GROWTH PERFORMANCE, CARCASS TRAITS AND ECONOMIC VALUES OF PEKIN, MUSCOVY, AND MULARD DUCKS

Slov Vet Res 2018; 55 (Suppl 20): 357 65 DOI 10.26873/SVR-663-2018 Originl Reserch Article GROWTH PERFORMANCE, CARCASS TRAITS AND ECONOMIC VALUES OF PEKIN, MUSCOVY, AND MULARD DUCKS Frdos A.M. Hssn, Elshim M. Roushdy, Asm W. Zglool, Mohmmed A. Ali, Imn E. El-Arby* Deprtment of Animl Welth Development, Fculty of Veterinry Medicine, Zgzig University, El-Zer str. 114, 44511 Zgzig, Egypt *Corresponding uthor, Emil: genetics_engineering@yhoo.com Abstrct: This study imed to reconnoiter breed vritions in productivity, trits of crcss, economic rte, nd IGF-1 gene regultion for met production mong Pekin, Muscovy, nd Mulrd ducks. A 10-week tril ws conducted, using 120 ducklings (2-week old) tht were divided into three groups bsed on breed. Ech breed ws kept in seprte group, divided into four replictes of 10 birds ech. Muscovy ducks exhibited superior body weight, weight gin, feed conversion rtio, dressing nd brest percentge compred to the other breeds (P 0.001). The highest percentge of crude protein ws observed in the met of Mulrd ducks leg (23.17) nd brest (50.55), nd in Muscovy brest met (51.04). Pekin ducks yielded significntly higher (P 0.001) leg nd brest ft content (6.27, 6.40 respectively) thn Muscovy (4.58, 4.26 respectively) or Mulrd ducks (4.13, 3.88 respectively). Notbly, Muscovy ducks in comprison to the other breeds yielded the highest gross mrgin ($1.12) nd lowest budget to produce 1kg of live body weight ($2.08) (P= 0.004). Furthermore, heptic IGF-1 nd IGF1R expression ws higher in the Muscovy breed thn in the other breeds. These genes increse the growth nd development of muscles. Therefore, the Muscovy ducks re generlly superior in terms of performnce, crcss trits, nd economic vlues. Key words: duck breeds; performnce; crcss merits; costs; IGF-1; IGF-1R Introduction Ducks hve been consumed spordiclly in the pst, but re now rered both intensively nd commercilly. They re primrily rered for met nd eggs, lthough their fethers lso hve economic vlue. Duck met is comprble to tht of chicken nd is n lterntive source of protein, minerls, nd other nutrients for humns. In comprison to chickens, ducks re better dpted to vrying environmentl conditions, require less cre, nd re more resistnt to number of diseses (1). These chrcteristics likely form the bsis for the incresing importnce nd populrity of the duck industry. Some of the populr duck breeds rised for met production under Egyptin conditions include the Pekin, Muscovy, nd Mulrd. The Pekin duck is commonly bred for met production in Egypt. Improvements in White Pekin strins tke dvntge of the duck s nturl bility to grow rpidly nd its resistnce to infections to which other poultry re susceptible. Thus, producers re ble to reduce input costs while improving crcss qulity nd Received: August 2018 Accepted for publiction: September 2018

358 F. A.M. Hssn, E. M. Roushdy, A. W. Zglool, M. A. Ali, I. E. El-Arby fethering. Genetic improvements hve now cused the modern domestic White Pekin to surpss the broiler breeds of chicken in feed efficiency nd weight gin t similr living mrket weight (2). On the other hnd, Muscovy ducks re very populr becuse they dpt well to vrious rering conditions nd they hve high brest met with unique tste nd lest clorie content (3) in comprison to Pekin ducks. The Mulrd (hybrid of Muscovy nd Pekin ducks) hs been used for production of fttened liver s well s for met production (4,5). Their crcsses re chrcterized by high proportion of brest nd leg muscle nd low proportion