Studies on diversity of Streptococcus pyogenes isolated from different sources
|
|
- Merry Williamson
- 5 years ago
- Views:
Transcription
1 Cairo University Faculty of Veterinary Medicine Department of Microbiology Studies on diversity of Streptococcus pyogenes isolated from different sources Thesis presented by Fatma Fathy Mohamed B. V. Sc., Faculty of Veterinary Medicine Cairo university (2003) For The Degree of Master of Veterinary Medical Sciences, Microbiology (Bacteriology Immunology Mycology) 2013
2 Under the supervision of Prof.Dr. Heidy Mohamed Shawky Head Professor of Microbiology, Faculty of Veterinary Medicine Cairo University Prof. Dr. Mohamed Kamal Refai Prof. of Microbiology, Faculty of Veterinary Medicine, Cairo University
3 The aim of the present study was to study the incidence of streptococcus specie in causing mastitis with special reference to enterococci and this will be achieved through : 1. isolation and identification of streptococcus species and streptococcal like bacteria causing mastitis. 2. studying the antibiotic sensitivity against different types of antimicrobial agents. 3. Identification and differentiation of enterococcus species using PCR 4. Detection of virulence gene in Enterococcus species.
4 Material and Methods. 1. Material : 1.1. Samples: Milk Samples were collected from mastitic, apparently healthy lactating animals from different farms in Egypt. The samples from cattle, buoffloes were collected from El Giza, ElMenofia, Alexandria, Elsharkia IsmailiaI and Bany Souif Governorats while from Sheep and goats were collected from ElMansoura and farm of Faculty of Agr. cairo University Media used for primary isolation and identification of Streptococcus species:
5 1.3. Reagents and chemicals were used for identification of streptococci: Lancifield grouping: ( slidex strepto plus)(biomérieux) 1.4. API 20strep (Biome rieux SA): 1.5. Antimicrobial sensitivity disks: (Oxoid) Buffers and solutions used for molecular identification : 1.7. Standard and reference strains of enterococci : The standard strain, E.faecalis ( ATCC isolate) and E. faecium (ATCC 19434) were obtained from the American Type Culture Collection.
6 Table (1 )Antimicrobial agents used for Antibiotic sensitivity test : Antimicrobial agents Disc code conc Zone diameter(mm) Amoxicilllin Ampicillin Cefatriaxon Ciprofloxacin Clindamycin AML AMP CRO CF CD R I S Gentamycin Erythromycin Ofloxacin Vancomycin Chloramphenicol Tetracyclin Rifampin Bacitracin Optochin Azithromycin CN E ON VN C TE RD B P AZ >
7 Table ( 2 ) Primer sequences used in this study for verification of Enterococcus species and virulence determinants: primer Enterococcus specific Ent1 Ent2 Oligonucleotide Sequence (5'3') 59TACTGACAAACCATTCATGATG3 59 AACTTCGTCACCAACGCGAAC39 Product Size 112bp Danbing KE et al.1999 Reference s ddl E. faecalis ddl E faecium. ddle1 ATCAAGTACAGTTAGTCTTTATTAG ddle2 ACGATTCAAAGCTAACTGAATCAGT ddlf1 TTGAGGCAGACCAGATTGACG ddlf2 TATGACAGCGACTCCGATTCC 941 bp 658 bp Aylin et al.2010 Aylin et al.2010 CylA virulence gene CYT I ACTCGGGGATTGATAGGC CYT II b GCTGCTAAAGCTGCGCTT 688 bp Aylin et al.2010
8 2.Methods 2.1. Collection of sample 2.2. California Mastitis test (CMT ) 2.3. Bacteriological examination 2.4. Identification of the isolates Biochemical identification of streptococcal species and Enterococcus species Rapid Biochemical method For identification of streptococcus species and Enterococcus species.. Serological identification: Lancifield grouping 2.5. Antibiotic sensitivity test 2.6. Polymerase Chain Reaction (PCR)
9 Table (3): Identification of Streptococci and streptococcus like bacteria on blood agar Beta haemolysis S. agalactiae S. equi subsp zooepidmicus Alpha haemolysis S.pneumoniae Aero coccus viridance Gamma haemolysis Enterococci S.dysagalactiae S.uberis Lacto lactis
10 Table (4) : Biochemical identification of streptococcus species : Biochemical test S.equi subspp S. agalactia S.uberis S.dysagalactia S.pneumoniae.zooepdimic us Catalase CAMP oxidase optochin Haemolysis B B Y Y α Bile esculin Sod hippurate hydrolysis Gelatin liquification Trehalose Lactose Sorbitol Manitol Inulin Salicin )(
11 Table( 5): Biochemical identification of enterococci specific tests: Biochemical test Catalase Growth in bile esculin agar PYR Hemolysis on blood agar Result ve ve ve Gamma hemolysis
12 Lact lactis Aero virdan1 E.faecium E.faecalis S.zooepidemic us S.dysagalactiae S.uberis S.agalactiae Test Vp ± ± ± Hip Esc ± ± PYRA ± ± αgal ± BGUR ± ± BGAL PAL LAP ADH RIB ± ARA ± MAN ± SOR ± LAC TRE ± INU ± RAF ± AMD ± ± GLYG ± BHEM Table (6 ) Biochemical details of streptococci, enterococci and streptococcus like bacteria obtained by API
13 E.faecium E.faecalis AMY APPA LeuA AlaA drib NOVO draf OPTO PIPLC CDEX ProA TyrA ILATK NC R dxyl ASPA BGURr dsor LAC dman SAL ADH1 BGAR AGAL URE NAG dmne SAC BGAL AMAN PyrA POLYB dmal Table (7 ) Biochemical details of enterocci obtained by vitke system
14 Table ( 8) :Serological identification ( Lancifield grouping): A B C D Result Enterococcus species D S. equi sub.zooepidemicus C S. agalactiae B S. uberis S.dysaglactiae non groupable
15 The following program of denaturing annealing synthesizing cycle was installed and applied: Initial heating for denaturation at First cycle denaturation at Annealing at Extension at Repeat for another 35 cycles. Final extension at 94 C for 2min. 94 C for 1 min. 55 C for 1 min. 72 C for 2 min. 72 C for10 min 5 μl of the PCR products were examined in a 1% agarose gel at 100 V
16 Table (9 ): Prevalence of Gram positive cocci isolated from mastitic milk samples collected from different animal species. Source of isolates No.of the examined samples No of positive samples No % Cattle % Buffaloes % Sheep % Goat % Total %
17 Figure ( 1 ):Prevalence of gram positive cocci isolated from mastitic milk samples collected from different animal species
18 Table (12): Frequency of isolation of Enterococcus species among examined mastitic milk samples collected from different animal species: Source of isolates No.of the examined samples No of positive samples No % Cattle % Buffaloes % Sheep % Goat % Total %
19 Figure (4) : Frequency of isolation of Enterococcus species among examined mastitic milk samples collected from different animal species.
