile-infected patients than does vancomycin. Microbiology 156: Warren, Y. A., K. L. Tyrrell, D. M. Citron, and E. J. Goldstein Clostridium aldenense sp. nov. and Clostridium citroniae sp. nov. isolated from human clinical infections. J.Clin.Microbiol. 44:

12 Table 1. In vitro activity of CB-183,315, Vancomycin and Metronidazole against Intestinal Organisms (μg/ml) CB-183,315 Vancomycin Metronidazole Group N Range MIC 50 MIC 90 Range MIC 50 MIC 90 Range MIC 50 MIC 90 Actinomyces species a NT Bifidobacterium species b NT Eggerthella lenta NT Eubacterium limosum NT Eubacterium group (other) c NT Lactobacillus species, VAN-R d >32 - >32 >32 >32 NT Lactobacillus species, VAN-S e NT Propionibacterium species f NT Clostridium clostridioforme NT grp g (CL. XIVa) Clostridium difficile (Cl. XI) NT Clostridium innocuum (Cl.XV) NT Clostridium perfringens (Cl.I) NT Clostridium ramosum (Cl. NT XVIII) Clostridium species (other) h NT Anaerobic gram-positive cocci i 49 < NT Bacteroides fragilis group j > > Fusobacterium species k > > > Porphyromonas species l Prevotella species m > > Gram-negative cocci n >8192 >8192 >8192 > > >8192 > E. coli >

13 >8192- >8192 >8192 Enterobacter species o 18 > >8192 >8192 > Klebsiella species p Cl, phylogenetic cluster a Actinomyces israelii (2), A. meyeri (2), A. naeslundii (1), A. neuii ss anitratus (2), A. neuii ss neuii (1), A. odontolyticus (2), A. turicensis (2), and A. viscosus (3). b Bifidobacterium adolescentis (2), B. bifidum (1), B. breve (4), B. catenulatum (2), B. dentium (1), B. longum (2), B. pseudocatenulatum (1), and B. urinalis (1). c Collinsella aerofaciens (6), Eubacterium biforme (1), E. contortum (1), E. cylindroides (1), E. timidum (3), Pseudoramibacter alactolyticum (4) and Eubacterium species (19). d Lactobacillus brevis (1), L. casei (7), L. fermentum (2), L. rhamnosus (6), and Lactobacillus GG (4). e Atopobium parvulum (1), Lactobacillus acidophilus (2), L. catenaformis (3), L. crispatus (1), L. gasseri (3), L. iners (1), L. jensenii (4), and L. leichmannii (2 ) f Propionibacterium acnes (7), P. avidum (4), and P. granulosum (4). g Clostridium aldenense (4), C. bolteae (5), C. citroniae (3), C. clostridioforme (2), and C. hathewayi (6). h Clostridium bifermentans (1), C. butyricum (5), C. cadaveris (3), C. cochlearium (2), C. fallax (1), C. glycolicum (3), C. hastiforme (1), C. hylemonae (1), C. indolis (1), C. leptum (2), C. nexile (1), C. paraputrificum (4), C. sartagoforme (1), C. scindens (1), C. sordelli (2), C. sphenoides (1), C. sporogenes (2), C. subterminale (1), C. symbiosum (4), and C. tertium (2). 13

14 i Anaerococcus lactolyticus (2), A. octavius (1), A. prevotii (6), A. tetradius (5), A. vaginalis (4) ; Finegoldia magna (7) ; Peptoniphilus asaccharolyticus (5), P. harei (2), P. indolicus (2), P. ivorii (3), and P. lacrimalis (2); Peptostreptococcus anaerobius (5) and Parvimonas micra (5). j Bacteroides caccae (1), B. distasonis (1), B. fragilis (11), B. nordii (1), B. ovatus (3), B. thetaiotaomicron (3), B. vulgatus (1). k Fusobacterium gonidiaformans (1), F. mortiferum-varium group (6), F. necrophorum (2), F. nucleatum (10), and F. russii (1). l Porphyromonas asaccharolytica (9), P. gingivalis (4), P. somerae (6), P. uenonis (2). m Prevotella bivia (10), P. disiens (3), P. intermedia/nigrescens (1), P. loeschii (3), and P. melaninogenica (3). n Acidaminococcus fermentans (8), Veillonella species (13). o Enterobacter aerogenes (6), Enterobacter cloacae (11), Enterobacter sp. (1) p Klebsiella oxytoca (3), Klebsiella pneumoniae (17) 14

ANTI-ANAEROBIC ACTIVITIES OF SULOPENEM COMPARED TO SIX OTHER. Departments of Pathology, Hershey Medical Center, Hershey, PA 17033

ANTI-ANAEROBIC ACTIVITIES OF SULOPENEM COMPARED TO SIX OTHER. Departments of Pathology, Hershey Medical Center, Hershey, PA 17033 AAC Accepts, published online ahead of print on 17 February 2009 Antimicrob. Agents Chemother. doi:10.1128/aac.01557-08 Copyright 2009, American Society for Microbiology and/or the Listed Authors/Institutions.