of subcutneous ft. Economic trits such s crcss trits nd growth performnce re very significnt in duck production. These trits re controlled by sets of cndidte genes which ply n importnt role in ducks growth nd development s the insulin-like growth fctors genes (IGF-1 nd IGF-2). The IGF-1 hs the potentil to be key regultor of growth, body composition nd skeletl trits during postntl development (6), wheres IGF-2 reportedly functions primrily during embryonic growth nd development (7). Therefore, this study ws crried out to evlute performnce, crcss merits, economic vlues, nd IGF-1 nd IGF1R gene regultion in Pekin, Muscovy, nd Mulrd ducks rered under Egyptin subtropicl conditions Mteril nd methods Experimentl design, diets, nd husbndry of duck flock: A totl of 120 mle, two weeks old Muscovy, Pekin, nd Mulrd ducklings (40 ech) of uniform body weight were used in this study. Ech breed ws rered until the ge of 12 weeks nd mintined s seprte groups, divided into four replictes with 10 ducklings ech. A wing bnd ws used to lbel ech duck. During the experiment, wter nd feed were supplied d libitum. Strter diets with 20% crude protein (from 2 to 7 weeks) nd Tble 1: Ingredients nd chemicl composition of experimentl diets fed to ducks Items Strter (2 7 weeks) Grower/Finisher (8 12 weeks) Ingredients (g/kg) Yellow corn Soyben mel, 44% Corn gluten, 60% Soyben oil Clcium crbonte Dibsic clcium phosphte Sodium chloride Premix 1 DL- Methionine, 98% L-lysine, 78% Clculted chemicl composition 2 ME, MJ CP, % EE, % CF, % C, % Avilble Ph, % Lysine, % Methionine, % 570.0 315.0 65.0 6.0 8.0 26.0 5.0 3.0 1.0 1.0 12.12 20.34 4.39 3.50 0.92 0.58 1.13 0.41 600.0 295.0 30.0 30.0 13.0 20.0 5.0 3.0 2.0 2.0 12.56 17.84 6.80 3.37 0.95 0.45 1.18 0.50 1 Supplied per kg of diet: Vitmin A (12000 IU); Vitmin D 3 (2200 IU); Vitmin E (10 mg); Vitmin K 3 (3 mg); Vitmin B 1 (1mg); Vitmin B 2 (5 mg); Vitmin B 6 (1.5 g); Pntothenic cid (10 mg); Vitmin B 12 (10mg); Nicin (30 mg); Folic cid (1mg); Biotin (50 mg); Fe (30 mg); Mn (60 mg); Cu (4 mg); I (1mg); Co (1mg); Se (1 mg); nd Zn (50 mg); Choline chloride (300 mg). 2 Clculted ccording to NRC (1994) tbles. ME = Metbolizble energy; CP = Crude protein; EE = Ether extrct; CF = Crude fiber.

Growth performnce, crcss trits nd economic vlues of Pekin, Muscovy, nd Mullrd ducks 359 grower/finisher diets with 18% crude protein (from 8 to 12 weeks) were fed to the ducklings in the form of dry msh. All experimentl diets were formulted to ensure n dequte supply of ll nutrients ccording to the Ntionl Reserch Council (8) recommendtions for duck breeds (Tble 1). Ducks of ll groups were kept under similr mngement conditions nd housed in pens with similr floors (5 birds/m 2 ) covered with 5-cm thickness of wood shvings s bedding. The temperture of the houses ws mintined t 25 C, nd continuous light ws provided from the 2 nd week until the end of the study. All ducklings were vccinted by live ttenuted vccines ginst duck choler (1 ml/duckling, subcutneous), duck plgue (0.5 ml/duck, intrmusculr), nd duck virus heptitis (1 ml/duck, intrmusculr) t the ge of 28, 46 nd 50 dys, respectively. The niml experiment protocol ws pproved by the Institutionl Animl cre nd Use committee t Zgzig University. The experiment ws conducted t the reserch frm of Poultry nd Rbbit, Fculty of Veterinry Medicine, Zgzig University, Egypt. Growth performnce Finl live body weight (LBW) ws recorded nd body weight gin (BWG), verge feed intke (AFI), nd feed conversion rtios (FCR) were clculted t the end of experiment. The feed ws withdrwn before birds weighing for 