20 Table (13): Results of streptococcal like bacteria in mastitic cattle. species Lact. lactis subsp lactis Aerococcus viridans1 Aerococcus viridans2 Total No %
21 Figure (5) :Results of streptococcal like bacteria in mastitic cattle.
22 Table (14): Streptococcus species on sheep blood agar. Beta haemolysis α heamolysis Y heamolysis Total Number percentage 41% 5.88% 52.94% 100%
23 Figure ( 6 ): Streptococcus species on sheep blood agar
24 Photo (1) S. equi subsp zooepidimicus on blood agar Photo (2) S.agalactiae on blood agar
25 Table (15):Enterococcus species on sheep blood agar: Sheep Blood agar Total Beta haemolytic Y haemolytic Enterococcus species Percent 28.57% 71.42% 100%
26 Figure (7):Enterococcus species on sheep blood agar
27 Photo ( 3 ) :Enterococcus species on sheep blood agar
28 Photo ( 4 ) S.agalactiae Photo (5 ) S.equi subsp zooepdemicus Photo ( 6 )S.pneumoniae Photo (7 ):Enterococci Microscopical appearance of streptococcus species and enterococcus species
29 Table ( 16 ) :Results biochemical identification test of streptococcus species Enterococcus species and streptococcal like bacteria: strains Total No Catalase Bile esculin PYR CAMP Positive % Positive % Positive % Positiv e % Streptococcus species Enterococcus Species Lactococcus species Aerococcus species % % % % % % % % % 6 100% 0 total % % % 4 3.8%
30 Figure ( 8 ): Results biochemical identification test of streptococcus species Enterococcus species and streptococcal like bacteria:
31 A: bile esculin B: PYR ve: black color ve: red color Photo ( 8 ): Results of biochemical identification test of streptococcus species and streptoccus like bacteria
32 Table( 17 ) :Biochemical identification of streptococcus species and streptococcus like bacteria among mastitic cattle examined by API: species Total % S.agalactiae % S.zooepidmicus % S.dysagalactiae % S.uberis % S.porcinus % S.mitis % S.pneumoniae % Lact lactis subsp lactis % Aero viridance % Aero viridance %
33 Figure ( 9 ): Biochemical identification of streptococcus species and streptococcus like bacteria among mastitic cattle examined by API:
34 A: S.uberis B: S.equi subsp equi Photo (9):API 20 strep of streptococcus species C: Aero virdance 1 D: lacto lactis subsp lactis Photo ( 10 ):API 20 strep of streptococcus like bacteria.
35 Table (18) : Biochemical identification of Enterococcus species among different mastitic Animal examined by API 20 strep: species E.faecalis E.faecium E.durans No % No % No % Cattle % % % Buffaloes % % Sheep % % Goat % % Total % % %
36 Figure ( 10 ): Biochemical identification of Enterococcus species among different mastitic Animal examined by API20 strep:
37 API of E.faecalis B API of E.faecium Photo ( 11 ):API 20 strep of Enterococcus species.
38 Table (19): Results of Lancifield classification of streptococci (slidex strepto plus BioMérieux) Group B Group C Group D Result Total 77 strains
39 Figure (11) Results of Lancifield classification of streptococci ( slidex strepto plus BioMérieux)
40 Photo (12): Results of Lancifield classification of streptococci ( slidex strepto plus BioMérieux).
41 Table ( 20 ) Results of Antibiotic sensitivity test of streptococcus species and Enterococcus species: Chemotheraputi c agent Streptococcus species % of susptable % of resistan t Enterococcus species % of susptable % of resistant Penicllin 100% 0 % 100% 0 % Vancomycin 100% 0 % Cefotaxime 95% 5 % 90% 10 % Erythromycin 50% 50 % 27.3% 72.7 % Rifampicin 60% 40 % 45.5% 54.5 % Gentamicin 55% 45 % 36.4% 63.6 % Ciprofloxacin 58 % 42 % 54.4% 45.5 % Ofloxacin 44.7% 55.3 % 63.7% 36.3 % Cholarmphenico 65% 36 % 72.8% 27.2 % l tetracycline 70% 30 % 63.4% 36.6 %