More information

In Vitro Activities of OPT-80 and Comparator Drugs against Intestinal Bacteria

In Vitro Activities of OPT-80 and Comparator Drugs against Intestinal Bacteria ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Dec. 2004, p. 4898 4902 Vol. 48, No. 12 0066-4804/04/$08.00 0 DOI: 10.1128/AAC.48.12.4898 4902.2004 Copyright 2004, American Society for Microbiology. All Rights

More information

AAC Revised. Activity of a Novel Cyclic Lipopeptide, CB-183,315 Against Resistant Clostridium difficile

AAC Revised. Activity of a Novel Cyclic Lipopeptide, CB-183,315 Against Resistant Clostridium difficile AAC Accepts, published online ahead of print on 5 March 2012 Antimicrob. Agents Chemother. doi:10.1128/aac.06257-11 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 AAC06257-11

More information

SESSION XVI NEW ANTIBIOTICS

SESSION XVI NEW ANTIBIOTICS SESSION XVI NEW ANTIBIOTICS New Antibiotics to Treat Anaerobic Infections 2 Goldstein, E.J.C.;* Citron, D.M. Antibiotic Pharmacodynamics 3 Stein, G.E.* Targeting Selenium Metabolism in Stickland Fermentors:

More information

R. M. Alden Research Laboratory, Santa Monica, California 90404, 1 and David Geffen School of Medicine at UCLA, Los Angeles, California

R. M. Alden Research Laboratory, Santa Monica, California 90404, 1 and David Geffen School of Medicine at UCLA, Los Angeles, California ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 2006, p. 2875 2879 Vol. 50, No. 8 0066-4804/06/$08.00 0 doi:10.1128/aac.00286-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. In Vitro

More information

on February 12, 2018 by guest

on February 12, 2018 by guest AAC Accepted Manuscript Posted Online 12 February 2018 Antimicrob. Agents Chemother. doi:10.1128/aac.00047-18 Copyright 2018 Stapert et al. This is an open-access article distributed under the terms of

More information

Antimicrobial Susceptibility Patterns of Anaerobic Bacterial Clinical Isolates From 2014 to 2016, Including Recently Named or Renamed Species

Antimicrobial Susceptibility Patterns of Anaerobic Bacterial Clinical Isolates From 2014 to 2016, Including Recently Named or Renamed Species Original Article Clinical Microbiology Ann Lab Med 2019;39:190-199 https://doi.org/10.3343/alm.2019.39.2.190 ISSN 2234-3806 eissn 2234-3814 Antimicrobial Susceptibility Patterns of Anaerobic Bacterial

More information

Multicenter Study of Antimicrobial Susceptibility of Anaerobic Bacteria in Korea in 2012

Multicenter Study of Antimicrobial Susceptibility of Anaerobic Bacteria in Korea in 2012 Original Article Clinical Microbiology Ann Lab Med 2015;35:479-486 http://dx.doi.org/10.3343/alm.2015.35.5.479 ISSN 2234-3806 eissn 2234-3814 Multicenter Study of Antimicrobial Susceptibility of Anaerobic

More information

Antimicrobial Susceptibility of Clinically Relevant Gram-Positive Anaerobic Cocci Collected over a Three-Year Period in the Netherlands

Antimicrobial Susceptibility of Clinically Relevant Gram-Positive Anaerobic Cocci Collected over a Three-Year Period in the Netherlands ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Mar. 2011, p. 1199 1203 Vol. 55, No. 3 0066-4804/11/$12.00 doi:10.1128/aac.01771-09 Copyright 2011, American Society for Microbiology. All Rights Reserved. Antimicrobial

More information

Piperacillin-Tazobactam, and Cefoxitin

Piperacillin-Tazobactam, and Cefoxitin ANTiMICROBLAL AGENTS AND CHEMOTHERAPY, Aug. 1993, p. 1649-1654 0066-4804/93/081649-06$00/0 Copyright 1993, American Society for Microbiology Vol. 37, No. 8 Susceptibilities of 428 Gram-Positive and -Negative

More information

Title: Effect of fidaxomicin versus vancomycin on susceptibility to intestinal

Title: Effect of fidaxomicin versus vancomycin on susceptibility to intestinal AAC Accepted Manuscript Posted Online 18 April 2016 Antimicrob. Agents Chemother. doi:10.1128/aac.02590-15 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 2 3 Title: Effect of

More information

Patterns of Susceptibility to Fluoroquinolones Among Anaerobic Bacterial Isolates in the United States

Patterns of Susceptibility to Fluoroquinolones Among Anaerobic Bacterial Isolates in the United States S377 Patterns of Susceptibility to Fluoroquinolones Among Anaerobic Bacterial Isolates in the United States Ellie J. C. Goldstein From R. M. Alden Research Laboratory, Santa Monica Hospital Medical Center,

More information

Third Belgian multicentre survey of antibiotic susceptibility of anaerobic bacteria

Third Belgian multicentre survey of antibiotic susceptibility of anaerobic bacteria Journal of Antimicrobial Chemotherapy (2007) 59, 132 139 doi:10.1093/jac/dkl458 Advance Access publication 9 November 2006 Third Belgian multicentre survey of antibiotic susceptibility of anaerobic bacteria

More information

Present Status of Therapy for Anaerobic Infections

Present Status of Therapy for Anaerobic Infections 89 Present Status of Therapy for Anaerobic Infections Sydney M. Finegold and Hannah M. Wexler From the Medical and Research Services, Veterans Affairs Medical Center West Los Angeles, and the Department

More information

As presented at 112th General Meeting of the American Society for Microbiology, Session C-173 June 16 19, 2012, San Francisco, California

As presented at 112th General Meeting of the American Society for Microbiology, Session C-173 June 16 19, 2012, San Francisco, California As presented at 112th General Meeting of the American Society for Microbiology, Session C-173 June 16 19, 2012, San Francisco, California Evaluation of the Analytical Reactivity (Inclusivity) and Analytical

More information

Should we test Clostridium difficile for antimicrobial resistance? by author

Should we test Clostridium difficile for antimicrobial resistance? by author Should we test Clostridium difficile for antimicrobial resistance? Paola Mastrantonio Department of Infectious Diseases Istituto Superiore di Sanità, Rome,Italy Clostridium difficile infection (CDI) (first

More information

Anaerobic bacteria in 118 patients with deepspace head and neck infections from the University Hospital of Maxillofacial Surgery, Sofia, Bulgaria