2h. Feed conversion ws clculted s g feed/g gin. LBW nd BWG were evluted bsed on individul bird dt, wheres AFI nd FCR were ssessed bsed on the replicte unit. Smple collection, crcss trits, nd met nlysis Eight ducks from ech studied breeds (two from ech replicte) were selected ccording to n verge body weight for the respective breed nd fsted for 12h before slughtering. The birds were mrked with individul numbers, weighed, nd euthnized by cervicl disloction before being mnully defethered nd eviscerted. The giblets (liver, gizzrd, nd hert), eviscerted crcss, brest nd thigh muscles were weighed nd their percentges reltive to live body weight were clculted. After slughter, the liver ws weighed nd two 1-cm sections were immeditely resected, gently flushed with PBS, nd stored t -80 C until mrna extrction. Smples of brest nd thigh met of selected individuls were lso resected, dried, ground, nd subjected to proximte nlysis to determine crude protein, moisture, totl sh, nd ft content. Smples were investigted using stndrd procedures (9). IGF-1 nd IGF1R gene expression in liver by Rel-Time PCR RNA from the liver smples ws extrcted using QIAmp RNesy Mini kit (Qigen, Germny) ccording to the mnufcturers instructions. A GeneQunt spectrophotometer (Phrmci Biotech, Freiburg, Germny) ws used to estimte purity nd concentrtion of RNA. Complementry DNA (cdna) ws obtined by reverse trnscriptse of RNA using RevertAid Reverse Trnscription kit (Thermo Fisher). Rel-time PCR nlysis ws performed using QuntiTect SYBR Green PCR kit (Qigen, Germny), with β-ctin s the internl control gene. Gene-specific primer sequences F1:CAACGAGCGGTTCAGGTGT, R1:TGGAGTTGAAGGTGGTCTCG, F2: ATCCAGCAGTAGACGCTTACACC, R2: CGTGCAGACTTAGGTGGCTTTA nd F3: GGTATTCCACCTCACTCTCCT, R3: AACTTCCTTCACAACTCCATCT were used to mplify 92 bp of Duck β-ctin, 117 bp of IGF-1, nd160 bp of IGF1R (10). The qrt-pcr ws crried out in 25µl volume of 12.5 µl of 2 QuntiTect SYBR Green PCR Mster Mix; 0.5 µl of ech primer, 0.25 µl of RevertAid Reverse Trnscriptse (200 U/µL); 3 µl of the templte nd 8.25 µl of nuclese free wter. The cycling ws progrmmed s follows: 95 C for 5 min; followed by 40 cycles of 15s t 95 C, 15s t 60 C, nd 15s t 72 C. Melt-curve nlysis ws performed between 65 C to 95 C, using increments in temperture of 0.5 C. Ct vlues for the SYBR green RT-PCR were mesured using Strtgene MX3005P softwre

360 F. A.M. Hssn, E. M. Roushdy, A. W. Zglool, M. A. Ali, I. E. El-Arby (Strtgene Technicl Services, USA). To clculte the vrition in gene expression in the RNA of vrious smples, the Ct of ech smple ws compred with tht of the Pekin breed s reference (the lowest growth breed) ccording to the "ΔΔCt method outlined by Yun et l. (11). Economic vlues of duck breeds The economic vlue of the breeds under investigtion ws evluted using cost-benefit nlysis, by estimting the totl vrible costs (TVC), gross income for live weight, gross mrgin, nd benefit cost rtio (BCR). Totl vrible costs were estimted by considering the cost incurred in obtining the ducklings, s well s the expenses of feed, litter, lbor, veterinry services, electricity, nd other miscellneous expenditure. Fixed costs were not included in the nlysis, becuse they were equl cross ll breeds. Gross mrgin nlysis ws used to determine profitbility of the breeds, s described by Olukosi nd Erhbor (12). The unit of mesurement ws USD/kg live weight. The following eqution ws used to derive gross mrgin: GM= GI TVC, where GM= gross mrgin; GI= gross income/kg live weight; nd TVC= totl vrible cost tht represents the totl cost of production/kg live weight. The