ISSN: X (print) ISSN: (online) 2l u m

Transcription

1 ISSN: X (print) ISSN: (online) e 2l u m Vo ian rs Pe lf Gu

2 In the Name of God, the Beneficent, the Merciful IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS (IJAB) CHAIRMAN AND EDITOR-IN-CHIEF Professor Dr. Jamshid Darvish (Ph.D) Ferdowsi University of Mashhad, Iran Tel: +98 (0) EDITOR: Dr. Mansour Aliabadian (Ph.D) Ferdowsi University of Mashhad EXECUTIVE EDITOR Dr. Omid Mirshamsi (Ph.D) Ferdowsi University of Mashhad, Iran Tel: +98 (0) ENGLISH EDITOR Dr. Behzad Ghonsouli (Ph.D) Ferdowsi University of Mashhad EDITORIAL BOARD M. ALIABADIAN S. C. ANDERSON Department of Biology, Ferdowsi University of Mashhad, Iran Department of Biological Sciences, University of the Pacific, California, USA D. BILTON School of Marine Science &Engineering, University of Plymouth, UK B. COAD Canadian Museum of Nature, Ottawa, Canada H. R. ESMAEILI Depertment of Biology, Shiraz University, Iran J. DARVISH Department of Biology, Ferdowsi University of Mashhad, Iran F. GHASEMZADEH Department of Biology, Ferdowsi University of Mashhad, Iran B. HASANZADEH-KIABI Faculty of Biological sciences, Shaheed Beheshti University, Iran S. HOSSEINIE (OSTAVANI) Department of Biology, Shiraz University, Iran J.P. HUGOT Muséum national d Histoire naturelle, France M. KARAMI Faculty of Natural Resources, University of Tehran, Iran M. MALEK School of Biology, University of Tehran, Iran M. MASHKOUR Muséum National d'histoire Naturelle, Paris, France M. MODARES-AVAL Faculty of Agriculture, Ferdowsi University of Mashhad, Iran N. RASTEGAR-POYANI Department of Biology, Razi University of Kermanshah, Iran A. SARI School of Biology, University of Tehran, Iran ALL CONTRIBUTIONS SHOULD BE SUBMITTED ONLINE AT IJAB WEBSITE: IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS (IJAB) IS PUBLISHED BIANNUALLY BY: Ferdowsi University of Mashhad, Azadi Square, Mashhad, Islamic Republic of Iran P.O.Box: Indexed by: ISI Thompson Zoological Records & Islamic World Science Citation Center (ISC) Cover photograph: Bedriaga's Plate-tailed Gecko, Teratoscincus bedriagai, Nikolsky, 1900, courtesy of Vida Hojati Authors are encouraged to send quality photographs (preferably in color) to the editor in-chief to be considered for use on the cover. Images should be at least 300dpi. ISSN: X (print), (online) Authorization number: 124/798; 29 April 2004 MSRT authorization number: 89/3/11/51155; 21 November 2010

3 Iranian Journal of Animal Biosystematics 2015, vol. 11, No. 1 KHOSHEGHBAL, M., PAZOOKI, J.- First report of two parasitic copepods of Pampus argenteus (stromateidae) in west of Persian Gulf, Iran...1 JAHED HAGHSHENAS, N., HOJATI, V.- The male reproductive cycle of the Bedriaga's plate-tailed Gecko, Teratoscincus bedriagai in Iran RASTEGAR POUYANI, N., FATTAHI, R., KARAMIANI, R., TAKESH, M.- Sexual size dimorphism in Hyla Savignyi Audouin, 1827 (Anura: Hylidae) from Kermanshah Province, Western Iran.17 KAZEMI, S. M., RASTEGAR-POUYANI, E., SHAFIEI DARABI, S.A, EBRAHIM TEHRANI, M., HOSSEINZADEH, M.S., MASHAYEKHI, M., MOBARAKI, A.- Annotated checklist of amphibians and reptiles of Qom Province, Central Iran 23 JABBARI, A., MODARRES AWAL, M., FEKRAT, L., KARIMI, J., RASHKI, M.- On the Short-horned grasshopper (Orthoptera: Caelifera) fauna of northeastern Iran with some information on sweep sampling capture rates KHOSHKHOLGH, M., ALAVI, A.R., NAZARI, S.- Karyotypic characterization of the Pike, Esox lucius from the south Caspian Sea basin TABADKANI, S.M, NOZARI, J., HOSSEININAVEH, V.- New records and updated checklist of the genus Philonthus (Col: Staphylinidae) for Iran MUILWIJK, J.- A new Nebria species (Carabidae: Nebriini) and a new Deltomerus species (Carabidae: Patrobini) from high mountain areas of Azarbayjan-e- Gharbi AKBARIRAD, S., DARVISH, J, ALIABADIAN, M., KILPATRICK, C.W.M.- Biosystematic study of Calomyscus mystax (Rodentia, Calomyscidae) from northeastern Iran HOSSEINI-CHEGENI, A., HOSSEINI, R., ABDIGOUDARZI, M., TELMADARRAIY, Z., TAVAKOLI, M.- An additional records of Hyalomma marginatum rufipes Koch, 1844 (Acari: Ixodidae) in southwestern and southern Iran with a molecular YAZDANI-MOGHADDAM, F., GHASEMIAN, F., GHASSEMZADEH, F., KHAZAEE, A.R., SEIFALI, M., GHANBARIFARDI, M.- The fish fauna of north and east regions of Khorasan-e-Razavi Province, Iran..91

4 Iranian Journal of Animal Biosystematics Editorial Policy Iranian Journal of Animal Biosystematics (IJAB) is published annually by Office of the Vicechancellor of Research Affairs of Ferdowsi University of Mashhad, Iran. IJAB publishes original scientific research, not published before or under consideration elsewhere, in the broad areas of Animal Biosystematics and Biodiversity which relates to the southern Palearctic region, including Iran. Publications will be in one of these three formats: full papers, short communications and reviews. Book reviews, scientific announcements and news relating to topics of the Journal will also be published. The main topics of interest are: theoretical, comparative, methodological and applied research relating to the following areas: Taxonomy, Morphology, Development, Population, Zoogeography, Ecology, Behavior, Biochemical and Molecular Population Genetics, Cytogenetics, Palaeo-neonthology, Phylogeny, Systems analysis and Modeling. The Journal is devoted to the understanding of animal diversity and its sustainable use, and addresses an international audience. For more details, please visit the web site: Subscription The subscription price of Iranian Journal of Animal Biosystematics is $20 per volume. Orders, which must be accompanied by the payment, may be sent to the publisher, Ferdowsi University of Mashhad Press, Mashhad, Iran. The Iranian Journal of Animal Biosystematics (IJAB) is published by Ferdowsi University Press. Mashhad, Islamic Republic of IRAN Ferdowsi University of Mashhad Press ISSN: X Website:

5 Iranian Journal of Animal Biosystematics (IJAB) Vol.11, No.1, 1-6, 2015 ISSN: X (print); (online) First report of two parasitic copepods of Pampus argenteus (Stromateidae) in west of Persian Gulf, Iran Khosheghbal, M., and Pazooki, J. * Department of Marine Biology, Faculty of Biological Sciences, Shahid Beheshti University, G. C. Tehran, Iran (Received: 20 July 2014; Accepted: 4 February 2015) A survey on parasitic copepods was carried out on Pampus argenteus Euphrasen, 1788 in Hormozgan province. Totally, 62 specimens were caught by bottom trawl from northwest of Qeshm Island in summer 2010 and winter These were immediately frozen in on-board deep freezer of fishing vessel. All samples were transferred to laboratory and after measuring fish weight and length, parasitological survey implemented by stereo-and light microscopes on body surface and gill cavities of the host. Individuals belong to two species of parasitic copepods were removed from the inner surface of the operculum and gill filaments of the host. The collected parasites were Nothobomolochus triceros (Basset- Smith, 1898) and Paralebion aliuncus (Rangnekar, 1955). The prevalence, mean intensity and abundance of parasites were as follows: N. triceros (6.45%, 0.8 ± 0.71 and 0.06) and P. aliuncus (1.61%, 0.2 ± 0.17 and 0.01), respectively. Both species of copepod parasites are reported, for the first time, from Iran. Key words: Crustacean parasites, Copepod, Qeshm Island, Silver pomfret. INTRODUCTION Crustaceans are the most various and ubiquitous in all the metazoan groups. Among them, the copepods are dominant. Many copepods have great economic importance as agents of disease in wild and cultured fish populations (Rohde, 2005). The silver pomfret, Pampus argenteus is commercially an important fish in the Asia. It has a wide distribution in the waters of the Indo-West Pacific, ranging from the Persian Gulf in the west to Indonesia and northward to Hokkaido, Japan (Ho & Lin, 2003). Studies on ectoparasites, mainly parasitic copepods on marine fish, are scarce in Iran. Previously recorded copepod parasites of Pampus argenteus include: Nothobomolochus triceros from the gill cavity of the host was noted by Pillai (1969) in the collection of the British Museum, London. N. triceros was reported from the gills of the host in Yosu Bay, Korea (Choi et al., 1994). Also this species was first reported in marine fishes of Kuwait Bay, Persian Gulf (Ho et al., 2000). N. triceros and Paralebion aliuncus from the gills and the branchiuran parasites Argulus sp. from body surface of the host were reported from Karachi waters by Ghani and Mohammad Ali (2003). Naricolax insolitus Ho & Lin, 2003 in the nasal cavities of the silver pomfret P. argenteus was described from Taiwan by Ho and Lin (2003). N. triceros was also reported by Lin and Ho (2004) from the host in Taiwan. The purpose of this study was identification of crustacean parasites on P. argenteus in northwest of Qeshm Island. *Corresponding Author: pazooki2001@yahoo.com 2015 FERDOWSI UNIVERSITY OF MASHHAD, IRAN

6 2 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 FIGURE 1. Sampling location in Persian Gulf, northwest of Qeshm Island (Chahoo Sharghi). MATERIALS AND METHODS A total of 62 specimens of Pampus argenteus were caught by bottom trawl in northwest of Qeshm Island (Chahoo Sharghi), in the Persian Gulf, Iran. The specimens were obtained in summer 2010 and winter 2011 (warm and cold seasons). These were collected from ' to ' N and ' to ' E (Figure. 1) and were immediately deep frozen. All samples were transferred to laboratory of Shahid Beheshti University and examined for the presence of parasites based on parasitology methods. After measuring weight and length of the host, body surface and gill cavities were carefully examined for copepod parasites. The samples were studied using stereo microscopes NSZ-606 and light microscopes Nikon YS 100. The copepod Parasites were removed from the inner surface of the operculum and gill arches of the host and preserved in 10% formalin. The specimens were cleared in 85% lactic acid for 1-2 hours. The illustrations were made with the aid of camera lucida. Measurements given in the description are in millimeters. Copepods identification carried out based on morphological features according to Rangnekar (1955) and Pillai (1969, 1985).

7 PARASITIC COPEPODS OF PAMPUS ARGENTEUS 3 Statistical analysis Because data were not normally distributed, significant differences between parasites abundance and gender of fish (male, female and immature) were compared using Kruskal wallis test. Nonparametric Spearman correlation coefficient was used to investigate the relationship between parasites abundance and total length of fish. The significant differences between summer and winter seasons with copepods abundance was determined using Non- parametric Mann- Whitney test. All data were analyzed using SPSS version RESULTS Sixty-two specimens of P. argenteus from Persian Gulf were investigated and five specimen or 8.06% of fish were found to be infested with copepod parasites. In total, two different parasites were observed in the fish including Nothobomolochus triceros and Paralebion aliuncus. The prevalence, mean intensity and abundance of N. triceros were 6.45%, 0.8 ± 0.71 and 0.06 also for P. aliuncus were 1.61%, 0.2 ± 0.17 and 0.01, respectively. N. triceros (Figure. 2a, 2b) is the most common copepod parasite of P. argenteus and female specimens were collected from gill filaments and inner surface of the operculum. The body length was mm, excluding setae on caudal rami with a mean length (±SE) of 3.21 ± 0.17 mm. Greatest width mm (measured at widest part of cephalon), egg sacs length was mm and width mm. P. aliuncus (Figure. 3a, 3b) was observed on gill filaments. It has a large size and can be easily seen by the naked eye. The body length was 5.21 mm long, excluding setae on caudal rami. Morphological measurement was made on 1 specimen (only one specimen was found on the host). Greatest width 1.95 mm (measured at widest part of cephalon excluding marginal membrane), egg sacs length was 2.70 mm and width 0.28 mm. The result of Kruskal-Wallis test showed no significant difference among the copepods analyzed with respect to the sex of the host (Chi-Square = 0.261; df = 2; P = 0.878). The result of nonparametric Mann- Whitney test showed no significant difference between copepods abundance in summer and winter (warm and cold weather) seasons (Z = -538; df = 1; P = 0.591). No significant correlation was found between parasites abundance and total length of fish (P > 0.05). DISCUSSION All discovered parasites were female. According to Heckmann (2003) identification of parasitic copepods (Entomostraca) is usually based on females. Males of these parasites disappear after copulation in pre-adult stages. The gills are a favorite site for the attachment of copepod parasites, as these feed on tissue of the gills and blood of the lamellae, causing to loss of respiratory surface area (Purivirojkul & Areechon, 2008). However, when present in small numbers, usually cause only minor harm to their hosts (Heckmann, 2003). N. triceros from P. argenteus was reported in several studies (Pillai, 1969; Choi et al., 1994; Ho et al., 2000; Lin & Ho, 2004). Naricolax insolitus a new species of bomolochid copepod was reported by Ho and Lin (2003) in the nasal cavities of the silver pomfret P. argenteus from Taiwan. P. aliuncus was first recorded by Rangnekar (1955) from P. argenteus in Bombay. Ghani and Mohammad Ali (2003) reported three species of crustacean parasites of P. argenteus from Karachi waters, two copepods parasites N. triceros and P. aliuncus also branchiopod Argulus sp. This study had the same parasites as found in Karachi waters (Ghani & Mohammad Ali, 2003) except for the branchiopod Argulus sp. Likewise, no copepod parasites were observed in the body surface and nasal cavities of fish.

8 4 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 a b FIGURE 2 (a, b). Nothobomolochus triceros (Basset- Smith, 1898) dorsal view, female

9 PARASITIC COPEPODS OF PAMPUS ARGENTEUS 5 a b FIGURE 3(A, B). Paralebion aliuncus (Rangnekar, 1955) dorsal view, female.

10 6 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 Copepods are the largest and most diversified group of crustaceans. Due to their feeding activities on the host are economically important parasites and should not be neglected. Although there are a few studies on copepod parasites in Iran, but more researches are needed to study their importance as disease agents. ACKNOWLEDGMENTS We are grateful to Mr. Safaei for providing samples. Special thanks to Dr. Shokri, Amir Qazilou, Fatemeh Tajbakhsh and Elham Karimi for their sincere assistances. This research was supported by Shahid Beheshti University, G. C. The authors declare that there is no conflict of interests. LITERATURE CITED Rohde, K Marine Parasitology. 1st edn. CABI Publishing, Wallingford, United Kingdom. Choi, S.D., Hongm, S.Y., & Suh, H.L Two copepod species of Nothobomolochus (Poecilostomatoida, Bomolochidae) parasitic on marine fishes from Yosu Bay, Korea. Bulletin of the Korean Fisheries Society 27, Ghani, N., & Mohammad Ali, Q Crustacean parasites of Pampus argenteus Euphrasen from Karachi waters. Pakistan Journal of Biological Sciences 6, Heckmann, R Other ectoparasites infesting fish; copepods, branchiurans, isopods, mites and bivalves. Aquaculture Magazine 29, Ho, J.S., Kim, I.H., & Sey, O Two species of bomolochid copepods (Crustacea) parasitic on marine fishes of Kuwait. Proceedings of the Biological Society of Washington 113, Ho, J.S., & Lin, C.L Naricolax insolitus n. sp. a bomolochid copepod (poecilostomatoida) parasitic in the nasal cavities of silver pomfret Pampus argenteus off Taiwan. Systematic parasitology 54, Lin, C.L., & Ho, J.S Three species of Nothobomolochus Vervoort, 1962 (Copepoda: Bomolochidae) parasitic on marine fishes landed at Mi-tuo fishing port in Southern Taiwan. Journal of the Fisheries Society of Taiwan 31, Pillai, N.K Notes on some copepod parasites in the collection of the British museum (N.H.), London. Journal of the Marine Biological Association of India 11, Pillai, N.K The Fauna of India: Parasitic copepods of marine fishes,1st edition. Technical and General Press, Calcutta, India. Purivirojkul, W., & Areechon, N A survey of parasitic copepods in marine fishes from the Gulf of Thailand, Chon Buri province. The Kasetsart Journal, Natural Science 42, Rangnekar, M.P Pseudocaligus laminiatus sp. nov. and Diphyllogaster aliuncus sp. nov. (Copepoda) parasitic on Bombay fishes. Journal of the University of Bombay 23,

11 Iranian Journal of Animal Biosystematics (IJAB) Vol.11, No.1, 7-16, 2015 ISSN: X (print); (online) The Male Reproductive Cycle of the Bedriaga's Plate-tailed Gecko, Teratoscincus bedriagai in Iran Jahed-Haghshenas, N., Hojati, V. * Department of Biology, Damghan Branch, Islamic Azad University, Damghan, Iran (Received: 30 March 2015; Accepted: 23 June 2015) The Bedriaga's Plate-tailed Gecko, Teratoscincus bedriagai, Nikolsky, 1900 is distributed in the northern and eastern deserts of Iran and the desert regions of southern Afghanistan. In this study, the male reproductive cycle of the lizard has been studied from 5 April to 5 August, Totally, 40 adult males were collected by hand at midnight from four adjacent stations in Damghan County, Semnan Province of Iran. Most of the lizards were observed on highly saline, loose soil covered with a thin salt crust, and were common near Tamarix bushes. Animals were transferred to the laboratory and their morphometric characters were measured. After anesthetizing the animals, their testes were removed and processed for morphometric and histological studies. Results showed that the spermatogenesis started after hibernation from early April and ended in August. The peak of spermatogenesis was in May. The numbers of seminiferous tubules were and their diameter varied between and µ. The diameter of tunica albuginea varied between 3.05 and 8.20 microns and diameter of germinal layer varied between and microns. Spermatogenesis of T. bedriagai in Iran is seasonal and alternates with associate type. Key words: Spermatogenesis, testis, lizard, gecko, Teratoscincus bedriagai, Iran. INTRODUCTION Three general types of reproductive cycles are observed in Lizards: constant, associated and dissociated (Pough et al., 2001). In constant reproductive cycle, gonads are active almost year-round (Jenssen and Nunez, 1994). In associated and dissociated reproductive cycles, mating season is discontinuous. In associated type, gonadal activity increases immediately prior to the mating period in both males and females simultaneously and females have no need to store sperm due to it s availability during the reproductive season (Huang, 1997; Censky, 1995). In a dissociated type, gonadal activity is low during the mating period and peaks during the non-mating period while male gonadal activity is shorter than that of females and sperm is stored by the female genital system for later fertilization (Torki, 2006). The Gekkota is a suborder of Squamata, and consists of seven families (Gamble et al., 2008). The Sphaerodactylidae are a family of geckos distributed in North America, South America, and the Caribbean, as well as in Southern Europe, North Africa, the Middle East, and into Central Asia *Corresponding Author: vida.hojati@gmail.com 2015 FERDOWSI UNIVERSITY OF MASHHAD, IRAN

12 8 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 (Gamble et al., 2008). The Bedriaga's Plate-tailed Gecko or Skink Gecko, Teratoscincus bedriagai Nikolsky, 1900, which belongs to the Sphaerodactylidae family, is a nocturnal and insectivorous lizard distributed in the northern and eastern desert basins of the Central Plateau of Iran, Sistan, and the desert regions of southern Afghanistan as far east as Kandahar. This species in Iran is distributed in Sistan and Balutchestan, Khorasan, Semnan, Tehran and Yazd Provinces (Smid et al., 2014). A description of this species was presented by Anderson (1999) which was based on five specimens. Further morphological data was given by Hojati in accordance with specimens collected in northern deserts of Central Plateau of Iran (Hojati et al., 2009, Hojati et al., 2014). The female reproductive cycle of the species in the study area has been studied as well (Mojibi and Hojati, 2014). Since no data is available on the spermatogenic cycle of the species, this research has been conducted to characterize the male reproductive cycle. MATERIALS AND METHODS The specimens were collected from deserts of four Adjacent villages including: Hassan Abad, Saleh Abad, Alian and Yazdan Abad located in south of Damghan County, Semnan Province of Iran (54 19 E, N). The study area is located at 1170 m above sea level and north of the Central Kavir Desert. The annual average temperature is 17.2 C. According to the reports of Department of Environment of Damghan County, this area consists of alkaline saline soils comprising clay and sand and the dominant plant species are Tamarix sp., Salsola sp., Alhaji sp., Peganum sp., Atriplex sp. and Astragalus sp. All specimens were collected periodically every month during the main activity period of this species from 5 April to 5 August Sampling occurred at night from 21:00 to 24:00 hours. In total, 40 sexually mature males were captured by hand (eight specimens per sampling period), usually from the holes in the desert sand. Most of the specimens were observed on highly saline, loose soil covered with a thin salt crust, and were common near Tamarix bushes (Fig. 1). Males have larger and more embossed base of tail because of the presence of the hemipenes. FIGURE 1. Teratoscincus bedriagai in Saleh Abad, Iran.

13 REPRODUCTIVE CYCLE OF THE BEDRIAGA'S PLATE-TAILED GECKO 9 The specimens were transferred alive to the zoology laboratory of Islamic Azad University, Damghan Branch, Iran. Table1 shows the measured characters. Length, width and diameter values were measured by dial caliper with an accuracy of 0.02 mm. Weight was measured by scale with an accuracy of g. Volume of the testis was calculated by using the formula for the volume of an ellipsoid: 4/3 ab 2, where a= ½ the longest axis, and b = ½ the shortest axis. Gonads, once removed, were measured for metric and meristic studies. Weight, diameter (length and width) and volume values were measured for the right and left testis separately. After fixing the testes in 10% formalin, tissues were dehydrated, cleared in xylene, infiltrated with paraffin, embedded and sectioned and stained with haematoxylin & eosin following standard histological protocols. The sections were studied by light microscopy at 400 magnification. Photographs were prepared by digital camera while the data was analyzed by SPSS 18 software and one-way ANOVA and Tukey test. TABLE 1. The measured characters in Teratoscincus bedriagai. Abbreviation Characters W Body Weight SVL Snout-Vent Length LCD Tail Length HL Head Length HW Head Width RTL Right Testis Length LTL Left Testis Length RTWi Right Testis Width LTWi Left Testis Width RTW Right Testis Weight LTW Left Testis Weight RTV Right Testis Volume LTV Left Testis Volume RTAD Right Tunica Albuginea Diameter LTAD Left Tunica Albuginea Diameter RSTN Right Seminiferous Tubules Number LSTN Left Seminiferous Tubules Number RSTD Right Seminiferous Tubules Diameter LSTD Left Seminiferous Tubules Diameter RGLD Right Germinal Layer Diameter LGLD Left Germinal Layer Diameter RLD Right Lumen Diameter LLD Left Lumen Diameter RSgN Right Spermatogonia Number LSgN Left Spermatogonia Number RSpN Right Spermatocytes Number LSpN Left Spermatocytes Number RStN Right Spermatids Number LStN Left Spermatids Number RSN Right Sperms Number LSN Left Sperms Number GI Gonadal index = gonadal weight/body weight 100 RHpL Right Hemipenis Length LHpL Left Hemipenis Length RHpW Right Hemipenis Width LHpW Left Hemipenis Width

14 10 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 RESULTS The mean body weight (W), snout-vent length (SVL), tail length (LCD), head length (HL) and head width (HW) of males were 7.56 g, mm, mm, mm and mm, respectively. The smallest SVL was mm while the largest one was mm. There was no significant difference in body size characters including W, SVL, LCD, HL and HW through different months (Table 1). The mean weight, length, width and volume of right testes were g, 7.50 mm, 3.10 mm and mm 3, respectively. The mean weight, length, width and volume of left testes were g, 7.04 mm, 3.70 mm and mm 3, respectively. The descriptive statistics of characters in T. bedriagai are shown in Tables 1 and 2. The mean number of seminiferous tubules was 52 (N=40). The mean diameters of seminiferous tubules in right and left testes were and 155 microns, respectively. The mean diameter of the tunica albuginea, germinal layer and lumen were 6.39, and microns in right testes; and 6.39, and microns in left testes, respectively. The mean number of spermatogonia, spermatocytes, spermatids and sperms were , , , in right testes; and , , and in left testes, respectively. The minimum diameter, weight and volume of testes were observed on 5 August (Figs 2 and 3). There were no significant differences in the testis and hemipenis characters between the left and right side of body (paired t-test, P >0.05 in all cases). There were significant differences in macroscopic testicular characters between months (Table 2). They hibernate from October to March. Early spermiogenesis starts in March and continues from April to July. Observation of the large numbers of mature sperms in the tubules in April shows that the spermatogenesis starts from March. The Sertoli cells, spermatogonia and spermatocytes were observed in the seminiferous tubules during the reproductive season from April to August. The spermatids were observed in the germinal layer from April to early August, but their number was reduced after June. The spermatozoids were abundant in the lumen of tubules during May and June and there were no spermatozoids after July (Fig. 4). Tubule diameter and germinal epithelium height reached maximum sizes during May. The minimum height of germinal epithelium was observed in early August. Tunica albuginea diameter reached its maximum and minimum size in April and August, respectively. Lumen diameter increased in July and August. The maximum level of sperm production was on May (Fig. 5). The gonadal index (GI) increased from April to May and decreased from July to August (Fig. 6). There were significant differences in microscopic testicular characters between months (Table 3). One pair of light pink hemipenes are located at the base of the cloaca. Hemipenes are club-shaped and apex is subdivided into two lobes (Fig. 7). There is an internal, ossified structure named hemibacula in each hemipenis. Their mean length and width of right hemipenis were 3.97 and 2.40 mm and those of the left side were 3.91 and 2.55 mm, respectively. There were significant differences in hemipenal characters between months (Table 2). The maximum size of hemipenes was observed in April and May while the minimum size observed in July and August (Fig. 8). DISCUSSION Testicular histology showed that spermatogenesis of Teratoscincus bedriagai began in early April, reached its peak in early May, and ended between late July and mid August. The gonadal index (GI) increased during spring because the testis weight increased in regenerative phase after hibernation and body weight decreased during hibernation. GI decreased in summer because the testis weight was reduced as a result of the high reproductive activity in spring. The authors predict that GI will increase after August because the testis weight increases again due to entering to the silent and regenerative phase. The spermatogenic cycle of sympatric lizard, Caspian Bent-toed Gecko, Tenuidactylus caspius has been studied in northern parts of Iran and has showed the similar results (Hojati et al., 2013). Gonadal index of Tenuidactylus caspius increased from September

15 REPRODUCTIVE CYCLE OF THE BEDRIAGA'S PLATE-TAILED GECKO 11 TABLE 2. Descriptive statistics of macroscopic characters in Teratoscincus bedriagai (N=40). Characters Minimum Maximum Mean ± Std. Error Std. Deviation Sig. W (g) ± SVL (mm) ± LCD (mm) ± HL (mm) ± HW (mm) ± RTW (g) ± LTW (g) ± RTL (mm) ± LTL (mm) ± RTWi (mm) ± LTWi (mm) ± RTV (mm3) ± LTV (mm3) ± RHpL (mm) ± LHpL (mm) ± RHpW (mm) ± LHpW (mm) ± GI ± TABLE 3. Descriptive statistics of microscopic characters in Teratoscincus bedriagai (N=40). Characters Minimum Maximum Mean ± Std. Error Std. Deviation Sig. RTAD (µ) ± LTAD (µ) ± RSTN ± LSTN ± RSTD (µ) ± LSTD (µ) ± RGLD (µ) ± LGLD (µ) ± RLD (µ) ± LLD (µ) ± RSgN ± LSgN ± RSpN ± LSpN ± RStN ± LStN ± RSN ± LSN ±

16 12 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 FIGURE 2. Mean of Testis Length (TL) of Teratoscincus bedriagai from April to August FIGURE 3. Mean of testis weight (TW) of Teratoscincus bedriagai from April to August 2013.