Anaerobic bacteria in 118 patients with deepspace head and neck infections from the University Hospital of Maxillofacial Surgery, Sofia, Bulgaria Journal of Medical Microbiology (2006), 55, 1285 1289 DOI 10.1099/jmm.0.46512-0 Anaerobic bacteria in 118 patients with deepspace head and neck infections from the University Hospital of Maxillofacial

More information

Labeled Uses: Acute Skin & Skin Structure Infections caused by susceptible bacteria 1,2,4

Labeled Uses: Acute Skin & Skin Structure Infections caused by susceptible bacteria 1,2,4 Brand Name: Generic Name: Teflaro Ceftaroline fosamil Manufacturer: Forest Pharmaceuticals, Inc 1,2 Drug Class: Cephalosporin, Fifth Generation 2,3 Uses: Labeled Uses: Acute Skin & Skin Structure Infections

More information

USA Product Label CLINTABS TABLETS. Virbac. brand of clindamycin hydrochloride tablets. ANADA # , Approved by FDA DESCRIPTION

USA Product Label CLINTABS TABLETS. Virbac. brand of clindamycin hydrochloride tablets. ANADA # , Approved by FDA DESCRIPTION VIRBAC CORPORATION USA Product Label http://www.vetdepot.com P.O. BOX 162059, FORT WORTH, TX, 76161 Telephone: 817-831-5030 Order Desk: 800-338-3659 Fax: 817-831-8327 Website: www.virbacvet.com CLINTABS

More information

In vitro activity of surotomycin against contemporary clinical isolates of toxigenic Clostridium difficile strains obtained in Spain

In vitro activity of surotomycin against contemporary clinical isolates of toxigenic Clostridium difficile strains obtained in Spain J Antimicrob Chemother 2015; 70: 2311 2315 doi:10.1093/jac/dkv092 Advance Access publication 15 April 2015 In vitro activity of surotomycin against contemporary clinical isolates of toxigenic Clostridium

More information

Effect of dalbavancin on the normal intestinal microflora

Effect of dalbavancin on the normal intestinal microflora Journal of Antimicrobial Chemotherapy (00), 1 doi:10.109/jac/dkl1 Advance Access publication 1 July 00 Effect of dalbavancin on the normal intestinal microflora Carl Erik Nord*, Gundars Rasmanis and Elisabeth

More information

Moxifloxacin resistance is prevalent among Bacteroides and Prevotella species in Greece

Moxifloxacin resistance is prevalent among Bacteroides and Prevotella species in Greece Journal of Antimicrobial Chemotherapy (2008) 62, 137 141 doi:10.1093/jac/dkn134 Advance Access publication 1 April 2008 Moxifloxacin resistance is prevalent among Bacteroides and Prevotella species in

More information

ECOLOGICAL IMPACT OF NARROW SPECTRUM ANTIMICROBIAL AGENTS COMPARED TO BROAD SPECTRUM AGENTS ON THE HUMAN INTESTINAL MICROFLORA CARL ERIK NORD

ECOLOGICAL IMPACT OF NARROW SPECTRUM ANTIMICROBIAL AGENTS COMPARED TO BROAD SPECTRUM AGENTS ON THE HUMAN INTESTINAL MICROFLORA CARL ERIK NORD Old Herborn University Seminar Monograph 3: Consequences of antimicrobial therapy for the composition of the microflora of the digestive tract. Editors: Carl Erik Nord, Peter J. Heidt, Volker Rusch, and

More information

Reply to Fabre et. al

Reply to Fabre et. al Reply to Fabre et. al L. Clifford McDonald, 1 Stuart Johnson, 2,3 Johan S. Bakken, 4 Kevin W. Garey, 5 Ciaran Kelly, 6 Dale N. Gerding, 2 1 Centers for Disease Control and Prevention, Atlanta, Georgia;

More information

INFECTIOUS DISEASES DIAGNOSTIC LABORATORY NEWSLETTER

INFECTIOUS DISEASES DIAGNOSTIC LABORATORY NEWSLETTER INFECTIOUS DISEASES DIAGNOSTIC LABORATORY NEWSLETTER University of Minnesota Health University of Minnesota Medical Center University of Minnesota Masonic Children s Hospital May 2017 Printed herein are

More information

Surveillance of susceptibility patterns in 1297 European and US anaerobic and capnophilic isolates to co-amoxiclav and five other antimicrobial agents

Surveillance of susceptibility patterns in 1297 European and US anaerobic and capnophilic isolates to co-amoxiclav and five other antimicrobial agents Journal of Antimicrobial Chemotherapy (2004) 53, 1039 1044 DOI: 10.1093/jac/dkh248 Advance Access publication 5 May 2004 Surveillance of susceptibility patterns in 1297 European and US anaerobic and capnophilic

More information

Tel: Fax:

Tel: Fax: CONCISE COMMUNICATION Bactericidal activity and synergy studies of BAL,a novel pyrrolidinone--ylidenemethyl cephem,tested against streptococci, enterococci and methicillin-resistant staphylococci L. M.