benefit cost rtio (BCR) ws derived by the following formul: GM/TVC. Sttisticl nlysis All sttisticl nlyses were performed using SPSS V.16 softwre (SPSS, IL, USA). Dt were nlyzed using one-wy ANOVA, fter normlity ws verifying using the Kolmogorov Smirnov test. The Tukey s (HSD) multiple comprison test ws used to determine significnt differences between men vlues. Vribility in the dt ws expressed s the pooled SEM, nd the lph level for determintion of significnce ws set t 0.05. Results Growth performnce As shown in Tble (2), the Muscovy breed showed the gretest finl BW (3903.75) nd BWG (3659.65) followed by the Mulrd (3518.52 nd 3267.42, respectively) nd Pekin (3355.00 nd 3117.20, respectively). In ddition, AFI nd FCR were significntly declined in Muscovy breed compred to the other breeds. However, no significnt chnge ws detected between the Pekin nd the Mulrd. Tble 2: Growth performnce of Muscovy, Pekin, nd Mulrd ducks Breed Prmeter Muscovy Pekin Mulrd SEM P-vlue Initil BW (g) 244.10 237.80 251.10 2.53 0.098 Finl BW (g) 3903.75 3355.00 c 3518.52 b 27.05 0.001 BWG (g) 3659.65 3117.20 c 3267.42 b 28.36 0.001 AFI (g) 10744.90 b 11336.00 11240.61 84.16 0.001 FCR (g feed: g gin) 2.94 b 3.64 3.44 0.09 0.001 BW: Body weight, BWG: Body weight gin, AFI: Averge feed intke, FCR: Feed conversion rtio c Mens bering different superscript letters within the sme row re significntly different (P<0.05). SEM: Stndrd error of mens. Crcss trits nd met composition Crcss trits of the vrious breeds re summrized in tble 3. The results reveled tht the dressing percentge of Muscovy ducks (75.20) ws highly significnt (P 0.001) thn tht of Mulrd or Pekin ducks (73.73, 72.41 respectively). Both Muscovy nd Mulrd ducks possess higher reltive brest weight (51.04, 50.55 respectively) compred to Pekin ducks (49.39). The reltive thigh weight differed significntly mong the breeds, with the Muscovy breed yielding the highest vlues (P = 0.001). Differences in the percentges observed

Reltive mrnaexpression of IGF-1&IGF-1R Growth performnce, crcss trits nd economic vlues of Pekin, Muscovy, nd Mullrd ducks 361 Tble 3: Crcss trits nd met composition of Muscovy, Pekin, nd Mulrd ducks Breed Prmeter Muscovy Pekin Mulrd SEM P-vlue Crcss chrcteristics Dressing % 75.20 72.41 c 73.73 b 0.30 0.001 Brest % 51.04 49.39 b 50.55 0.20 0.001 Thigh % 24.16 23.02 b 23.17 b 0.16 0.001 Hert % 0.66 0.65 0.68 0.01 0.163 Liver % 2.36 b 2.26 b 3.34 0.15 0.001 Gizzrd % 2.35 2.39 2.07 0.08 0.179 Brest met composition Moisture % 74.32 71.53 b 74.73 0.38 0.001 Protein % 19.21 17.41 b 19.64 0.26 0.001 Ft % 4.26 b 6.40 3.88 b 0.29 0.001 Ash % 1.31 1.26 1.21 0.02 0.125 Thigh met composition Moisture % 73.46 72.04 73.14 0.33 0.188 Protein % 17.52 b 17.26 b 19.08 0.22 0.001 Ft % 4.58 b 6.27 4.13 b 0.22 0.001 Ash % 1.12 1.04 1.09 0.02 0.253 c Mens bering different superscripts within the sme row re significntly different (P<0.05). SEM: Stndrd error of mens. 3 Muscovy Pekin Mulrd 2,5 b 2 1,5 b 1 c c 0,5 0 1-IGF 1-IGFR Figure 1: Quntittive expression of IGF-1 nd IGF1R extrcted from the liver of vrious duck breeds (men ± SEM) fter 10 weeks. Groups with different letters re significntly different (P< 0.05, one-wy ANOVA)