17 13 REPRODUCTIVE CYCLE OF THE BEDRIAGA'S PLATE-TAILED GECKO FIGURE 4. Seminiferous tubules of Teratoscincus bedriagai. Spermatogonia, spermatocytes, spermatids and sperms are abundant on April (A) and May (B). Seminiferous epithelial heights and tubule diameters increase on May; and testes regression with germinal epithelium reduces on July (C) and August (D). All slides are shown at 400 magnificence SN Right 200 Left Apr 5-May 5-Jun 5-Jul 5-Augst FIGURE 5. Mean of sperm number (SN) of Teratoscincus bedriagai from April to August 2013.

18 14 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 FIGURE 6. Mean of gonadal index (GI) of Teratoscincus bedriagai from April to August FIGURE 7. Hemipenes of Teratoscincus bedriagai.

19 REPRODUCTIVE CYCLE OF THE BEDRIAGA'S PLATE-TAILED GECKO 15 FIGURE 8. Mean of hemipenis length (HpL) of Teratoscincus bedriagai from April to August to November and the peak of spermatogenesis was in May and June. All lizards of the study area hibernated from October or November to March. In T. bedriagai, most of testicular parameters were observed in minimum size in August. In comparison with other lizards of Iran, these two sympatric geckos, Teratoscincus bedriagai and Tenuidactylus caspius, start their reproductive activities earlier than other studied species. Hemipenal morphology in many geckos has long been described (Russell, 1977). Hemipenes in geckos are generally characterized by a club-shaped basal part consisting of pedicel and truncus that is followed by a voluminous apex with paired lobes. The hemipenes of some gekkonids such as Aristelliger and Uroplatus have internal supportive, calcified structures named hemibacula (Rösler & Böhme, 2006). This structure has been observed in T. bedriagai. Also, this ossified structure was observed in Tenuidactylus caspius (Hojati et al., 2013). Moreover, the female reproductive cycle of T. bedriagai was studied in this area and showed the synchronization between the ovarian and testicular activities. Mating occurs in spring, especially at the beginning of May, with oviposition occurring from late May to late July (Mojibi and Hojati, 2014). Approximately, 1 to 2 eggs are laid by females per clutch. The maximum ovarian activity takes place in May and continues with a little decreasing in June and more reduction in July and finally ends in August (Mojibi and Hojati, 2014). Since spermatogenesis of T. bedriagai occur from April to July, this species follows a seasonal and alternate reproductive cycle with associate type. LITERATURE CITED Anderson, S. C The Lizards of Iran. Society for the Study of Amphibians and Reptiles, Ithaca, New York.i-vii, 442 pp. Censky, E. J Reproduction in to lesser Antillean population of Ameiva plei (Teiidae). Journal of Herpetology 29: Gamble, T., Bauer, A. M., Greenbaum, E., Jackman, T. R Evidence for Gondwanan vicariance in an ancient clade of gecko lizards. Journal of Biogeography 35 (1):

20 16 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 Hojati, V., Kami, H. G., Faghiri, A., Ahmadzadeh, F A morphological study of the Bedriaga Plate-tailed Gecko, Teratoscincus bedriagai Nikolsky, 1900, in Semnan Province of Iran (Reptilia: Gekkonidae). Zoology in the Middle East 46: Hojati, V., Mojibi, F., Jahed Haghshenas, N A Preliminary Study on the Biology of the Bedriaga's Plate-tailed Gecko, Teratoscincus Bedriagai in Iran. Journal of Entomology and Zoology Studies, 2: Huang, W. S Reproductive Cycle of the Oviparious Lizard Japalura brevipes (Agamidae: Reptilia) in Taiwan, Republic of China. Journal of Herpetology 31: Jenssen, T. A., Nunez, S. C Male and female reproductive cycles of the Jamaican lizard, Anolis opalinus. Copeia Mojibi, F., Hojati, V The Female Reproductive Cycle of the Bedriaga's Plate-tailed Gecko, Teratoscincus bedriagai (Sauria: Gekkonidae) in Iran. International Journal of Zoology, 2014: 1-6. Pough, F. H., Andrews, R. M., Cadle, J. E., Crump, M. L., Savitzky, A. H., Wells, K. D Herpetology, Prentice Hall, Upper Saddle River, NJ, USA. Rösler, H., Böhme, W Peculiarities of the hemipenes of the gekkonid lizard genera Aristelliger Cope, 1861 and Uroplatus Duméril, Proceedings of the 13th Congress of the Societas Europea Herpetologica, pp Russell, A. P Comment concerning postcloacal bones in geckos (Reptilia: Gekkonidae). Canadian Journal of Zoology, 55: Smid, J., Moravec, J., Kodym, P., Kratochvil, L., Hosseinian Yousefkhani, S. S., Rasetar Pouyani, E Annotated checklist and distribution of the lizards of Iran. Zootaxa 3855 (1): Torki, F Spermatogenesis of the agama Trapelus lessonae in the central Zagros Mountains, Iran. Zoology in the Middle East, 38:

21 Iranian Journal of Animal Biosystematics (IJAB) Vol.11, No.1, 17-22, 2015 ISSN: X (print); (online) Sexual Size Dimorphism in Hyla savignyi Audouin, 1827 (Anura: Hylidae) from Kermanshah Province, Western Iran Rastegar-Pouyani, N a,b*, Fattahi, A a,b, Karamiani, R a,b, Takesh, M a,b a Department of Biology, Faculty of Science, Razi University, Kermanshah, Iran b Iranian Plateau Herpetology Research Group (IPHRG), Faculty of Science, Razi University, Kermanshah, Iran (Received: 23 April 2014; Accepted: 5 July 2014) We investigated sexual size dimorphism in the tree frog, Hyla savignyi using 33 males and 22 females from the western and northwestern regions of Kermanshah Province, western Iran. Out of sixteen measured morphometric characters, four were significantly larger in females than in males. These characters were nostril-eye length, brachium length, elbow-longest finger length and hind limb length. Key words: Hyla savignyi, sexual size dimorphism, Kermanshah Province, western Iran INTRODUCTION Sexual dimorphism in morphology is widespread among animals (Woolbright, 1983; Greenwood and Wheeler, 1985; Cooper and Vitt, 1989; Winquist and Lemon, 1994). The traditional explanation for morphological differences between the sexes is based on Darwin's (1871) theory of sexual selection. Sexual dimorphism is the outcome from a balance of many selective pressures differing between the sexes in strength and/or in direction. Sexual selection (acting via female choice or male male contest for mating opportunities), fecundity selection (leading to larger body size or body volume in females) and other factors such as natural selection acting to reduce intersexual resource competition and differential mortality between the sexes due to differences in longevity can all be potential causes of sexual dimorphism (Shine, 1989; Hews, 1990; Andersson, 1994; Olsson et al., 2002). Amphibians are an excellent group for investigating SSD, because of their great diversity of morphologies, habitats and life-histories (Shine, 1979). In the present study, sexual size dimorphism in a tree frog, Hyla savignyi, Audouin, 1827 was investigated and it was shown that there is a relatively clear pattern of dimorphism in the metric characters between the sexes. Based on our opinion, fecundity selection is a force which is behind the femalebiased SSD in Hyla savignyi. MATERIALS AND METHODS During March and July 2012, a total of 55 (33 and 22 ) adult specimens of Hyla savignyi were collected in the vicinity of Qhasr-e-Shirin (34º27 N 45º37 E) and Ravansar (34º42 N 46º36 E), in Kermanshah Province, western Iran. Sixteen metric traits were chosen to measure by digital caliper (±0.01 mm). Sex was determined by the presence of a vocal sac in males. Following collection, they were preserved in ethanol 75% and kept in the RUZM (Razi University Zoological Museum). The following metric characters were measured: From the tip of snout to the vent as the representative of length of body (SVL); the length of head measured axially to the *Corresponding Author: nasrullah.r@gmail.com 2015 FERDOWSI UNIVERSITY OF MASHHAD, IRAN

22 18 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 beginning of arms (HL); from the tip of snout to the anterior rim of the eye (SEL); the distance between the two nostrils (DN); from behind the nostril to the anterior rim of the eye (NEL); eye diameter measured horizontally (ED); Width of head at the widest part (WH); height of head at the widest part (HH); the distance between the eyes at their anterior ends (DE); from the base of the hand to the end of the longest finger as the representative of hand length (FLL), from the base of the hand to the elbow as the representative of brachium length (BL), from the elbow to the tip of the longest finger (EFL), from the base of leg to the knee as the representative of thigh length (LT), from the knee to the tip of the longest toe (KTL), from the base of leg to the tip of the longest toe as the representative of whole leg length (HLL), the length of trunk (TL) from rear of arms to end of body (Table 1). To determine the significance of sexual size dimorphism in Hyla savignyi, one-way ANOVA as well as Principal Component Analysis (PCA: correlation matrix) were applied. The SPSS statistical software (version 16) was used for the statistical analyses. Results were considered statistically significant at P RESULTS A One-Way ANOVA revealed significant differences between the sexes in four out of sixteen morphological characters. All the four metric characters have larger values in females than in males. These were the nostril-eye length (p = 0.001), brachium length (p = 0.04), elbow-longest finger length (p = 0.007) and hind limb length (p = 0.033). The values for these traits as well as direction of differences are summarized in Table 1. Further, multivariate analysis techniques including Principal Component Analysis (PCA) were carried out to identify the factors that statistically explain the patterns of discrimination between the sexes, which identify the characters that are mainly responsible for the observed variation. TABLE 1. Comparison of 16 morphological characters in males and females of Hyla savignyi. Std: standard deviation, D of d: Direction of difference. All measurements in millimeter (mm). Abbreviations: SVL (snout-vent length), HL (Head length), SEL (Snout-eye length), DN (Distance of nostrils), NEL (Nostril-eye length), ED (Eye diameter), WH (Width of head), HH (Height of head), DE (Distance of eyes), FLL (Front limb length), BL (Brachium length), EFL (Elbow-longest finger length), LT (Length of Thigh), KTL (Knee-toe length), HLL (Hind limb length), and TL (Trunk length). SEX SVL HL SEL DN NEL ED WH HH Mean (N=33) Std Mean (N=22) Std D. of d. F>M F>M F>M F>M F>M F>M F>M M>F p-value SEX DE FLL BL EFL LT KTL HLL TL Mean (N=33) Std Mean (N=22) Std D. of d. F>M F>M F>M F>M F>M F>M F>M F>M p-value

23 SEXUAL SIZE DIMORPHISM IN HYLA SAVIGNYI 19 TABLE 2. Loadings from a Principal Component Analysis of metric characters of Hyla savignyi. Abbreviations: NEL (snout-vent length), BL (length of tail), EFL (head length), HLL (head width). Variable PC1 PC2 NEL BL EFL HLL Eigenvalue % Variance Cumulative FIGURE 1. Ordination of the individual males and females of Hyla savignyi on the first two principal components. Note the relative degree of isolation between the sexes.

24 20 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 The first two PCA factors jointly explain of total information (Table 2). Of this, is explained by the PC1 and by the PC2 (Fig. 1 and Table 2). For calculating the eigenvalues, the four significant variables entered into the analysis including NEL, BL, EFL and HLL showed maximum (p = 0.782) and minimum (p = 0.707) participation in the PC1. Furthermore, the maximum (p = 0.580) and minimum (p = 0.232) participation in the PC2 are devoted to EFL and BL, respectively (Table 2). DISCUSSION Such sexual size dimorphism (SSD) as observed here is the evolutionary result of selection acting differently on body size and the rest of male and female traits (Andersson, 1994). Several hypotheses have been proposed to explain the interspecific variation in SSD (reviewed in Shine, 1989; Andersson, 1994; Blanckenhorn, 2005). First, increased female body size relative to male size (female-biased SSD) may be the result of selection for fecundity (Andersson, 1994; Sandercock, 2001; Shine, 1979, 1989). Second, if resources are scarce and differential exploitation between the sexes arises, then changes in morphology and body size may follow in species (Shine, 1989; Sandercock, 2001; Temeles and Kress, 2003). Third, sexual selection acting on either sex may select for SSD (Raihani et al., 2006). For instance, male-male competition may favour large body size in males of those species in which males compete intensely for females (Mitani et al., 1996; Dunn et al., 2001; Lindenfors et al., 2003; Raihani et al., 2006). Thus, large size may be advantageous for males in polygynous species (Clutton-Brock and Harvey, 1977; Owens and Hartley, 1998). Finally, the selective advantage of body size may depend on whether the competition occurs on the ground or in the air (Payne, 1984; Jehl and Murray, 1986). If males compete or display in the air then small male size may be advantageous (Andersson and Norberg, 1981; Blomqvist et al., 1997; Székely et al., 2000, 2004; Serrano-Meneses and Székely, 2006), whereas large size may be beneficial in those species where males display or compete on the ground (Clutton-Brock et al., 1982; Anderson and Fedak, 1985; Lindenfors and Tullberg, 1998). These selection processes may be reinforced via female choice (reviewed in Thornhill and Alcock, 1983; Choe and Crespi, 1997). To our idea, the best fit for explanation of the SSD in Hyla savignyi is the first hypothesis (fecundity selection) in which higher reproductive success in females is related to their larger body size relative to the males. ACKNOWLEDGMENTS We thank the field drivers, Sabzali Rasooli and Hormoz Nematzadeh, who helped us very much during field work in western Iran. Also, we thank Mohammad Reza Ashrafi Kooshk for his help in preparation of the manuscript. LITERATURE CITED Anderson, S.S., Fedak M.F., Grey seal males: energetic and behavioral links between size and sexual success. Animal Behaviour 33, Andersson, M., Sexual Selection. Princeton University Press, Princeton, NJ. Andersson, M., Norberg, R.A., Evolution of reversed sexual size dimorphism and role partitioning among raptors, with a size scaling of flight performance. Biological Journal of the Linnean Society 15,

25 SEXUAL SIZE DIMORPHISM IN HYLA SAVIGNYI 21 Audouin, V., [1827] Explication sommaire des planches de reptiles (supplément), publiées par Jules-César Savigny, membre de l Institut; offrant un exposé des caractères naturels des genres, avec la distinction des espèces. In: Description de l Égypte. Histoire naturelle, Vol. 1. Paris: Imprimerie Impériale, Blanckenhorn, W.U., Behavioral causes and consequences of sexual size dimorphism. Ethology 111, Blomqvist, D., Johansson, O.C., Unger, U., Larsson, M., Flodin, L.A., Male aerial display and reversed sexual size dimorphism in the dunlin. Animal Behaviour 54, Choe, J.C, Crespi, B.J., Mating Systems in Insects and Arachnids. Cambridge: Cambridge University Press. Clutton-Brock, T.H., Harvey, P.H., Primate ecology and social organization. Journal of Zoology 183, Clutton-Brock, T.H., Guinness, F.E., Albon, S.D., Red Deer: Behavior and Ecology of Two Sexes. Chicago: University of Chicago Press. Cooper, W.E., Vitt, L.J., Sexual dimorphism of head and body size in an iguanid lizard: paradoxical results. American Naturalist 133, Darwin, C., The Descent of Man, and Selection in Relation to Sex. John Murray, London. Volume 1:423 pp.,volume 2, 476 pp. Dunn, P.O., Whittingham, L.A., Pitcher, T.E., Mating systems, sperm competition and the evolution of sexual size dimorphism in birds. Evolution 55, Greenwood, P.J., Wheeler, P., The evolution of sexual size dimorphism in birds and mammals: a hot blooded hypothesis. In: Greenwood, P.J., Harvey, P.H., Slatkin, M. (Eds.), Evolution. Essays in Honour of John Maynard Smith. Cambridge University Press, Cambridge pp. Mitani, J.C., Gros-Luis, J., Richards, A.F., Sexual dimorphism, the operational sex ratio, and the intensity of male competition in polygynous primates. American Naturalist 147, Hews, D.K., Examining hypotheses generated by field measures of sexual selection on male lizards, Uta palmer. Evolution 44, Jehl, J.R., Murray, B.G., The evolution of normal and reverse sexual size dimorphism in shorebirds and other birds. In: Current Ornithology. Vol. 3 (Ed. by R. F. Johnston), pp New York: Plenum. Lindenfors, P., Tullberg, B.S., Phylogenetic analyses of primate size evolution: the consequences of sexual selection. Biological Journal of the Linnean Society 64,

26 22 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 Lindenfors, P., Székely, T., Reynolds, J.D., Directional changes in sexual size dimorphism in shorebirds, gulls and alcids. Journal of Evolutionary Biology 16, Olsson, M., Shine, R., Wapstra, E., Ujvari, B., Madsen, T., Sexual dimorphism in lizard body shape: the roles of sexual selection and fecundity selection. Evolution 56, Owens, I.P.F., Hartley, I.R., Sexual dimorphism in birds: why are there so many different forms of dimorphism? Proceedings of the Royal Society of London, Series B 265, Payne, R.B., Sexual Selection, Lek and Arena Behavior, and Sexual Size Dimorphism in Birds. Washington, D.C.: American Ornithologists Union. Raihani, G., Székely, T., Serrano-Meneses, M.A., Pitra, P., Goriup, P., The influence of sexual selection and male agility on sexual size dimorphism in bustards (Otididae). Animal Behaviour 71, Sandercock, B.K., What is the relative importance of sexual selection and ecological processes in the evolution of sexual size dimorphism in monogamous shorebirds? Wader Study Group Bulletin 96, Serrano-Meneses, M.A., Székely, T., Sexual size dimorphism in seabirds: sexual selection, fecundity selection and differential niche-utilization. Oikos 113, Shine, R., Sexual selection and sexual dimorphism in the amphibia. Copeia 2, Shine, R., Ecological causes for the evolution of sexual size dimorphism: a review of the evidence. Quarterly Review of Biology 64, Székely, T., Reynolds, J.D., Figuerola, J., Sexual size dimorphism in shorebirds, gulls, and alcids: the influence of sexual and natural selection. Evolution 54, Székely, T., Freckleton, R.P., Reynolds, J.D., Sexual selection explains Rensch s rule of size dimorphism in shorebirds. Proceedings of the Natural Academy of Sciences, U.S.A 101, Temeles, E.J., Kress, W.J., Adaptation in a plant and humming-bird association. Science 300, Thornhill, R., Alcock, J., The Evolution of Insect Mating Systems. Cambridge, Massachusetts: Harvard University Press. Winquist, T., Lemon, R.E., Sexual selection and exaggerated male tail length in birds. American Naturalist 143, Woolbright, L.L., Sexual selection and size dimorphism in anuran amphibians. American Naturalist 121,

27 Iranian Journal of Animal Biosystematics (IJAB) Vol.11, No.1, 23-31, 2015 ISSN: X (print); (online) Annotated checklist of amphibians and reptiles of Qom Province, central Iran Kazemi, S. M. a,b *, Rastegar-Pouyani, E. c, Shafiei Darabi, S. A. d, Ebrahim Tehrani, M. e, Hosseinzadeh, M. S. f, Mobaraki, A. e & Mashayekhi, M. g a Department of Biology, College of Sciences, Qom Branch, Islamic Azad University, Qom, Iran b Zagros Herpetological Institute, , P. O. No 12, Somayyeh 14 Avenue, Qom, Iran c Department of Biology, Faculty of Science, Hakim Sabzevari University, Sabzevar, Iran d Department of Plant physiology, Faculty of Biology, Isfahan University, Isfahan, Iran e Department of Environment, Biodiversity and Wildlife Bureau, Tehran, Iran f Department of Biology, Faculty of science, Ferdowsi University of Mashhad, Mashhad, Iran g Department of Environment and Energy, Science and Research branch, Islamic Azad University, Tehran, Iran (Received: 21 July 2014; Accepted: 10 February 2015) The updated checklist of amphibians and reptiles of Qom Province, Central Iran is presented. Totally 46 species, 35 genera and 17 families of reptiles and amphibians are reported in the area. The most diverse suborder is serpentes with 19 species or 41.3% of the reptile species richness of the region. The most specious families with high diversification are ranked respectively: Colubridae with 11 species (23.91%), Agamidae (seven species, 15.21%), Lacertidae and Gekkonidae (each of which with five species, 10.86%), Scincidae (four species, 8.69%), Natricidae and Viperidae (each of which with two species, 4.3%), Bufonidae, Ranidae, Geoemydidae, Testudinidae, Anguidae, Varanidae, Typhlopidae, Erycidae, Lamprophiidae and Psammophiidae with a single species of each. Key words: Herpetofauna, Qom, type species, record, taxon. INTRODUCTION The Qom Province covers a land area of about 11,340 km² (0.6% of total area of Iran), it is located between latitudes N and longitudes E. The region is bordered to the north by Tehran Province, to the south by Isfahan Province, to the west by Markazi Province, and to the east by Semnan Province. The elevation range in the Qom province extends from 800 m in the eastern parts to about 3330 m in the southern parts (Velija Mountain). However, Ahmadzadeh et al. (2008) reported biodiversity of lizards in Qom province. The comprehensive faunistic study has been carried out on the herpetofauna of Qom Province, including all species of reptiles and amphibians, by Rastegar-Pouyani (2010). Additionally, Ebrahimi et al. (2013) studied the effects of environmental factors on lizard habitat selectivity in the Qom Province using 15 species of lizard. In hence, in this paper we prepared a revised and updated checklist of amphibians and reptiles in the Qom Province. *Corresponding Author: Kazemi_m1979@yahoo.com 2015 FERDOWSI UNIVERSITY OF MASHHAD, IRAN

28 24 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 MATERIALS AND METHODS This update checklist has been prepared based on all previous works done on the amphibians and reptiles fauna of Qom Province (e.g Ahmadzadeh et al., 2008; Rastegar-pouyani, 2010; Ebrahimi et al., 2013) and also by examination of material from various herpetological collections as well as several field expeditions during in the Qom Province. RESULTS Taxonomic Account Family Bufonidae Gray, 1825 Genus Bufotes Rafinesque, 1815 Comment: Bufo Laurenti, 1768 (Type species: Bufo viridis Laurenti, 1768 by subsequent designation of Tschudi, 1838). Bufotes variabilis variabilis (Pallas, 1769) Type locality: Lübeck, Germany. Family Ranidae Rafinesque, 1814 Genus Pelophylax Fitzinger, 1843 Comment: Pelophylax Fitzinger, 1843 (Type species: Rana esculenta Linneus, 1758, by original designation). Pelophylax ridibundus (Pallas, 1771) Pelophylax ridibunda ridibunda (Pallas, 1771) Type locality: Gurjev, north coast of Caspian Sea. Family Geoemydidae Theobald, 1868 Genus Mauremys Gray, 1869 Comments: Mauremys Gray, 1869 subsequently designated type species (Lindholm, 1929). Mauremys fulignosa (Gray, 1860) is a synonym of Mauremys leprosa leprosa (Schweigger, 1812). Mauremys caspica siebenrocki Wischuf and Fritz, 1997 Type locality: Basrah, Iraq. Family Testudinidae Batsch, 1788 Genus Testudo Linnaeus, 1758 Comments: Testudo Linnaeus, 1758 subsequently designated type species (Fitzinger, 1843). Testudo graeca Linnaeus, 1758 and Testudo graeca graeca Linnaeus, 1758 are synonymous. Testudo graeca buxtoni Boulenger, Type locality: Manjil, between Rasht and Qazvin, Iran. Comments: Testudo perses Perälä, 2002 and T. g. buxtoni are synonyms (Fritz et al., 2007). The other Iranian subspecies is Testudo graeca zarudnyi Nikolsky, 1896 (Rastegar-Pouyani et al., 2008). Family Agamidae Spix, 1825 Genus Laudakia Gray, 1845 Comment: Laudakia Gray, 1845 (Type species: Agama tuberculata Hardwicke and Gray, 1827, by monotypy). Laudakia nupta nupta (De Filippi, 1843) Type locality: Persepolis, Fars, Iran. Genus Paralaudakia Baig, Wagner, Ananjeva and Böhme 2012 Comment: Paralaudakia Baig, Wagner, Ananjeva and Böhme, 2012 (Type species: Stellio caucasius Eichwald, 1831).

29 CHECKLIST OF HERPETOFAUNA OF QOM PROVINCE 25 Paralaudakia caucasia caucasia (Eichwald, 1831) Type locality: Moghan Steppe. Genus Phrynocephalus Kaup, 1825 Commen: Phrynocephalus Kaup, 1825 (Type species: Lacerta caudivolvula Pallas, is synonymous with Lacerta guttata Gmelin, 1789), by subsequent designation of Fitzinger, Phrynocephalus maculatus maculatus Anderson, 1872 Type locality: Abadeh in north of Shiraz, Fars, Iran. Phrynocephalus persicus De Filippi, 1863 Type locality: along route between Armenia and Tehran, Iran. Phrynocephalus scutellatus (Olivier, 1807) Type locality: Sophia Mountain, near Esfahan, Esfahan, Iran. Genus Trapelus Cuvier, 1816 Comments: Trapelus Cuvier, 1817 (1816) (Type species: Changeant d Egypte Geoffrroy = Agama mutabilis Merrem 1820, by monotypy). Trapelus agilis agilis (Olivier, 1804) Type locality: Neighborhood of Baghdad, Iraq. Trapelus ruderatus (Olivier, 1804) Type locality: Near Esfahan, Esfahan, Iran. Comments: The taxon formerly identified as T. lessonae (Rasyegar-Pouyani, 2000) but Ananjeva et al. (2013) changed its nomenclature to T. ruderatus. Family Anguidae Gray, 1825 Genus Pseudopus Merrem, 1820 Comments: Pseudopus Merrem, 1820 (Type species: Pseudopus apodus Pallas, 1775). With regard to occurrence of this species in humid habitats, reporting of this species in the Qom province with arid climate is enigmatic. Two specimens of the species have been reported from Mujan and Veshareh villages (50 12 E, N). It seems human introduction such as maintaining pets probably have a major role to record the species in the Qom province. Pseudopus apodus apodus (Pallas, 1775) Type locality: Naryn Steppe, Russia, on north coast of Caspian Sea. Family Gekkonidae Gray, 1825 Genus Agamura Blanford, 1874 Comment: Agamura Blanford, 1874 (Type species: Gymnodactylus persicus Duméril, 1856, by subsequent designation of Smith, 1935). Agamura persica (Duméril, 1856) Type locality: Persia (=Iran). Genus Bunopus Blanford, 1874 Comment: Bunopus Blanford, 1874 (Type species: Bunopus tuberculatus Blanford, 1874, by monotypy). Bunopus crassicaudus Nikolsky, 1907 Type locality: Kum (=Qom), Iran Genus Cyrtopodion Fitzinger, 1843 Comment: Cyrtopodion Fitzinger, 1827 (Type species: Stenodactylus scaber Heyden in Rüppell, 1827, by original designation). Cyrtopodion scabrum (Heyden, 1827)

30 26 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 Type locality: Tor, Sinai, Egypt. Genus Tenuidactylus Szczerbak and Golubev, 1894 Comment: Tenuidactylus Szczerbak and Golubev, 1894 (type species: Gymnodactylus caspius Eichwald, 1831). Tenuidactylus caspium caspium (Eichwald, 1831) Type locality: Baku (Azerbaijan). Genus Microgecko Nikolsky, 1907 Comments: Microgecko Nikolsky, 1907 (Type species: Microgecko helenae Nikolsky, 1907). Formerly, the species is located in the genus Tropiocolotes Peters, 1880 but Sindaco and Jeremčenko (2008) positioned following species: helenae, latifi and persicus in the genus Microgecko Nikolsky, Microgecko latifi (Leviton and Anderson, 1972) Type locality: Kerman, Kerman Province, Iran. Family Lacertidae Bonaparte, 1831 Genus Eremias Fitzinger, 1834 Comments: Eremias Fitzinger in Wiegmann, 1834 (Type species: Lacerta variabilis Pallas, 1827 is a synonymous with E. arguta (Pallas), 1773, by subsequent designation of Fitzinger, 1843). Eremias fasciata Balnford, 1874 Type locality: Said abad, Southwest of Kerman, Iran (for more details see Ebrahimi et al., 2013). Eremias persica Blanford, 1875 Type locality: Near Esfahan, Esfahan Province, Iran. Eremias velox velox (Pallas, 1771) Type locality: Inderskiensem, Ghazaghistan. Genus Mesalina Gray, 1838 Comment: Mesalina Gray, 1838 (Type species: Mesalina Lichtensteinii Gray, 1838 is synonymous with Lacerta rubropunctata Lichtenstein, 1823). Mesalina watsonana (Stoliczka, 1872) Type locality: Sind, between Karachi and Sukkur, Pakistan. Genus Ophisops Ménétriés, 1832 Comment: Ophisops elegans Ménétriés, 1832 (Type species: Ophisops elegans Ménétriés, 1832, by monotypy). Ophisops elegans Ménétriés, 1832 Type locality: vicinity of Baku, Azerbaijan. Family Scincidae Oppel, 1811 Genus Ablepharus Fitzinger, 1823 Comments: Ablepharus Fitzinger in Lichtenstein in Eversmann, 1823 (Type species: Ablepharus pannonicus Fitzinger in Lichtenstein in Eversmann, 1823, by monotypy). Ablepharus pannonicus Fitzinger, 1823 Type locality: Bokhara, Uzbekistan. Genus Eumeces Wiegmann, 1834 Comments: Eumeces Wiegmann, 1834 (Type species: Scincus pavimentatus Geoffroy St. Hilaire, 1827 and Scincus schneiderii Daudin, 1802 are synonyms by subsequent designation of Wiegmann, 1835).