More information

Ciprofloxacin, Enoxacin, and Ofloxacin against Aerobic and

Ciprofloxacin, Enoxacin, and Ofloxacin against Aerobic and ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 1988, p. 1143-1148 Vol., No. 8 0066-4804/88/081143-06$00/0 Copyright 1988, American Society for Microbiology Comparative Activities of, Amoxicillin-Clavulanic

More information

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution

More information

Aberdeen Hospital. Antibiotic Susceptibility Patterns For Commonly Isolated Organisms For 2015

Aberdeen Hospital. Antibiotic Susceptibility Patterns For Commonly Isolated Organisms For 2015 Aberdeen Hospital Antibiotic Susceptibility Patterns For Commonly Isolated s For 2015 Services Laboratory Microbiology Department Aberdeen Hospital Nova Scotia Health Authority 835 East River Road New

More information

Susceptibility Testing of Anaerobic Bacteria: Evaluation of the Redesigned (Version 96) biomérieux ATB ANA Device

Susceptibility Testing of Anaerobic Bacteria: Evaluation of the Redesigned (Version 96) biomérieux ATB ANA Device JOURNAL OF CLINICAL MICROBIOLOGY, June 1999, p. 1824 1828 Vol. 37, No. 6 0095-1137/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Susceptibility Testing of Anaerobic

More information

Antimicrobial Resistance in Human Oral and Intestinal Anaerobic Microfloras

Antimicrobial Resistance in Human Oral and Intestinal Anaerobic Microfloras ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Aug. 1993, p. 1665-1669 Vol. 37, No. 8 0066-4804/93/081665-05$02.00/0 Copyright X 1993, American Society for Microbiology Antimicrobial Resistance in Human Oral and

More information

Classification of Bacteria

Classification of Bacteria Classification of Bacteria MICROBIOLOGY -TAXONOMY Taxonomy is the system to classify living organisms Seven groups kingdom, phylum or div, class, order, family, genus, species Binomial system of nomenclature

More information

Clostridium difficile infection: The Present and the Future

Clostridium difficile infection: The Present and the Future Clostridium difficile infection: The Present and the Future Carlos E. Figueroa Castro, MD Assistant Professor, Division of Infectious Diseases Medical College of Wisconsin November 2014 I have made this

More information

ACCEPTED. Anaerobe Reference Laboratory, Department of Bacterial and Inflammatory Diseases, National

ACCEPTED. Anaerobe Reference Laboratory, Department of Bacterial and Inflammatory Diseases, National AAC Accepts, published online ahead of print on April 00 Antimicrob. Agents Chemother. doi:./aac.000-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights

More information

Resistance pattern of anaerobic bacteria isolated in a general hospital during a two-year period

Resistance pattern of anaerobic bacteria isolated in a general hospital during a two-year period Journal of Antimicrobial Chemotherapy (9), Supp. D, 9 6 Resistance pattern of anaerobic bacteria isolated in a general hospital during a two-year period J. F. Acar, F. W. Goldstein, M. D. Kitzis and M.

More information

Intra-abdominal infections: review of the bacteriology, antimicrobial susceptibility and the role of ertapenem in their therapy

Intra-abdominal infections: review of the bacteriology, antimicrobial susceptibility and the role of ertapenem in their therapy Journal of Antimicrobial Chemotherapy (2004) 53, Suppl. S2, ii29 ii36 DOI: 10.1093/jac/dkh201 Intra-abdominal infections: review of the bacteriology, antimicrobial susceptibility and the role of ertapenem

More information

11/2/2015. Update on the Treatment of Clostridium difficile Infections. Disclosure. Objectives

11/2/2015. Update on the Treatment of Clostridium difficile Infections. Disclosure. Objectives Update on the Treatment of Clostridium difficile Infections Spencer H. Durham, Pharm.D.,BCPS (AQ-ID) Assistant Clinical Professor of Pharmacy Practice Auburn University Harrison School of Pharmacy Kurt

More information

Overview of C. difficile infections. Kurt B. Stevenson, MD MPH Professor Division of Infectious Diseases

Overview of C. difficile infections. Kurt B. Stevenson, MD MPH Professor Division of Infectious Diseases Overview of C. difficile infections Kurt B. Stevenson, MD MPH Professor Division of Infectious Diseases Conflicts of Interest I have no financial conflicts of interest related to this topic and presentation.

More information

Effect of Lactobacillus F19 on the emergence of antibioticresistant microorganisms in the intestinal microflora

Effect of Lactobacillus F19 on the emergence of antibioticresistant microorganisms in the intestinal microflora Journal of Antimicrobial Chemotherapy (2004) 54, 791 797 DOI: 10.1093/jac/dkh406 Advance Access publication 25 August 2004 Effect of Lactobacillus F19 on the emergence of antibioticresistant microorganisms

More information

Taking Action to Prevent and Manage Multidrug-resistant Organisms and C. difficile in the Nursing Home: Part 1 Reviewing the organisms

Taking Action to Prevent and Manage Multidrug-resistant Organisms and C. difficile in the Nursing Home: Part 1 Reviewing the organisms Taking Action to Prevent and Manage Multidrug-resistant Organisms and C. difficile in the Nursing Home: Part 1 Reviewing the organisms Nimalie D. Stone, MD,MS Division of Healthcare Quality Promotion National

More information

MICHAEL J. RYBAK,* ELLIE HERSHBERGER, TABITHA MOLDOVAN, AND RICHARD G. GRUCZ

MICHAEL J. RYBAK,* ELLIE HERSHBERGER, TABITHA MOLDOVAN, AND RICHARD G. GRUCZ ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 2000, p. 1062 1066 Vol. 44, No. 4 0066-4804/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. In Vitro Activities of Daptomycin,

More information

Specificity (target gene) Primer name Sequence Product length[bp] GGATTAGATACCCTGGTAGTC TACCTTGTTACGACTT

Specificity (target gene) Primer name Sequence Product length[bp] GGATTAGATACCCTGGTAGTC TACCTTGTTACGACTT Supplementary material for Beneficial Microbes DOI: http://dx.doi.org/10.3920/bm2013.0021 Individual responses of mother sows to a probiotic Enterococcus faecium strain lead to different microbiota composition

More information

Evaluation of a computerized antimicrobial susceptibility system with bacteria isolated from animals

Evaluation of a computerized antimicrobial susceptibility system with bacteria isolated from animals J Vet Diagn Invest :164 168 (1998) Evaluation of a computerized antimicrobial susceptibility system with bacteria isolated from animals Susannah K. Hubert, Phouc Dinh Nguyen, Robert D. Walker Abstract.