362 F. A.M. Hssn, E. M. Roushdy, A. W. Zglool, M. A. Ali, I. E. El-Arby Tble 4: Economic vlues for Muscovy, Pekin, nd Mulrd ducks Prmeter Breed Muscovy Pekin Mulrd SEM P-vlue Feed cost / duck ($) 4.59 b 4.85 4.83 0.04 0.005 Feed cost / kg weight gin ($) b 1.26 1.67 1.58 0.04 0.001 TVC / kg live weight ($) 2.08 b 2.15 b 2.30 0.03 0.004 Gross income / duck ($) 12.49 8.15 c b 10.34 0.21 0.001 GM / kg live weight ($) 1.12 0.28 c 0.64 b 0.11 0.001 Benefit cost rtio (BCR) 0.54 0.13 c 0.28 b 0.05 0.001 Costs per kg feed=$0.45 nd $0.41 for strter nd grower rtion, respectively. Purchsing price per duck= $2.56, $1.41, $2.30 for Muscovy, Pekin, nd Mulrd, respectively. Selling price (Gross income)/kg live weight= $3.20, $2.43, $2.94 for Muscovy, Pekin nd Mulrd, respectively. TVC = Totl vrible costs; GM = Gross mrgin. -c Mens bering different superscripts within the sme row re significntly different (P< 0.05). SEM: Stndrd error of mens. for hert nd gizzrd were not significnt (P>0.05) mong the breeds; however, the liver percentge of Mulrd ducks (3.34%) ws considerbly higher thn tht of Muscovy nd Pekin ducks (2.36 nd 2.26%, respectively). As shown in Tble 3, the brest nd thigh met composition differed significntly mong the vrious breeds. The moisture content ws highly significnt (P 0.001) in the brest met of Mulrd nd Muscovy ducks compred to tht of Pekin ducks. The highest percentge of crude protein ws observed in the leg nd brest met of Mulrd ones, nd in Muscovy brest met. Pekin ducks yielded significntly higher (P 0.001) content of ft in both leg nd brest met thn Muscovy nd Mulrd ducks, wheres the crcss ftness of Muscovy nd Mulrd ducks ws similr. No significnt differences (P>0.05) were detected in the sh content of brest nd thigh muscles mong the vrious breeds. IGF-1 nd IGF1Rgenes expression The reltive chnges in IGF-1 mrna trnscript levels re presented in Figure (1). These results clerly demonstrte tht the Muscovy ducks showed higher significnt IGF- 1 gene expression, followed by Mulrd nd Pekin ducks in tht order. Economic vlues of duck breeds Economic clcultions reveled tht Muscovy breed hd significntly lower (P 0.001) feed cost nd feed cost/kg gin compred to the other breeds, wheres there is no significnt difference between Pekin nd Mulrd breeds (Tble 4). However, the totl vrible costs of Muscovy nd Pekin were significntly lesser thn those of Mulrd ducks (P = 0.004). Muscovy ducks showed the highest vlues for gross income ($12.49), gross mrgin ($1.12), nd benefit cost rtio (0.54), followed by Mulrd nd Pekin ducks in tht order. Discussion It is importnt to note tht the three breeds under investigtion (Muscovy, Pekin, nd Mulrd) differ considerbly in terms of growth rte nd the chrcteristics of vluble body prts, but ll hve the bility to grow continuously until the 12 th week of life (13). As shown in our results, Muscovy ducks yielded superior vlues for body weight, weight gin, verge feed intke, nd feed conversion rtio (3903.75, 3659.65, 10744.90 nd 2.94, respectively), which is consistent with previous studies (14-16). However, Bhuiyn et l. (17) climed tht the Pekin breed is superior to both Muscovy nd Deshi white ducks. The highest weight in Mulrd hybrid ducks during the 12 th week of life, in comprison to Muscovy nd Pekin ducks (13). Numerous studies hve shown tht the crcss s composition nd the met yield of ducks vried by breed. In the present study, Muscovy ducks yielded significntly higher dressing percentge of 75.20 compred to Pekin (72.41%) nd Mulrd ducks (73.73%). Moreover, the highest brest nd thigh percentges