42 Figure ( 12 ) :Results of Antibiotic sensitivity test of Streptococcus species and Enterococcus species.
43 Photo: ( 13 )Antibiotic sensitivity test of Photo ( 14): E test MIC S. agalactiae for pencillin
44 Table (22) Incidence of bacitracin susceptibility in examined sample: S. agalactiae S.zooepdemicus S R S R bacitracin % 50% 50% 100% 0%
45 Table (23 ) Results of antibiotic resistance of E. faecium and E. faecalis: % resistance for E.faecium % resistance for E.faecalis Penicllin 0 % 0 % Vancomycin 0 % 0 % Erythromycin 72% 93.3% Rifampicin 44% 86.6% Gentamicin 60% 66.7 % Ciprofloxacin 28% 73 % Ofloxacin 28% 36 % Cholarmphenicol 28% 33.3 % Tetracycline 24% 66.6 % Azithromycin 15% 20 %
46 Fig. (13):Results of antibiotic resistance of E. faecium and E. faecalis:
47 Photo ( 15 ) E. faecium Photo (16) E. faecalis Antibiotic sensitivity test of Enterococcus species.
48 Table ( 23 ) :Results of Enterococci positive PCR products amplified by using the Ent1 and Ent2 specific primers : Source Lane 1 ve control Lane 2 Lan 3 Lane 4 Lane 5 Lane 6 Lane 7 Lane 8 Lane 9 cattle Baffaloes sheep goat
49 Photo ( 17 ): Electrophoretic profile of PCR products of Enterococcus isolates amplified by using specific primer(ent1, Ent2). (1 ) Marker 1000bp. ( 2) ve control reference strain.. (3,4,5,6,7,8,9,10) Enterococcus species.
50 Table (25) Results of E. faecium positive PCR products amplified by using ddlefaecium primers: Source ve control Lane2 Lan3 Lane4 Lane5 Lane6 Lane7 Lane8 Lane9 cattle Baffaloes ve sheep goat
51 Photo ( 18 ): Electrophoretic profile of PCR products of E faecium isolates amplified by using specific primer (ddle faecium) (1 ) Marker 100bp. ( 2) ve control reference strain (ATCC 19434) (3,4,5,6,7,8,9) E.faecium.
52 Table (26) Results of E. faecalis positive PCR products amplified by using ddlefaecalis primers: Source ve control Lane2 Lan3 Lane4 Lane5 Lane6 Lane7 Lane8 Lane9 cattle Baffaloes 941 ve 941 sheep goat
53 Photo (19 ): Electrophoretic profile of PCR products of E.faecalis isolates amplified by using specific primer (ddle faecalis) (1 ) Marker 100bp. ( 2) ve control reference strain (ATCC 29212) (3,4,5,,8,9,10) E.f aecalis.
54 Table (27): Result of Incidence of virulence gene cyla among Enterococci spp: species Number of examined samples Positive cyla virulence gene E.faecalis E.faecium No % No % cattle % 2 100% goat % 1 100% Buffalo % zero 0 % Sheep % 1 100% Total % %
55 Figure (14 ) :Incidence of virulence gene CylA among Enterococcus species.
56 Photo (20 ): Electrophoretic profile of PCR products of virulence CylA gene incidence i in E.faecium and E.faecalis isolates amplified by using specific virulence primer CylA gene (1 ) Marker 100bp. (2,3,4,5,6,8,9) Positive virulence gene of E.faecium and E.faecalis.
Medical bacteriology Lecture 8. Streptococcal Diseases
Medical bacteriology Lecture 8 Streptococcal Diseases Streptococcus agalactiae Beat haemolytic Lancifield group B Regularly resides in human vagina, pharynx and large inine Can be transferred to infant
More informationCHARACTERIZATION AND ANTIBIOTIC SUSCEPTIBILITY PATTERNS OF CATALASE-NEGATIVE GRAM-POSITIVE COCCI ISOLATED FROM BOVINE MASTITIS IN BRAZIL
CHARACTERIZATION AND ANTIBIOTIC SUSCEPTIBILITY PATTERNS OF CATALASE-NEGATIVE GRAM-POSITIVE COCCI ISOLATED FROM BOVINE MASTITIS IN BRAZIL E. Maricato 1, C.C. Lange 2, M.AV.P. Brito 2, J.R.F. Brito 2*, M.M.O.P.
More informationGram-positive cocci Staphylococci and Streptococcia
Medical microbiology Laboratory Lab 8 Gram-positive cocci Staphylococci and Streptococcia Lecturer Maysam A Mezher Gram positive cocci 1-Staphylococcus. 2-Streptococcus. 3-Micrococcus The medically important
More informationVPM 201-Lab 6 Bovine Mastitis, Bacillus & Mastitis (2012)
Exercise 1. Bovine mastitic milk sample A. Note relevant images are on next page Sample A is Staphylococcus aureus Moderate size (1.0 mm), circular, convex, cream-to-light yellow, opaque Double-zone (target)
More informationMicrococcus. May be normal present in upper respiratory tract. - Grow on ordinary media Nutrient agar - Blood agar and. M. luteus.
Micrococcus Morphology: - Gram +ve cocci - Arrangement : Tetrades - Non motile, non capsulated, non sporulated Habitat: May be normal present in upper respiratory tract Species : 1- M.varians 2- M. luteus
More informationPhenotypic and Genotypic Characterization of Enterococci from Clinical Isolates in a Tertiary Care Hospital
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 7 (2017) pp. 1160-1173 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.607.141
More informationLab Exercise: Antibiotics- Evaluation using Kirby Bauer method.
Lab Exercise: Antibiotics- Evaluation using Kirby Bauer method. OBJECTIVES 1. Compare the antimicrobial capabilities of different antibiotics. 2. Compare effectiveness of with different types of bacteria.