More information

Help with moving disc diffusion methods from BSAC to EUCAST. Media BSAC EUCAST

Help with moving disc diffusion methods from BSAC to EUCAST. Media BSAC EUCAST Help with moving disc diffusion methods from BSAC to EUCAST This document sets out the main differences between the BSAC and EUCAST disc diffusion methods with specific emphasis on preparation prior to

More information

Chapter Anaerobic infections (individual fields): intraperitoneal infections (acute peritonitis, hepatobiliary infections, etc.

Chapter Anaerobic infections (individual fields): intraperitoneal infections (acute peritonitis, hepatobiliary infections, etc. J Infect Chemother (2011) 17 (Suppl 1):84 91 DOI 10.1007/s10156-010-0146-5 GUIDELINES Chapter 2-5-4. Anaerobic infections (individual fields): intraperitoneal infections (acute peritonitis, hepatobiliary

More information

The prevalence of antibiotic resistance in anaerobic bacteria isolated from patients with skin infections Research Article

The prevalence of antibiotic resistance in anaerobic bacteria isolated from patients with skin infections Research Article Gene Therapy and Molecular Biology Vol 9, page 263 Gene Ther Mol Biol Vol 9, 263-268, 2005 The prevalence of antibiotic resistance in anaerobic bacteria isolated from patients with skin infections Research

More information

Ecological impact of the des-f(6)-quinolone, BMS , on the normal intestinal microflora C. E. Nord 1, D. A. Gajjar 2 and D. M.

Ecological impact of the des-f(6)-quinolone, BMS , on the normal intestinal microflora C. E. Nord 1, D. A. Gajjar 2 and D. M. ORIGINAL ARTICLE Ecological impact of the des-f(6)-quinolone, BMS-284756, on the normal intestinal microflora C. E. Nord 1, D. A. Gajjar 2 and D. M. Grasela 2 1 Department of Microbiology, Pathology and

More information

NON-SPORING ANAEROBES

NON-SPORING ANAEROBES 36 NON-SPORING ANAEROBES 36.1 INTRODUCTION Anaerobic bacteria are widespread and very important. They do not require oxygen for growth, which is often toxic for them. They lack the enzymes superoxide dismutase,

More information

Clindamycin Palmitate Hydrochloride for Oral Solution, USP (Pediatric)

Clindamycin Palmitate Hydrochloride for Oral Solution, USP (Pediatric) Clindamycin Palmitate Hydrochloride for Oral Solution, USP (Pediatric) To reduce the development of drug-resistant bacteria and maintain the effectiveness of clindamycin palmitate hydrochloride (HCl) for

More information

ETX0282, a Novel Oral Agent Against Multidrug-Resistant Enterobacteriaceae

ETX0282, a Novel Oral Agent Against Multidrug-Resistant Enterobacteriaceae ETX0282, a Novel Oral Agent Against Multidrug-Resistant Enterobacteriaceae Thomas Durand-Réville 02 June 2017 - ASM Microbe 2017 (Session #113) Disclosures Thomas Durand-Réville: Full-time Employee; Self;

More information

2015 Antibiogram. Red Deer Regional Hospital. Central Zone. Alberta Health Services

2015 Antibiogram. Red Deer Regional Hospital. Central Zone. Alberta Health Services 2015 Antibiogram Red Deer Regional Hospital Central Zone Alberta Health Services Introduction. This antibiogram is a cumulative report of the antimicrobial susceptibility rates of common microbial pathogens

More information

Epidemiology and Antimicrobial Susceptibility of Anaerobic Bloodstream Infections: A 10 Years Study

Epidemiology and Antimicrobial Susceptibility of Anaerobic Bloodstream Infections: A 10 Years Study JMID/ 2018; 8 (4):135-139 Journal of Microbiology and Infectious Diseases doi: 10.5799/xxxxx RESEARCH ARTICLE Epidemiology and Antimicrobial Susceptibility of Anaerobic Bloodstream Infections: A 10 Years

More information

against Clinical Isolates of Gram-Positive Bacteria

against Clinical Isolates of Gram-Positive Bacteria ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Feb. 993, p. 366-370 Vol. 37, No. 0066-0/93/00366-05$0.00/0 Copyright 993, American Society for Microbiology In Vitro Activity of CP-99,9, a New Fluoroquinolone,

More information

Title: N-Acetylcysteine (NAC) Mediated Modulation of Bacterial Antibiotic

Title: N-Acetylcysteine (NAC) Mediated Modulation of Bacterial Antibiotic AAC Accepts, published online ahead of print on June 00 Antimicrob. Agents Chemother. doi:0./aac.0070-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights

More information

In Vitro Antibacterial Properties of Pexiganan, an Analog of Magainin

In Vitro Antibacterial Properties of Pexiganan, an Analog of Magainin ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 1999, p. 782 788 Vol. 43, No. 4 0066-4804/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. In Vitro Antibacterial Properties

More information

Test Method Modified Association of Analytical Communities Test Method Modified Germicidal Spray Products as Disinfectants

Test Method Modified Association of Analytical Communities Test Method Modified Germicidal Spray Products as Disinfectants Study Title Antibacterial Activity and Efficacy of E-Mist Innovations' Electrostatic Sprayer Product with Multiple Disinfectants Method Modified Association of Analytical Communities Method 961.02 Modified

More information

2016 Antibiogram. Central Zone. Alberta Health Services. including. Red Deer Regional Hospital. St. Mary s Hospital, Camrose