Growth performnce, crcss trits nd economic vlues of Pekin, Muscovy, nd Mullrd ducks 363 were observed in Muscovy ducks. The high dressing percentge observed in the Muscovy could be ttributed to its heviness. In ddition, two possible resons for the higher dressing percentge of Muscovy ducks re reduced plumge nd smller internl orgns in comprison to other breeds (14). Similrly, El- Soukkry et l. (18) reported tht the Muscovy duck hd significntly higher commercil cut yield (including the brest nd drumstick) thn Pekin nd Sudni ducks. Also, Wwro et l. (19) reported tht the highest vlues for brest nd leg muscle weight were observed in the crcsses of Muscovy mles. However, Bhuiyn et l. (17) reported tht the highest dressing yield ws observed in Pekin ducks (70%) s compred to Muscovy nd Deshi White ducks. The present study clrified tht the moisture content in the brest met of Mulrd nd Muscovy ws highly significnt thn tht of Pekin breed. The highest percentge of crude protein ws observed in the met of leg nd brest of Mulrd ducks, nd in Muscovy brest met. Pekin ducks yielded significntly higher in both leg nd brest met ft content thn either Muscovy or Mulrd ducks. No significnt vrinces (P> 0.05) were detected in sh content of brest nd thigh muscles mong the vrious breeds. These results re consistent with those of nother study conducted by Wwro et l. (19), who reported the highest crude protein vlues ( = 19.5%) in Muscovy nd Mulrd brest muscles, nd low significnt vlue in the Pekin brest muscle ( = 19.0%). According to Isguzr et l. (20), the ft content of the Pekin leg nd brest met is significntly higher thn tht of locl Turkish breeds. The moisture percentge in the Muscovy leg nd brest met ws higher thn Sudni ducks (21). In contrst, Bons et l. (22) noted greter content of brest protein (21.5%) nd muscles of leg (22.5%) of Pekin breed. The thigh nd brest muscle wter content were significntly higher, nd the sh content ws significntly lower in the Pekin thn in the Muscovy (15). The IGF system hs been considered s n essentil regultory system for controlling development nd growth in mmmls nd chickens. IGF-1, s member of the IGF fmily, is growth, metbolism, body composition, skeletl chrcteristics, ft deposition nd growth of dipose tissue cndidte gene in chickens (23). Moreover, IGFIR is membrne glycoprotein mediting the biologicl ctions of IGF-1 nd IGF-2, which hve gret effect on chicken growth nd qulity trits of met nd crcss (24). IGF1R plyed importnt roles on the developmentl nd dult stges such s the cell cycle, trnsplnttion, subsistence, metbolism, propgtion nd differentition (25) In previous studies, higher significnt of heptic IGF-1 expression hs shown breed specificity in ducks (26), nd chickens (27). Similrly, the present results showed significnt differences in IGF-1 expression mong the vrious breeds. The highest expression ws observed in the Muscovy, finding tht might be responsible for its superior muscle growth nd crcss merit. Assessment of the three breeds indicted tht the Muscovy ws the most economicl (followed by the Mulrd nd Pekin), both in terms of the cost to produce 1kg live weight nd the feed cost per unit gin. In ddition, the highest profit mrgin ws relized from the Muscovy. The min contributing fctors to the comprtively higher profit mrgin of Muscovy ducks include the higher mrket price of the met, nd to lesser extent, the superior biologicl efficiency of Muscovy ducks in comprison to Mulrd nd Pekin ducks (28). In comprison to other breeds, the Muscovy yields the best vlues for net income, net income mrgin, nd gross return ttributed to the totl vrible costs per 100 prent ducks (29). Conclusion In conclusion, Muscovy ducks showed higher performnce, dressing percentge, nd IGF-1 expression thn Mulrd or Pekin ducks. The Muscovy nd Mulrd breeds yielded better qulity thn the Pekin, owing to higher protein content nd lower body ft. Conflict of interest The uthors declre tht they hve no conflict of interest.

