Potential Impacts of Antibiotics in the Environment Amy Pruden Assistant Professor, Civil Engineering, Colorado State University 11 12 R1 R2 10 13 D 9 14 8 15 C R3 R4 7 16 B 6 17 5 A 4 1 3 2 H CNH 2 H H H
verview Agricultural Antibiotics verview of potential impacts Why study resistance genes? Poudre River Study Conclusions Recommendations
Agricultural Antibiotics More than ½ used in U.S. Animals Subtherapeutic use promotes weight gain. Animal waste > 130 x human waste (United States Senate Committee on Agriculture, 1997) Antibiotics can be excreted unaltered. Animal Waste Treatment??
Antibiotic Pathways Modified from www.usda.gov
Antibiotics Used: Tetracyclines Chlortet., oxytet., tet... Sulfonamides Macrolides Tylosin, erythromycin.. Ionophores Monensin.. β-lactams Penicilillin H 3 C H H H 3 C H C H H CH 3 H 11 12 H 3 C H N Erythromycin (Ery) H H 3 C R1 R2 10 13 D 9 14 8 15 C R3 R4 7 16 B H H H C 2 H 3 H 6 17 N--CH 2 --CH 2 -CH 2 - H 3 C H H H 3 C H 5 A Tetracylcline (Tet) CH H H H 3 C N CH3 Tylosin (Tyl) C 4 1 H 3 CH 3 2 H H CNH 2 H 3 C H Roxithromycin (Rox) H H N
Public Concern
Potential Impacts Toxicity to Aquatic life (H. Ramsdell, CSU) Planaria, flathead minnow, and Hyalella Chlortetracycline, tylosin, sulfamethazine, metronidizine, monensin and lyolocid showed toxicity Monensin strong toxicity and widespread use LD 50 = 5 ppm in water for minnows LD 50 = 20 ppm in sediment for Planaria LD 50 = 1 ppm in water for Hyalella Sublethal effects?
Potential Impacts Sub-lethal impacts: Endocrine disruptors Micropollutants not removed by wastewater treatment May cause hermaphroditism Effects on frogs Fish in Chesapeake Bay Sower et al., Env. Health Perspect. 2000
Potential Impacts Plant Uptake Antibiotic uptake by plants from soil fertilized with animal manure- Kumara et al. U. Minn. J Environ Qual (2005) Greenhouse studies: corn, green onion, & cabbage Uptake of chlortetracycline, but not tylosin Low: 2 17 ng/g, but correlates with manure concentration Implications for allergic individuals
Antibiotic Resistance Genes (ARG) Spread of ARG one of most urgent human health issues according to WH Use of antibiotics selects for antibiotic resistant organisms Shea, 2003; Fedorka-Cray et al., 2002; Smith et al., 2002; Sørum and L Abée-Lund, 2002; Teuber, 2001. Can be spread across microbial populations and in the environment ARG as pollutants
Resistance Gene Transfer ASM News November, 2004
Antibiotic Resistance Genes If we can detect and quantify resistance genes, then we have an assay on the bioavailability/impact of the antibiotics.
Mechanisms of Resistance Alteration of the antibiotic or target site tetm tets tet tetw tetq tett tetbp Impaired uptake or enhanced efflux teta tetb tetc tetd tete tetg teth tetj tety tetz verproduce target so higher concentration of antibiotic needed sul genes (PABA overproduction to make folic acid) Degrade antibiotic β-lactams Resistance transfer: Plasmids can be exchanged within and between species
Methods Plate counting: R2A agar with antibiotics. Polymerase chain reaction (PCR) assays: Presence/absence of a resistance gene family. Quantitative real-time PCR (Q-PCR) Quantify resistance gene families. Goal: Indicator of Bioavailability/impact of Antibiotics
Study Site: Poudre River
Map of Study Sites
CFU at Sites: April 2004 CFU Per Gram of Sediment 10 8 10 7 10 6 10 5 10 4 10 3 10 2 Chlortetracycline xytetracycline Mecolcycline Sulfamethoxazole Sulfamethazine Erythromycin Tylosin Monensin No Ab. site 1 site 2 site 3 site 4 site 5
CFU at Sites: February 2005 CFU Per Gram of Sediment 10 8 10 7 10 6 10 5 10 4 10 3 10 2 Chlortetracycline xytetracycline Mecolcycline Sulfamethoxazole Sulfamethazine Erythromycin Tylosin Monensin No Ab. site 1 site 2 site 3 site 4 site 5
Pitfalls of Culture-Based Methods 99% of environmental organisms cannot be cultured on standard media (Amann et al., Pace et al.). 16S rrna gene as a target for detecting microorganisms in environmental samples (Woese et al.). Targeting of functional genes.