2016 Antibiogram. Central Zone. Alberta Health Services. including. Red Deer Regional Hospital. St. Mary s Hospital, Camrose 2016 Antibiogram Central Zone Alberta Health Services including Red Deer Regional Hospital St. Mary s Hospital, Camrose Introduction This antibiogram is a cumulative report of the antimicrobial susceptibility

More information

Learning Objectives 6/1/18

Learning Objectives 6/1/18 Gulf Coast Multidisciplinary Pharmacotherapy Conference Kelly R. Reveles, PharmD, PhD, BCPS College of Pharmacy, The University of Texas at Austin School of Medicine, UT Health San Antonio Email: kdaniels46@utexas.edu

More information

Intra-abdominal anaerobic infections. Diagnostics and therapy

Intra-abdominal anaerobic infections. Diagnostics and therapy Intra-abdominal anaerobic infections. Diagnostics and therapy Elisabeth Nagy MD. PhD. DSc. Institute of Clinical Microbiology, Faculty of Medicine, University of Szeged 4th ESCMID School, Szeged, Hungary

More information

2017 Antibiogram. Central Zone. Alberta Health Services. including. Red Deer Regional Hospital. St. Mary s Hospital, Camrose

2017 Antibiogram. Central Zone. Alberta Health Services. including. Red Deer Regional Hospital. St. Mary s Hospital, Camrose 2017 Antibiogram Central Zone Alberta Health Services including Red Deer Regional Hospital St. Mary s Hospital, Camrose Introduction This antibiogram is a cumulative report of the antimicrobial susceptibility

More information

Effect of Antibiotic Treatment on Establishment and Elimination of Intestinal Colonization by KPC-Producing Klebsiella pneumoniae in Mice

Effect of Antibiotic Treatment on Establishment and Elimination of Intestinal Colonization by KPC-Producing Klebsiella pneumoniae in Mice ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, June 2011, p. 2585 2589 Vol. 55, No. 6 0066-4804/11/$12.00 doi:10.1128/aac.00891-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Effect

More information

Secondary bacterial infections complicating skin lesions

Secondary bacterial infections complicating skin lesions J. Med. Microbiol. Vol. 51 (2002), 808 812 # 2002 Society for General Microbiology ISSN 0022-2615 REVIEW ARTICLE Secondary bacterial infections complicating skin lesions ITZHAK BROOK Department of Pediatrics,

More information

An evaluation of the susceptibility patterns of Gram-negative organisms isolated in cancer centres with aminoglycoside usage

An evaluation of the susceptibility patterns of Gram-negative organisms isolated in cancer centres with aminoglycoside usage Journal of Antimicrobial Chemotherapy (1991) 27, Suppl. C, 1-7 An evaluation of the susceptibility patterns of Gram-negative organisms isolated in cancer centres with aminoglycoside usage J. J. Muscato",

More information

PDF hosted at the Radboud Repository of the Radboud University Nijmegen

PDF hosted at the Radboud Repository of the Radboud University Nijmegen PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/26062

More information

Susceptibility of Respiratory Tract Anaerobes to Orally Administered Penicillins and Cephalosporins

Susceptibility of Respiratory Tract Anaerobes to Orally Administered Penicillins and Cephalosporins ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Oct. 1976, p. 713-720 Copyright 0 1976 American Society for Microbiology Vol. 10, No. 4 Printed in U.S.A. Susceptibility of Respiratory Tract Anaerobes to Orally

More information

Anaerobic and microaerophilic gram-positive cocci Peptococcus species, Peptostreptococcus species, Microaerophilic streptococci

Anaerobic and microaerophilic gram-positive cocci Peptococcus species, Peptostreptococcus species, Microaerophilic streptococci CLINDACIN Composition Each capsule contains Clindamycin (as hydrochloride) 150 mg Capsule Action Clindamycin bind exclusively to the 50S subunit of bacterial ribosomes and suppress protein synthesis. Clindamycin

More information

1/30/ Division of Disease Control and Health Protection. Division of Disease Control and Health Protection

1/30/ Division of Disease Control and Health Protection. Division of Disease Control and Health Protection Surveillance, Outbreaks, and Reportable Diseases, Oh My! Assisted Living Facility, Nursing Home and Surveyor Infection Prevention Training February 2015 A.C. Burke, MA, CIC Health Care-Associated Infection

More information

Alfonso Torress-Cook, Dr.P.H. Director of Epidemiology/Patient Safety Pacific Hospital of Long Beach

Alfonso Torress-Cook, Dr.P.H. Director of Epidemiology/Patient Safety Pacific Hospital of Long Beach Alfonso Torress-Cook, Dr.P.H. Director of Epidemiology/Patient Safety Pacific Hospital of Long Beach Historical overview The myriad causes of hospital acquired diarrhea Microbiology and ecology of Clostridium

More information

(c) 2016, Freeman et al. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license.

(c) 2016, Freeman et al. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license. This is a repository copy of In vitro activities of MCB3681 and 8 comparators against Clostridium difficile isolates with known ribotypes and diverse geographical spread. White Rose Research Online URL

More information

Fluoroquinolones and Anaerobes

Fluoroquinolones and Anaerobes REVIEWS OF ANTI-INFECTIVE AGENTS Louis D. Saravolatz, Section Editor INVITED ARTICLE Fluoroquinolones and Anaerobes Gary E. Stein 1,2 and Ellie J. C. Goldstein 3,4 Departments of 1 Medicine and 2 Pharmacology,

More information

Lessons Learned from the Anaerobe Survey: Historical Perspective and Review of the Most Recent Data ( )

Lessons Learned from the Anaerobe Survey: Historical Perspective and Review of the Most Recent Data ( ) SUPPLEMENT ARTICLE Lessons Learned from the Anaerobe Survey: Historical Perspective and Review of the Most Recent Data (2005 2007) David R. Snydman, 1,2 Nilda V. Jacobus, 1 Laura A. McDermott, 1 Yoav Golan,