31 CHECKLIST OF HERPETOFAUNA OF QOM PROVINCE 27 Eumeces schneiderii princeps (Eichwald, 1839) Type locality: Talysh Mountains, Azerbaijan. Genus Ophiomorus Duméril and Bibron, 1839 Comment: Ophiomorus Duméril and Bibron, 1839, 1839 (Type species: Ophiomorus millaris Duméril & Bibron, 1839, by monotypy). Ophiomorus nuchalis Nilson and Andrén, 1978 Type locality: Siah kuh, Kavir Protected region, Tehran, Iran (for more detail See Farhadi-Qomi, 2011). Genus Trachylepis Fitzinger, 1843 Comment: Trachylepis Fitzinger, 1843 (Type species: Euprepes savignyi Duméril & Bibron, 1839 is a synonym of Scincus quinquetaeniatus Lichtenstein, 1823). Members of this genus were previously placed in genus Mabuya Fitzinger, 1826 (for more details see Mausfeld et al., 2002; Mausfeld & Schmidtz, 2003; Bauer, 2003). Trachylepis septemtaeniata (Reuss, 1834) Type locality: Massua, Abyssinien (Massawa, Eritrea). Family Varanidae Gray, 1827 Genus Varanus Merrem, 1820 Comment: Varanus Merrem, 1820 (Type species: Lacerta varia White, 1790 by subsequent designation of Gray, 1827). Varanus griseus caspius Eichwald, 1831 Type locality: Dardscha Peninsula, east of Caspian Sea. Family Typhlopidae Merrem, 1820 Genus Xerotyphlops Hedges, Marion1, Lipp, Marin and Vidal, 2014 Comment: Xerotyphlops Hedges, Marion1, Lipp, Marin and Vidal, 2014 (Type species: Typhlops vermicularis Merrem, 1820). Xerotyphlops vermicularis (Merrem, 1820) Type locality: restricted to Greek Islands by Mertens and Müller, 1928 (for more details see Rastegar-Pouyani, 2010). Family Erycidae Bonaparte 1831 Comments: The family formerly considered Boidae (Gray, 1825) but Pyron et al. (2013) revised the taxon and change the name to Erycidae. Genus Eryx Daudin, 1803 Comments: Eryx Daudin, 1803 (Type species: Boa turcica Olivier, 1801= Eryx jaculus turcicus (Olivier, 1801) by subsequent designation by Fitzinger, 1843). Eryx c.f jaculus turcicus (Olivier, 1801) Type locality: Egypt. Family Colubridae Oppel, 1811 Genus Eirenis Jan, 1863 Comments: Eirenis Jan, 1863 (Type species: Coluber collaris Menetries, l832 by subsequent designation by Smith, 1943). Eirenis punctatolineatus punctatolineatus (Boettger, 1892) Type locality: Russisch- Armenia.

32 28 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 Eirenis persicus (Anderson, 1872) Type locality: Bushehr, Bushehr Province, Iran. Genus Hemorrhois Boie, 1826 Comment: Hemorrhois Boie, 1826 (Type species: Coluber hippocrepis Linnaeus, 1754, by original designation). Hemorrhois ravergieri (Ménétriés, 1832) Type locality: Baku, Azerbaijan. Genus Lytorhynchus Peters, 1862 Comments: Lytorhynchus Peters, 1862 (Type species: Heterodon diadema Durntril, Bibron and Dumtril, 1854 by monotypy). Lytorhynchus ridgewayi Boulenger, 1887 Type locality: Chinkilok, Afghanistan Genus Platyceps Blyth, 1860 Comment: Platyceps Blyth, 1860 (Type species: by monotypy, Platyceps subfasciatus Blyth = Coluber ventromaculatus Gray). Platyceps karelini karelini (Brandt, 1836) Type locality: borders of Caspian Sea. Platyceps najadum najadum (Eichwald, 1831) Type locality: Baku, Azerbaijan. Comments: Formerly, members of this genus were considered genus Coluber Linnaeus, Coluber najadum najadum (Eichwald, 1831). Latifi (2000) recorded P.najadum Dahli that was probably confusion with P. najadum najadum and then the taxon excluded in the Iranian herpetofauna (Rastegar-Pouyani et al., 2008). P. najadum dahli is distributed in Croatia, Montenegro, Bulgaria, Greece and east through Turkey, Syria and Iraq. Platyceps rhodorachis rhodorachis (Jan, 1865) Type locality: Persia (Iran), restricted to Schiras (Shiraz), Krammer and Schnurrenberger, Platyceps ventromaculatus ventromaculatus (Gray, 1834) Type locality: not stated. Genus Spalerosophis Jan in De Filippi, 1865 Comment: Chilolepis Fitzinger, 1843 (Type species: Coluber cliffordii Schlegel, 1837 is synonymous with Spalerosophis diadema cliffordi). Spalerosophis Jan in De Filippi, 1865 (Type species: Sphalerosophis microlepis by original designation). Spalerosophis microlepis Jan, 1865 Type locality: Larestan, Iran. Spalerosophis diadema cliffordii (Schlegel, 1837) Type locality: Tripoli, Lybia. Genus Telescopus Wagler, 1830 Comments: Telescopus Wagler, 1830 (Type species: Coluber dhara Forskal, 1775 is a synonym of Telescopus obtusus Reuss, 1834 by subsequent designation of Merten and Muller (1940). Telescopus rhinopoma (Blanford, 1874) Type locality: Kerman, Iran (for more details see Rastegar-Pouyani, 2010).

33 CHECKLIST OF HERPETOFAUNA OF QOM PROVINCE 29 Family Natricidae Bonaparte, 1838 Genus Natrix Laurenti, 1768 Comments: Natrix Laurenti, 1768 (Type species: Natrix vulgaris Laurenti, 1768 is a synonym of Coluber natrix Linnaeus, 1758) by designation by Stejneger (1936). Natrix natrix natrix (Linnaeus, 1758) Type locality: Europe, Sweden (for more details see Kazemi & Rajabizadeh, 2007). Natrix tessellata tessellata (Laurenti, 1768) Type locality: in Japidia (= Lapydia), vulgo Cars (= alpain meadow), (probably Italy). Family Lamprophiidae Fitzinger, 1843 Genus Malpolon Fitzinger, 1826 Comments: Malpolon Fitzinger, 1826 (Type species: Natrix lacertina Wagler in Spix, 1824 = Malpolon monspessulana (Hermann, 1804) based on subsequent designation of Mertens and Muller (1928). Malpolon insignitus (Geoffroy Saint- Hilaire, 1827) Type locality: "Egypte' (= Egypt) (For more details see Kazemi & Rajabizadeh, 2007; Rastegar- Pouyani, 2010). Family Psammophiidae Bonaparte, 1845 Genus Psammophis Fitzinger, 1826 Comments: Psammophis Boie, 1826 (Type species: Coluber sibilans Linnaeus 1758 by monotypy). Psammophis schokari (Forsskål, 1775) Type locality: Yemen. Family Viperidae Laurenti, 1768 Genus Macrovipera Reuss, 1927 Comments: Macrovipera Reuss, 1927 (Type species: Coluber lebetinus Linnaeus, 1758 (revised nomenclature is Macrovipera lebetina (Linnaeus, 1758) by original designation). Macrovipera lebetina cernovi (Chikin et Szczerbak, 1992) Type locality: Bank of the river Murghab in the vicinity of town Lolotan, Marijsky district, Turkmenista. Comments: Six subspecies of M. lebetina has been reported by Ananjeva et al. (2006). The subspecies, M. lebetina cernovi occurs in eastern part of Iran (Chikin et Szczerbak, 1992). According to Sindaco et al. (2013) M. lebetina peilei is synonymous with M. lebetina cernovi. Genus Pseudocerastes Boulenger, 1896 Comment: Pseudocerastes Boulenger, 1896 (Type species: Cerastes persicus Dumeril, Bibron & Bibron 1854, by monotypy). Pseudocerastes persicus (Duméril, Bibron, & Duméril, 1854) Type locality: Persia (= Iran). DISCUSSION According to our results, the Qom Province contains a large number of the Iranian herpetofuana whereas the Qom Province is the smallest province of Iran. This is a first comprehensive research of different taxa of amphibians and reptiles in the Qom Province. More supplementary studies to investigate more biological, biogeographical and historical aspects of the herpetofauna are needed.

34 30 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 LITERATURE CITED Ahmadzadeh, F., Abdoli, A., Mostafavi, H., Ebrahimi, M. & Mehrabian, A.R., The lizard biodiversity of Qom province. Journal of Environmental Studies, 34 (46), Ananjeva, N. B., Orlov, N. L., Khalikov, R. G., Darevsky, I. S., Ryabov, S. A., Barabanov, A. V., The Reptiles of Northern Eurasia: Taxonomic Diversity, Distribution, Conservation Status. Zoological Institute of the Russian Academy of Sciences, Saint-Petersburg. Ananjeva, N. B., David, P., Barabanov, A. V., Dubois, A., On the type specimens of Trapelus ruderatus (Olivier, 1804) and some nomenclatural problems on Trapelus Cuvier, 1816 (Agamidae, Sauria). Russian Journal of Herpetology, 20, Anderson, S. C., The Lizards of Iran. Society for the Study of Amphibians and Reptiles, NY. Baig, K. J., Bohme, W., Ananjeva, N. B., Wagner, P., A morphology-based taxonomic revision of Laudakia Gray, 1845 (Squamata: Agamidae). Vertebrate Zoology 62(2), Baloutch, M., Kami, H. G., Amphibians of Iran. Tehran University Publications, Tehran, Iran (In Persian). Bauer, A. M., On the identity of Lacerta punctatus Linnaeus, 1758, the type species of the genus Euprepis Wagler, 1830, and the generic assignment of Afro-Malagasy skinks. African Journal of Herpetology 52(1), 1-7. Ebrahimi, M., Ahmadzadeh, F., Mostafavi, H., Mehrabian, A. R., Abdoli, A., Mahini, A. S., The Ecological Associations of Surface-Dwelling Lizards in Qom Province in the Northwest of Central Plateau of Iran. PLoS ONE, 8, e doi: /journal.pone Farhadi-Qomi, M., Some biological characteristics of the lizard Ophiomorus nuchalis in the provinces of Qom, Tehran and Isfahan. MSc thesis, Islamic Azad University, Damghan, Iran. Fritz, U., Ayaz, D., Buschbom, J., Kami, H. G., Mazanaeva, L. F., Aloufi, A. A., Auer, M., Rifai, L., Šilić, T., Hundsdörfer, A. K., Go east: phylogeographies of Mauremys caspica and M. rivulata discordance of morphology, mitochondrial and nuclear genomic markers and rare hybridization. Journal of Evolutionary Biology 21, Fritz, U., Hundsdörfer, A. K., Široký, P., Auer, M., Kami, H. G., Lehmann, J., Mazanaeva, L. F., Türkozan, O., Wink, M., Phenotypic plasticity leads to incongruence between morphologybased taxonomy and genetic differentiation in western Palaearctic tortoises (Testudo graeca complex; Testudines, Testudinidae). Amphibia-Reptilia 28, Kazemi, M., Rajabizadeh, M., A report on snake fauna of western part of Ghom Province, Iran. Proceedings of the 2th National Congress of Animal Science; 15 Sep 2007, Gilan, Iran. Latifi, M., The Snakes of Iran, 3nd edn. Iran Department of the Environment, Tehran (In Persian).

35 CHECKLIST OF HERPETOFAUNA OF QOM PROVINCE 31 Leviton, A. E., Anderson, S. C., Adler, K., Minton, S. A., Handbook to Middle East Amphibians and Reptiles. Society for the Study of Amphibians and Reptiles, Oxford, Ohio, USA. Mausfeld, P., Schmitz, A., Molecular phylogeography, intraspecific variation and speciation of the Asian scincid lizard genus Eutropis Fitzinger, 1843 (Squamata: Reptilia: Scincidae): taxonomic and biogeographic implications. Organisms Diversity and Evolution 3(3), Mausfeld, P., Schmitz, A., Böhme, W., Misof, B., Vrcibradic, D., Rocha, C. F. D., Phylogenetic affinities of Mabuya atlantica Schmidt, 1945, endemic to the Atlantic Ocean Archipelago of Fernando de Noronha (Brazil): Necessity of partitioning the genus Mabuya Fitzinger, 1826 (Scincidae: Lygosominae). Zoologischer Anzeiger 241, Nilson, G., Andrén, C., A new species of Ophiomorus (Sauria: Scincidae) from Kavir Desert, Iran. Copeia 4, Nilson, G., Andrén, C., Die Herpetofauna des Kavir-Schutzgebietes, Kavir-Wüste, Iran. Salamandra 17(3-4), Parham, J. F., Türkozan, O., Stuart, B. L., Arakelyan, M., Shafei, S., Macey, J. R., Werner, Y. L., Papenfuss, T. J., Genetic evidence for premature taxonomic inflation in Middle Eastern Tortoises. Proceedings of the California Academy of Sciences 4, 57(33), Pyron, R. A., Reynolds, R. G., Burbrink, F. T., A Taxonomic Revision of Boas(Serpentes: Boidae). Zootaxa 3846 (2), Rastegar-Pouyani, E., Atlas Reptiles and Amphibians of Qom. (In Persian). Sabzevar Tarbiat Moallem university press. Rastegar-Pouyani, N., Analysis of geographic variation in the Trapelus agilis complex (Sauria: Agamidae). Zoology in the Middle East 19, Rastegar-Pouyani, N., Taxonomic status of Trapelus ruderatus (Olivier) and T. persicus (Blanford), and validity of T. lessonae (De Filippi). Amphibia-Repitilia 21, Rastegar-Pouyani, N., Johari, M., Rastegar-Pouyani, E., Field Guide to the Reptiles of Iran. Volume 1: Lizards. 2nd edn, Razi University Press (In Persian). Rastegar-Pouyani, N., Kami, H. G., Rajabzadeh, M., Shafiei, S., Anderson, S. C., Annotated Checklist of Amphibians and Reptiles of Iran. Iranian Journal of Animal Biosystematics 4(1), Sindaco, R., Jeremčenko, V. K., The reptiles of the western Palearctic. Monografie della Societas Herpetologica Italica Vol. I. Edizioni Belvedere, Latina, Italy. Sindaco, R., Venchi, A., Grieco, C., The Reptiles of the Western Palearctic, Volume 2: Annotated Checklist and Distributional Atlas of the Snakes of Europe, North Africa, Middle East and Central Asia, with an Update to Volume 1. Monografie della Societas Herpetologica Italica. II. Edizioni Belvedere, Latina.

36

37 Iranian Journal of Animal Biosystematics (IJAB) Vol.11, No.1, 33-42, 2015 ISSN: X (print); (online) On the short-horned grasshopper (Orthoptera: Caelifera) fauna of northeastern Iran with some information on sweep sampling capture rates Jabbari, A. a, Modarres Awal a, M., Fekrat a, L., Karimi, J. a & Rashki, M. b a Department of Plant Protection, Faculty of Agriculture, Fedrowsi University of Mashhad, Mashhad, Iran b Department of Biodiversity, Institute of Science and High Technology and Environmental Sciences, Graduate University of Advanced Technology, Kerman, Iran. (Received: 5 December 2014; Accepted: 19 April 2015) In order to improve the knowledge of the Caelifera species of north-eastern Iran, faunistic investigations on grasshoppers of this region were carried out during Collected specimens as well as deposited specimens in Insect Museum of Ferdowsi University of Mashhad were examined, in detail. Totally 19 species belonging to 17 genera, 9 subfamilies and three families were collected and determined. Among them Paranocarodes straubei is newly recorded for the fauna of Iran. In addition to faunistic records, differences in species diversity and captured numbers upon times of day were investigated via sweep sampling at two rangeland sites during There were no significant differences among capture rates in various day hours; so standardized grasshopper sampling could be done between the hours of 8:00 and 16:00 to generate consistent estimates of rangeland grasshopper densities. Key words: Caelifera, faunistic, Iran, Khorasan-e-Razavi, sampling, sweep net. INTRODUCTION Iran is a country with various geographic, climatic and vegetative zones which confluence of them has endowed a suitable platform for a rich and diverse faunal assemblage in this country. The Orthoptera are common and well known group of insects which can be found in various habitats throughout Iran. Many studies on orthopteroids and specially grasshoppers have enhanced faunistic knowledge of this order in this country (Alexandrov, 1947; Bey-Bienko, 1957, 1960; Descamps, 1967; Dirsh & Mirzayans, 1971; Azemayeshfard, 1974, 1975, 1983, 1990, 1991; Cejchan, 1974; Dirsh & Uvarov, 1957; Mirzayans 1951, 1959, 1990, 1991, 1998; Neyestanak, 2000 a,b,c; Garai, 2010, 2011). In comparison to other parts of Iran, a little work has been done on the fauna of grasshoppers in northeastern parts of Iran. Khorasan provinces were not studied well and the current research is thus focused on the mentioned area to determine species of short horned grasshoppers in this region which has specific ecological characteristics for its diversity on climatic perspective with rich fauna and flora. Because of the potential of most of the grasshoppers to cause economic damage, these insects are monitored in various provinces of Iran by ministry of agriculture annually to determine their potential for outbreaks (Taleban Fard and Shariati, 2010). So, the accurate estimates of their density *Corresponding Author: fekrat@ferdowsi.um.ac.ir 2015 FERDOWSI UNIVERSITY OF MASHHAD, IRAN

38 34 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 have a tremendous effect on determination of management strategies especially the need for treatment. Despite the variability of methods of estimating grasshopper numbers, sweep sampling is the most common because of its cost-effectiveness as well as relatively rapid speed of assessment (Gardiner et al., 2005). Until now, sweep sampling has been used in several studies in order to estimate the population of grasshoppers in various times of day (Estano and Shepard, 1988; Whipple et al., 2010), but no studies have been performed in rangeland grasshoppers of Iran. In this study, in addition to faunistic records, we examined and compared the impact of time of day on sweep-net capture of various rangeland grasshoppers in north-east Iran. MATERIAL AND METHODS Faunistic study This study is based on the material deposited in the Insect Museum of Ferdowsi University of Mashhad as well as those collected by the first author from different locations in Khorasan-e- Razavi province. The samplings were conducted mainly by sweeping or via hand-catching and the materials were transferred to killing jars. All of the specimens were pinned and labeled with accurate collection data. The material was deposited in the Insect Museum of Plant-Protection Department at Ferdowsi University of Mashhad. The specimens were identified by Dr. Battle Ciplak from Akdeniz University, Turkey. Compare capture rates in two rangelands One and two rangeland sites with mixed-grass vegetation and low grazzing pressure were chosen for sweep samplings (Site1: N, E; Site 2: N, E) in Khorasan-e- Razavi province in 2013 and 2014, respectively. Sites 1 and 2 were near Golmakan and Akhlamad, respectively. The approximate distance between these two sites was about 15 Kilometers. Each of these two prairies was sampled over three consecutive days for three sampling periods between June and September. Twenty low and fast sweeps (Wipple et al., 2010) were taken at each site. Sweep samples were collected every four hours from 8:00 to 16:00 and at each time interval a different location within each site was sampled. The data were normally distributed so the one-way ANOVA (SPSS 16) was used to determine the differences in number of captured grasshopper specimens in various times of day. RESULTS Totally, 19 species belonging to three families, nine subfamilies and 17 genera were collected and identified. Among them, Paranocarodes straubei (Fieber, 1853) is newly recorded for the fauna of Iran. Family Acrididae MacLeay, 1821 Subfamily Acridinae MacLeay, 1821 Tribe Acridini MacLeay, 1821 Genus Acrida Linnaeus, 1758 Acrida bicolor (Thunberg, 1815) Distribution: Mediterranean area including islands, Canary Islands, most countries of Africa including south of the Sahara, Asia Minor (Dirsh, 1966; Garai, 2010), Iran (Natanz, Binaloud) (Garai, 2010). Material examined: Khorasan-e-Razavi, Quchan ( N, E), 4, 1, 9.VII.2013, Leg: A. Jabbari; Neyshabour ( N, E), 3, 17.VII.2013, Leg: A. Jabbari. Subfamily Calliptaminae Tinkham, 1940 Tribe Calliptamini Tinkham, 1940

39 GRASSHOPPER FAUNA OF NORTHEASTERN IRAN 35 Genus Calliptamus Serville, 1831 Calliptamus coelesyriensis Giglio-Tos, 1893 Distribution: Samos Island, Turkey, Caucasus range, Azerbaijan, Iran: north-east and center of Iran (Garai, 2010). Material examined: Khorasan-e-Razavi, Mashhad ( N, E), 1, 25.VI.2013, Leg. N.Golami. C.italicus (Linnaeus, 1758) Distribution: North of Africa, Turkey, from Caucasus through Iran, Afghanistan, west of Pakistan to north-west of Mongolia and west of China and western Siberia (Garai, 2010), Iran (Razan (Hamedan prvince), Kushk-e Nosrat (Fars province), Natanz) (Garai, 2010). Material examimed: Khorasan-e-Razavi, Golmakan ( N, E ), 5, 2, 11.VII.2013, Leg. A. Jabbari; Chenaran, Kerengan ( N, E), 1, 12.VII.2013, Leg. A. Jabbari; Akhlamad ( N, E),1, 18.VI Leg. A. Jabbari. C. barbarus cephalotes Fisher- Waldheim, 1846 Distribution: North Africa, Caucasus, Turkey, north Afghanistan, Kazakhstan, Mongolia, west China, Siberia, Iran (Zagros, Bostanabad, Azad-Ber, Lardam, Sahreza, Erak, Zanjan, Makoo) (Garai, 2010). Material examined: Khorasan-e-Razavi, Chenaran ( N, E), 30, 18.VI.2013, Leg. A. Jabbari; Shirhesar (36 34' 20'' N, 59 23' 19'' E), 19, 2.VIII.2013, Leg. A. Jabbari. Subfamily Cyrtacanthacridinae Kirby, 1910 Tribe Cyrtacanthacridini Kirby, 1910 Genus Anacridium Uvarov, 1923 Anacridium aegyptium aegyptium (Linnaeus, 1923) Distribution: South wastern Europe, Middle-Africa, Asia Minor, Caucasus, Kazakhstan, Afghanistan (Garai, 2010), Iran (Azad Shar, Khomer, Borazgan) (Garai, 2010). Material examined: Khorasan-e-Razavi,Chenaran, Kerengan ( N, E), 1, 27VII Leg. A. Jabbari; Golmakan ( N, E ), 8, 27VII Leg. A. Jabbari; Mohsenabad ( N, E), 3, 27.VII Leg. A. Jabbari. Genus Schistocerca stål, 1873 Schistocerca gregaria (Forskål, 1775) Distribution: North of Africa, Syria, Iraq, Afghanistan, Turkmenistan, Uzbekistan, Tajikistan, W- Pakistan (Hemp, 2009), Iran (Bidak, Demavend, Dehdib). Material examined: Khorasan-e-Razavi, Golmakan ( N, E ), 3, 1.VII Leg. A. Jabbari, Gonabad ( N, E), 2, 11VII Leg. A. Jabbari, Khaf ( N, E), 4, 11VII Leg. A. Jabbari. Subfamily Gomphocerinae Fieber, 1853 Tribe Ramburiellini Defaut, 2012 Genus Ramburiella Bolívar, 1906 Ramburiella bolivari (Kuthy, 1907) Distribution: Asia-Temperate, western Asia, Turkey (Eades et al. 2014). Material examined: Khorasan-e-Razavi, Chenaran, Kerengan ( N, E),3,1, 24.VII Leg. A. Jabbari;, Quchan ( N, E), 2,1, 24.VII.2013, Leg. A.

40 36 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 Jabbari, Torbat-e- Heydarieh, Oryan, ( N, E / N E), 1, 24.VII.2013, Leg. A. Jabbari; Mohsenabad ( N, ),1, 24.VII.2013, Leg. A. Jabbari. Family Dericorythidae Jacobson & Bianchi, 1905 Subfamily Dericorythinae Jacobson & Bianchi, 1905 Genus Dericorys Serville, 1838 Dericorys albidula Servielle, 1838 Distribution: North of Africa, Syria, Iraq, Afghanistan, Turkmenistan, Uzbekistan, Tajikistan, W- Pakistan, Iran (Bidak, Demavend, Dehdib, Natanz) (Garai, 2010). Material examined: Khorasan-e-Razavi, Gonabad ( N, E), 3, 2, 31.V.2013 Khaf ( N, E), 6,1, 9.VI.2013, Leg. A. Jabbari. Subfamily Oedipodinae Walker, 1871 Tribe Oedipodini Walker, 1871 Genus Oedipoda Latreille, 1829 Oedipoda miniata Pallas, 1771 Distribution: Caucasus, Tajikistan, Afghanistan, western Pakistan, India, central Asia, Western Siberia (Garai, 2010), Iran (Zagros, Miyane, Geshlagh valley, Jevenly, Karaby, Geshlagh, Razan, Fasa, Sangar, Zageja Bala, Kivi, Lardam, Yasug, Erak, Miyane, Thangebolhayat, Khorambid, Nur, Miyane, Natanz, Zanjan, Sivand, Miyane, Rieneh, Arak, Binaloud, Quazvin) (Garai, 2010). Material examined: Khorasan-e-Razavi, Chenaran, Kerengan ( N, E), 15, 3.VII Leg. A. Jabbari; Golmakan ( N, E ), 25, 3.VII.2013, Leg. A. Jabbari; Golmakan ( N, E ), 15, 19.VI.2013, Leg. A. Jabbari; Akhlamad ( N, E), 15, 3.VII.2013, Leg. A. Jabbari, Mohsenabad ( N, E), 15, 3.VII.2013, Leg. A. Jabbari. Sphingonotus pilosus Saussure, 1884 Distribution: Caucasus range, Turkey, Turkmenistan, Iran (Jevenly,Geshlagh vall, Natanz, Thangebolhayat, Nur, Khorambid, Miyane, Khansar Dalekhi) (Garai, 2010). Material examined: Khorasan-e-Razavi, Chenaran, Kerengan ( N, E), 18, 3.VII Leg.A. Jabbari, Golmakan ( N, E) 62, 3.VII Leg.A. Jabbari, Akhlamad ( N, E), 8, 3.VII Leg.A. Jabbari; Mohsenabad ( N, ), 7, 3.VII Leg.A. Jabbari. Heliopterix humeralis (Kuthy, 1907) Distribution: Iran (Guilan, Isfahan) (Ghahari et al., 2009). Material examined: Khorasan-e-Razavi, Chenaran, Kerengan ( N, E), 21, 3.VII Leg. A. Jabbari; Golmakan ( N, E), 49, 3.VII Leg. A. Jabbari; Akhlamad ( N, E), 15, 3.VII Leg. A. Jabbari; Mohsenabad ( N, E), 10, 3.VII Leg. A. Jabbari. Oedalus decorus (Germar, 1825) Distribution: Asia-Temperate, Caucasus, north of Caucasus, Dagestan (Eades et al., 2014). Material examined: Khorasan-e-Razavi, Chenaran, Kerengan ( N, E), 23, 3.VII Leg. A. Jabbari, Golmakan ( N, E), 47, 3.VII Leg. A. Jabbari, Akhlamad ( N, E), 16, 3.VII Leg. A. Jabbari, Mohsenabad ( N, E), 9, 3.VII Leg. A. Jabbari.