More information2012 ANTIBIOGRAM. Central Zone Former DTHR Sites. Department of Pathology and Laboratory Medicine
2012 ANTIBIOGRAM Central Zone Former DTHR Sites Department of Pathology and Laboratory Medicine Medically Relevant Pathogens Based on Gram Morphology Gram-negative Bacilli Lactose Fermenters Non-lactose
More informationHelp with moving disc diffusion methods from BSAC to EUCAST. Media BSAC EUCAST
Help with moving disc diffusion methods from BSAC to EUCAST This document sets out the main differences between the BSAC and EUCAST disc diffusion methods with specific emphasis on preparation prior to
More informationRoutine internal quality control as recommended by EUCAST Version 3.1, valid from
Routine internal quality control as recommended by EUCAST Version.1, valid from 01-01-01 Escherichia coli Pseudomonas aeruginosa Staphylococcus aureus Enterococcus faecalis Streptococcus pneumoniae Haemophilus
More information22/09/2010. Laboratory 2a + b Staphylococci and Streptococci
Laboratory 2a + b Staphylococci and Streptococci 1 Hamster: To be or not to be..!? (a play on Ham-let!) Summary on Exercise 1 (Lab 2a) Big colony heavy growth, color? Double-zone hly CAT and Tube Coag
More informationNorthern NY Agricultural Development Program Project Report
Northern NY Agricultural Development Program 2013-14 Project Report Identification, Distribution, and Characterization of Mastitis-Causing Pathogens Previously Identified as Other Streptococcal Species
More informationEUCAST recommended strains for internal quality control
EUCAST recommended strains for internal quality control Escherichia coli Pseudomonas aeruginosa Staphylococcus aureus Enterococcus faecalis Streptococcus pneumoniae Haemophilus influenzae ATCC 59 ATCC
More informationQUICK REFERENCE. Pseudomonas aeruginosa. (Pseudomonas sp. Xantomonas maltophilia, Acinetobacter sp. & Flavomonas sp.)
Pseudomonas aeruginosa (Pseudomonas sp. Xantomonas maltophilia, Acinetobacter sp. & Flavomonas sp.) Description: Greenish gray colonies with some beta-hemolysis around each colony on blood agar (BAP),
More informationEuropean Committee on Antimicrobial Susceptibility Testing
European Committee on Antimicrobial Susceptibility Testing Routine and extended internal quality control for MIC determination and disk diffusion as recommended by EUCAST Version 8.0, valid from 018-01-01
More informationApplied Veterinary Bacteriology and Mycology: Identification of aerobic and facultative anaerobic bacteria Chapter 1: Aerobic Gram-positive cocci
Applied Veterinary Bacteriology and Mycology: Identification of aerobic and facultative anaerobic bacteria Applied Veterinary Bacteriology and Mycology: Identification of aerobic and facultative anaerobic
More informationInt.J.Curr.Microbiol.App.Sci (2018) 7(8):
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 08 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.708.378
More information2015 Antibiogram. Red Deer Regional Hospital. Central Zone. Alberta Health Services
2015 Antibiogram Red Deer Regional Hospital Central Zone Alberta Health Services Introduction. This antibiogram is a cumulative report of the antimicrobial susceptibility rates of common microbial pathogens
More informationEuropean Committee on Antimicrobial Susceptibility Testing
European Committee on Antimicrobial Susceptibility Testing Routine and extended internal quality control as recommended by EUCAST Version 5.0, valid from 015-01-09 This document should be cited as "The
More informationتقارير الدروس العملية
وزارة التعليم جامعة الباحة كلية العلوم الطبية التطبيقية قسم طب المختبرات تقارير الدروس العملية مقرر أحياء دقيقة إكلينيكية الدكتور : شائع بن صالح المالكي 5341 ه -5341 ه Routine of Laboratory Diagnosis of
More informationComment on Survey Specimen B9 Microbiology
Verein für medizinische Qualitätskontrolle Association pour le contrôle de Qualité medical Associazione per il controllo di qualità medico Comment on Survey Specimen B9 Microbiology 2014-1 Specimen A:
More information2017 Antibiogram. Central Zone. Alberta Health Services. including. Red Deer Regional Hospital. St. Mary s Hospital, Camrose
2017 Antibiogram Central Zone Alberta Health Services including Red Deer Regional Hospital St. Mary s Hospital, Camrose Introduction This antibiogram is a cumulative report of the antimicrobial susceptibility
More informationInterpretation of results from milk samples tested for mastitis bacteria with Mastit 4 qpcr test from DNA Diagnostic
Mastit 4 Interpretation of results from milk samples tested for mastitis bacteria with Mastit 4 qpcr test from DNA Diagnostic The 40th ICAR Biennial Session Puerto Varas, Chile, 24-28 october 2016 Jorgen
More informationHigh Level Gentamicin Resistance and Vancomycin Resistance in Enterococcus species at a tertiary care hospital in India
ISSN: 2347-3215 Volume 3 Number 10 (October-2015) pp. 276-280 www.ijcrar.com High Level Gentamicin Resistance and Vancomycin Resistance in Enterococcus species at a tertiary care hospital in India Sangram
More informationDrug resistance & virulence determinants in clinical isolates of Enterococcus species
Student IJMR Indian J Med Res 137, May 2013, pp 981-985 Drug resistance & virulence determinants in clinical isolates of Enterococcus species Sanal C. Fernandes & B. Dhanashree * M.B.B.S. Third year student,