More information

ESCMID Online Lecture Library. by author

ESCMID Online Lecture Library. by author Anaerobic Bacteria in Intra-Abdominal Infections and Bacteremia Maria Hedberg, Umeå University, Umeå, Sweden Anaerobic Bacteria: Next Generation Technology Meets Anaerobic Diagnostics ESCMID Postgraduate

More information

Pathogens commonly isolated from selected diseases

Pathogens commonly isolated from selected diseases Pathogens commonly isolated from selected diseases Equine pneumonia/pleuropneumonia -hemolytic Strep. Clostridium Pasteurella E. coli Klebsiella pneumoniae Bacteroides Equine enteric pathogens Salmonella

More information

Bacteriology of Moderate-to-Severe Diabetic Foot Infections and In Vitro Activity of Antimicrobial Agents

Bacteriology of Moderate-to-Severe Diabetic Foot Infections and In Vitro Activity of Antimicrobial Agents JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 2007, p. 2819 2828 Vol. 45, No. 9 0095-1137/07/$08.00 0 doi:10.1128/jcm.00551-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Bacteriology

More information

Clostridium difficile Colitis

Clostridium difficile Colitis Update on Clostridium difficile Colitis Fredrick M. Abrahamian, D.O., FACEP Associate Professor of Medicine UCLA School of Medicine Director of Education Department of Emergency Medicine Olive View-UCLA

More information

after trauma in children

after trauma in children 6 Department of Pediatrics, Navy Hospital, Bethesda, Maryland, USA Brook Correspondence to: Dr tzhak Brook, PO Box 704, Chevy Chase, MD 08-04, USA. Accepted for publication November 997 Table JAccid Emerg

More information

BACTERIOLOGY PROFICIENCY TESTING PROGRAM

BACTERIOLOGY PROFICIENCY TESTING PROGRAM BACTERIOLOGY PROFICIENCY TESTING PROGRAM Comprehensive Category January 20, 2015 If you have any questions or comments, please contact either: Dr. Wendy Archinal Dr. Kimberlee Musser Phone: (518) 474-4177

More information

In vitro susceptibility to 17 antimicrobials of clinical Clostridium difficile isolates collected in in Sweden

In vitro susceptibility to 17 antimicrobials of clinical Clostridium difficile isolates collected in in Sweden ORIGINAL ARTICLE BACTERIOLOGY In vitro susceptibility to 17 antimicrobials of clinical Clostridium difficile isolates collected in 1993 2007 in Sweden T. Norén 1,2, I. Alriksson 2,T.Åkerlund 3, L. G. Burman

More information

ESBL Producers An Increasing Problem: An Overview Of An Underrated Threat

ESBL Producers An Increasing Problem: An Overview Of An Underrated Threat ESBL Producers An Increasing Problem: An Overview Of An Underrated Threat Hicham Ezzat Professor of Microbiology and Immunology Cairo University Introduction 1 Since the 1980s there have been dramatic

More information

Mark Your Calendars Now! Next Event Ships: September 14, 2015

Mark Your Calendars Now! Next Event Ships: September 14, 2015 www.wslhpt.org 2601 Agriculture Drive Madison, WI 53718 (800) 462-5261 (608) 265-1111 Shipment Date: June 15, 2015 Questions or comments should be directed to Amanda Weiss at 800-462-5261 x51 or amanda.weiss@slh.wisc.edu.

More information

Cipro for gram positive cocci in urine

Cipro for gram positive cocci in urine Buscar... Cipro for gram positive cocci in urine 20-6-2017 Pneumonia can be generally defined as an infection of the lung parenchyma, in which consolidation of the affected part and a filling of the alveolar

More information

ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED

ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED ESCHERICHIA COLI RESISTANCE AND GUT MICROBIOTA PROFILE IN PIGS RAISED WITH DIFFERENT ANTIMICROBIAL ADMINISTRATION IN FEED Caroline Pissetti 1, Jalusa Deon Kich 2, Heather K. Allen 3, Claudia Navarrete

More information

Cleocin Pediatric clindamycin palmitate hydrochloride for oral solution, USP

Cleocin Pediatric clindamycin palmitate hydrochloride for oral solution, USP To reduce the development of drug-resistant bacteria and maintain the effectiveness of CLEOCIN PEDIATRIC and other antibacterial drugs, CLEOCIN PEDIATRIC should be used only to treat or prevent infections

More information

CLEOCIN HCl Capsules contain clindamycin hydrochloride equivalent to 75 mg, 150 mg, or 300 mg of clindamycin.

CLEOCIN HCl Capsules contain clindamycin hydrochloride equivalent to 75 mg, 150 mg, or 300 mg of clindamycin. CLEOCIN HCl clindamycin hydrochloride capsules, USP To reduce the development of drug-resistant bacteria and maintain the effectiveness of CLEOCIN HCl and other antibacterial drugs, CLEOCIN HCl should

More information

Preventing Multi-Drug Resistant Organism (MDRO) Infections. For National Patient Safety Goal

Preventing Multi-Drug Resistant Organism (MDRO) Infections. For National Patient Safety Goal Preventing Multi-Drug Resistant Organism (MDRO) Infections For National Patient Safety Goal 07.03.01 2009 Methicillin Resistant Staphlococcus aureus (MRSA) About 3-8% of the population at large is a carrier

More information

2 0 hr. 2 hr. 4 hr. 8 hr. 10 hr. 12 hr.14 hr. 16 hr. 18 hr. 20 hr. 22 hr. 24 hr. (time)