41 GRASSHOPPER FAUNA OF NORTHEASTERN IRAN 37 Pyrgodera armata Fisher Waldheim, 1846 Distribution: Russia (Eades et al., 2014), Iran (Azerbaijan, Ardabil) (Havaskary et al., 2012). Material examined: Khorasan-e-Razavi, Gonabad ( N, E), Khaf ( N, E), 5, 2, 9VI.2013, Leg. A. Jabbari. Locusta migratoria Linnaeus, 1758 Distribution: South and East of Europe, Central Asia, W- China, Mongolia, Korea, Siberia, Iran(Azerbaijan, Gilan, Makoo) (Garai, 2010). Material examined: Khorasan-e-Razavi, Chenaran, Kerengan ( N, E), 2, 3.VII.2013, Leg. A. Jabbari; Golmakan ( N, E ), 2, 3.VII Leg. A. Jabbari; Akhlamad ( N, E), 2, 3.VII.2013, Leg. A. Jabbari; Mohsenabad ( N, ), 2, 3.VII.2013, Leg. A. Jabbari. Family Pamphagidae Burmeister, 1840 Subfamily Pamphaginae Burmeister, 1840 Tribe Nocarodeini Bolívar, 1916 Genus Nocaracris Uvarov, 1928 Nocaracris cyanipes (Fischer von Waldheim, 1846) Distribution: Asia-Temperate, Caucasus (Eades et al. 2014). Material examined: Khrasan-e-Shomali, Bidak ( N, E), 3, 11.VI Leg. F. Gamali; Khorasan-e-Shomali, Amirabad ( N, E), 10.VII Leg. S. Hosseini. Genus Paranocarodes Bolívar, 1916 Paranocarodes straubei (Fieber, 1853) This species is newly recorded for the fauna of Iran. Distribution: Asia-Temperate, western Asia, Turkey, Northwest Anatolia, Brussa (Eades et al., 2014). Material examined: Khorasan-e-Shomali, Boujnord ( N, E), 3, 15.VII Leg. M. Hosseini; Khorasan-e- Shomali, Ashkhaneh ( N, E), 2, 28.VII Subfamily Thrinchinae Stål, 1876 Genus Eremopeza Saussure, 1888 Eremopeza gibbera (Stål, 1876) Distribution: South of Iran (Garai, 2010). Material examined: Khorasan-e-Razavi, Gonabad ( N, E), 2, 9.VI Leg. A. Jabbari; Khaf ( N, E),4, 9.VI Leg. A. Jabbari. Family Pyrgomorphidae Brunner von Wattenwyl, 1882 Subfamily Pyrgomorphinae Brunner von Wattenwyl, 1882 Tribe Pyrgomorphini Brunner von Wattenwyl, 1882 Genus Pyrgomorpha Serville, 1838 Pyrgomorpha Cognata Krauss, 1877 Distribution: West of Europe, northern Africa, Levante, Turkey, Caucasus, Iraq, Iran, Afghanistan, West of Pakistan (Garai, 2010). Material examined: Khorasan-e-Razavi, Gonabad ( N, E), 2, 9.VI Leg. A. Jabbari; Khaf ( N, E),4, 9.VI Leg. A. Jabbari.

42 38 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 TABLE 1. Total number of adult and nymphal grasshoppers species collected during every four hours sweep samples from two rangelands sites in Khorasan-e-Razavi over three dates between June and September TIME SPECIES 8: 00 12:00 4:00 Oedipoda miniata Eromopeza gibberto Locusta migratoria Caliptamus italicus Schistocerca gregaria Pyrgomorpha cognata Locusta migratoria Anacridium aegyptium Dociostaurus maroccanus Total grasshoppers TABLE 2. Total number of adult and nymphal grasshoppers by species collected during every four hours sweep samples from two rangelands sites in Khorasan-e-Razavi over three dates between June and September Time Species 8:00 12: 00 4:00 Oedipoda miniata Caliptamus italicus Locusta migratoria Eromopeza gibberto Pyrgodero armata Schistocerca gregaria Acrida bicolor Dociostaurus maroccanus Pyrgomorpha cognata Total grasshoppers SAMPLING RATES In 2013, a total of 199 specimens belonging to 9 species were collected and identified in rangeland site 1 (Table 1). There was not any significant difference in number of collected grasshopper specimens in various times of day (F= 0.530, P= 0.595). In 2014, a total of 458 grasshopper specimens from 9 species were collected in two rangeland sites (table 2). Although the number of captured species was highest at 12:00, but there were no significant differences among capture rate of specimens in various day hours (F= 0.828, P=0.443) (Fig. 1). The most abundant species collected in our study was Oedipoda miniata; Caliptamus italicus and Eromopeza gibberto were in the next two ranks.

43 GRASSHOPPER FAUNA OF NORTHEASTERN IRAN 39 FIGURE1. Mean±SE number of grasshoppers specimens captured in different times of day at rangeland site 1 in FIGURE 2. Mean±SE number of grasshoppers specimens captured in different times of day at two rangeland sites in 2014.

44 40 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 DISCUSSION The study of grasshopper and locust fauna in Khorasan provinces (Northeastern Iran) revealed the presence of 19 species, divided into 3 families including Acrididae, Pyrgomorphidae and Pamphagidae. Among these families, Acrididae was the best represented one with 7 subfamilies. Subfamily Oedipodinae was the largest, consisting of 6 species. The subfamilies of Acridinae, Dericoryuthinae, Gomphocerinae, Thrinchinae and Pyrgomorphinae were represented by only one species each. The Italian locust, Calliptamus italicus, and the migratory locust, Locusta migratoria, appear to be of economic importance in the region of Khorasan-e-Razavi. These species can invade various agricultural crops in Khorasan-e-Razavi and control programs should be applied annually in their aggregation centers to obstruct their drastic damages (Abivardi, 2001; Noorbakhsh et al. 2012). Although Oedipoda miniata was dominant species in our samplings in terms of number of collected specimens, but it does not have economic importance in our study region and no control measures performed against it. The results of this study indicate that standardized sampling of grasshoppers can be conducted in various times of day between 8:00 and 16:00 and there is not any significant difference among capture rates in these hours. Because in some studies (Whipple et al., 2010), differences in number of captured grasshoppers by time of day was observed, there is need to further studies in more rangeland ecosystems during more times of day to determine the best time of sampling for accurate estimation of number of grasshoppers. ACKNOWLEDGMENTS We would like to express our gratitude to Dr. Battle Ciplak from Akdeniz University, Turkey, for being generous in identifying and confirming our specimens. This research is a part of M.Sc. thesis of the first author. We would like to acknowledge the financial support provided by the Faculty of Agriculture, Ferdowsi University of Mashhad, Iran. LITERATURE CITED Abivardi, C., Iranian Entomology: An Introduction, Volume 2, Applied Entomology. Springer Verlag, Heidelberg. Noorbakhsh, S., Sahraian, H., Soroosh, M. J., Rezaii, V and Fotoohi, A. R., List of pests, diseases and weeds of major agricultural products and the recommended methods for their control. Plant Protection Organization. [in Persian] Alexandrov, N. V., Les Acridiens des regions Nord, Nord-Est et Nord-Ouest de l Iran. Entomologie et Phytopathologie Appliquées 3: Azemayeshfard, P., Identification and distribution banded wings grasshopper (Orth: Oedopodinae) of Karadj. Entomologie et Phytopathologie Appliquées 39: Azemayeshfard, P., An investigation about morphology and biology of Aiolopus talassinus F. under laboratory conditions. Entomologie et Phytopathologie Appliquées 39: Azemayeshfard, P., Investigation on the biology of Acrotulus insubricus Scop. In Karadj vicinity and under laboratory condition. Proceeding of VII. Plant Protection Congress, Iran, University of Tehran, pp. Azemayeshfard, P., Investigations on the band winged grasshoppers (Oedipodinae) of Iran. Boletin de Sanidad Vegetal, Plagas 20:

45 GRASSHOPPER FAUNA OF NORTHEASTERN IRAN 41 Azemayshfard, P., Investigation of long horned grasshoppers (Polysarcus fieber) in Iran. [Abstract]. Metaleptea13: 13. Bey-Bienko, G. J., New and interesting grasshoppers (Orthoptera, Acrididae) from Iran. Zoologiceskij Zhurnal 36: [In Russian, English summary]. Bey-Bienko, G.J., New Iranian Acridoidea (Ergebnisse der Entomologishen Reisen Willi Ricter, im Iran 1954 und Nr. 28). Stuttgarter Beitrage zur Naturkunde, Stuttgart 36: 1-7. Cejchan, A., Results of the Czechoslovak - Iranian entomological expedition to Iran 1970 No. 7. Orthoptera, Tettigoniidae: A new species of Nephoptera Uvarov, 1929, from Iran. Acta Entomologica Musei Nationalis Pragae Suppl., 6: Cressman, K., Monitoring desert locusts in the Middle East: An Overview. Yale School of Forestry & Environmental Studies. [Cited 6 Apr 2015.] Available from URL: publication-series/documents/downloads/0-9/103cressman.pdf. Descamps, M., Revue et diagnose préliminaire de quelques Pamphagidae et Acrididae d Iran (Orth. Acridoidea). Bulletin de la Société entomologique de France 72: Dirsh, V.M., Acridoidea of Angola. Museo do Dundo. Publicações culturais de Companhia de Diamantes de Angola, 74: Dirsh, V. M., Mirzayans, H., Some Iranian Acridoidea (Orthoptera). Journal of Entomolomology Series B, Taxonomy 40(2): Dirsh, V.M., Uvarov, B. P., An interesting grasshopper from Iran. Journal of Entomologische Berichte Amsterdam 17: Eades, D.C., Otte, D., Cigliano, M.M. and Braun, H., Orthoptera Species File. Version 5.0/5.0. [Cited 20 Dec 2014]. Available from URL: File.org>. Estano, D. B., Shepard, B. M., Influence of time of day and sweeping pattern on catches of green leafhoppers (GLH). International Rice Research Newsletter 13: 22. Ghahari, H., Havashary, M., Tabari, M., Ostovan, H., Sakenin, H. and Satar, A., 2009, An annotated catalogue of Orthoptera (Insecta) and their natural enemies from Iranian rice fields and surrounding grasslands. Linzer Biologische Beitraege 41(1): Garai, G. A., Contribution to the knowledge of the Iranian Orthopteroid insects I. (Plates 61, 62). Esperiana 15: Garai, G. A., Contribution to the knowledge of the Iranian Orthopteroid insects II. Description of three new species of Iranian Platycleidini and one of Drymadusini (Plates 1-8). Esperiana Band 16: Gardiner, T., Hill, J., Chesmore, D., Review of the methodsfrequently used to estimate the abundance of orthoptera in grassland ecosystems. Journal of Insect Conservation 9:

46 42 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 Havaskary, M., Farshbaf pour Abad, R., Kazemi, M. H., Satar, A. and Rafeii, A., A contribution to the short-horned grasshoppers (orthoptera: Acrididae) from Arasbaran and vicinity, NW Iran. Munis Entomology and Zoology 7(2): Mirzayans, H., Les Orthopteres de l Iran. Entomologie et Phytopathologie Appliquees 12-13: Mirzayans, H., Liste des Orthopteres et leurs distribution en Iran. Entomologe et Phytopathologie appliqués 18: Mirzayans, H., A harmful bush-cricket from Gorgan area Decorana capitata (Uv.) (Tettigonidae: Dectinae). Journal of Entomological Society of Iran 10: Mirzayans, H., 1991 Three new genera and four new species of Orthoptera from Iran. Journal of Entomological Society of Iran, supplementary 6: Mirzayans, H., The list of Orthoptera in the collection of Plant Pest and Diseases Research Institute of Iran. Insect Taxonomy Research Department Publication 3. Neyestanak, M. M., 2000 a. A faunal investigation on the long-horned grasshoppers (Orthoptera- Tettigoniidae) of Gazvin to Damavand distinct - Abstract book I XXI- International Congress of Entomology; Aug 2000, Brazil. Neyestanak, M. M., 2000 b. Introduction of six new ensiferous Orthoptera for the fauna of Iran. 14th Iranian Plant Protection Congress, September: 338. Neyestanak, M. M., 2000 c. A preliminary survey on the Orthopteroidea of the Iranian island of Persian Gulf. 14th Iranian Plant Protection Congress, September: 339. Peveling, R., Attignon, S., Langewald, J., Ouambama, Z., An assessment of the impact of biological and chemical grasshopper control agents on ground-dwelling arthropods in Niger, based on presence/absence sampling. Crop Protection 18: Taleban Fard, A. A. and Shariati, M. H., Another view to the outbreaks of the saxaul locust, a problem or natural reaction. [Cited 5 Apr 2015.] Available from URL: Whipple, S. D., Brust, M. L., Hoback, W. W., Farnsworth-Hoback, K. M., Sweep sampling capture rates for rangeland grasshoppers (Orthoptera: Acrididae) vary during morning hours. Journal of Orthoptera Research 19(1):75-80 Purivirojkul, W., & Areechon, N A survey of parasitic copepods in marine fishes from the Gulf of Thailand, Chon Buri province. The Kasetsart Journal, Natural Science 42, Rangnekar, M.P Pseudocaligus laminiatus sp. nov. and Diphyllogaster aliuncus sp. nov. (Copepoda) parasitic on Bombay fishes. Journal of the University of Bombay 23,

47 Iranian Journal of Animal Biosystematics (IJAB) Vol.11, No.1, 43-49, 2015 ISSN: X (print); (online) Karyotypic characterization of the pike, Esox lucius from the south Caspian Sea basin Khoshkholgh, M. a*, Alavi, A.R. a, Nazari, S. b a Department of Fisheries, Faculty of Natural Resources, University of Guilan, P.O. Box 1144 Sowmehsara, Iran b Genetic and Breeding Research Center for Coldwater Fishes, P.O. Box Yasouj, Iran (Received: 20 December 2014; Accepted: 15 June 2015) The karyotype of pike from Anzali lagoon in the south Caspian Sea basin have been investigated for the first time by conventional chromosome staining. The chromosomes spreads were stained with 7% Giemsa solution for 15 min and examined under a light microscope. Appropriate metaphase plates were photographed in order to prepare karyotype. All samples had a diploid number of 50 chromosomes (2n=50), with a karyotype consist of 12 metacentric, 24 submetacentric, 14 subtelocentric and fundamental number (NF) of 86. The largest chromosome in this species was a pair of metacentric chromosomes. Based on type of chromosomes, the karyotype of this species was nearly differed with what that found in previous studies, which could be attributed to the existence of different populations for this species. Despite the conserved diploid number, the data on the cytogenetic structure help characterize the karyotype of this species. Key words: Esox lucius, Caspian Sea, Cytogenetic, Giemsa staining. INTRODUCTION The genus Esox belongs to the family Esocidae comprises five species distributed in the Holarctic region (Nelson, 1994) and there is only one species reported in Iran (Jolodar & Abdoli, 2004). The pike Esox lucius (Linnaeus, 1758) is distributed across northern Eurasia and northern North America. Iranian populations are found in the Caspian Sea basin, from the Anzali lagoon and the Sia Keshim Protected Region to Gorgan Bay and its tributaries such as the Karasu, described from the rivers including the Safid, Tajan, Babol and Haraz, and the Atrak River basin, and the Amirkelaye Lagoon near Lahijan (Nejatsanatee, 1994; Riazi, 1996; Abbasi et al., 1999; Kiabi et al., 1999; Jolodar & Abdoli, 2004). Pikes are important sport fishes and are found in lakes and rivers where the water is still or flowing slowly as well as marshes and ponds. They are found only in the lower reaches of rivers along the Iranian shore (Abbasi et al., 1999). The study of karyotype, which is the chromosome number and morphology, is a relevant source of information on taxonomical and phylogenetic relationships among fishes (King, 1993). In the recent years, cytogenetic and molecular methods mentioned novel taxonomical and phylogenetic relationships among different aquatic species (Rab & Mayr, 1987; Pourkazemi et al., 2010; Nazari et al., 2011). Even though Euteleostei fishes belong to a cytogenetically fairly studied fish group, the family Esocidae has received far less attention, in particular in Iran. Although the chromosome *Corresponding Author: majidrezagu@yahoo.com 2015 FERDOWSI UNIVERSITY OF MASHHAD, IRAN

48 44 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 number of the genus Esox have described, the karyotype of Esox lucius have not been studied in Iranian water (Arkhipchuk, 1999). The karyotypes of the family Esocidae seem to be close to the ancestral esocoid (Crossman & Rab, 1996). Studies of northern pike (Esox lucius) chromosomes concerned general cytogenetic characterization and its karyotype has been investigated from some European (Nygren, 1968; Rab & Mayr, 1987; Rab & Crossman, 1994; Jankun et al., 1998) and china populations (Zou & Li, 2006). Jankun et al. (1998) also analyzed heterochromatin and the location of nucleolar organizer regions (NOR) in the chromosomes of northern pike (Esox lucius) in Poland. Since karotypic polymorphism characterizes Esocae fishes (Jankun et al., 1998), it is significant to survey the chromosomal complements of the pike throughout its distribution range. In this paper we present the karyotype of Esox lucius from Caspian Sea basin and compare our results with the available data for this species. MATERIALS AND METHODS Eight individuals of Esox lucius, were collected from Anzali lagoon in north part of Iran (37º28'N, 49º27'E) between June and August of 2011 and kept in the laboratory in aerated fresh water until studied. The preparation of chromosomes was performed according to Collares- Pereira et al. (1998) with some modifications (Nazari et al., 2009). This technique is particularly convenient for the preparation of chromosomes from fishes. Briefly, The specimens were injected intraperitoneally with a 0.01% distill water solution of colchicine at 0.5 ml per 100 gram of body weight, allowed to remain in aerated fresh water at C for a period of h, and then sacrificed. The gill filaments and the head kidney tissues of specimens were squashed and placed in a hypotonic solution of KCl (0.075 M) for 50 min in room temperature (22-23 C), then drained and fixed in freshly prepared Carnoy fixative (3:1, methanol: acetic acid) at 4 C. The supernatants were then discarded and 5 ml fresh and cold fixative was added to sediments, mixed thoroughly and three changes of fixative of each were made at 10-min intervals. Then a few drops of the suspension were trickled on hot (heated on a hot plate after rinsing in alcohol) and cold (placed in a freezer after rinsing in alcohol) slides. The slides were air dried and stained with 7% Giemsa solution (ph=7) for analysis of chromosomal morphology. Slides were rinsed in distilled water and dried at room temperature for 3-4 h. Using Olympus light microscope chromosomes were counted in 69 metaphase plates of E.lucius. Photos were obtained and chromosomes were classified according to standard method (Levan et al., 1964). Karyotype was prepared by organizing chromosomes in pairs by size. The idiogram were prepared to supply the common depict of the pike chromosomes in Microsoft Excel 2003 software. RESULTS The chromosome feature of the E.lucius specimens was 2n = 50 chromosomes with 6 pairs of metacentric (M), 12 pairs of submetacentric (Sm), 7 pairs of subtelocentric (St) chromosomes, with a fundamental number (NF) equal to 86 (Fig. 1). A total of 69 numberings were made of chromosome spreads at metaphase from four males and four females. Similarity of the karyotypes of females and males did not show the presence of any chromosomal differences (data not displayed). After combining the data the frequency of these numberings in relation to the discerned chromosome number is demonstrated in figure 2. This obviously proves that the modal number was 2n= 50 with 79% of the cells checked having this chromosomes number. In figure 1 one of the metaphase spreads is depicted and the karyotype presented from this metaphase is demonstrated in figure 3. The karyotype formula suggested for E.lucius was 2n=50, 12M + 24Sm+14St, and the arm number (number of chromosome arms) was NF=86, which was estimated by alloting a value of two arm for M/Sm chromosomes and one arm for the St/A chromosomes (Fig. 3).

49 KARYOTYPIC CHARACTERIZATION OF THE PIKE, ESOX LUCIUS 45 FIGURE 1. Metaphase chromosomes of pike (Esox lucius) in this study FIGURE 2. Distribution of the chromosome numbers from 69 metaphase plates from E.lucius

50 46 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 FIGURE 3. Karyotype in pike (Esox lucius) (2n=6M + 12 SM + 7St/a) FIGURE 4. Haploid idiogram of pike (Esox lucius) from Anzali lagoon DISCUSSION Based on the results obtained the chromosome number of the species Esox lucius was 2n=50 which similar to the chromosome number reported for other species belonging to the genus Esox. In the genus Esox, the chromosome numbers 2n=50 was confirmed by Rab & Crossman (1994) who studied in E. lucius, E.americanus, E. niger and E. masquinongy. Furthermore, Nygren (1968) informed a diploid number of 2n = 50 acrocentric chromosomes in Esox lucius from two Swedish lakes: Mälaren and Uttran; the same 2n numbers were reported by Rab & Mayr (1987), and Jankun et al. (1998). In this study we observed that both male and female specimens of E. lucius obtained from Anzali lagoon had a diploid number of chromosomes 2n = 50 and the number of chromosome arms were NF = 86, which different with the results of the previous studies (Rab & Crossman, 1994, NF = 76; Jankun et al., 1998, NF = 86; Zou & Li, 2006, NF = 50) (Table 1).

51 KARYOTYPIC CHARACTERIZATION OF THE PIKE, ESOX LUCIUS 47 TABLE 1. Chromosome formula, chromosome number (2n) and chromosome arms in different species belonging to the genus Esox. No. Species 2n Chromosome formula NF Reference 1 Esox lucius 50 14M + 36SMSt _ Nygren, Esox lucius 50 24M /Sm + 14St + 12t 76 Rab and Mayr, Esox lucius 50 24M /Sm + 14St + 12t 88 Rab & Crossman, Esox lucius Jankun et al., Esox lucius St 50 Zou and Li, Esox lucius 50 12M + 24Sm + 14St /t 86 Presnt study 7 Esox masquinongy 50 12M + 14Sm + 24St/ A 78 Rab & Crossman, Esox niger 50 12M + 12Sm + 26St/ A 74 Rab & Crossman, Esox americanus 50 12M + 10Sm + 28St/ A 72 Rab &Crossman,1994 Although chromosome numbers of the present study and the previous studies were similar, but differences in chromosome formula and number of arms (NF) were observed. Chromosome analysis of the species Esox masquinongy (Linneaus, 1758) was reported as 2n=50 and NF=76 (Rab & Crossman, 1994) and for the species E. niger belong to north American rivers was reported as 2n=50 and NF=74 (Rab & Crossman, 1994). Zou and Li, 2006 described a karyotype of 2n=50 consisting 25 pairs of telocentric chromosomes with NF=50 for white spot pike E. lucius from Ertix river in China (Table 1). Some explanations for these discrepancies in number and type of chromosome may be due to the presence of different populations, races and/or sub species in sampling area arising from mutation, race improvement and hybridization with other indigenous species (Crossman & Rab, 1996; Vasil ev & Vasil eva, 2008; Nazari et al., 2010). Sex, age as well as the hygienic state of the species, the concentration of colchicines and also the time of mitotic arrest may also influence chromosome characteristics particularly the chromosome arm number (NF) (Kalbasi et al., 2006; Pourkazemi et al., 2010). It has been presented that the successful gynogenesis in northern pike produced only females by heat shock (Luczynski et al., 1997); this lead to the deduction that the chromosomal sex detection organization in E. lucius is of the type of XY, as females are homogametic (Jankun et al., 1998). Unluckily, procedures of chromosome polymorphism test utilized in this report did not show sex chromosomes in the pike. Further sensitive techniques for cytogenetic studies in E. lucius should include take advantage of restriction enzymes, the use of differential staining methods combined with molecular techniques (e.g. fluorescent in situ hybridization with telomeric probe), will be required to acquire a better comprehension of chromosomal studies of this species. ACKNOWLEDGMENTS We thank Faculty of Natural Resources of Guilan University for supporting the study. We thank also M. Sanjide and A. Pirbeigi for kindly providing fish for the study and for the technical efforts. LITERATURE CITED Abbasi, K., Valipour, A., Talebi Haghighi, D., Sarpanah, A. and Nezami, Sh Atlas of Iranian Fishes. Guilan Inland Waters. Guilan Fisheries Research Centre, Rasht. 113 pp. (In persian). Arkhipchuk, V.V Chromosome database. Database of Dr. Victor Arkhipchuk.

52 48 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 Coad, B. W Endemicity in the freshwater fishes of Iran. Iran. Journal of Animimal Biosystematics. 1: Collares-Pereira, M.J., Próspero, M.I., Biléu, M.I. and Rodrigues, E.M Leuciscus (Pisces, Cyprinidae) karyotypes: transect of Portuguese populations. Genetics and Molecular Biology. 21: Crossman, E.J. and Rab, P Chromosome-banding study of the Alaska blackfish, Dallia pectoralis (Euteleostei: Esocae), with implication for karyotype evolution and relationship of esocoid fishes. Canadian Journal of Zoology. 74: Fontana, F A cytogenetic approach to the study of taxonomy and evolution in sturgeons. Journal of Appllied Ichthyology. 18 (2002), Jankun, M., Woznicki, P., Dajnowicz, G., Demska-Zakes, K., Luczynski, M. J. and Luczynski, M Heterochromatin and NOR location in northern pike (Esox lucius). Aquatic science. 60 (1998) Jolodar, M. N. and Abdoli, A Fish Species Atlas of South Caspian Sea Basin (Iranian Waters). Iranian Fisheries Research Organization, Teheran. 110 pp. Kalbasi, MR., Dorafshan, S., Tavakolian,T., Khazab, M & Abdolhay, H Karyological analysis of endangered Caspian salmon, Salmo trutta caspius (Kessler, 1877). Aquaculture research. 37, Kiabi, B. H., Abdoli, A. and Naderi, M Status of the fish fauna in the South Caspian Basin of Iran. Zoology in Middle East. 18: King, M Species evolution: the role of chromosome change. Cambridge University. Press, Cambridge, pp Levan, A., Fredga, K. and Sandberg, A.A Nomenclature for centromeric position on chromosomes. Hereditas. 52: Luczynski, M.J., Glogowski, J., Kucharczyk, D., Luczynski, M. and Demska-Zakes, K Gynogenesis in northern pike (Esox lucius L.) induced by heat shock-preliminary data. Poliske Arch Hydrobiologie 44. Mayr, B Chromosome banding studies in European esocid fishes: localization of NOR in Umbra krameri and Esox lucius. Copeia 1987: Nazari, S., Pourkazemi, M and Porto, J.I.R Comparative cytogenetic analysis of two Iranian cyprinids Alburnoides bipunctatus and Alburnus filippii (Cypriniformes: Cyprinidae). Iran. Journal of Animimal Biosystematics 5(2), Nazari, S., Pourkazemi, M and Porto, J.I.R Chromosome description and localization of Nucleolus Organizing Regions by Ag-staining Technique in Alburnus filippii (Cyprinidae, Cypriniformes) of the south Caspian Sea Basin, Guilan, Iran. Iranian Journal of fisheries science, 10(2),

53 KARYOTYPIC CHARACTERIZATION OF THE PIKE, ESOX LUCIUS 49 Nejatsanatee, A. R Ameerkalaye Lagoon in Lahijan, Abzeeyan, Tehran, 5(1 & 2):2-4, II-III. (In Persian). Nelson, J.S Fishes of the World. J. Wiley & Sons Inc. New York, pp Nygren, A Cytological studies in perch (Perca fluviatilis L.), pike (Esox lucius), pike perch (Lucioperca lucioperca) and ruff (Acerina cernua). Hereditas 59, Pourkazemi, M., Nazari, S., Bakhshalizadeh S Karyotype analysis in white bream Blicca bjoerkna from north coast of Iran. Iranian Journal of Fisheries Science 9(3) Rab, P. and Crossman, E. J Chromosomal NOR phenotypes in North American pikes and pickerels genus Esox, with notes on the Umbridae (Euteleostei: Esocae). Canadian Journal of Zoology. 72: Rab, P. and P. Roth, (1988) Cold-blooded vertebrates. In: P. Balicek, J. Forejt and J. Rubes (Editors) Methods of Chromosome Analysis. Cytogenet. Sect. Cs. Biol. Soc., Brno, pp Riazi, B Siah-Keshim. The Protected Area of Anzali Wetland. Department of the Environment, Tehran. 101 pp. ( In Persian). Vasil ev, V. P. and Vasil eva, E. D Comparative Karyology of Species of the Genera Misgurnus and Cobitis (Cobitidae) from the Amur River Basin in Connection with Their Taxonomic Relations and the Evolution of Karyotypes. Journal of Ichthyology. 48, (1) Zou Sh. and Li,S. F The study on chromosomes of white spot pike (Esox lucius). Journal of Shang Fisheries University. 2,