More informationANTIMICROBIAL SUSCEPTIBILITY DETECTION OF ELEVATED MICs TO PENICILLINS IN β- HAEMOLYTIC STREPTOCOCCI
HAEMOLYTIC STREPTOCOCCI This specimen was designated as a sample from a skin wound that was to be cultured, identified to species level and susceptibility tested [1-3]. The culture contained a Streptococcus
More informationAntimicrobial Susceptibility Testing: Advanced Course
Antimicrobial Susceptibility Testing: Advanced Course Cascade Reporting Cascade Reporting I. Selecting Antimicrobial Agents for Testing and Reporting Selection of the most appropriate antimicrobials to
More informationASSIST. PROF. Dr. Abdulameer Abdullah University of Basra, College of Nursing
ASSIST. PROF. Dr. Abdulameer Abdullah University of Basra, College of Nursing 2017-2108 Gram Positive Cocci Pyogenic Opportunists (normal flora) Staphylococcus, Streptococcus, Enterococcus Contagious Pathogens
More informationBacterial Causes of Embryonic Death in Ostrich Egg
Volume 3, Issue 8, August 2015, PP 46-52 ISSN 2349-0357 (Print) & ISSN 2349-0365 (Online) www.arcjournals.org Bacterial Causes of Embryonic Death in Ostrich Egg Heidy Abo El Yazeed 1, Mahmoud El Hariri
More informationBACTERIOLOGICALL STUDY OF MICROORGANISMS ON MOBILES AND STETHOSCOPES USED BY HEALTH CARE WORKERS IN EMERGENCY AND ICU S
Research Article Harika A,, 2013; Volume 2(3): 290-297 ISSN: 2277-8713 BACTERIOLOGICALL STUDY OF MICROORGANISMS ON MOBILES AND STETHOSCOPES USED BY HEALTH CARE WORKERS IN EMERGENCY AND ICU S HARIKAA A,
More information2016 Antibiogram. Central Zone. Alberta Health Services. including. Red Deer Regional Hospital. St. Mary s Hospital, Camrose
2016 Antibiogram Central Zone Alberta Health Services including Red Deer Regional Hospital St. Mary s Hospital, Camrose Introduction This antibiogram is a cumulative report of the antimicrobial susceptibility
More informationCompliance of manufacturers of AST materials and devices with EUCAST guidelines
Compliance of manufacturers of AST materials and devices with EUCAST guidelines Data are based on questionnaires to manufacturers of materials and devices for antimicrobial susceptibility testing. The
More informationTHE NAC CHALLENGE PANEL OF ISOLATES FOR VERIFICATION OF ANTIBIOTIC SUSCEPTIBILITY TESTING METHODS
THE NAC CHALLENGE PANEL OF ISOLATES FOR VERIFICATION OF ANTIBIOTIC SUSCEPTIBILITY TESTING METHODS Stefanie Desmet University Hospitals Leuven Laboratory medicine microbiology stefanie.desmet@uzleuven.be
More informationGroup b strep and macrodantin
Group b strep and macrodantin The Borg System is 100 % Group b strep and macrodantin 12-10-2017 Group B Streptococcus, also known as Streptococcus agalactiae, was once considered a pathogen of only domestic
More informationEUCAST-and CLSI potency NEO-SENSITABS
EUCASTand CLSI potency NEOSENSITABS Neo Sensitabs Page 1 / 6 Document: 6.2.0 Fastidious organisms EUCAST Interpretation zones and MIC breakpoints according to recommendations by the "Comité de l'antibiogramme
More informationJan A. Jacobs* and Ellen E. Stobberingh
Journal of Antimicrobial Chemotherapy (996) 37, 37-375 In-vitro antimicrobial susceptibility of the 'Streptococcus millerv group {Streptococcus anginosus, Streptococcus constellatus and Streptococcus intermedius)
More informationFinnzymes Oy. PathoProof Mastitis PCR Assay. Real time PCR based mastitis testing in milk monitoring programs
PathoProof TM Mastitis PCR Assay Mikko Koskinen, Ph.D. Director, Diagnostics, Finnzymes Oy Real time PCR based mastitis testing in milk monitoring programs PathoProof Mastitis PCR Assay Comparison of the
More informationChemotherapy of bacterial infections. Part II. Mechanisms of Resistance. evolution of antimicrobial resistance
Chemotherapy of bacterial infections. Part II. Mechanisms of Resistance evolution of antimicrobial resistance Mechanism of bacterial genetic variability Point mutations may occur in a nucleotide base pair,
More informationHigh Level Resistance of Enterococcus faecium and E. faecalis Isolates from Municipal Sewage Treatment Plants to Gentamicin
Iranian J Publ Health, Vol. 37, No.1, 2008, Iranian pp.103-107 J Publ Health, Vol. 37, No.1, 2008, pp.103-107 Original Article High Level Resistance of Enterococcus faecium and E. faecalis Isolates from
More information2015 Antibiotic Susceptibility Report
Citrobacter freundii Enterobacter aerogenes Enterobacter cloacae Escherichia coli Haemophilus influenzenza Klebsiella oxytoca Klebsiella pneumoniae Proteus mirabilis Pseudomonas aeruginosa Serratia marcescens
More informationHuman, cattle and goat blood as substitutes for sheep blood in blood-supplemented culture media
12 Research article Abstract Human, cattle and goat blood as substitutes for sheep blood in blood-supplemented culture media GN Dilrukshi 1, UN Jayewardane 1, F Sajidha 1, DMBT Dissanayake 1 Sri Lankan
More informationActivities of the Centre for Zoonoses, Animal Bacterial Diseases and Antimicrobial Resistance (ZOBA) in Switzerland
Activities of the Centre for Zoonoses, Animal Bacterial Diseases and Antimicrobial Resistance (ZOBA) in Switzerland Gudrun Overesch Institute of Veterinary Bacteriology, Vetsuisse-Faculty, Bern 6 th EURL-AR
More informationIsolation and molecular identification of Moraxella ovis and Moraxella spp. from IKC in sheep in India