2 0 hr. 2 hr. 4 hr. 8 hr. 10 hr. 12 hr.14 hr. 16 hr. 18 hr. 20 hr. 22 hr. 24 hr. (time) Key words I μ μ μ μ μ μ μ μ μ μ μ μ μ μ II Fig. 1. Microdilution plate. The dilution step of the antimicrobial agent is prepared in the -well microplate. Serial twofold dilution were prepared according

More information

Antibacterials. Recent data on linezolid and daptomycin

Antibacterials. Recent data on linezolid and daptomycin Antibacterials Recent data on linezolid and daptomycin Patricia Muñoz, MD. Ph.D. (pmunoz@micro.hggm.es) Hospital General Universitario Gregorio Marañón Universidad Complutense de Madrid. 1 GESITRA Reasons

More information

Multi-Drug Resistant Organisms (MDRO)

Multi-Drug Resistant Organisms (MDRO) Multi-Drug Resistant Organisms (MDRO) 2016 What are MDROs? Multi-drug resistant organisms, or MDROs, are bacteria resistant to current antibiotic therapy and therefore difficult to treat. MDROs can cause

More information

Ellie JC Goldstein Diane M. Citron C. Vreni Merriam Kerin L Tyrrell

Ellie JC Goldstein Diane M. Citron C. Vreni Merriam Kerin L Tyrrell AAC Accepts, published online ahead of print on 1 October 2012 Antimicrob. Agents Chemother. doi:10.1128/aac.01794-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 1 2 3 4 5

More information

In Vitro Activity of Netilmicin, Gentamicin, and Amikacin

In Vitro Activity of Netilmicin, Gentamicin, and Amikacin ANTIMICROBIAL AGzNTS AND CHEMOTHERAPY, Jan. 1977, p. 126-131 Copyright X 1977 American Society for Microbiology Vol. 11, No. 1 Printed in U.S.A. In Vitro Activity of Netilmicin, Gentamicin, and Amikacin

More information

Florida Health Care Association District 2 January 13, 2015 A.C. Burke, MA, CIC

Florida Health Care Association District 2 January 13, 2015 A.C. Burke, MA, CIC Florida Health Care Association District 2 January 13, 2015 A.C. Burke, MA, CIC 11/20/2014 1 To describe carbapenem-resistant Enterobacteriaceae. To identify laboratory detection standards for carbapenem-resistant

More information

Childrens Hospital Antibiogram for 2012 (Based on data from 2011)

Childrens Hospital Antibiogram for 2012 (Based on data from 2011) Childrens Hospital Antibiogram for 2012 (Based on data from 2011) Prepared by: Department of Clinical Microbiology, Health Sciences Centre For further information contact: Andrew Walkty, MD, FRCPC Medical

More information

In Vitro Susceptibility to Pexiganan of Bacteria Isolated from Infected Diabetic Foot Ulcers

In Vitro Susceptibility to Pexiganan of Bacteria Isolated from Infected Diabetic Foot Ulcers In Vitro Susceptibility to Pexiganan of Bacteria Isolated from Infected Diabetic Foot Ulcers Yigong Ge, Dorothy MacDonald, Marietta M. Henry, Howard I. Hait, Kimberly A. Nelson, Benjamin A. Lipsky, Michael

More information

6.0 ANTIBACTERIAL ACTIVITY OF CAROTENOID FROM HALOMONAS SPECIES AGAINST CHOSEN HUMAN BACTERIAL PATHOGENS

6.0 ANTIBACTERIAL ACTIVITY OF CAROTENOID FROM HALOMONAS SPECIES AGAINST CHOSEN HUMAN BACTERIAL PATHOGENS 6.0 ANTIBACTERIAL ACTIVITY OF CAROTENOID FROM HALOMONAS SPECIES AGAINST CHOSEN HUMAN BACTERIAL PATHOGENS 6.1 INTRODUCTION Microorganisms that cause infectious disease are called pathogenic microbes. Although

More information

Running head: CLOSTRIDIUM DIFFICILE 1

Running head: CLOSTRIDIUM DIFFICILE 1 Running head: CLOSTRIDIUM DIFFICILE 1 Clostridium difficile Infection Christy Lee Fenton Mountainland Applied Technology College CLOSTRIDIUM DIFFICILE 2 Clostridium difficile Infection Approximately 200,000

More information

Clostridium difficile Infection Prevention. Basics of Infection Prevention 2-Day Mini-Course 2012

Clostridium difficile Infection Prevention. Basics of Infection Prevention 2-Day Mini-Course 2012 Clostridium difficile Infection Prevention Basics of Infection Prevention 2-Day Mini-Course 2012 2 Objectives Describe the etiology and epidemiology of C. difficile infection (CDI) Review evidence-based

More information

available. and P. aeruginosa resistant to gentamicin by standardized disk testing (1) in the Microbiology Laboratory

available. and P. aeruginosa resistant to gentamicin by standardized disk testing (1) in the Microbiology Laboratory ANTimICROBIAL AGENTh AND CHEMOTHERAPY, OCt. 1976, p. 677-681 Copyright 1976 American Society for Microbiology Vol. 10, No. 4 Printed in U.S.A. In Vitro Susceptibility of Gentamicin-Resistant Enterobacteriaceae

More information

6. STORAGE INSTRUCTIONS

6. STORAGE INSTRUCTIONS VRESelect 63751 A selective and differential chromogenic medium for the qualitative detection of gastrointestinal colonization of vancomycin-resistant Enterococcus faecium () and vancomycin-resistant Enterococcus

More information

03/09/2014. Infection Prevention and Control A Foundation Course. Talk outline

03/09/2014. Infection Prevention and Control A Foundation Course. Talk outline Infection Prevention and Control A Foundation Course 2014 What is healthcare-associated infection (HCAI), antimicrobial resistance (AMR) and multi-drug resistant organisms (MDROs)? Why we should be worried?

More information