54

55 Iranian Journal of Animal Biosystematics (IJAB) Vol.11, No.1, 51-56, 2015 ISSN: X (print); (online) New records and updated checklist of the genus Philonthus (Col: Staphylinidae) for Iran Tabadkani, S.M., Nozari, J. * and Hosseininaveh, V. Department of Plant Protection, College of Agriculture, University of Tehran, Karaj, Iran (Received: 23 April 2014; Accepted: 18 June 2015) Six species of rove beetles (Coleoptera: Staphylinidae), belonging to the genus Philonthus Stephens 1829, are reported for the first time from Iran. They include Philonthus juvenilis Peyron, 1858, Philonthus micans (Gravenhorst, 1802), Philonthus spinipes Sharp, 1874, Philonthus longicornis Stephens 1832, Philonthus viridipennis Fauvel 1875, and Philonthus wuesthoffi Bernhauer All specimens were collected from Mazandaran province, north of Iran during An updated checklist of this genus, including 43 species, has been provided. Key words: Rove beetles, Staphylinidae, Staphylininae, Iran, Mazandaran, Philonthus INTRODUCTION Rove beetles (Coleoptera: Staphylinidae) are the largest or the second large family of beetles, with more than described species worldwide, classified in 33 subfamilies (Anlas and Deveci, 2011; Janak and Bordoni, 2012). Despite tremendous variations in habitus and size, the vast majority of rove beetles can be simply distinguished from other beetles by short truncate elytra, which expose more than half of their long abdomen (Newton et al., 2000). Various developmental stages of rove beetles are found in a wide variety of terrestrial and semi-aquatic habitats, including leaf litters, forests, dungs, carrions, under stones or barks, on flowers, under seaweed, in fungi, and in the nests of birds, mammals, and social insects (Anlas, 2009). The majority of rove beetles are free-living predators of other small arthropods and some species play important roles in biological control of insect pests with agricultural and medicinal importance (Maus et al., 1998; Polaszek, 1998). According to the Palaearctic catalogue (Lobl and Smetana, 2004) and recent contributions to this family, rove beetles are represented in Iran by 677 valid (sub-) species (Anlas and Newton, 2010; Assing, 2011). This species number is much less than those recorded from many smaller countries in the Palearctic region, such as Turkey (with 1600 species) (Anlas, 2009), Czech Republic (with 1403 species) (Bohac et al., 2007), and Romania (with 1200 species) (Stan, 2004). The subfamily Staphylininae Latreille 1802, with more than 140 identified species (Anlas and Newton, 2010), is considered as the largest subfamily of rove beetles in Iran. The genus Philonthus is a very large worldwide genus of this subfamily with more than 1000 described species found in a wide variety of habitats (Newton et al., 2000). In this paper, six additional records of the genus are *Corresponding Author: nozari@ut.ac.ir 2015 FERDOWSI UNIVERSITY OF MASHHAD, IRAN

56 52 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 reported from Iran. These species are based on materials collected from Mazandaran province (north of Iran) during MATERIAL AND METHODS The materials referred to in this study are deposited in the Zoological Museum located at the College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran. The samples were collected through direct monitoring of forest leaf litter, dungs, decaying materials, carrions, riparian edges, etc. Adult beetles were preserved in jars containing 75% ethanol in the field and pinned before drying. The faunestic list contained localities, altitude, GPS coordinates, collecting date, number, and sex of each specimen examined. Morphological studies were carried out using a Stereomicroscope (Olympus SZ40, Japan) and photographs were taken using a digital camera (Canon, IXUS 132). RESULTS Tribe Staphylinini Latreille, 1802 Subtribe Philonthina Kirby, 1837 Genus Philonthus Stephens, 1829 Philonthus juvenilis Peyron, 1858 (Fig. 1, a-b) Examined materials: Valasht Lake (36º32'15.36'' N, 51º17'15.23'' E, elev: meters ASL), 2, 3, riparian edge of the lake, leg: SM Tabadkani, Distribution: East Europe, Cyperus, and Turkey, new record for Iran. Philonthus micans (Gravenhorst, 1802) (Fig. 1, c-d) Examined materials: Marzanabad (36º46'49.11'' N, 51º16'23.02'' E, elev: meters ASL), 3, 2, leaf litter in riparian edge, leg: SM Tabadkani, Najjardeh Village, Noshahr (36º36'27.31'' N 51º33'57.95'' E, elev: meters ASL), 2, 4, forest leaf litters, leg: SM Tabadkani, Distribution: Algeria, Morocco, Kazakhstan, North America, Turkey, and whole Europe, new record for Iran. Philonthus longicornis Stephens 1832 (Fig. 1, e-f) Examined materials: Valiabad Village, Tehran-Chalous Road (36º14'23.22'' N, 51º17'51.72'' E, elev: meters ASL), 2, 4, riparian edges, leg: SM Tabadkani, Distribution: This is a cosmopolitan species distributed across all geographic regions. It is reported for the first time from Iran. Philonthus viridipennis Fauvel 1875 (Fig. 1, g-h) Examined materials: Noshahr (36º32'07.67'' N, 51º38'21.85'' E, elev: 986 meters ASL), 2, 3, Chalous (36º38'20.31'' N, 51º25'03.19'' E, elev: 122 meters ASL), 4, 1, riparian edges, leg: SM Tabadkani, Distribution: Although, the distribution of this species is not clear, it may be native to West Palearctic region including Romania, and Czech Republic, new record for Iran. Philonthus wuesthoffi Bernhauer 1939 (Fig. 1, i-j) Examined materials: Noshahr (36º32'07.43'' N, 51º37'52.34'' E, elev: meters ASL), 3, 1, riparian edges, leg: SM Tabadkani, , Chalous (36º37'46.48'' N, 51º26'56.28'' E, elev: 132 meters ASL), 1, 1, riparian edges, leg: SM Tabadkani, , Ramsar (36º52'39.01'' N, 50º33'38.21'' E, elev: 694 meters ASL), 1, 4, riparian edges, leg: SM Tabadkani, ,

57 NEW RECORDS OF STAPHYLINIDAE FROM IRAN 53 FIGURE 1. a-b) Philonthus juvenilis, c-d) Philonthus micans, e-f) Philonthus longicornis, g-h) Philonthus viridipennis, i-j) Philonthus wuesthoffi, k-l) Philonthus spinipes; a, c, e, g, i and k) dorsal habitus, b, d, f, h, j, and l) aedeagus in lateral and ventral views, Scale bars: 1 mm. Babolsar (36º41'50.55'' N, 52º40'51.01'' E, elev: 35.5 meters ASL), 2, 5, riparian edges, leg: SM Tabadkani, Distribution: China, Japan, North Korea, South Korea, Russia, Far East, Ukraine and Romania, new record for Iran. Philonthus spinipes Sharp, 1874 (Fig. k-l) Examined materials: Valiabad Village, Tehran-Chalous Road (36º14'22.17'' N, 51º17'52.68'' E, elev: 587 meters ASL), 7, 5, decaying plant matter and dung, leg: SM Tabadkani, Distribution: This species probably originally occurred in Far East of Asia, although, it has extended its distribution range westward and now, is now known from the entire Palaearctic region including Armenia, Europe, China (Fujian), Japan, Kazakhstan, Korea, Thaiwan, and Turkey (Schillhammer, 1999). It is reported for the first time from Iran.

58 54 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 TABLE 1. Checklist of Philonthus recoreded from Iran. Species Collection area(s), province(s) Reference(s) Philonthus aeneipennis Boheman 1858 unspecified See Anlas & Newton, 2010 Philonthus atratus (Gravenhorst 1802) North Iran See Anlas & Newton, 2010 Philonthus biskrensis Fagel 1957 Khuzestan, unspecified See Anlas & Newton, 2010 Philonthus broumandi Bohac 1981 Khuzestan (Endemic) See Anlas & Newton, 2010 Philonthus carbonarius (Gravenhorst 1802) unspecified See Anlas & Newton, 2010 Philonthus caucasicus Nordmann 1837 Kordestan See Anlas & Newton, 2010 Philonthus cognatus Stephens 1832 Fars, Mazandaran See Anlas & Newton, 2010 Philonthus concinnus (Gravenhorst 1802) Mazandaran, unspecified See Anlas & Newton, 2010 Philonthus cruentatus (Gmelin 1790) unspecified Smetana, 2004 Philonthus debilis (Gravenhorst 1802) North Iran See Anlas & Newton, 2010 Philonthus dimidiatipennis Erichson 1840 Khuzestan, Unspecified See Anlas & Newton, 2010 Philonthus discoideus (Gravenhorst 1802) Sistan Baluchestan See Anlas & Newton, 2010 Philonthus ebeninus ebeninus (Gravenhorst 1802) Golestan, Unspecified See Anlas & Newton, 2010 Philonthus filator (Tottenham 1953) Guilan Khormali, 2013 Philonthus infirmus Erichson 1840 Unspecified Smetana, 2004 Philonthus intermedius Lacordaire 1835 Mazandaran, Unspecified See Anlas & Newton, 2010 Philonthus irakoiranicus Scheerpeltz 1961 Khuzestan See Anlas & Newton, 2010 Philonthus khouzestanicus Bohac 1981 Hormozgan, Khuzestan, Sistan Baluchestan See Anlas & Newton, 2010 Philonthus juvenilis Peyron, 1858 Mazandaran Present paper Philonthus laminatus (Creutzer 1799) Mazandaran See Anlas & Newton, 2010 Philonthus longicornis Stephens 1832 Mazandaran Present paper Philonthus micans (Gravenhorst, 1802) Mazandaran Present paper Philonthus nitidicollis (Lacordaire 1835) Mazandaran, Tehran See Anlas & Newton, 2010 Philonthus parvicornis (Gravenhorst 1802) Mazandaran See Anlas & Newton, 2010 Philonthus picimanus (Menetries 1832) Mazandaran See Anlas & Newton, 2010 Philonthus politus (Linnaeus 1758) Northwest Iran See Anlas & Newton, 2010 Philonthus punctus punctus (Gravenhorst 1802) Northwest Iran, Unspecified See Anlas & Newton, 2010 Philonthus punctus rapillyi Jarrige 1971 Fars See Anlas & Newton, 2010 Philonthus quisquiliarius (Gyllenhal 1810) Unspecified See Anlas & Newton, 2010 Philonthus rotundicollis (Menetries 1832) East Azerbaijan, Mazandaran See Anlas & Newton, 2010 Philonthus rubripennis Stephens 1832 Unspecified See Anlas & Newton, 2010 Philonthus salinus Kiesenwetter 1834 Guilan See Anlas & Newton, 2010 Philonthus schaeuffelei Scheerpeltz 1961 Khuzestan See Anlas & Newton, 2010 Philonthus spinipes Sharp 1874 Mazandaran Present paper Philonthus splendens (Fabricius 1793) Unspecified Smetana, 2004 Philonthus succicola Thomson 1860 Golestan See Anlas & Newton, 2010 Philonthus tenuicornis Mulsant & Rey 1853 Guilan See Anlas & Newton, 2010 Philonthus turbidus Erichson 1840 Unspecified Smetana, 2004 Philonthus varians (Paykull 1789) Mazandaran, Tehran See Anlas & Newton, 2010 Philonthus velatipennis Solsky 1870 Golestan, Hormozgan, Sistan Baluchestan See Anlas & Newton, 2010 Philonthus ventralis (Gravenhorst 1802) Unspecified See Anlas & Newton, 2010 Philonthus viridipennis Fauvel 1875 Mazandaran Present paper Philonthus wuesthoffi Bernhauer 1939 Mazandaran Present paper DISCUSSION In this study, six species of the genus Philonthus were identified as new records for the fauna of Iran. By inclusion of these species, the Philonthus fauna of Iran raises to 43 valid species. The distributional checklist of this genus has been summarized in Table 1. A simple comparison of this species number with those recorded for adjacent countries such as Turkey (with 62 species, Anlas, 2010), and Czech Republic (with 58 species, Bohac et al., 2007) reveals that the fauna of this genus in Iran is relatively poorly understood. Therefore, continued faunestic studies in different geographical areas would result in significant increase in our knowledge on real situation of this genus in Iran.

59 NEW RECORDS OF STAPHYLINIDAE FROM IRAN 55 ACKNOWLEDGMENTS The authors appreciate Dr. Harald Schillhammer (Naturhistorisches Museum Vien, Austria) for their generous helps in examination and confirmation of species identification referred to in this study. LITERATURE CITED Anlas, S., Distributional checklist of the Staphylinidae (Coleoptera) of Turkey, with new and additional records. Linzer biologische Beitrage 41, Anlas, S., Deveci, O., New records of Staphylinidae from Turkey, Syria, and Iran (Insecta: Coleoptera). Turkish Journal of Zoology 35, Anlas, S., Newton, A.F., Distributional checklist of the Staphylinidae (Coleoptera) of Iran, with new and additional records. Linzer biologische Beitrage 42, Assing, V., On the Staphylinidae (Coleoptera) of Iran. II. New species and additional records, with special reference to the Paederinae, Xantholinini, and Aleocharinae. Stuttgarter Beiträge zur Naturkunde A, 4, Bohac, J., Matejicek, J., Rous, R., Check-list of staphylinid beetles (Coleoptera, Staphylinidae) of the Czech Republic and the division of species according to their ecological characteristics and sensitivity to human influence. Casopis Slczskeho Musea v Opav (A) 56, Janak, J., Bordoni, A., Revision of the genus Achmonia of Africa south of the Sahara (Coleoptera: Staphylinidae: Staphylininae). Zootaxa 3872, Khormali J (2013) Faunestic study on rove beetles (Coleoptera: Staphylinidae) in Rasht (Guilan province, North of Iran). MSc Thesis, University of Guilan (in Persian with English abstract). Lobl, I., Smetana, A., Catalogue of Palaearctic Coleoptera. volume 2. Hydrophiloidea, Histeroidea, staphylinoidea. Apollo books, Stenstrup. Maus, C., Mittmann, B., Peschke, K., Host records of the parasitoid Aleochara Gravenhorst species (Coleoptera: Staphylinidae) attacking puparia of cyclorrhapheous Diptera. Deutsche Entomologische Zeitschrift 45, Newton, A., Thayer, M.K., Ashe, J.S., Chandler, D.S., Staphylinidae Latrielle, In: American beetles: Archostemata, Myxophaga, Adephaga Polyphaga: Staphyliniformia (Arnett RH, Thomas MC, eds.). CRC Press, New York. pp Polaszek, A., African cereal stem borers: economic importance, taxonomy, natural enemies and control. CAB International, Wallingford, Oxon, UK, 530 pp. Schillhammer, H., Revision of the East Palaearctic and Oriental species of Philonthus Stephens, part 2. The spinipes and cinctulus groups (Coleoptera: Staphylinidae, Staphylininae). Koleopterologische Rundschau 69,

60 56 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 Smetana, A., Staphylinidae, subfamilies Omaliinae, Dasycerinae, Phloecharinae, Apaticinae, Piestinae, Staphylininae. In: Lobl I, Smetana A (eds.). Catalogue of Palaearctic Coleoptera. Volume 2. Hydrophiloidea, Histeroidea, Staphylinoidea. Apollo Books, Stenstrup, pp Stan, M., Checklist of Staphylinids (Coleoptera: Staphylinidae) of Romania. Travaux du Museum d Histoire Naturelle Grigore Antipa 46,

61 Iranian Journal of Animal Biosystematics(IJAB) Vol.11, No.1, 57-63, 2015 ISSN: X (print); (online) A new Nebria species (Carabidae: Nebriini) and a new Deltomerus species (Carabidae: Patrobini) from high mountain areas of Azarbayjan-e Gharbi Province, Iran Muilwijk, J. Korhoenlaan 41, 3721 EB Bilthoven, Nederland (Received: 15 February 2015; Accepted: 25 June 2015) During a comprehensive study of the genus Stenus (Staphylinidae) along streams and river banks in Iran, some ground beetles (Carabidae) were also collected. In the high mountain areas along the Iranian-Turkish border in the province of Azarbayjan -e Gharbi, a Nebria and a Deltomerus species were found. These Nebria and Deltomerus species were clearly different from known Iranian species, but related to Turkish species. Nebria (Nebria) azarbayanei sp. nov. is compared with the related N. (N.) thonitida Ledoux and Roux Deltomerus (Deltomerus) veldkampi sp. nov. is compared with the closely related D. (D.) lodozi Ledoux Differences between these new species and the related species are discussed. Pterostichus cryobioides Chaudoir 1868 and Nebria (N.) mandibularis Bates 1872 are recorded for the first time from Iran. Key words: Coleoptera, Carabidae, Nebria, Deltomerus, Pterostichus, new species, new records, Iran. INTRODUCTION Within a sample of Iranian Carabid beetles collected by Johannes Frisch (Museum für Naturkunde, Berlin) and Sayeh Serri (Hayek Mirzayans Insect Museum, Tehran) given to me for identification, several interesting species were found, including a Deltomerus, two Nebria and a Pterostichus species different from known Iranian species(löbl & Smetana, 2003). The Deltomerus species and one Nebria species were undescribed, and the description is given below. MATERIAL AND METHODS Morphological features of the beetles were examined using a stereomicroscope LEICA MZ12.5. Macro photos were taken using a Sony NEX 5N digital camera and Nikon macro 105 mm lens. Male genitalia were dissected, cleaned and mounted in Euparal on transparent labels under the respective specimens. Drawings of aedeagi were made using photographs taken with a ZEISS Discovery V12 stereomicroscope. The morphological terminology is borrowed from Duff (2012). Abbreviations used in the text are as follows: Length: total body length (measured from the anterior margin of clypeus to the apex of elytra). *Corresponding Author:Jan.Muilwijk@gmail.com 2015 FERDOWSI UNIVERSITY OF MASHHAD, IRAN

62 58 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 HL: head length (measured from the anterior margin of clypeus to the base). PL: pronotum length (measured along the middle line). EL: elytral length (measured along suture from the elytral base to the apex). HW: maximum width head. PW: maximum width of pronotum. EW: maximum width of elytra. Acronyms of the collections: MNB:Museum für Naturkunde, Berlin, Germany. cmu: collection of Jan Muilwijk, Bilthoven, Nederland. cve: collection of Wim Veldkamp, Eibergen, Nederland. RESULTS Nebria (Nebria) azarbayanei sp. nov. (Figs. 1-2). Type material. Holotype male with label: Iran, Azarbayjan-e Gharbi/ Khoy Siyah Chesmeh road/17 km W Zar Abad 2640m/N E / , lg. Frisch & Serri /HOLOTYPUS (red label, printed)/nebria azarbayanei sp. nov./muilwijk det. 2014, Deposited in MNB. Paratype one male from the same place and date as holotype. Paratypewith label: PARATYPUS(red label, printed)/nebria azarbayanei sp. nov./muilwijk det Deposited in cmu. Description. Medium-sizedNebria with blackupperside and appendages.length: 12.6mm. Habitus as in Fig. 1. Head transverse (HL/HW 0.72), black, with a faint red spot, eyes small, slightly convex, temples almost parallel, about as long as the eyes. With superficial irregular reticulate microsculpture, and scattered shallow punctures. Margin of the labrum undulate, with six setiferous punctures. The antennae slender, reaching the anterior third of elytral length, antennomere I with two accessory setae and antennomere IV with five accessory setae. Pronotum transverse (PL/PW 0.67), smooth, distinctly cordate, maximum width before the middle. Lateral bead rather broad, with shallow punctures, one setiferous puncture in the middle and another in the hind angle. Fore angles protruding as small lobes. Hind angles sharply angled, clearly pointing backwards and somewhat upwards. Fore and hind margins straight. Basal foveae large and deep, with shallow punctures. Microsculpture superficially reticulate. Middle line shallow, from fore margin to back margin. Elytra oblong-elliptical (EL/EW 1.6), maximum width slightly after the middle. Humeri rounded. Striae clear, superficially punctated, interstriae flat, 3 e interval with three-four punctures. Scutellar pore present. Keel at apex clear. With superficial reticulate microsculpture, wingless. Legs short and stout.

63 NEW NEBRIA AND DELTOMERUS SPECIES FROM IRAN 59 Ventral side: mentum with two teeth. Each sternite with two hairs, and two hairs on each side along the apical margin of the anal sternite. Meso- and metepisternum and first visible sternite with scattered shallow punctures. Mesoepisternaabout as long as broad. Male genitalia: aedeagus short, base large as in Fig 2. Intraspecific variation: length paratype: 12.6 mm. Differential diagnosis: N. (Nebria) azarbayanei sp. nov. is compared with the related N. thonitida Ledoux and Roux 1990 from East Turkey. The lateral bead of the pronotum of N. thonitida clearly narrows to the fore angles, the red spot on the disc of the head more clear, eyes more protruding, elytral striae more flat, metatarsi more slender and appendages more rufous. Distribution. Known so far only from the type locality. Collected along a stream bank. Etymology. Named after the Iranian province where this species was found. Deltomerus (Deltomerus) veldkampi sp. nov. (Figs. 3-5). Type material. Holotype male with label: Iran Azarbayjan-e Gharbi/18 km S. Ziveh (Ulugh Dagh)/N E / , lg. Frisch & Serri.HOLOTYPUS(red label, printed)/deltomerus veldkampi sp. nov./muilwijk det. 2014, deposited in MNB. Paratypes, 13 males and 11 females from the same place and date as holotype. Paratypes with label: PARATYPUS (red label, printed)/deltomerus veldkampi sp. nov./ Muilwijk det Paratypes are deposited in cmu, cve and MNB. Description. A very large, dark Deltomerus with elongated metatrochanters visible from the upperside. Head black, pronotum and elytra very dark brown, only labrum, tarsi and palpi dark rufous. Length: 13.4 mm. Habitus as in Fig. 3. Head as broad as long (HL/HW 0.99), eyes small, temples slightly longer than eye diameter. Neck constriction rather superficially, raised edge with coarse punctures. Frontal furrows distinct, rather deep. Disc a little bit shiny with scattered punctures, with three supraorbital and 3-5 occipital setiferous punctures on each side. Labrum slightly concave with five setiferous punctures. Antennae short, reaching backwards to the anterior sixth of the elytral length, antennomerae I and II with 4 accessory setae. Pronotum subcordate and broad, transverse (PL/PW 0,83), lateral sides more or less parallel before the hind angles. Anterior margin straight, anterior angles small and not projecting before apex, lateral bead small with 4-9 setiferous punctures and 1 in the hind angles. Hind angles straight, not protruding laterally. Dull by irregular dense microsculpture, with scattered shallow punctures. Inner basal foveae clear, half-moon shaped bent inwards, outer basal foveae reduced, short and straight. Middle line clear, evanescent to fore margin and hind margin.

64 60 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 FIGURE. 1. Nebria (Nebria) azarbayanei sp. nov., holotype male; habitus, dorsal aspect. Scale: 5 mm. FIGURE 2. Median lobe of aedeagus, right lateral aspect. Scale: 1 mm.

65 NEW NEBRIA AND DELTOMERUS SPECIES FROM IRAN 61 Elytra oblong-elliptical (EL/EW 1.8) with maximum width in the middle, humeri indicated with a small tooth. Striae fine, interstriae flat, 3 e interstria with four setiferous punctures. Dull by regular dense microsculpture. Wingless. Legs short, fore tibia with an elongated spine at the apex and at the base of the antennal cleaner. Tarsomeres with scattered setae. Apical lateral side of mesotibia with a dense bristle of setae. Metatrochanter slightly shorter than one half of metafemur length. Ventral side: mentum bifid. Sternites with on each side one setiferous puncture in the middle, anal sternite at one side with three and at the other side with four setiferous punctures along the apical margin, meso- and metasternum and sternites at the lateral sides with scattered punctuation. Anal sternite of male with superficial basal circular impression. Male genitalia: aedeagus strongly curved downwards with a large sclerite near the base (Fig. 4), distal part on left side narrowed before the rounded apex, with 3 spines as in Fig.5. Intraspecific variation: length: Paratypes with six setiferous punctures on the labrum. Immature specimens light brown. Differential diagnosis: D. (Deltomerus) veldkampi sp. nov. is compared with D. (Deltomerus) lodozi Ledoux 1976, the only other known Deltomerus species with elongated metatrochanters. D. lodozi differs from the new species by more slender pronotum and body, setiferous punctures on interstriae V and VII, number of supraorbital and setiferous occipital punctures (resp. 4 and 8inD. lodozi; 3 and max. 5 in the new species), form and number of sclerites in the aedeagus and more redappendages. Distribution. Known so far only from the type locality. Collected along a stream bank. Etymology. Dedicated to Wim Veldkamp (Eibergen, Nederland), enthusiastic collector of Coleoptera and nature lover. DISCUSSION At present eight Nebria species with several subspecies have been known from Iran (Ledoux and Roux, 2005); four species of the subgenus Eunebria and four species of the subgenus Nebria. Identification tables and descriptions for these species and subspecies are found in Ledoux and Roux, N. (N.) azarbayanei sp. nov. differs from the known Iranian species from the subgenus Nebria by its slender stature and is related to the high mountain species of Turkey.Furthermore, four male specimens of N. (N.) mandibularis Bates 1872 were collected. The description of N. mandibularis Bates was based on a single male from a collection made in Northern Persia, Kurdistan and Mesopotamia. Ledoux & Roux, 2005 described N. mandibularis based on specimens from Cilo Dag and Sat Dag near Oramar in Turkey. Comparison of a male specimen from Turkey with the Iranian material showed differences between them. Unfortunately, the holotype of this species could not be found for further taxonomic research. Currently, the Deltomerus fauna of Iran consists of eight species (Zamojtaljov, 2001; Deuve, 2010). The davatchii group sensu Zamojtaljov, 2001 from Elburs Mts. is characterized by a row of setiforous punctures in the 8 th interstria and the possession of a single dentiform apical sclerite in the aedeagus (Zamojtaljov, 2001). According to the description of D. boroumandi Deuve 2010, this species belongs

66 62 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 FIGURE 3.Deltomerus (Deltomerus) veldkampi sp. nov., holotype male; habitus, dorsal aspect. Scale: 5mm. FIGURE 4. Deltomerus (Deltomerus) veldkampi sp. nov., median lobe of aedeagus, dorsal aspect. Scale: 1mm. FIGURE 5.Deltomerus (Deltomerus) veldkampi sp. nov., median lobe of aedeagus, left lateral aspect. Scale: 1mm.