Isolation and molecular identification of Moraxella ovis and Moraxella spp. from IKC in sheep in India R K Vaid*, T Anand, B C Bera, B N Shukla, D K Nagar, Gagandeep Singh, N Virmani, S Barua, B K Singh
More informationANTIBIOTIC SENSITIVITY PATTERN OF YERSINIA ENTEROCOLITICA ISOLATED FROM MILK AND DAIRY PRODUCTS*
Short Communication ANTIBIOTIC SENSITIVITY PATTERN OF YERSINIA ENTEROCOLITICA ISOLATED FROM MILK AND DAIRY PRODUCTS* T.R.Pugazhenthi 1, A. Elango 2, C. Naresh Kumar 3, B. Dhanalakshmi 4 and A. Bharathidhasan
More informationBackground and Plan of Analysis
ENTEROCOCCI Background and Plan of Analysis UR-11 (2017) was sent to API participants as a simulated urine culture for recognition of a significant pathogen colony count, to perform the identification
More informationUnderstanding the Hospital Antibiogram
Understanding the Hospital Antibiogram Sharon Erdman, PharmD Clinical Professor Purdue University College of Pharmacy Infectious Diseases Clinical Pharmacist Eskenazi Health 5 Understanding the Hospital
More informationBovine Mastitis Products for Microbiological Analysis
Bovine Mastitis Products for Microbiological Analysis 121917ss Hardy Diagnostics has everything for your laboratory! SAVE MONEY Now you have a choice for obtaining your supplies for mastitis testing. Hardy
More informationBacteria in chicken rolls sold by fast food restaurant and their public health significance
The Bangladesh Veterinarian (2015) 32 (1) : 13 18 Bacteria in chicken rolls sold by fast food restaurant and their public health significance S Sultana, MA Islam and MM Khatun* 1 Department of Microbiology
More informationMain objectives of the EURL EQAS s
EQAS Enterococci, Staphylococci and E. coli EURL workshop, April, 11 Lourdes García Migura Main objectives of the EURL EQAS s To improve the comparability of antimicrobial susceptibility testing (AST)
More information2010 ANTIBIOGRAM. University of Alberta Hospital and the Stollery Children s Hospital
2010 ANTIBIOGRAM University of Alberta Hospital and the Stollery Children s Hospital Medical Microbiology Department of Laboratory Medicine and Pathology Table of Contents Page Introduction..... 2 Antibiogram
More informationCONTAGIOUS COMMENTS Department of Epidemiology
VOLUME XXIII NUMBER 1 July 2008 CONTAGIOUS COMMENTS Department of Epidemiology Bugs and Drugs Elaine Dowell, SM (ASCP), Marti Roe SM (ASCP), Ann-Christine Nyquist MD, MSPH Are the bugs winning? The 2007
More informationSuggestions for appropriate agents to include in routine antimicrobial susceptibility testing
Suggestions for appropriate agents to include in routine antimicrobial susceptibility testing These suggestions are intended to indicate minimum sets of agents to test routinely in a diagnostic laboratory
More informationWhat s new in EUCAST methods?
What s new in EUCAST methods? Derek Brown EUCAST Scientific Secretary Interactive question 1 MIC determination MH-F broth for broth microdilution testing of fastidious microorganisms Gradient MIC tests
More informationBactiReg3 Event Notes Module Page(s) 4-9 (TUL) Page 1 of 21
www.wslhpt.org 2601 Agriculture Drive Madison, WI 53718 (800) 462-5261 (608) 265-1111 2015-BactiR Reg3 Shipment Date: September 14, 2015 Questions or comments should be directed to Amanda Weiss at 800-462-5261
More informationn Am I B I A U n IVE RS ITV OF SCIEnCE AnD TECH n 0 LOGY
n Am I B I A U n IVE RS ITV OF SCIEnCE AnD TECH n 0 LOGY FACULTY OF HEALTH AND APPLIED SCIENCES DEPARTMENT OF HEALTH SCIENCES QUALIFICATION: BACHELOR OF BIOMEDICAL SCIENCES QUALIFICATION CODE: SOBBMS LEVEL:
More information2009 ANTIBIOGRAM. University of Alberta Hospital and the Stollery Childrens Hospital
2009 ANTIBIOGRAM University of Alberta Hospital and the Stollery Childrens Hospital Division of Medical Microbiology Department of Laboratory Medicine and Pathology 2 Table of Contents Page Introduction.....
More informationCUMULATIVE ANTIBIOGRAM
BC Children s Hospital and BC Women s Hospital & Health Centre CUMULATIVE ANTIBIOGRAM 2017 Division of Medical Microbiology Department of Pathology and Laboratory Medicine Page 1 of 5 GRAM-POSITIVE BACTERIA
More informationAntibiotic. Antibiotic Classes, Spectrum of Activity & Antibiotic Reporting
Antibiotic Antibiotic Classes, Spectrum of Activity & Antibiotic Reporting Any substance of natural, synthetic or semisynthetic origin which at low concentrations kills or inhibits the growth of bacteria
More informationRCH antibiotic susceptibility data
RCH antibiotic susceptibility data The following represent RCH antibiotic susceptibility data from 2008. This data is used to inform antibiotic guidelines used at RCH. The data includes all microbiological
More informationJ. W. Mouton, H. P. Endtz, J. G. den Hollander, N. van den Braak and H. A. Verbrugh
Journal of Antimicrobial Chemotherapy (1997) 39, Suppl. A, 75 80 JAC In-vitro activity of quinupristin/dalfopristin compared with other widely used antibiotics against strains isolated from patients with
More informationCONTAGIOUS COMMENTS Department of Epidemiology
VOLUME XXIX NUMBER 3 November 2014 CONTAGIOUS COMMENTS Department of Epidemiology Bugs and Drugs Elaine Dowell SM MLS (ASCP), Marti Roe SM MLS (ASCP), Sarah Parker MD, Jason Child PharmD, and Samuel R.