Molecular Biology Approach Polymerase Chain Reaction (PCR) Exponentially amplify target genes using primers specific to the target. Low detection limit. Provides a means of presence/absence detection.
sul D sul BC sul Bcr sul A sul III sul I sul II Phylogenetics of Sul Sul Genes
New Sul Primers Primer Sul I-FW a SulI-RV Sul II-FW Sul II-RV Sul III-FW Sul III-RV Sul A-FW Sul A-RV Sul BC-FW Sul BC-RV Sul Bcr-FW Sul Bcr-RV Sul D-FW Sul D-RV Class targeted Sul I Sul II Sul III Sul A Sul BC Sul Bcr Sul D Sequences cgcaccggaaacatcgctgcac tgaagttccgccgcaaggctcg tccggtggaggccggtatctgg cgggaatgccatctgccttgag tccgttcagcgaattggtgcag ttcgttcacgccttacaccagc tcttgagcaagcactccagcag tccagccttagcaaccacatgg acaaggtcgcttccagactagc agctcggtatctggcatggctc atagctcccattgcgggttctc tttcaggaacgatgaacacagc agagtccagtgtcttagcgacg agtcttgtgctggtagccaggt Q-PCR annealing temp (ºC) 65 163 57.5 191 61 128 60 299 58.5 352 53.5 116 57.8 102 Amplicon Size (bp) Specificity verified by cloning and sequencing the inserts.
Detection of PCR Product
PCR Presence / Absence Assay Gene ID Site 1 April 2004 high-flow spring Site 2 Site 3 Site 4 Site 5 Site 1 February 2005 low-flow winter Site 2 Site 3 Site 4 Site 5 + control tetb(p) - - - - + - - - - - + tet() + - + + + + + + + + + tet(s) - - - - + - - - - - + tet(t) - - + + + - - - - - + tet(w) - + + + + + + + + + + sul(i) + + + + + + + + + + + sul(ii) - - + + + - - + + + + sul(iii) - - + + + - - - - - + sul(a) - - + - + - - - - - +
Real-time PCR Fluorescence 0 5 10 15 20 25 30 35 40 45 50 Number of Cycles
Log Copy of sul I Genes per Reaction 12 10 Sul I Gene Calibration 8 6 4 2 0 y = -0.22 x + 12.13 r 2 = 0.9978 0 10 20 30 40 50 Threshold Cycle (CT) Value
April, 2004: Spring High-Flow Copy of ARG / Copy of 16S Genes 10-2 sul(i) 10-3 sul(ii) 10-4 tet(w) tet() 10-5 10-6 10-7 10-8 10-9 10-10 site 1 site 2 site 3 site 4 site 5
Feb, 2005: Winter Low-Flow Copy of ARG / Copy of 16S genes 10-2 sul(i) 10-3 sul(ii) 10-4 tet(w) tet() 10-5 10-6 10-7 10-8 10-9 10-10 site 1 site 2 site 3 site 4 site 5
Aug, 2005: Summer Low-Flow Copy of ARG / Copy of 16S genes 10-2 sul(i) 10-3 sul(ii) 10-4 tet(w) tet() 10-5 10-6 10-7 10-8 10-9 10-10 site 1 site 2 site 3 site 4 site 5
Conclusions Resistance genes in Poudre sediments correlate with human and agricultural activity No direct correlation with antibiotics High sulfonamide resistance compared to tet resistance Fate of antibiotics vs fate of genes? High-flow versus low-flow? Implications for transport?
Recommendations Need further studies into the origin of the antibiotic resistance genes and their fate Human vs agricultural Do genes persist longer than antibiotics? Investigate and apply treatment strategies for mitigating risk.
Composting Field Study
Biodegradation of ARG
Students!!!
Thank You!! Thank you to USDA NRI and to the CSU Agricultural Research Station for supporting this research!! Ken Carlson & Sung-chul Kim Jessica Davis & Kathy Doesken Questions??