67 NEW NEBRIA AND DELTOMERUS SPECIES FROM IRAN 63 to the davatchii group. All species of the davatchii group are rather slender. Based on the strong stature and short antennae, D. veldkampi sp. nov. belongs to the lodozi group sensu Zamojtaljov, Until now, the lodozi group consists of two Turkish species, D. lodozi and D. punctatus Heinz & Ledoux, Four specimens of P. cryobioides were also collected. These rare species was compared with one specimen from Museum Prague, collected by B. von Bodemeyer in Luristan, identified by A. Jedlička. ACKNOWLEDGMENTS Azadeh Taghavian of the Muséum National d'histoire Naturelle, Paris for sending the types. Beulah Garner from Natural History Museum, London for cooperation. Walter Heinz was so kind to loan a paratype of D. lodozi. Ron Felix for making the drawings of the aedeagi and commenting the manuscript. Mr. P. Roux commented the description of N. azarbayanei. Johannes Frisch of the Museum für Naturkunde, Berlin for loaning the material from Iran. LITERATURE CITED Bates, H.W Notes on Cicindelidae and Carabidae, and descriptions of new species. The Entomologist's Monthly Magazine 9, Deuve,Th Nouveaux Nebriidae, Broscidae et Trechidae De Chine et D'Iran (Coleoptera, Caraboidea). Revue française d'entomologie (N.S.) 32, Ledoux, G Contribution a l'étude des Coléoptères Carabidae de Turquie. Trois nouvelles espèces de Deltomerus. Annales de la Société entomologique de France (N.S.) 12, Ledoux, G. & Roux, P Nebria (Coleoptera, Nebriidae): faune mondiale.société Linnéenne de Lyon, Lyon, 976 pp. Löbl, I. & Smetana A. (eds.) Catalogue of Palaearctic Coleoptera. Volume 1. Archostemata - Myxophaga - Adephaga. Apollo Books, Stenstrup, 819 pp. Zamotajlov, A.S Contribution to the knowledge of the carabid genus Deltomerus from the Middle East. Russian Entomological Journal 3,

68

69 Iranian Journal of Animal Biosystematics (IJAB) Vol.11, No.1, 65-77, 2015 ISSN: X (print); (online) Biosystematic study of Calomyscus mystax (Rodentia, Calomyscidae) from northeastern Iran Akbarirad, S. a, Darvish, J. a,b,c*, Aliabadian, M. a,c, Kilpatrick, C.W. M. d a Department of Biology, Faculty of Sciences, Ferdowsi University of Mashhad, Mashhad, Iran b Rodentology Research Department, Institute of Applied Zoology, Faculty of Sciences, Ferdowsi University of Mashhad, Mashhad, Iran. c Zoological Innovations Research Department, Institute of Applied Zoology, Faculty of Sciences, Ferdowsi University of Mashhad, Mashhad, Iran d Department of Biology, University of Vermont, Burlington, VT , USA (Received: 23 April 2015; Accepted: 29 June 2015) We use a combination of traditional and geometric morphometric plus phylogenetic analyses of mitochondrial cytochrome b sequences to confirm the presence in the Kopetdagh Mts. of northeastern Iran (North Khorasan province) of the Great Balkhan brush-tailed mouse, Calomyscus mystax Kashkarov, 1925 previously regarded as endemic to the Nibit-Dag region of southwestern Turkmenistan. We further compare C. mystax to other brush-tailed mice species in eastern and northern Iran and provide diagnostic external and craniodental characters for each and to examine the affinities with C. grandis with which C. mystax shares a similar karyotype. Key words: Calomyscus mystax; Kopetdagh Mts.; northeastern Iran. INTRODUCTION The Great Balkhan brush-tailed mouse, Calomyscus mystax Kashkarov, 1925 is known from the Great Balkhan Mountains in southwestern Turkmenistan where it was first described from Bolshoi (=Greater) Balkhan Mts. (Nibit-Dag region), Bolshoi Mugur (Kashkarov, 1925). Vorontsov et al. (1979) extended its geographic range to include the eastern region of the Lesser Balkhan and Kopetdagh Mts. in southern Turkmenistan and the North Khorasan and Mazanderan provinces of northeastern Iran. Musser and Carleton (1993), Meyer and Malikov (1995, 2000) and Pavlinov and Rossilimo (1998) included the Lesser Balkhans and Kopetdagh Mts. within the distribution of C. mystax. However, Meyer and Malikov (2000) recognized the forms from the central Kopetdagh Mts. of Turkmenistan as C. firiusaensis and forms from the western and central Kopetdagh Mts. of Turkmenistan as C. mystax zykovi. Musser and Carleton (2005) included both C. firiusaensis and C. mystax zykovi in C elburzensis and restricted C. mystax to southwestern Turkmenistan. C. mystax was recognized as a distinct species by Vorontsov et al. (1979) based on its morphology and geographic distribution and its morphometric divergence was further confirmed by Lebedev et al. (1998). Specimens of C. mystax from the Great Balkhan region have a karyotype with a 2N=44 and FN a =46, whereas most specimens currently recognized as have a karyotype with a *Corresponding Author: darvishj2001@yahoo.com 2015 FERDOWSI UNIVERSITY OF MASHHAD, IRAN

70 66 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 2N=44 and FN a =58 (Graphodatsky et al., 2000). A different cytotype with a 2N=30, FN a =44 has been reported from central and western Kopetdagh Mts. (Graphodatsky et al., 2000), which was described as C. mystax zykovi. Partial reproductive isolation (Meyer & Malikov, 2000) and differences in cranial measurements (Lebedev et al., 1998) have been reported between C. mystax zykovi and C. elburzensis., Musser and Carleton (2005) included C. mystax zykovi in and Norris et al. (2008) tentatively recognized it as a subspecies of this taxon. C. mystax possess an identical karyotype with C. grandis from central Elburz Mts. in Tehran province. This similarity may be the result of having a common ancestor which was disturbed throughout the Koptdagh and Elburz Mts. Alpine glaciations in the Pleistocene may have isolated the northern populations in Turkmenistan from the southern ones in Iran (Malikov et al., 1999) facilitating morphological and genetic divergence. However, sharing similar cytotype can also be as a consequence of convergence (Graphodatsky et al., 2000). The objectives of this paper were to determine the affinities of specimens recently collected from the Kopetdagh Mts. in northeastern Iran and to examine the phylogenetic affinities among the two taxa, C. mystax and C. grandis, that share a similar karyotype (2N=44; FN a =46). MATERIAL AND METHODS Our analyses included data from 78 specimens of Calomyscus from Iran and a single sample of C. mystax from Turkmenistan (Table 1). The Iranian material includes 61 samples provided by Zoology Museum of Ferdowsi University of Mashhad (ZMFUM) and 17 newly captured specimens. These samples were collected from 14 localities and include specimens of C. eburzensis, C. hotsoni, C. grandis and six samples of Calomyscus sp. (Table 1 and Fig. 1). All of the specimens from Iran are deposited in ZMFUM (supplemental data). In addition, ethanol preserved tissue from a single specimen of C. mystax from voucher deposited in the Zoological Institute in St. Petersburg, Russia, was provided by Vladimar Malikov and was utilized in the molecular analysis (supplemental data) TABLE 1. Locality, species and number of each species samples which were used in morphometric (first numbers) and molecular (second numbers in parentheses) analyses in this study. N Species Locality Coordinates (sequenced samples) City, province 2 (2) Calomyscus sp. Jodar, Kopetdagh Mts., North Khorasan N, E 3 (3) Calomyscus sp. Takale-ghoz, Kopetdagh Mts., North Khorasan N, E 1 (1) Calomyscus sp. Sumbar, Kopetdagh Mts., North Khorasan N, E 9 (2) KhajeMorad, Khorasan-e-Razavi N, E 4 (1) Torbat-e-Jam, Khorasan-e-Razavi N, 60.4 E 4 (3) Aghdarband, Khorasan-e-Razavi 36.5 N, E 2 (1) Dargaz, Kopetdagh Mts., Khorasan-e-Razavi N, E 27 (2) Neyshabur, Khorasan-e-Razavi N, E 4 (3) Chenaran, North Khorasan N, E 3 (1) Saluk, North Khorasan N, E 4 (2) Kurkhud, North Khorasan N, E 5 (1) FakhrAbad, Yazd N, E 5 (3) C. grandis Fasham, Tehran N, E 5 (4) C. hotsoni Saravan, Sistan-o-Baluchistan 27.3 N, E

71 CALOMYSCUS MYSTAX FROM NORTHEASTERN IRAN 67 FIGURE 1. Sampling localities represented for four species of Calomyscus. Molecular analyses Genomic DNA was extracted from fresh or 96% ethanol preserved muscle or liver tissue using a standard salt method extraction (Bruford et al., 1992). The mitochondrial cytochrome b gene was amplified using the modified universal L7 and H6 primers and protocol of Montgelard et al. (2002) or the primers and protocol used by Norris et al. (2008). PCR products were either sequenced at the Macrogen Company, Republic of South Korea or on an Applied Biosystem 373 automated DNA sequencer at the University of Vermont, USA. The sequences were aligned and edited by BioEdit v (Hall, 1999). Mean genetic distance (K2P) was calculated within and among pairwise comparisons of species using Mega5 (Tamura et al. 2011) and ExcaliBAR (Aliabadian et al., 2014). Bayesian analyses were conducted with MrBayes (Ronquist & Huelsenbeck, 2003), using a TVM+I+G model of molecular evolution. Four Markov Chain Monte Carlo (MCMC) were run simultaneously for 6 million generations and the first 60,000 trees (as a conservative burn-in ) were discarded. Posterior probabilities were calculated from the remaining trees using a majority-rule consensus analysis. The Bayesian tree was rooted with Spalax ehrenbergi from Spalacidae (Muroidea) and basal to the Eumorida (which included Calomyscidae) (Steppan et al., 2004). Cytb sequences of the outgroup, two additional C. hotsoni and three C. baluchi were retrieved from GenBank (supplementary data). Morphometric analyses Four external (BL: body length, TL, tail length, EL: ear length and FL: hind foot length), 15 cranium and 12 dental variables were measured from adult specimens by a rule, digital caliper and measurescope, respectively (Fig. 2). Measurements were checked for normality with a Shapiro-Wilk test and the presence of sexual dimorphism and significant of differentiation of variables among species and groups were evaluated by ANOVAs. Eleven external and cranium measurements of type specimens of C. mystax recorded by Kashkarov (1925) were compared with four groups of brushtailed mice.

72 68 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 FIGURE 2. Description of cranial and dental measurements. 1-LLD (lower length of diastema); 2-MH (mandibular height); 3-UDL (upper diastema length); 4-NL (nasal length); 5-ZW (zygomatic width); 6-Forl (length of anterior palatine foramen); 7-NW(nasal width); 8-SH (skull height); 9-Occl (occipitonasal length); 10-CW (cranium width); 11-CBL (condylobasal length); 12-Patl (palatal length); 13-Mxl (maxillary tooth row); 14-Mnl (mandibular tooth row); 15-Mndl (mandible length); 16-M.1L (length of M1); 17-M.1W (width of M1); 18-M.2L (length of M2); 19-M.2W (width of M2); 20-M.3L (length of M3); 21-M.3W (width of M3); 22-m1.L (length of m1); 23-m1.W (width of m1); 24-m2.L (length of m2); 25-m2.W (width of m2); 26-m3.L (length of m3); 27-m3.W (width of m3). Canonical Variate Analysis was conducted on four groups of brush-tailed mice. All the statistical analyses were performed using PAST v2.08 (Hammer et al., 2001) and SPSS Base 20 (SPSS Inc. 2011). Geometric-morphometric analyses Shape variations in cranium and mandible were evaluated based on eight digitized landmarks on the dorsal side of the skull and 12 landmarks on the labial side of the mandible of each specimen (Fig. 3). Landmarks were digitized using the software TpsDig (Rohlf, 2001) and then significant differences among groups was calculated using ANOVA (in PAST). Landmark configurations were superimposed with procrustes method. Shape variations among superimposed configurations were visualized as a thin-plate spline deformation grid, and also through a canonical variate analysis of landmark coordinates or wrap scores. Discriminant function analyses were then conducted to explore shape changes in pairs of groups.

73 CALOMYSCUS MYSTAX FROM NORTHEASTERN IRAN 69 FIGURE 3. Landmarks depicted on dorsal view of the studied skulls (a) and labial side of mandible (b). RESULTS Molecular results Cytochrome b sequences consisting of 988 bases without any stop codon were utilized for phylogenetic analysis. A total of 142 different mutations were observed among the sequenced examined and of these 988 bps, 117 sites were variable and 87 were parsimony informative. The phylogenetic tree (Fig. 4) constructed with Bayesian analysis placed the samples of brush-tailed mice captured from Kopetdagh Mountains in northeastern Iran, which had not previously been assigned to any species of Calomyscus, with C. mystax from Turkmenistan. This C. mystax clade containing sequences from both Turkmenistan and Iran was highly support with a posterior probability of 100% (Fig. 4). This C. mystax clade was the sister group to a C. grandis and clade, forming a group of 3 species that all have a diploid number of 44. Low K2P genetic distance, 1.4%, was observed between individuals of Calomyscus sp. from northeastern Iran and C. mystax from Turkmenistan, in comparison to their mean genetic distances with other species (13.82%). Morphoemtric results Most of the variables had a normal distribution and no sexual dimorphism was detected in our analyses (p>0.05). ANOVA and Tukey's test were conducted for identifying cranium and dental variables that differed significantly (p<0.05) among specimens from the Kopetdagh Mts. in northeastern Iran which were recognized as C. mystax based on their cyt b sequences, with other species of brush-tailed mice occurring in northern Iran. C. mystax, as well as specimens of C. hotsoni and, showed significant shorter lower and upper diastem, shorter nasal, anterior palatine foramen, occipitonasal, condylobasal, palatal and mandible, with narrower nasal and cranium than C. grandis (Table 2). Specimens of C. mystax differed significantly from in the neighboring regions in length of ear, lower diastem and third lower molar that were shorter in C. mystax. The only difference of C. mystax and C. hotsoni was in wider rostrum in the former species. In addition, C.

74 70 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 FIGURE 4. Phylogenetic tree based on the Bayesian analysis of Calomyscus species cytochrome b data. Posterior probability values are indicated for each node with significant level>95. hotsoni had significantly shorter upper diastema, nasal, anterior palatine foramen and palatal with narrower nasal than. The mean of eleven external and cranial measurements of two type specimens of C. mystax recorded by Kashkarov (1925) were compared with external and cranium linear measurements of samples from northeastern Iran which clustered with C. mystax in phylogenetic tree. The mean of two individuals measures of Kashkarov' (1925) C. mystax are situated in the range of 5 specimens' external and cranium quantities of brush-tailed mice from northeastern Iran in the present study (Table 3) and confirmed belonging these 5 specimens to C. mystax species. In the canonical variate analysis the first and second axes contained 56.67% and 28.02% of total variance, respectively (Table 4) and significant separation was observed among each species (Fig. 5). In the first CV, and C. mystax overlapped with each other, but are separated from C. grandis and C. hotsoni (Fig. 5). The CV2 discriminated two species of and C. grandis from two others, C. hotsoni and C. mystax (Fig. 5). Mahalanobis distances between group centroids were estimated which showed significant separation among these four species of brush-tailed mice (Table 5).

75 CALOMYSCUS MYSTAX FROM NORTHEASTERN IRAN 71 TABLE 2. Means, standard errors and range of variation for morphometric measurements in four species of Calomyscus (n= sample size). Taxon C. grandis n=5 C. hotsoni n=5 n=63 C. mystax n=5 Variables Mean±Sd Min-Max Mean±Sd Min-Max Mean±Sd Min-Max Mean±Sd Min-Max BL 79.20± ± ± ± TL 91.20± ± ± ± FL 20.40± ± ± ± EL 14.60± ± ± ± LLD 3.56± ± ± ± HLD 2.17± ± ± ± MH 5.96± ± ± ± UDL 7.08± ± ± ± NL 10.54± ± ± ± ZW 12.84± ± ± ± Forl 5.15± ± ± ± NW 3.28± ± ± ± Intw 4.05± ± ± ± SH 8.00± ± ± ± Occl 26.33± ± ± ± CW 11.84± ± ± ± CBL 23.23± ± ± ± Patl 12.07± ± ± ± Mxl 3.41± ± ± ± Mnl 3.35± ± ± ± Mndl 13.42± ± ± ± M.1L 1.601± ± ± ± M.1W 1.070± ± ± ± M.2L 1.202± ± ± ± M.2W 1.103± ± ± ± M.3L 0.545± ± ± ± M.3W 0.746± ± ± ± m1.l 1.418± ± ± ± m1.w 0.926± ± ± ± m2.l 1.222± ± ± ± m2.w 1.004± ± ± ± m3.l 0.735± ± ± ± m3.w 0.677± ± ± ± TABLE 3. Comparison of eleven morphometric variables between two type specimens of C. mystax and five specimens from northeastern Iran. Variables Type specimens of C. mystax Samples from northeastern Iran Mean Minimum Maximum BL EL FL Occl CW NL NW Forl Intw Mxl Mnl

76 72 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 FIGURE 5. Scatter plot of the first two canonical variates of morphometric variables with the most important character vectors on the first two CV axes. TABLE 4. Eigenvalue, percentage of total variance and cumulative percentage of principal component loading in four species of Calomyscus for the first two CV axes. Functions Eigenvalues %Variance % Cumulative TABLE 5. Mahalanobis distances between pairs of centroid groups (p<0.05). *: indicated the significant separation between groups. C. grandis C. hotsoni C. mystax C. grandis C. hotsoni * * * C. mystax * * * Geometric-morphometric results No sexual dimorphism in dorsal cranium and mandible shape analyses (p>0.05) was detected. The first two CVA factors for cranium and mandible explained 54.88% and 33.4% of total variance, respectively. Relative wraps analysis was conducted to explore shape variability along the axis of maximum covariation within the data. In the analysis of the cranium, the first axis separated C. grandis in the negative side with longer nasal and interparietal bones and shorter parietal than other three species by actual landmarks (Fig. 6A). This species had the widest zygomatic arc represented by semi-landmarks. Based on the second axis C. mystax and C. hotsoni have shorter nasal and parietal and longer frontal (actual landmarks) and wider zygomatic arc (semi-landmarks) than (Fig. 6A). In the canonical variate analysis of mandibular shape, the first CV characterized C. mystax and C. grandis with lower position of coronoid process in comparison to the other two species. Whereas C. mystax and showed shorter height of lower diastema and narrower angular process than C. grandis and C. hotsoni in the positive deviation of second CV (Fig. 6B).

77 CALOMYSCUS MYSTAX FROM NORTHEASTERN IRAN 73 FIGURE 6. Plot of canonical variate scores for landmarks on dorsal side of cranium of Calomyscus (A); Plot of canonical variate scores for landmarks on labial side of mandible of Calomyscus (B). The eight and twelve actual landmarks on cranium and mandible, respectively, have been joined by semilandmarks. DISCUSSION Vorontosov et al. (1997) first recognized the karyotypic difference between C. mystax (2N=44) and C. urartensis (2N=32). Meyer and Malikov (2000) reported two cytotypes of brush-tailed mice from the Kopetdagh Mts. in southwestern and southcentral Turkmenistan. One cytotype with a 2N=30, FN a =40 was recognized as a subspecies of C. mystax (C. m. zykovi) and the other with a 2N=44, FN a =58 was described as a new species, C. firiusaensis (Meyer & Malikov 2000). The later cytotype is also known from northeastern and eastern Iran (Esmaeili et al. 2008) and both C. fiiusaensis and C. mystax zykovi have been considered synonyms of (Musser & Carleton, 2005; Norris et al., 2008). Karyotypes with a 2N=44 have been described from C. mystax (Meyer & Malikov 1995, 2000, Vorontosov et al. 1997, Malikov et al. 1999, Graphodatsky et al. 2000) and C. grandis (Graphodatsky et al. 2000) both with a FN a =46 and as described above with a FN a =58. Although C. grandis and C. mystax share an identical karyotype, they were not found to share a common ancestor in our phylogenetic analysis. Six specimens of Calomyscus from Kopetdagh Mts. in northeastern Iran were analyzed in this study. Cytochrome b sequences from these six samples form a well supported clade with the sequence

78 74 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 from a single specimen of C. mystax from Turkmenistan. These specimens from the Kopetdagh Mts. were recognized as C. mystax based on their placement in phylogenetic analysis of Cytb gene and the low genetic distance observed between them and a specimen of C. mystax from near the type locality. Discriminant analysis of cranial measurements has distinguished individuals of C. mystax from Turkmenistan (Lebedev et al., 1998). The present morphometric and geometric-morphometric studies also separated specimens of this species from three other species. C. mystax had shorter and narrower cranium and nasal than C. grandis; shorter ear, nasal, parietal, lower diastema and M3.L and wider zygomatic than and wider nasal than C. hotsoni (Fig. 6A). The lower position of coronoid process of the mandible distinguished C. mystax from and C. hotsoni (Fig. 6B). The range of C. mystax has been controversial with some workers (Graphodatsky et al. 2000, Musser & Carleton, 2005; Norris et al., 2008) restricting it distribution to the Great Balkhan Mountains, whereas other workers (Vorontsov et al. 1979, Musser and Carleton 1993, Meyer and Malikov 1995, 2000, Pavlinov and Rossilimo 1998) have expanded its distribution to include the Lesser Balkhans and Kopetdagh Mts. of Turkmenistan and northeastern Iran. We extended the known range of C. mystax from the area of the Greater Balkhan Mts. of Turkmenistan to include more southern regions in central Kopetdagh Mts. of northeastern Iran. ACKNOWLEDGMENTS Samples from North Khorasan province were collected in "Rodent Fauna of North Khorasan province project" with code of project: in Research Projects of Ferdowsi University of Mashhad. This work was financed principally by Iran National Science Foundation: INSF (INSF contribution no ). We thank Dr. Vladimir Malikov for providing tissue from C. mystax from Turkmenistan. LITERATURE CITED Aliabadian, M., Nijman, V., Mahmoudi, A., Naderi, M., Vonk, R., Vences, M ExcaliBAR: a simple and fast software utility to calculate intra- and interspecific distances from DNA barcodes. Contributions to Zoology 83: Bruford, M. W., Hanotte, O., Brokfield, J. F. Y., Burke, T Single-locus and multilocus DNA fingerprinting. In Hoelzel, A. R. ed. Molecular genetic analysis of populations: a practical approach. Oxford University Press, New York, pp Graphodatsky, A. S., Sablina, O. V., Meyer, M. N., Malikov, V. G., Isakova, E. A., Trifonov, V. A., Polyakov, A. V., Lushnikova, T. P., Vorobieva, N. V., Serdyukova, N. A., Perelman, P. L., Borodin, P. M., Benda, P., Frynta, D., Leikepova, L., Munclinger, P., Pialek, J., Sadlova, J., Zima, J Comparative cytogenetics of hamsters of the genus Calomyscus. Cytogenetics and Cell Genetics 88, Hammer, Ø., Harper, D. A. T., Ryan, P. D PAST: Paleontological Statistics software package for education and data analysis. Palaeontologia Electronica 4, 9pp. Hall, T. A BioEdit: a user-friendly biological sequence alignment editor and analisys program for Windows 95/98NT. Nucleic Acids Symposium Series 41, Kashkarov, D [Materials to the knowledge of the rodents of the Turkestan.] Transactions of the SA cientific Society of Turkestan at Middle Asiatic University 2, (in Russian).

79 CALOMYSCUS MYSTAX FROM NORTHEASTERN IRAN 75 Lebedev, V. S., Pavlinov, I. Ya., Meyer, M. N., Malikov, V. G [Craniometric analysis of mouse-like hamsters of the genus Calomyscus (Cricetidae)]. Zoologichaskii Zhurnal 77, (in Russian). Malikov, V. G., Meyer, M. N., Graphodatsky, A. S., Polyakov, A. V., Sablina O. V., Vaziri, A. Sh., Nazari, F., Zima J On a taxonomic position of some karyomophs belong to genus Calomyscus (Rodentia, Cricetidae). Proceedings of the Zoological Institute RAS 281, Meyer, M. N., Malikov, V. G [On the distribution, taxonomic status and biology of mouselike hamsters of the genus Calomyscus (Rodentia, Cricetidae)]. Zoologiskii Zhurnal 74, (in Russian). Meyer, M. N., Malikov, V. G [New species and subepscies of mouse-like hamsters of the genus Calomyscus (Rodentia, Cricetidae) from southern Turkmenistan]. Zoologichaskii Zhurnal 79, (in Russian). Montgelard, C., Bentz, S., Tirard, C., Verneau, O., Catzeflis, F. M Molecular systematics of Sciurognathi (Rodentia): the mitochondrial cytochrome b and 12S rrna genes support the Anomaluroidea (Peptidae and Anomaluridae). Molecular Phylogenetic and Evolution 22, Musser, G. G., Carleton, M. D Family Muridae. In Wilson, D. E., Reeder, D. M., eds. Mammal species of the world: A taxonomic and geographic reference. Smithsonian Institution Press, Washington D.C. second edition, pp Musser, G. G., Carleton, M. D Subfamily Murinae. In Wilson, D. E., Reeder, D. M., eds. Mammal species of the world: A taxonomic and geographic reference. The Johns Hopkins University Press, Baltimore, third edition, volume 2, pp Norris, R. W., Woods, C. A., Kilpatrick, C. W Morphological and molecular definition of Calomyscus hotsoni (Rodentia: Muroidea: Calomyscidae). Journal of Mammalogy 89, Palvinov, I. Ya., Rossolimo, O. I [Systematics of mammals of the USSR. Addenda M.] Archives of the Zoological Museum, Moscow State University 38, 190 pp (in Russian). Rohlf, F. J TpsDig, version Dept. Ecology and Evolution, State University of New York at Stony Brook. Ronquist, F., Huelsenbeck, J. P MRBAYES3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, Steppan, S. J., Adkins, R. M., Anderson, J Phylogeny and divergence-date estimates of rapid radiation in muroid rodents based on multiple nuclear genes. Systematic Biology 53, Tamura, K., Peterson, D., Peterson, N., Strecher, G., Nei, M., Kumar, S Mega5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28:

80 76 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 Vorontsov, N. N., Kartavtesva, I. V., Potapova, E. G [Systematics of the genus Calomyscus. 1. Karyological differentiation of the sibling species from Transcaucasia and Turkmenia and a review of species of the genus Calomyscus.]. Zoologichaskii Zhurnal 58, (in Russian). Supplementary TABLE 1 Details of sampled localities, tissue and voucher numbers and Cytb accession numbers of specimens from Iran, Pakistan and Turkmenistan. Accession No Voucher No Locality Jodar, Kopetdagh Mts., North Khorasan, Iran Jodar, Kopetdagh Mts., North Khorasan, Iran Takale-ghoz, Kopetdagh Mts., North Khorasan, Iran Takale-ghoz, Kopetdagh Mts., North Khorasan, Iran Takale-ghoz, Kopetdagh Mts., North Khorasan, Iran Sumbar, Kopetdagh Mts., North Khorasan, Iran KhajeMorad, Khorasan-e-Razavi, Iran KhajeMorad, Khorasan-e-Razavi, Iran KhajeMorad, Khorasan-e-Razavi, Iran KhajeMorad, Khorasan-e-Razavi, Iran KhajeMorad, Khorasan-e-Razavi, Iran KhajeMorad, Khorasan-e-Razavi, Iran KhajeMorad, Khorasan-e-Razavi, Iran KhajeMorad, Khorasan-e-Razavi, Iran KhajeMorad, Khorasan-e-Razavi, Iran Torbat-e-Jam, Khorasan-e-Razavi, Iran Torbat-e-Jam, Khorasan-e-Razavi, Iran Torbat-e-Jam, Khorasan-e-Razavi, Iran Torbat-e-Jam, Khorasan-e-Razavi, Iran Aghdarband, Khorasan-e-Razavi, Iran Aghdarband, Khorasan-e-Razavi, Iran Aghdarband, Khorasan-e-Razavi, Iran Dargaz, Kopetdagh Mts., Khorasan-e-Razavi, Iran Dargaz, Kopetdagh Mts., Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Neyshabur, Khorasan-e-Razavi, Iran Chenaran, North Khorasan, Iran Species Calomyscus sp. Calomyscus sp. Calomyscus sp. Calomyscus sp. Calomyscus sp. Calomyscus sp.