More informationUniversity Ss Cyril and Methodius in Skopje Faculty of veterinary medicine-skopje
University Ss Cyril and Methodius in Skopje Faculty of veterinary medicine-skopje ACTIVITIES of the NRL-AR in Macedonia Food institute NRL AR, MK assist. prof. d-r Sandra Mojsova, Head of food and feed
More informationExploring simvastatin, an antihyperlipidemic drug, as a potential topical antibacterial agent
Supplementary materials Exploring simvastatin, an antihyperlipidemic drug, as a potential topical antibacterial agent Shankar Thangamani 1, Haroon Mohammad 1, Mostafa Abushahba 1, Maha Hamed 1, Tiago Sobreira
More informationMastitis-Causing Streptococci Are Important Contributors to Bacterial Counts in Raw Bulk Tank Milk
2644 Journal of Food Protection, Vol. 67, No. 12, 2004, Pages 2644 2650 Copyright, International Association for Food Protection Mastitis-Causing Streptococci Are Important Contributors to Bacterial Counts
More informationThere are two international organisations that set up guidelines and interpretive breakpoints for bacteriology and susceptibility
ANTIMICROBIAL SUSCEPTIBILITY TESTING ON MILK SAMPLES Method and guidelines There are two international organisations that set up guidelines and interpretive breakpoints for bacteriology and susceptibility
More informationOriginal Article. Hossein Khalili a*, Rasool Soltani b, Sorrosh Negahban c, Alireza Abdollahi d and Keirollah Gholami e.
Iranian Journal of Pharmaceutical Research (22), (2): 559-563 Received: January 2 Accepted: June 2 Copyright 22 by School of Pharmacy Shaheed Beheshti University of Medical Sciences and Health Services
More informationDetection of Methicillin Resistant Strains of Staphylococcus aureus Using Phenotypic and Genotypic Methods in a Tertiary Care Hospital
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 7 (2017) pp. 4008-4014 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.607.415
More informationPerformance Information. Vet use only
Performance Information Vet use only Performance of plates read manually was measured in three sites. Each centre tested Enterobacteriaceae, streptococci, staphylococci and pseudomonas-like organisms.
More informationagainst Clinical Isolates of Gram-Positive Bacteria
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Feb. 993, p. 366-370 Vol. 37, No. 0066-0/93/00366-05$0.00/0 Copyright 993, American Society for Microbiology In Vitro Activity of CP-99,9, a New Fluoroquinolone,
More informationAntibiotics: mode of action and mechanisms of resistance. Slides made by Special consultant Henrik Hasman Statens Serum Institut
Antibiotics: mode of action and mechanisms of resistance. Slides made by Special consultant Henrik Hasman Statens Serum Institut This presentation Definitions needed to discuss antimicrobial resistance
More informationFluoroquinolones resistant Gram-positive cocci isolated from University of Calabar Teaching Hospital, Nigeria
GSC Biological and Pharmaceutical Sciences, 2017, 01(01), 001 005 Available online at GSC Online Press Directory GSC Biological and Pharmaceutical Sciences e-issn: 2581-3250, CODEN (USA): GBPSC2 Journal
More informationGrowth Control of Standard L.monocytogenes and L.monocytogenes Spiked in Goat Milk by Natural products, Antibiotics and Lactic Acid Bacteria
Internet Journal of Food Safety, Vol.14, 2012, p.30-34 Copyright 2012, FoodHACCP.com Publishing Growth Control of Standard L.monocytogenes and L.monocytogenes Spiked in Goat Milk by Natural products, Antibiotics
More informationThe prevalence, vancomycin resistance and virulence gene profiles of Enterococcus species recovered from different foods of animal origin
. Veterinarski Arhiv 88 (1), 111-124, 2018 DOI: 10.24099/vet.arhiv.160905 The prevalence, vancomycin resistance and virulence gene profiles of Enterococcus species recovered from different foods of animal
More information2016 Antibiotic Susceptibility Report
Fairview Northland Medical Center and Elk River, Milaca, Princeton and Zimmerman Clinics 2016 Antibiotic Susceptibility Report GRAM-NEGATIVE ORGANISMS 2016 Gram-Negative Non-Urine The number of isolates
More informationTel: Fax:
CONCISE COMMUNICATION Bactericidal activity and synergy studies of BAL,a novel pyrrolidinone--ylidenemethyl cephem,tested against streptococci, enterococci and methicillin-resistant staphylococci L. M.
More informationMRSA surveillance 2014: Poultry
Vicky Jasson MRSA surveillance 2014: Poultry 1. Introduction In the framework of the FASFC surveillance, a surveillance of MRSA in poultry has been executed in order to determine the prevalence and diversity
More informationQuad Plate User s Manual
A part of Eurofins DQCI SSGN - SSGNC Mastitis Culture Quad Plate User s Manual Eurofins Microbiology Laboratories / Eurofins DQCI Services 5205 Quincy Street, Mounds View, MN 55112 P: 763-785-0485 F: 763-785-0584
More informationGuidelines for Laboratory Verification of Performance of the FilmArray BCID System
Guidelines for Laboratory Verification of Performance of the FilmArray BCID System Purpose The Clinical Laboratory Improvement Amendments (CLIA), passed in 1988, establishes quality standards for all laboratory
More informationMILK COMPOSITIONAL CHANGES DURING MASTITIS
MASTITIS PA R T 2 MILK COMPOSITIONAL CHANGES DURING MASTITIS Increased SCC Na Cl Whey protein (e.g. serum albumin, Ig, lactoferrin) Decreased Production α-lactalbumin & Lactose Casein K MILK LOSS LACTOFERRIN
More information6. STORAGE INSTRUCTIONS
VRESelect 63751 A selective and differential chromogenic medium for the qualitative detection of gastrointestinal colonization of vancomycin-resistant Enterococcus faecium () and vancomycin-resistant Enterococcus
More informationThe Basics: Using CLSI Antimicrobial Susceptibility Testing Standards
The Basics: Using CLSI Antimicrobial Susceptibility Testing Standards Janet A. Hindler, MCLS, MT(ASCP) UCLA Health System Los Angeles, California, USA jhindler@ucla.edu 1 Learning Objectives Describe information
More informationEuropean Antimicrobial Resistance Surveillance System (EARSS) in Scotland: 2004
European Antimicrobial Resistance Surveillance System (EARSS) in Scotland: 2004 SECOND ANNUAL REPORT MJ Coyne 1, SJ Dancer 1, G Edwards 2, 3, D Morrison 2. 1 Health Protection Scotland, 2 Scottish MRSA
More informationValidation of the PathoProof TM Mastitis PCR Assay for Bacterial Identification from Milk Recording Samples
Validation of the PathoProof TM Mastitis PCR Assay for Bacterial Identification from Milk Recording Samples Mikko Koskinen, Ph.D. Finnzymes Oy Benefits of using DHI samples for mastitis testing Overview
More informationPhylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA.