81 CALOMYSCUS MYSTAX FROM NORTHEASTERN IRAN EU EU EU EU EU AJ * Chenaran, North Khorasan, Iran Chenaran, North Khorasan, Iran Chenaran, North Khorasan, Iran Saluk, North Khorasan, Iran Saluk, North Khorasan, Iran Saluk, North Khorasan, Iran Kurkhud, North Khorasan, Iran Kurkhud, North Khorasan, Iran Kurkhud, North Khorasan, Iran Kurkhud, North Khorasan, Iran FakhrAbad, Yazd, Iran FakhrAbad, Yazd, Iran FakhrAbad, Yazd, Iran FakhrAbad, Yazd, Iran FakhrAbad, Yazd, Iran Fasham, Tehran, Iran Fasham, Tehran, Iran Fasham, Tehran, Iran Fasham, Tehran, Iran Fasham, Tehran, Iran Saravan, Sistan-o-Baluchistan, Iran Saravan, Sistan-o-Baluchistan, Iran Saravan, Sistan-o-Baluchistan, Iran Saravan, Sistan-o-Baluchistan, Iran Saravan, Sistan-o-Baluchistan, Iran Pakistan, Balochistan, Khuzder Dist., Dancer, Village Pakistan, Sindh, Dadu Dist., Rani Kot near Shergart Fort Pakistan, Balochistan, Kalat Dist., Khan's Palace Bungalow Pakistan, Balochistan, Kalat Dist., Kargaz, 4 km S Khan of Kalat's Bungalow Pakistan, North Waziristan, Datta Khel, 55 km SW Miran Shaw Turkmenistan, Great Balkhan Mts. C. grandis C. grandis C. grandis C. grandis C. grandis C. hotsoni C. hotsoni C. hotsoni C. hotsoni C. hotsoni C. hotsoni C. hotsoni C. baluchi C. baluchi C. baluchi C. mystax Spalax ehrenbergi * Deposited in Zoological Institute, St. Petersburg, Russia

82

83 Iranian Journal of Animal Biosystematics (IJAB) Vol.11, No.1, 79-89, 2015 ISSN: X (print); (online) Additional records of Hyalomma marginatum rufipes Koch, 1844 (Acari: Ixodidae) in southwestern and southern Iran with a molecular evidence Hosseini-Chegeni, A. a, Hosseini, R. a*, Abdigoudarzi, M. b, Telmadarraiy, Z. c, Tavakoli, M. d a Department of Plant Protection, Faculty of Agriculture, University of Guilan, Guilan, Iran b Razi Vaccine and Serum Research Institute, Department of Parasitology, Reference Laboratory for Ticks and Tick Borne Diseases, Karaj, Iran c Department of Medical Entomology and Vector Control, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran d Lorestan Agricultural and Natural Recourses Research Center, Lorestan, Iran (Received: 20 April 2014; Accepted: 10 February 2015) Hyalomma marginatum rufipes (Acari: Ixodidae) along with three closely related subspecies is considered as marginatum group. The subspecies had proven as main vector of Crimean Congo hemorrhagic fever virus, the cause of human death in Asia, Africa and Europe. This tick is also a vector of parasitic protozoan Theileria annulata, agent of tropical theileriosis in cattle. Nonetheless, taxonomical status of this tick not recognized or confirmed in tick s fauna of Iran, then we decided to show most taxonomic characteristics and confirm the presence of this subspecies in Iran by molecular methods. Tick specimens were collected from cattle in Manujan township, Kerman province, southern Iran. Specimens were identified morphologically using suitable taxonomical identification keys. The morphologically identified specimens were subjected to molecular studies. Morphological and COI gene analysis clearly confirmed the occurrence of H. m. rufipes in Iran, however, according to ITS2 fragment H. m. rufipes can be the same H. m. marginatum. Thus, it seems that based on most popular molecular markers, H. m. rufipes and its relative H. m. marginatum really should be assigned as a polymorphic species H. marginatum. Key words: Hyalomma marginatum rufipes, Ixodidae, marginatum group, morphological variation, COI, ITS2, Iran. INTRODUCTION The distribution patterns of animal species have a major role in zoogeography that is an essential factor in dispersal and establishing of species across an area (Hickman et al., 2001). Taxonomical, ecological and biological characteristics of a new species have a significant role in further monitoring of species population. Among ticks (suborder Ixodida), species of the genus Hyalomma have a great degree of medical and veterinary importance around the world (Sonenshine 2009). They are the specialized vectors of animal and human pathogenic agents, where can be considered as the most excellent choice for biological studies (Bakheit et al., 2012). Unlike, the common behavior of adult Hyalomma ticks that infest mammals, it was determined that generally nymphal stages of six *Corresponding Author: rhosseini@guilan.ac.ir 2015 FERDOWSI UNIVERSITY OF MASHHAD, IRAN

84 80 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 particular species in this genus feed on the birds and reptiles (Hoogstraal & Aeschlimann 1982). The subspecies Hyalomma marginatum rufipes Koch, 1844, commonly named hairy Hyalomma, is considered as an indigenous tick from African continent that can be transported by migratory birds toward distant localities (Hoogstraal 1956, Kaiser et al., 1974). Blood feeder immature stages of H. m. rufipes can remain more than 16 days on the bird host body, where they have an adequate time to spread across more farther distances (Korch 1994). H. m rufipes is closely related to H. m. marginatum, H. m. turanicum and H. m. isaaci, all recently promoted to species level (Apanaskevich & Horak 2008, Guglielmone et al., 2014). This subspecies has been reported as a main vector of Crimean Congo hemorrhagic fever virus (CCHFV), a human fatal disease in Asia, Africa and Europe (Hoogstraal 1979). This tick is also a vector of parasitic protozoan Theileria annulata, the agent of tropical theileriosis in cattle (d'oliveira et al., 1997). Nonetheless, taxonomical status of this tick not recognized or confirmed in tick s fauna of Iran (Mazlum 1971, Filippova et al., 1976, Rak 1976, Hoogstraal & Valdez 1980, Hashemi-Fesharaki et al., 2002, Rahbari et al., 2007, Nabian et al., 2009, Razmi & Ramoon 2012). However, Hoogstraal in 1967 (cited in Abdigoudarzi 2004) compiled a taxonomical key to the identification of marginatum group members (H. m. marginatum, H. m. rufipes and H. m. turanicum) in Iran. In an comprehensive study on Hyalomma fauna of Iran few specimens H. rufipes recognized by the first author in Lorestan and Hormozgan provinces (Hosseini-Chegeni et al., 2013). Then, we decided to recording more specimens of this rare and important subspecies as well as showing most taxonomic characteristics and confirming the presence of this subspecies in Iran by molecular methods. The molecular identification of animal taxa using DNA barcoding recommended by different authors (Hebert et al., 2003, Tautz et al., 2003). The basis of DNA barcoding is cytochrome oxidase subunit I (COI or COXI) which is reported as a choice gene for the identification of tick species (Lv et al., 2014, Zhang & Zhang 2014). Internal transcribed spacer 2 (ITS2), as well as, is the best choice for the identification of ticks because of the low level intraspecies variability and high level interspecies differences (Rumer et al., 2011). MATERIALS AND METHODS Tick collection Ten specimens were collected from Chahshoor village, Manujan township, Kerman province, southern Iran (27 23'33''N/57 32'05''E) and an unknown region in Khuzestan province. The male specimens were collected from cattle. The identified subspecies are preserved in the tick s collection of Natural History Museum of University of Guilan. Morphological studies Determination of specimens The specimens were identified using suitable taxonomical identification keys including Delpy (1949a,b), Feldman-Muhsam (1954), Hoogstraal (1956), Abdigoudarzi (2004), Walker et al (2007) and Apanaskevich and Horak (2008). The characters were used to the identification of subspecies shown in Table 1. Drawing Taxonomical characters of subspecies were drawn by drawing tube (Olympus SZH-Japan) connected to stereomicroscope (Olympus ) and then, redrawing using Corel Draw Graphics Suite (version X6), software.

85 RECORDS OF HYALOMMA MARGINATUM RUFIPES 81 TABLE 1. A set of taxonomical characters for differentiation male Hyalomma marginatum group in the Iranian specimens according to Delpy (1949b), Walker et al., (2007), Apanaskevich and Horak (2008), Hosseini and Tavakoli (2012). Character Character state Taxon diagnosed Scutum punctuation density Sparse H. m. marginatum localized-regular H. m. turanicum dense/very dense H. m. rufipes Scutum color dark-light brown H. m. marginatum dark-dark red H. m. turanicum dark-dark brown H. m. rufipes Scutum shape - H. m. marginatum - H. m. turanicum egg shaped H. m. rufipes Posterior scutal margin shape - H. m. marginatum - H. m. turanicum Round H. m. rufipes Spiracular plate tail * Broad H. m. marginatum Narrow H. m. turanicum very narrow H. m. rufipes Circumspiracular integument setae density Sparse H. m. marginatum moderately dense H. m. turanicum very dense H. m. rufipes Legs bands Present H. m. marginatum Present H. m. turanicum Present H. m. rufipes Lateral grooves long ** H. m. marginatum Long H. m. turanicum short or long-concealed H. m. rufipes Posteromedian, paramedian grooves shallow and distinct H. m. marginatum and caudal field superficial and poorly developed H. m. turanicum absent and indistinct punctuated H. m. rufipes -: No characteristic, * : Joint of body and tail of spiracular plate, ** : Sometimes continuing towards eyes as lines of punctuations Molecular studies DNA extraction DNA was extracted by phenol-chloroform method according to Sambrook and Russell (2001) with some modifications. Primers The list of primers used in the present study was shown in Table 2. Also, primer TRH was designed, because the failures in amplification of ITS2 fragment Hyalomma species using universal primers ( TABLE 2. Primers used in the present study. Target Name Type Primer sequence (5 3 ' ) ' Reference COI C1-J-1718 Forward GGAGGATTTGGAAATTGATTAGTTCC Simon et al., (1994) C1-N-2191 Reverse CCCGGTAAAATTAAAATATAAACTTC Simon et al., (1994) ITS2 3SA Forward CTAAGCGGTGGATCACTCGG Barker (1998) TRH Reverse TCTTCGGGACGGCGACTG Designed

86 82 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 Polymerase chain reaction PCR was carried out at thermal cycler MyGenie (Bioneer, South Korea) and Bio-Rad (U.S.) for all specimens. Temperature profiles for amplification of COI and ITS2 gene, as well as, the required ingredients for each PCR reaction are shows in Table 3 and Table 4, respectively. TABLE 3. Temperature profiles used for amplification of COI and ITS2 gene. Step Temperature ( C) Time (minute) COI 1. Initial denaturation Denaturation Annealing Extension 72 1 Repeat steps 2-4, 34 times 5. Final extension ITS2 (touchdown) 1. Initial denaturation Denaturation Annealing * 1 4. Extension Repeat steps 2-4, 20 times 5. Denaturation Annealing Extension Repeat steps 5-7, 20 times 8. Final extension *: Temperature may be decrease 1 C/cycle to 45 C TABLE 4. The quantity and concentration of PCR ingredients. Ingredient (company-initial concentration) Quantity (µl) Final concentration (for 25 µl) Sterile water µl PCR buffer (Bioflux -10x) µl MgCl 2 (Bioflux -50 mm) 1* 2 mm Forward primer (10 µm) µm Reverse primer (10 µm) µm dntps (Bioflux -10 mm) µm Taq DNA polymerase enzyme (Bioflux -5 U/µl) U gdna template 4 Not measured *: The amount MgCl 2 can be increase to 2 µl Gel electrophoresis, purification and sequencing The PCR products were visualized by 1% agarose gel electrophoresis. PCR products with desired band were purified using GeneJET Gel Extraction Kit, then were sent to Sequetech Company for sequencing using ABI 3730XL DNA sequencer. BLAST of sequences, calculation distance difference and construction of phylogenetic tree The results of COI and ITS2 sequencing were reviewed by Finch TV software and edited manually. The Basic Local Alignment Search Tool (BLAST) was used to compare the similarity of our sequences with sequences presented in GeneBank database ( The sequences were submitted to GeneBank with accession numbers KP and KP for COI and ITS2, respectively (released in 2016). The pairwise distance differences were computed using the Kimura 2-parameter method (Kimura 1980) by MEGA6 software (Tamura et al., 2013). As well as, a phylogenetic tree for each gene was constructed using Neighbor-Joining (NJ) method

87 RECORDS OF HYALOMMA MARGINATUM RUFIPES 83 by MEGA6 software. The evolutionary distances were computed using the Maximum Composite Likelihood method. RESULTS Morphology The specimens were diagnosed as Hyalomma marginatum rufipes Koch, 1844 based on scutal punctuation, central festoon and other taxonomical characters presented in the earlier studies. The scutal patterns of H. m. rufipes collected from different area of Iran represented in Figure 1 and Figure 2. A particular variation observed as a punctate scutum with glabrous area (Figure 2, 1-III). FIGURE 1. Two scutal punctuation pattern as a section in mid scutum Hyalomma marginatum rufipes I) small and distant, II) large and compact. FIGURE 2. Variation in punctuation of whole scutum H. rufipes; I: very dense and compact (Kerman specimen), II) dense, small and distant (Khuzestan specimen), III) dense, small and distant with glabrous area (arrow) (Khuzestan specimen).

88 84 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 FIGURE 3. Phylogenetic trees reconstructing evolutionary relationship among H. marginatum group and other Hyalomma species, phylogenetic tree of COI (A) and ITS2 (B) sequences data using NJ method with 1000 replicates bootstrapping, green boxes representing a clade including sequence of this study (as bold) and GenBank sequences with accession number and abbreviated country name, taxon Rhipicephalus sanguineus is taken as outgroup, thicker branches showing bootstrap value greater than 90%, sign (A) indicating a morphologically hybrid or intermediate taxa were stated in Rees et al., (2003), Ch. China, Et. Ethiopia, Ir. Iran, Sp. Spain. Molecular essay and phylogenetic tree The result of BLAST showed the COI sequence of H. m. rufipes has 99% similarity with COI sequences of H. m. rufipes (accession numbers: AJ437091, AJ437094, AJ ), H. truncatum (accession number: AJ437088) and H. dromedarii (accession numbers: AJ , AJ ), as well as, 96% similarity with COI sequences of H. m. marginatum from Spain (accession numbers: EU ). The result of BLAST with partial ITS2 showed 99% identity with a single sequence belongs to H. m. rufipes from China (accession number: JQ737104). As well as, the comparison ITS2 sequence of H. m. rufipes of this study with an ITS2 sequence H. m. marginatum submitted from Iran (accession number: FJ416322) shown 93% similarity. Both COI and ITS2 phylogenetic trees along with constructed clades is shown in Figure 3. The phylogenetic analysis were conducted on 19

89 RECORDS OF HYALOMMA MARGINATUM RUFIPES 85 nucleotide sequences with 437 positions and 7 nucleotide sequences with 583 positions in the final dataset for COI and ITS2 phylogenetic trees, respectively. All gap positions and missing data were removed. DISCUSSION Traditional taxonomy Hyalomma marginatum rufipes is a member of marginatum group. This subspecies have been considered as a tick dispersed via land migratory birds and it can established outside its original distribution, then causes the spread of CCHF virus to the new localities (Hoogstraal & Kaiser 1958a, Hoogstraal 1972, Kaiser et al., 1974). Leastwise, ten forms of migrant birds that can transport immature stages of H. m. rufipes into Egypt, clearly are responsible for introducing of H. m. rufipes to new areas (Hoogstraal & Kaiser 1958b). Since morphological characters of ticks of marginatum group are more similar and qualitative, thus their taxonomical status is debatable and species delimitation not to be easy (Apanaskevich & Horak 2008). It is thought that H. m. rufipes has been introduced to Iran by land migratory bird or imported livestock, thus the report of this subspecies from Iran is more important since it has been reported originally from Ethiopian region (Egypt, Libya, Palestine, Anatolia) and southern Russia in small numbers (Hoogstraal & Kaiser 1958a). In the current study three taxonomical characters including scutal punctuation, circumspiracular integument setae and spiracular plate tail were seen as the most valuable characters (i.e., less variables morphological traits) using for differentiating of male specimens H. m. rufipes. A unique trait that was found for identification of three subspecies rufipes, marginatum and turanicum is breadth of spiracular plate tail at the junction tail to spiracle body. This character in rufipes is narrower than other taxa and properly illustrated in Pomerantzev ( 1950 ), however, it has been called as H. plumbeum impressum. Feldman- Muhsam and Kahn (1958) compared laboratory progeny of a single female H. rufipes and reported notable variability in the characteristics e.g., scutal punctuation, total shape and color of scutum. They showed less variability in circumspiracular integument setae (Feldman-Muhsam & Kahn 1958). Whereas, interbreeding among populations of three subspecies rufipes, marginatum and turanicum occur in areas where the migratory birds transfer hybrid forms into other region (Hoogstraal et al., 1963). Thus, intermediate forms combining form two or three subspecies rufipes, marginatum and turanicum may be seen. Delpy (1949b) splits the taxon H. rufipes as two subspecies H. r. rufipes and H. r. glabrum based on total scutum shape, posterior margin of scutum and circumspiracular integument setae density. However, these characters are very debatable and ambiguous for the differentiation of species as we examined many specimens that shown the combined characteristics of two subspecies described by Delpy (1949b). Molecular phylogeny According to COI phylogenetic tree, H. m. rufipes has a subspecific taxonomical level. Thus, it seems that based on COI, a protein coding gene, two taxon of rufipes and marginatum really should be assigned as distinct subspecies of polymorphic species H. marginatum (2% pairwise distance difference). So that, both rufipes and marginatum shared a common ancestor in COI phylogenetic tree. Unfortunately, except an ITS2 sequence submitted from China (JQ737104) further sequences were not found in GenBank to comparing our H. m. rufipes ITS2 sequence, exactly. However, on the ITS2, a non protein coding gene, H. m. rufipes is a distinct subspecies. Based on COI phylogenetic tree and 4% pairwise distant difference, H. m. rufipes, H. anatolicum and H. lusitanicum are closely related species, phylogenetically. This difference among ITS2 sequences of H. m. rufipes, H. detritum and the H. asiaticum group is 6-9%, greater than COI sequences. Rees et al., (2003) reported some hybrid forms in marginatum group (used in COI phylogenetic tree) representing the probability of

90 86 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 crossbreeding among Hyalomma species. According to maternal inheritance of mitochondrial genome (e.g., COI gene), thus COI phylogeny is reflecting of only female species coupled with male. ACKNOWLEDGMENTS Authors are grateful to M. Paydareh and H. Bahrani for collecting tick specimens in Kerman and Khuzestan provinces, respectively. Also, from F. Shirzaiiyan-Zarouni for her encouragements as well as H. Hosseini for his kindness helps. LITERATURE CITED Abdigoudarzi, M Review of Ticks (Acari: Ixodidae) and redescription of Hyalomma and Rhipicephalus genera by RAPD-PCR in Iran. Doctor of Philosophy, Department of Agricultural Entomology, Tarbiat Modares University. Tehran Iran. Apanaskevich, D.A., Horak, I.G The genus Hyalomma Koch, 1844.V. Re-evaluation of the taxonomic rank of taxa comprising the H. (Euhyalomma) marginatum Koch complex of species (Acari: Ixodidae) with redescription of all parasitic stages and notes on biology. International Journal of Acarology 34, Bakheit, A.M., Latif, A.A., Vatansever, Z., Seitzer, U., Ahmed, J The huge risks due to Hyalomma ticks. In: Mehlhorn H, ed. Arthropods as Vectors of Emerging Diseases (Parasitology Research Monographs). Springer-Verlag, Berlin Germany, pp Barker, S.C Distinguishing species and populations of Rhipicephaline ticks with ITS 2 ribosomal RNA. Journal of Parasitology 84, d'oliveira, C., Van der Weide, M., Jacquiet, P., Jongejan, F Detection of Theileria annulata by the PCR in ticks (Acari: Ixodidae) collected from cattle in Mauritania. Experimental and Applied Acarology 21, Delpy, L.P. 1949a. Essai critique de synonymie du genre Hyalomma C. L. Koch 1844 depuis Linné, Annales de Parasitologie Humaine et Comparée 24, Delpy, L.P. 1949b. Révision par les voies expérimentales du genre Hyalomma C. L. Koch, e partie. Annales de Parasitologie Humaine et Comparee 24, Feldman-Muhsam, B Revision of the genus Hyalomma I. Description of Koch s types. Bulletin of Research Council of Israel 4, Feldman-Muhsam, B., Kahn, J The variation in laboratory bred ticks. Journal of Parasitology 44, 23. Filippova, N.A., Neronov, V.M., Farhang-Azad, A Data on ixodid tick fauna (Acarina, Ixodidae) of small mammals in Iran. Entomologicheskoe Obozreniye 55, Guglielmone, A.A., Robbins, R.G., Apanaskevich, D.A., Petney, T.N., Estrada-Peña, A., Horak, I.G The hard ticks of the world (Acari: Ixodida: Ixodidae). Springer, Dordrecht Netherlands, pp. 738.

91 RECORDS OF HYALOMMA MARGINATUM RUFIPES 87 Hashemi-Fesharaki, R., Abdigoudarzi, M., Esmaeil-Nia, K An illustrated guide to the Ixodidae ticks of Iran. Veterinary Organisation of Iran, Tehran Iran [In Persian], pp Hebert, P.D.N., Cywinska, A., Ball, S.L., dewaard, J.R Biological identifications through DNA barcodes. Proceeding Royal Society of London Serie B 270, Hickman, C.P., Roberts, L.S., Larson, A Integrated principles of zoology. McGraw-Hill, New York USA, pp Hoogstraal, H African Ixodoidea. I. Ticks of the Sudan (with special reference to Equatoria Province and with preliminary reviews of the genera Boophilus, Margaropus and Hyalomma), research report. United State Navy, Washington DC, pp Hoogstraal, H Birds as tick hosts and as reservoirs and disseminators of tickborme infectious agents. Wiadomosci Parazytologiczne 18, Hoogstraal, H The epidemiology of tick-borne Crimean Congo haemorrhagic fever in Asia, Europe, and Africa. Journal of Medical Entomology 15, Hoogstraal, H., Aeschlimann, A Tick host specificity. Bulletin de la Société Entomologique Suisse 55, Hoogstraal, H., Kaiser, M.N. 1958a. Observations on Egyptian Hyalomma ticks (Ixodoidea, Ixodidae). 2. parasitism of migrating birds by immature H. rufipes Koch. Annals of the Entomological Society of America 51, Hoogstraal, H., Kaiser, M.N. 1958b. The ticks (Ixodoidea) of Egypt: A brief review and keys. The Journal of the Egyptian Public Health Association 33, Hoogstraal, H., Kaiser, M.N., Traylor, M.A., Guindy, E., Sobhy, G Ticks (Ixodidae) on birds migrating from Europe and Asia to Africa, Bulletin World Health Organization 28, Hoogstraal, H., Valdez, R Ticks (Ixodoidea) from wild sheep and goats in Iran and medical and veterinary implications. Fieldiana Zoology 6, Hosseini-Chegeni, A., Hosseine, R., Tavakoli, M., Telmadarraiy, Z., Abdigoudarzi, M The Iranian Hyalomma (Acari: Ixodidae) with a key to the identification of male species. Persian Journal of Acarology 2, Hosseini, A., Tavakoli, M A taxonomic study on hard ticks Hyalomma marginatum species group (Acari: Ixodidae) in Iran. Proceeding of 1 st International & 8 th National Congress of Parasitology & Parasitic Disease in Iran, Kerman University of Medical Sciences, Kerman, Iran. Kaiser, M.N., Hoogstraal, H., Watson, G.E Ticks (Ixodoidea) on migrating birds in Cyprus, fall 1967 and spring 1968, and epidemiological considerations. Bulletin Entomological Research 64,

92 88 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 Kimura, M A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16, Korch, G.W Geographic dissemination of tick-borne zoonoses. In: Sonenshine DE, Mather TN, eds. Ecological dynamics of tick-borne zoonoses. Oxford University Press, Oxford UK, pp Lv, J., Wu, S., Zhang, Y., Chen, Y., Feng, C., Yuan, X. Jia, G., Deng, J., Wang, C., Mei, L., Lin, X Assessment of four DNA fragments (COI, 16S rdna, ITS2, 12S rdna) for species identification of the Ixodida (Acari: Ixodida). Parasites & Vectors 7, Mazlum, Z Ticks of domestic animals in Iran: geographic distribution, host relation, and seasonal activity. Journal of Veterinary Faculty University Tehran Iran 27, 1 32 [In persian]. Nabian, S., Rahbari, S., Changizi, A., Shayan, P The distribution of Hyalomma spp. ticks from domestic ruminants in Iran. Medical and Veterinary Entomology 23, Nicholas, K.B., Nicholas, H.B.J., Deerfield, D.W GeneDoc: analysis and visualization of genetic variation. Embnew News 4, 14. Pomerantzev, B.I. 1950). Fauna of USSR arachnida: Ixodid ticks (Ixodidae), Fauna SSSR. Akademii Nauk SSSR, Leningrad USSR, pp. 224 [In Russian]. Rahbari, S., Nabian, S., Shayan, P Primary report on distribution of tick fauna in Iran. Parasitology Research 101 S175 S77. Rak, H Tick borne diseases and their vectors in Iran. Proceeding of International Congress on Tick-Borne Diseases and Their Vectors, Edinburgh UK. Razmi, G.R., Ramoon, M A study of tick fauna in Tandoureh national park, Khorasan Razavi province, Iran. Acarina 20, Rees, D.J., Dioli, M., Kirkendalla, L.R Molecules and morphology: evidence for cryptic hybridization in African Hyalomma (Acari: Ixodidae). Molecular Phylogenetics and Evolution 27, Rumer, L., Sheshukava, O., Dautel, H., Danosa-Mantke, O., Niedrig, M Differentiation of medically important Euro-Asian tick species Ixodes ricinus, Ixodes persulcatus, Ixodes hexagonus, and Dermacentor reticulatus by polymerase chain reaction. Vector-Borne and Zoonotic Diseases 11, Sambrook, J., Russell, D.W Molecular cloning, a laboratory manual. Cold Spring Harbor Laboratory Press, New York USA, pp Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87,

93 RECORDS OF HYALOMMA MARGINATUM RUFIPES 89 Sonenshine, D.E Ticks. In: Resh VH, Cardé RT, eds. Encyclopedia of insects. Academic Press, San Diego CA, pp Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution 30, Tautz, D., Arctander, P., Minelli, A., Thomas, R.H., Vogler, A.P A plea for DNA taxonomy. Trends in Ecology & Evolution 18, Walker, A.R., Bouattour, A., Camicas, J.L., Estrada-Peña, A., Horak, I.G., Latif, A.A., Pegram, R.G., Preston, P.M Ticks of domestic animals in Africa: a guide to identification of species. Bioscience Reports, Edinburgh UK, pp Zhang, R.L., Zhang, B Prospects of using DNA barcoding for species identification and evaluation of the accuracy of sequence databases for ticks (Acari: Ixodida). Ticks and Tick-borne Diseases 5,

94

95 Iranian Journal of Animal Biosystematics (IJAB) Vol.11, No.1, , 2015 ISSN: X (print); (online) The Fish fauna of north and east regions of Khorasan-e-Razavi Province, Iran Yazdani-Moghaddam, F.* a,b, Ghasemian, F. c, Ghassemzadeh, F. a,b, Khazaee, A.R. c, Seifali, M. d, Ghanbarifardi, M. e a Research Department of Zoological Innovations, Institute of Applied Zoology, Faculty of Sciences, Ferdowsi University of Mashhad, Mashhad, Iran b Department of Biology, Faculty of Sciences, Ferdowsi University of Mashhad, Mashhad, Iran c Department of Biology, Faculty of Sciences, University of Zanjan, Zanjan, Iran d Department of Biology, Faculty of Sciences, University of Alzahra, Tehran, Iran e Department of Biology, Faculty of Sciences, University of Sistan and Baluchestan, Zahedan, Iran (Received: 20 October 2014; Accepted: 23 May 2015) Khorasan-e-Razavi province in the northeast of Iran possesses varied climatic and geographical conditions that lead to a rich biodiversity. An investigation on the status of the fish fauna was carried out from March to October A total of 401 specimens was collected and identified, from 30 localities among seven counties in this province. Sampling was performed using hand net, cast net and electrofishing equipment. The collected specimens represented two families, seven genera and nine species including Cyprinidae (Capoeta capoeta, Capoeta fusca, Schizothorax pelzami, Alburnoides eichwaldii, Squalius cephalus, Garra rossica, Pseudorasbora parva) and Nemacheilidae (Paraschistura cristata and Paraschistura turcmenica). The Cyprinidae with seven species, showed the highest diversity among the families represented here. Key words: Khorasan-e-Razavi province, fauna, fish, Iran. INTRODUCTION It is important to survey fishes in aquatic ecosystems for several reasons, such as identification, evolutionary review, ecology, ethology, conservation, water resources management, exploitation of reserves and pisciculture. The confirmed freshwater ichthyofauna of Iran is represented by 202 species in 104 genera, 28 families, 17 orders and 3 classes, found in 19 different basins. (Esmaeili et al, 2010). The most diverse order is the Cypriniformes with 120 confirmed species (59.4%), followed by Cyprinidae with 93 confirmed species (46.0%), Nemacheilidae with 22 species (10.9%) and Cobitidae with five species (2.5%) (Esmaeili et al, 2010). However, a few new and exotic fishes have been recently reported from inland waters of Iran, increasing the number of confirmed species to more than 220 (Esmaeili et al, 2013; Teimori et al, 2014,). Several studies have been done on the ichthyofauna in Iran, over the last few decades. Some investigations on the status of fish fauna of Khorasan-e-Razavi province were conducted by Abdoli et al (1999) and (2007), Badiei (2002), and Zareian et al. (2013). Khorasan-e-Razavi is one of the 31 provinces of Iran; located in north-eastern part of the country and covers an area of 144,681 km 2. It borders North Khorasan province and Turkmenistan in the north, Semnan province in the west, South Khorasan province in the south and Afghanistan and Turkmenistan in the east. In terms of its geographical location, this province is divided into northern and southern areas. The northern area is covered with fertile plains while the southern one consists *Corresponding Author: yazdani@um.ac.ir 2015 FERDOWSI UNIVERSITY OF MASHHAD, IRAN

96 92 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 of desert plains and low hills covered with poor vegetation. Climatologically, Khorasan-e-Razavi province has different conditions in different areas. For example, the northern part contains mountains with a semiarid condition, such as Hezar-Masdjed and Binaloud mountains, while the southern part which is mostly flat has a warm and dry climate. Due to its geographical location and mostly warm and dry climate, this region has mostly been neglected from the standpoint of ichthyofauna studies. Consequently, in order to address the lack of information on the fish fauna of Khorasan-e-Razavi province, the current research is focused on the mentioned area to determine fish species of this region. MATERIALS AND METHODS The study area is located in northeastern Iran between to N and to E. The altitude ranges from 229m (Sarakhs plain) to 3615m (Binaloud peak) above sea level ( The annual precipitation varies from 133mm in Bardaskan County to more than 320 mm in Kalat-e-Naderi county ( The field work was carried out from March to October Specimens were caught by electro fishing gear and dip net. The locality data and habitat features were recorded for all the studied species. The tissue and fin samples of specimens were preserved in % ethanol for molecular study and whole specimens were fixed in 5-10% formalin. The voucher specimens are deposited in the Zoological Museum of the Ferdowsi University of Mashhad (ZMFUM). Specimens were identified according to Abdoli (2000), Coad (2015) and Freyhof et al. (2015) identification keys. Ten meristic characters were recorded including, Dorsal fin ray (D1), Anal fin ray (A1), Ventral fin ray (V1), Lateral line scales (LLS), Pre dorsal scale row (PDSR), Upper transverse (UT), Scale from lateral line to pelvic fin origin (SLPO), Lower transverse scale row (LTS), Circum-peduncular scale row (CSR). Also twenty conventional morphometric characters were measured for individual specimens, using digital Vernier calipers. Measurements included total length (TL), standard length (SL), head length (HL), snout length (SNL), eye diameter (ED), body depth (BD), dorsal-fin length (DFL), pectoral-fin length (PFL), anal-fin length (AFL), ventral-fin length (VFL), caudal-peduncle depth (CPD), caudal-peduncle depth maximum (CPDM), predorsal distance (PDD), prepectoral distance (PPD), preventral distance (PVD), preanal distance (PAD), occipital origin to ventral fin (OTV), occipital origin to anal fin (OTA), dorsal origin to pectoral fin (DOP), and occipital origin to pectoral fin (OTP). RESULTS A total of 401 specimens were collected from the study area wherein nine species belonging to seven genera and two families (Table 1). The distribution map of the studied species and their photos are presented in Figure 1 and Figure 2. The biggest individual belonged to Squalius cephalus while the smallest was from Paraschistura turcmenica. Univariate analysis of variance (ANOVA) showed significant differences with varying degrees between the means of all samples of standardized morphometric measurements (P<0.005). Family Cyprinidae Subfamily Cyprininae Capoeta capoeta (Güldenstädt, 1773) 30 specimens. Distribution: Asia: eastern Turkey and southern Caspian Sea watersheds. Distribution in Iran: Capoeta capoeta is known from Tedzhen or Harirud basin of Iran and eastwards including the Kashaf River.