Zoology Department Phylogeographic assessment of Acanthodactylus boskianus (Reptilia: Lacertidae) based on phylogenetic analysis of mitochondrial DNA By HAGAR IBRAHIM HOSNI BAYOUMI A thesis submitted in
More informationJasmine M. Chaitram, 1,2 * Laura A. Jevitt, 1,2 Sara Lary, 1,2 Fred C. Tenover, 1,2 and The WHO Antimicrobial Resistance Group 3,4
JOURNAL OF CLINICAL MICROBIOLOGY, June 2003, p. 2372 2377 Vol. 41, No. 6 0095-1137/03/$08.00 0 DOI: 10.1128/JCM.41.6.2372 2377.2003 The World Health Organization s External Quality Assurance System Proficiency
More informationProject Summary. Impact of Feeding Neomycin on the Emergence of Antibiotic Resistance in E. coli O157:H7 and Commensal Organisms
Project Summary Impact of Feeding Neomycin on the Emergence of Antibiotic Resistance in E. coli O157:H7 and Commensal Organisms Principal Investigators: Mindy Brashears, Ph.D., Texas Tech University Guy
More informationAntibiotic Susceptibility of Common Bacterial Pathogens in Canine Urinary Tract Infections
Vol.1 No.2 Oct-Dec 2013 ISSN : 2321-6387 Antibiotic Susceptibility of Common Bacterial Pathogens in Canine Urinary Tract Infections S. Yogeshpriya*, Usha N.Pillai, S. Ajithkumar and N. Madhavan Unny Department
More informationAustralian Journal of Basic and Applied Sciences. Isolation and Molecular Differentiation of Brucella Isolates in Some Foods in Egypt
ISSN:1991-8178 Australian Journal of Basic and Applied Sciences Journal home page: www.ajbasweb.com Isolation and Molecular Differentiation of Brucella Isolates in Some Foods in Egypt 1 Safaa Ali, 2 Nadia
More informationShort Report. R Boot. Keywords: Bacteria, antimicrobial susceptibility testing, quality, diagnostic laboratories, proficiency testing
Short Report Frequent major errors in antimicrobial susceptibility testing of bacterial strains distributed under the Deutsches Krebsforschungszentrum Quality Assurance Program R Boot Former Section of
More informationApproach to pediatric Antibiotics
Approach to pediatric Antibiotics Gassem Gohal FAAP FRCPC Assistant professor of Pediatrics objectives To be familiar with common pediatric antibiotics o Classification o Action o Adverse effect To discus
More informationPCR detection of Leptospira in. stray cat and
PCR detection of Leptospira in 1 Department of Pathology, School of Veterinary Medicine, Islamic Azad University, Shahrekord Branch, Shahrekord, Iran 2 Department of Microbiology, School of Veterinary
More informationEvaluation of a computerized antimicrobial susceptibility system with bacteria isolated from animals
J Vet Diagn Invest :164 168 (1998) Evaluation of a computerized antimicrobial susceptibility system with bacteria isolated from animals Susannah K. Hubert, Phouc Dinh Nguyen, Robert D. Walker Abstract.
More informationAntimicrobial susceptibility of Gram-positive non-urinary isolates to fosfomycin
Antimicrobial susceptibility of Gram-positive non-urinary isolates to fosfomycin Matthew E. Falagas, Sofia Maraki, Drosos E. Karageorgopoulos, Antonia C. Kastoris, Anastasios Kapaskelis, George Samonis
More informationCompliance of manufacturers of AST materials and devices with EUCAST guidelines
Compliance of manufacturers of AST materials and devices with EUCAST guidelines Data are based on questionnaires to manufacturers of materials and devices for antimicrobial susceptibility testing. The
More informationARCH-Vet. Summary 2013
Federal Department of Home Affairs FDHA FSVO ARCH-Vet Report on sales of antibiotics in veterinary medicine and antibiotic resistance monitoring of livestock in Switzerland Summary 2013 Published by Federal
More informationESBL Producers An Increasing Problem: An Overview Of An Underrated Threat
ESBL Producers An Increasing Problem: An Overview Of An Underrated Threat Hicham Ezzat Professor of Microbiology and Immunology Cairo University Introduction 1 Since the 1980s there have been dramatic
More informationINFECTIOUS DISEASES DIAGNOSTIC LABORATORY NEWSLETTER
INFECTIOUS DISEASES DIAGNOSTIC LABORATORY NEWSLETTER University of Minnesota Health University of Minnesota Medical Center University of Minnesota Masonic Children s Hospital May 2017 Printed herein are
More informationObjectives. Antibiotics uses in food animals 3/25/2018. California Dairy Productions. Antimicrobial Resistance in the Animal Production Environment
Antimicrobial Resistance in the Animal Production Environment Xunde Li Western Institute for Food Safety and Security Department of Population Health and Reproduction University of California Davis Objectives
More informationCurriculum Vitae. : AlBaha University, faculty of Science.
Curriculum Vitae Personal Data : Name : Layla Ismail Mohamed Nationality : Sudanese Present Position Held: Associate Professor Address Academic Qualification: : AlBaha University, faculty of Science. E-mail:
More informationAntimicrobial Resistance Strains
Antimicrobial Resistance Strains Microbiologics offers a wide range of strains with characterized antimicrobial resistance mechanisms including: Extended-Spectrum β-lactamases (ESBLs) Carbapenamases Vancomycin-Resistant
More information