97 THE FISH FAUNA OF KHORASAN-E- RAZAVI PROVINCE, IRAN 93 Morphology: Dorsal fin with 4 unbranched rays and 7(9) or 8(21) branched rays, anal fin with 3 unbranched rays and 5(8) or 6(22) branched rays, pectoral fin branched rays 14(15), 15(3), 17(12), pelvic fin branched rays 7(23), 8(7). Lateral line scales Maximum Total Length (TL) of an adult measured mm and Standard Length (SL) measured 96.02mm. Maximum Body Depth (MaBD) of an adult measured 22.69mm and Minimum Body Depth (MiBD) measured 10.62mm (Figure 2a). Capoeta fusca Nikolskii, specimens. Distribution: Asia: eastern Iran, western Afghanistan. Distribution in Iran: Its distribution encompasses much of eastern Iran (Tedzhen, Bedjestan, Sistan, Kavir and Lut basins; Ghorrghoori, Asafshad, Mardan Shah, Gazdmoo and Afin rivers), western Afghanistan (Nikolskii, 1899; Berg, 1949; Abdoli, 2000). Morphology: Dorsal fin with three unbranched rays and 7(18) or 8(25) branched rays, anal fin with 3 unbranched rays and 5(43) branched rays, pectoral fin with 14(5), 15(25), 16(5) or 20(7) branched rays, pelvic fin with 7(32) or 9(11) branched rays. Lateral line scales Scales are found regularly arranged over the whole body and are enlarged around the anus and anal fin base (Coad, 2015). Maximum Total Length (TL) of an adult measured mm and Maximum Standard Length (SL) measured mm. Maximum Body Depth (MaBD) measured 38.02mm and Minimum Body Depth (MiBD) measured 17.41mm (Figure 2b). Schizothorax pelzami Kessler, specimens. Distribution: Central Asia. Distribution in Iran: Schizothorax pelzami (Transcaspian Marinka) is found in the Murgab and Tedzhen rivers of Turkmenistan and Afghanistan including Iranian drainages of the former known as the Hari River in its Iranian reach (Aliev et al, 1988) and distributed in springs, streams, rivers and qanats (Coad, 2015). Schizothorax pelzami is distributed in Tedzhen River and Kavir basin in Iran (Esmaeili et al. 2010). Morphology: dorsal fin branched rays 7(11) or 8(20); anal fin branched rays 5(31); pectoral fin branched rays 16(2), 17(4), 18(12), or 20(15); pelvic fin branched rays 7(2), 8(27) or 9(2); lateral line scales Maximum Total Length (TL) of and adult measured mm and Maximum Standard Length (SL) measured mm. Maximum Body Depth (MaBD) measured 28.77mm and Minimum Body Depth (MiBD) measured 14.09mm (Figure 2c). Alburnoides eichwaldii (De Filippi, 1863) Distribution: Eurasia. Distribution in Iran: It is distributed in many rivers and streams of Iran, such as Kura River, Caspian Sea basin 15 specimens. Morphology: Branched anal fin rays 8(5), 9( 9) and1( 9); branched dorsal fin rays 7(14), 8(1)Dorsal fin with 7(14) or 8(1) branched rays, anal fin with 8(10) or 11(5) branched rays, pectoral fin with 14(5), 15(5), 16(5) branched rays, pelvic fin with 7(10) or 8(5) branched rays. Maximum Total Length (MTL) of an adult measured 92.59mm. Standard Length (SL) measured 76.72mm. Maximum Body Depth (MaBD) measured 22.74mm, Minimum Body Depth (MiBD) measured 7.53mm and Maximum Lateral Line Scales (LLS) about 54mm (Figure 2d). The species-level taxonomy of the members of the genus remains to be settled (Turan et al 2014). Alburnoides eichwaldii is distributed in small streams and rivers of Iran (Esmaeili et al. 2010; Coad, 2015).

98 94 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 Subfamily Leuciscinae Squalius cephalus (Linnaeus, 1758) 26 specimens. Distribution: Europe and Asia Minor. Distribution in Iran: It is distributed in some basins including the Caspian Sea, Lake Urmia, Namak Lake and Tigris River (Esmaeili et al. 2010) Morphology: Dorsal fin branched rays 7(10), 8(12, after 2(6), usually three, unbranched rays, anal fin branched rays 7(4), 10 (16) and 8(6) after three unbranched rays, pectoral fin branched rays 14(5), 16(4), 18(12) and 19(5), and pelvic fin branched rays 6(5), 8(4), and 9(17). Lateral line scales Maximum Total Length (TL) measured mm and Maximum Standard Length (SL) measured mm (Figure 1e). Maximum Body Depth (MaBD) measured 44.15mm and Minimum Body Depth (MiBD) measured 19.46mm (Figure 2e). Subfamily Gobioninae Pseudorasbora parva (Temminck & Schlegel, 1846) 10 specimens Distribution: Northeastern Asia. Distribution in Iran: It is an introduced fish to the Caspian Sea, Namak Lake, Tedzhen River, Sistan, Maharlu, Urmia, Gulf and Tigris River basins and probably elsewhere (Esmaeili et al. 2015). Morphology: Dorsal fin unbranched rays 3 followed by 7(5) and 8( 7) branched rays, anal fin with 2(1) and 3(9) unbranched rays and 5(7) and 7(3) branched rays. Pectoral fin branched rays 11-14, and pelvic fin branched rays 6(5), 7(3) and 8(2). Lateral line scales 30-40, with the lateral line rarely incomplete. A pelvic axillary scale is present (Figure2i). The fish's size is rarely above 8 cm and usually 2 to 7.5 cm long. Subfamily Labeoninae Garra rossica (Nikolskii, 1900) 18 specimens Distribution: Asia: Iran, Afghanistan and Pakistan Distribution in Iran: It is widely distributed in eastern Iran (Coad, 2015). Morphology: Dorsal fin branched rays 6(10) and 7(8), anal fin branched rays 5 (18), pectoral fin branched rays 11(2), 12(4), 13(4), 14(5), and 16(3); pelvic finbranched rays 7(9) and 8(11); lateral line scales Maximum Total Length (TL) of and adult measured 80.7mm and Maximum Standard Length (SL) measured 68.68mm. Maximum Body Depth (MaBD) measured 13.28mm and Minimum Body Depth (MiBD) measured 7.08mm (Figure 2h). Family Nemacheilidae Paraschistura turcmenica (Berg, 1932) 100 specimens. Distribution: Paraschistura turcmenica is known from rivers flowing in the eastern Kavir basin and towards the western Karakum desert: the Hari in Afghanistan, Iran and Turkmenistan, the Murgab in Afghanistan and Turkmenistan and the streams of the northern slope of Kopetdag in Turkmenistan (Freyhof et al. 2015). Morphology: Dorsal fin with 2-5 unbranched and 6-8 branched rays, anal fin with 2-3 unbranched and 4-6, usually 5, branched rays, pectoral fin branched rays 7-10, and pelvic fin branched rays 6-7). Maximum Total Length (TL) measured 50.77mm and Maximum Standard Length (SL) measured 39.76mm. Maximum Body Depth (MaBD) measured 5.6mm and Minimum Body Depth (MiBD) measured 3.67mm (Figure 2f).

99 THE FISH FAUNA OF KHORASAN-E- RAZAVI PROVINCE, IRAN 95 FIGURE 1. Distribution of species in the study area.

100 96 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 Paraschistura cristata (Berg, 1898) 128 specimens. Distribution: Paraschistura cristata is known from the Hari drainage in Afghanistan, Iran and Turkmenistan as well as from streams flowing down from the Kopedag to the Karakum desert in Turkmenistan. Distribution in Iran: This species is reported throughout the Hari river basin and in the Tedzhen basin (Esmaeili et al. 2015). This species is confirmed to be from Sarakhs on the Hari Rud, and probably the Kashaf River, a Hari River tributary (Abdoli, 2000). Morphology: Dorsal fin branched rays 8(2) 7(140), anal fin branched rays 5(4), pectoral fin branched rays 8(2), 9(2), 10(1) or 11(1); pelvic fin branched rays 7(4) 9(1), 6(1) or 11(1). Maximum Total Length (TL) of and adult measured 80.7mm and Maximum Standard Length (SL) measured 68.68mm. Maximum Body Depth (MaBD) measured 13.28mm and Minimum Body Depth (MiBD) measured 7.08mm (Figure 2g). DISCUSSION The current study recorded nine species of fishes belonging to seven genera and two families of Cyprinidae and Nemachelidae. A high diversity of genus and species was found for the Cyprinidae family. The genus Capoeta that belongs to the cyprinidae family bears 24 valid species (Froese & Pauly, 2012), of which seven species are distributed in Iran. Capoeta capoeta collected in this study can be distinguished by its two pairs of barbells in comparison with one pair in other subspecies. Esmaeili, et al (2010) and Reshetnikov and Shakirova (1993) recognized Capoeta capoeta heratensis as a full species. C. c. heratensis shows major variations in body form, sometimes called morpha elata with a deep body and morpha elongata with a shallow and elongated body. These are not taxonomically significant but simply ecomorphs and all intermediates between the two extremes can be found. The deep-bodied form probably formed part of the fishes described as asmussii (Berg, ). Capoeta capoeta heratensis: is not a valid species name any longer. This is now incorporated into the Capoeta capoeta complex. Therefore, the obtained results for this sub-species are invalid without molecular confirmation and cannot be published. The spirlin, Alburnoides bipunctatus (Bloch, 1782) is characterized by small black spots near the pores located on each side of the lateral line outlining the canal at least along its anterior portion (Bogutskaya and Coad 2009). Ten subspecies and local forms were described or reported within the Alburnoides bipunctatus complex. Some of the subspecies were recently given a rank of species. Alburnoides eichwaldii was a subspecies of Alburnoides bipunctatus but it was raised to species level by Bogutskaya and Coad (2009). However, taxonomic problems persist because most of the earlier investigations were solely based on classical techniques. A synthesis of classical techniques with recent morphometric and molecular studies may provide a solution to the Cyprinid taxonomic problem, particularly among the Alburnoides complex. Northeastern Iran is a habitat for several native fish species. However, a great number of taxa remains to be described. Most of the collected species are native to the north and east regions of Khorasan-e-Razavi province, but only one species, Pseudorasbora parva from aquaculture farms, have been introduced to this region that are exotic species.. Pseudorasbora parva (Stone moroko), is native to Asia. The phenotype of this species is highly influenced by environmental conditions and this is suggested to be one of the attributes that makes this fish a successful invasive species Today, the most compelling fish invasion in the world is arguably the accidental introduction of the Pseudorasbora parva, a small freshwater cyprinid species originating from East Asia, with 32 countries invaded from Central Asia to North Africa in less than 50 years. (Gozlan et al. 2002). This invasion has a gradually negative and decremental effect on the endemic fishes of this and other regions.

101 THE FISH FAUNA OF KHORASAN-E- RAZAVI PROVINCE, IRAN 97 FIGURE 2. Habitus of the examined species. TABLE 1. Fish species collected from north and east regions of Khorasan-e- Razavi province No Species Paraschistura cristata Paraschistura turcmenica Alburnoides eichwaldii Capoeta capoeta heratensis Capoeta fusca Schizothorax pelzami Squalius cephalus Garra rossica Pseudorasbora parva Common Name Turkmenian Crested Loach Sarhadd Loach Bleak Transcaspian Khramulya Siah Mahi Transcaspian Marinka Chub Rossbarbe Stone Moroko statue native native native native native native native native Introduced Family Nemacheilidae Nemacheilidae Cyprinidae Cyprinidae Cyprinidae Cyprinidae Cyprinidae Cyprinidae Cyprinidae Nemacheilid loaches of the genus Paraschistura are a group of poorly known species; therefore, not all of its species are fully examined and ascribed to it or related genera (Coad, 2014 and Kottelat, 2012). The genus was only recently described by Prokofiev (2009), and subsequently Kottelat (2012) listed 14 species in Paraschistura, based mostly on the proposals of Prokofiev (2009). Paraschistura cristata is distinguished from the other species of Paraschistura in Iran by having a prominent dorsal adipose crest supported by procurrent rays of the caudal fin, a complete lateral line and the large size of adults, usually reaching 70 mm SL. Lateral line complete, reaching to caudal-fin base; caudal peduncle with a prominent dorsal adipose crest supported by 22-25procurrent caudal-fin rays Freyhof et al (2015). P. turcmenicus described from Turkmenistan suggested a synonym of P. sargadensis (Berg ) but Bănărescu and Nalbant (1966) consider it to be a valid subspecies (Vatandoost and Igdari 2015). Freyhof et al (2015) have given precedence to Paraschistura over Metaschistura. Metaschistura is, thus, a subjective junior synonym of Paraschistura (Freyhof et al., 2012). Paraschistura is currently diagnosed by just a number of osteological characters in Iran. However, the

102 98 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 application of non-morphological methods, such as cytogenetic and molecular studies, may provide a complementary data source for a more accurate and precise identification of Paraschistura species. Systematic studies, for most species of ichthyofauna of Khorasan-e-Razavi province, of the population, species, and subspecies levels have not yet been completed, and requires systematic investigation using both molecular and morphological data. The biology of most species is unknown (Coad, 2015 and Abdoli et al., 2011). To ensure survival of many rare and endangered species, longterm research will be needed. Detailed survey, exploration and more accurate identification, occurrence and distribution of fishes in the streams of main rivers are much needed for this region. Industrial, agricultural and aquaculture pollutants, as the main sources of water pollution, have significantly increased in Khorasan-e-Razavi province. Since some of the fish species collected in this province are considered endemic, special attention should be paid to their conservation. ACKNOWLEDGMENTS The authors are grateful to the Biology Department and Institute of Applied Zoology in Ferdowsi University of Mashhad, for using their facilities. This work was supported by Environment Protection Organization of Khorasan-e- Razavi province (Project No: 32428). LITERATURE CITED Abdoli, A., 2000.The Inland Water Fishes of Iran. Iran wildlife and nature museum (Darabad), Tehran, Iran. (In Persian). Abdoli, A., Rasooli, P., Yazdandad, H., Abdoli, L., A Study on Some Ecological Aspects of Snow Trout (Schizothorax pelzami) from Laiinsoo River in Northeastern Iran. Environmental sciences 4(3), Abdoli, A, Golzarianpour, K, Kiabi, B, Naderi, M and Patimar, R.., Status of the endemic loaches of Iran. Folia Zoologica 60(4) Aliev, D.S., Sukhanova A.I., Shakirova F.M., Fishes of the inland waters of Turkmenistan, Ylym, Ashkhabad. 142pp. 11pls. Bânârescu P., Nalbant T.T., The 3rd Danish Expedition to Central Asia. Zoological results 34. Cobitidae (Pisces) from Afghanistan and Iran. Videnskabelige Meddelelser fra Dansk Naturhistorisk Forening i København, 129: Badiei, N., Identification of fish fauna of Bajestan (morphometric and meristic) M.s thesis; Ferdowsi university Mashhad. Berg, L.S., Freshwater fishes of U.S.S.R and Adjacent Countries. Trady Institute Academic, Nauk U.S.S.R, 2, 3:1510p. Berg, L.S., 1949.Freshwater Fishes of Iran and Adjacent Countries, Trady Zoologii Icheskogd Institute Academic, Nauk U.S.S.R, 8:

103 THE FISH FAUNA OF KHORASAN-E- RAZAVI PROVINCE, IRAN 99 Bogutskaya, N.G. and B.W. Coad., A review of vertebral and fin-ray counts in the genus Alburnoides (Teleostei: Cyprinidae) with a description of six new species. Zoosystematica Rossica 18(1): Coad B.W., Freshwater Fishes of Iran. Available from: Esmaeili, H.R., Coad, W.B., Gholamifard, A., Nazari, N., Teimory, A., Annotated checklist of the freshwater fishes of Iran. Zoosystematica Rossica 19(2): Esmaeili HR, Gholamifard A, Sayyadzadeh G, Parsi B, Mirghiyasi S, Ghasemian S.,2013. New record of the convict cichlid, Amatitlania nigrofasciata (Günther, 1867), from the Middle East (Actinopterygii: Cichlidae). Aqua International Journal of Ichthyology 19: Freyhof, J., Erk akan,f., Ozeren,C.,Perdices, A. J., An overview of the western Palaearctic loach genus Oxynoemacheilus (Teleostei: Nemacheilidae). Ichthyological Exploration of Freshwaters 22: Freyhof, J., Esmaeili,H. R., Sayyadzadeh, G., Geiger, M., Review of the genus Paraschistura from Iran with description of six new species (Teleostei: Nemacheilidae). Ichthyological Exploration of Freshwaters, 26: Froese, R., & Pauly D., Fishbase www. fishbase. org. World wide web electronic publication. Gozlan RE, Pinder AC, Shelley J Occurrence of the Asiatic cyprinid Pseudorasbora parva in England. Journal of Fish Biology 61: Güldenstädt, J. A. von Cyprinus capoeta et Cyprinus mursa. Novi Commentarii Academiae Scientiarum Imperialis Petropolitanae v. 17: Kottelat, M., Conspectus cobitidum: an inventory of the loaches of the world (Teleostei: Cypriniformes: Cobitoidei). The Raffles Bulletin of Zoology, Suppl. 26: Nikolski, A.M., Reptiles, fishes and amphibia of the second expedition of N.A Zarudni to Persia, reported September 1, Annuaire du Musée Zoologique de l'academie Impériale des Sciences de St. Pétersbourg 4: , (In Russian). Prokofiev, A. M., Problems of the classification and phylogeny of Nemacheiline loaches of the group lacking the preethmoid I (Cypriniformes: Balitoridae: Nemacheilinae). Journal of Ichthyology, 49: Reshetnikov, Y.S. and F.M. Shakirova., A zoogeographical analysis of the ichthyofauna of Central Asia including a list of freshwater fishes. Journal of Ichthyology 33: Teimori A, Esmaeili H.R., Erpenbeck D., Reichenbacher B. A New and unique species of the genus Aphanius Nardo, 1827 (Teleostei: Cyprinodontidae) from Southern Iran: A case of regressive evolution. Zoologischer Anzeiger 253:

104 100 IRANIAN JOURNAL OF ANIMAL BIOSYSTEMATICS Vol.11, No.1 Turan, D., Kaya, C., Ekmekçi, F.G., Doğan, E., Three new species of Alburnoides (Teleostei: Cyprinidae) from the Euphrates River, Eastern Anatolia, Turkey. Zootaxa 3754 (no. 2): Vatandoust, S. and Eagderi, S., 2015 Paraschistura ilamensis, a new species of loach from the Tigris River drainage (Teleostei: Nemacheiliidae). International Journal of Aquatic Biology 3: Zareian H., Esmaeili, H.R., Gholamhosseini, A., Sayyadzadeh, G., 2013.New records and geographical distribution of Alburnus hohenackeri Kessler, 1870 (Teleostei: Cyprinidae) in Iran. Check List 9:

105 Iranian Journal of Animal Biosystematics Editorial Policy Iranian Journal of Animal Biosystematics (IJAB) is published biannually by Office of the Vice-chancellor of Research Affairs of Ferdowsi University of Mashhad, Iran. IJAB publishes original scientific research, not published before or under consideration elsewhere, in the broad areas of Animal Biosystematics and Biodiversity which relates to the southern Palearctic region, including Iran. Publications will be in one of these three formats: full papers, short communications and reviews. Book reviews, scientific announcements and news relating to topics of the Journal will also be published. The main topics of interest are: theoretical, comparative, methodological and applied research relating to the following areas: Taxonomy, Morphology, Development, Population, Zoogeography, Ecology, Behavior, Biochemical and Molecular Population Genetics, Cytogenetics, Palaeo-neonthology, Phylogeny, Systems analysis and Modeling. The Journal is devoted to the understanding of animal diversity and its sustainable use, and addresses an international audience. For more details, please visit the web site: Subscription The subscription price of Iranian Journal of Animal Biosystematics is $20 per volume. Orders, which must be accompanied by the payment, may be sent to the publisher, Ferdowsi University of Mashhad Press, Mashhad, Iran. Copyright No part of this publication may be reproduced, stored or distributed by any means without permission in writing from Ferdowsi University of Mashhad Press, acting for the copyright holder Ferdowsi University of Mashhad Press ISSN: X (print), (online) Instructions to Authors Submission of the Manuscripts All manuscripts should conform to the following instructions and be prepared in grammatically correct American English. The length of manuscripts is not specified, but authors are requested not to exceed the length of an individual issue of the Journal. If there is any doubt about suitability, authors wishing to submit long manuscripts should contact the editor-in-chief before considering submission. Three identical copies should be submitted to the editor-in-chief, Jamshid Darvish, Rodentology Research Department, Faculty of Sciences, Ferdowsi University, , Mashhad, Iran, FAX +98 (0) , e- mail: Each copy should be complete with tables and high-quality reproductions of the original illustrations. Following scientific and linguistic reviews, the manuscript will be returned to the first (or corresponding) author for revision. The corrected manuscript must be returned to the editorial office within three months, or it will be discarded or considered as a newly submitted manuscript. Final submission requires original figures and an identical electronic copy (including all tables) on a CD using MS Word. Preparation of the Manuscripts All parts of the manuscript text, including literature cited, tables, figures and figure legends should be MS Word processed (2000, XP or 2003), double spaced, typed on one side of A4 paper, with margins of at least 3 cm on each side. All pages should be numbered consecutively at the top, right-hand corner. Papers should strictly follow the International Code of Zoological Nomenclature. Use the metric system for all measures and weights. All unfamiliar terms, as well as symbols, acronyms and abbreviations should be explained at the first time they are used. Manuscripts should conform to the following layout: TITLE PAGE: This should include contact information of the corresponding author (upper left), title of the paper, full name(s) of the author(s), followed by address(es), and a short running head. If both the vernacular and scientific names are used in the title, then the latter should be separated by a comma. Transliteration of authors names should be made according to the British National System of Transliteration. The superscript arabic numerals should link the authors names with their affiliations. Each affiliation should be on a separate line. ABSTRACT: Each paper should have an abstract. Provide one paragraph on a separate page in which the main results and conclusions are described briefly, with no description of the methods, discussion or abbreviations. It must be words long for regular papers and may be shorter for the notes and short communications. The abstract should be in a form that is intelligible if published alone in conjunction with the title. It should not include references.

106 KEY WORDS: They should immediately follow the abstract. Provide 3-6 alphabetically sorted words suitable for an information-retrieval system. INTRODUCTION: It should state the purpose of the work in relation to other works in the same field. Provide the full scientific name (genus and species) of studied organisms at the first mention of the vernacular name; thereafter, use either the scientific or the vernacular name consistently for all species. The author of the scientific name of a taxon may be cited at the first mention. MATERIAL AND METHODS: This section should follow the Introduction and should provide enough information to permit repetition of the experimental work. However, do not give excessive details of the procedures and leave out the type and make of instruments or chemicals used unless they are not widely available. RESULTS: This should be presented concisely and contain only enough explanation and interpretation to allow readers to understand what information the experiments and observations have provided. Explanations of why and how the results were obtained should be given in the Introduction and Methods sections respectively, and they should not be repeated in the Results section, nor should the results be discussed. The approximate position of each figure and table should be indicated in pencil in the margins of the manuscript. DISCUSSION: This part should interpret the results and not repeat them. No new results may be presented in the Discussion. In short manuscripts it may often be advantageous to combine RESULTS and DISCUSSION in one section. ACKNOWLEDGEMENTS (optional): This section should contain a very concise but full acknowledgement of all institutions or persons (without mention of their academic or other titles) who provided financial, collaborative or other support for the study. LITERATURE CITED: It should include only published works or works in press. Use the name-year system following style guidelines as provided in the CBE/CSE style manual (Council of Biology Editors/Council of Science Editors Scientific Style and Format: the CBE/CSE Manual for Authors, Editors, and Publishers. 6th edition, 1994, or 7th edition; Authors names should be provided in small capital letters. TABLES: Each table should be typed on a separate page and numbered with Roman numerals, without vertical lines, with the caption given at the top. Ensure that all numerical data are with the decimal point (not the decimal comma). All text information should be aligned left. In case of using abbreviations, they should be defined in the caption. ILLUSTRATIONS: Artworks should be submitted in black ink on good-quality white paper. Computer-generated diagrams should be printed on good-quality bond paper with high quality printers. The authors names, paper title abbreviations, figure numbers, and the arrows indicating the top of the figures should be supplied on the reverse. Figures will be reduced in publication to 8, 12, or 17 cm wide, so all internal structures, letters, and graphic symbols must be fully legible after size reduction. In maximum size, figures are accepted on A4 paper. Figure legends should be typed as a separate section of the manuscript, represented before the illustrations. Figures must be numbered consecutively as they appear in the text. Do not send original illustrations until the paper has been accepted. Illustrations are normally not returned to the authors. Procedure for submitted manuscripts Evaluation: Manuscripts will be refused without review if they address inappropriate topics or are apparently deficient in the style, format, linguistic or scientific level. All other manuscripts are reviewed by at least two referees. The author(s) should consider all recommendations or corrections suggested by the referees and the editor-in-chief. After the revision of the manuscript and receipt of the final version, the authors will be informed of the decision on acceptance within one month. Proofs and Reprints: One galley proof will be sent to the first (or corresponding) author. This should be corrected, signed, and returned to the editor-in-chief, Jamshid Darvish, Rodentology Research Department, Faculty of Sciences, Ferdowsi University, , Mashhad, Iran, FAX +98 (0) , ijab@um.ac.ir. If the proof has not been received in time, publication may be postponed or the article may be published without the author s revision. Thirty reprints of each paper are supplied free of charge. Additional reprints can be purchased and the orders should be received with the corrected proofs. Ethics Papers may be refused if based on research associated with the killing or damaging species regarded as threatened or listed in Red Data Books. Copyright After the acceptance of the manuscript, the authors must agree with the transfer of the copyright to the publisher, and also the right to reproduce the article in all forms and media.

107