364 F. A.M. Hssn, E. M. Roushdy, A. W. Zglool, M. A. Ali, I. E. El-Arby References 1. Adzitey F, Adzitey SP. Duck production: Hs potentil to reduce poverty mong rurl households in Asin communities A review. J.World's Poult. Res. 2011; 1: 7 10. 2. Xu TS, Liu XL, Hung W, Hou SS. Estimtes of genetic prmeters for body weight nd crcss composition in Pekin ducks. J. Anim Vet. Adv. 2011; 10: 23 28. 3. Wu X, Yn MJ, Lin SY, Liu XT, Li A, et l. GH gene polymorphisms nd expression ssocited with egg lying in Muscovy ducks (Cirinmoscht). Heredits 2014; 151: 14 9. 4. Béz E, Slichon MR, Mrche G, Wcrenier N, Dominguez B, Culioli J, et l. Effect of ge nd sex on the structurl, chemicl, technologicl chrcteristics of mule duck met. Br. Poult. Sci. 2000; 41: 300 7. 5. Wwro K, Bochno R, Wilkiewicz- Wwro E. Slughter vlue of crossbred ducks (Muscovy Pekin) slughtered t different ge. NATSCI. 2001; 8:17 25. 6. Mrk McM, Richrds P, Poch SM, McMurtry JP. Expression of insulin-like growth fctor system genes in liver nd brin tissue during embryonic nd post-htch development of the turkey. CBP 2005; 141: 76 86. 7. Mc Murtry JP, Frncis GL, Upton Z. Insulin-like growth fctors in poultry. Domest. Anim. Endocrinol.1997; 14: 199 229. 8. Richrds MP, Poch SM, McMurtry JP. Expression of insulin-like growth fctor system genes in liver nd brin tissue during embryonic nd post-htch development of the turkey. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2005; 141: 76 86. 9. Ntionl Reserch Council (NRC). Nutrient requirements of poultry, 9 th revised edition. Ntionl Acdemy Press, Wshington, DC, USA 1994; 42 4. 10. AOAC. Officil methods of nlysis (18 th ed).assocition of Officil Anlyticl Chemist. Arlington, VA, USA 2004; 931. 11. Song CL, Liu HH, Kou J, Lv L, Li L, Wng WX nd Wng JW. Expression profile of insulin-like growth fctor system genes in muscle tissues during the postntl development growth stge in ducks. Genet. Mol. Res. 2013; 12 (4): 4500 14. 12. Yun JS, Reed A, Chen F, Stewrt CN, et l. Sttisticl nlysis of rel-time PCR dt. BMC Bioinformtics 2006; 7: 85. 13. Olukosi JO, Erhbor PO. Introduction to frm mngement: principles nd pplictions. Agitb Publishers Limited, Zri, Nigeri 1988; 77 83. 14. Szász S. Chnges in fether development nd met producing cpcity of the Pekin, Mule nd Muscovy ducks ccording to the ge nd sex. PhD thesis, Deprtment of Poultry Breeding, Fculty of Animl Science, 2003; University of Kposvár, Kposvár, Hungry. 15. Rshid MA, Kwsr MH, Rshid MA, Mih MY, Howlider MAR, et l. Fertility nd htchbility of Pekin nd Muscovy duck eggs nd performnce of their ducklings. Progress. gric. 2009; 20: 93 8. 16. Gll A, Ali WAH, Ahmed AMH, AliKh AA, et l. Performnce nd crcss chrcteristics of Dumyti, Muscovy, Peking nd Sudni duck breeds. Egyptin J. Anim. Prod.2011; 48: 191 202. 17. Stęczny K, Kuźnick J, Admski M. Comprison of growth rte nd body weight of ducks of different origins. Act Sci.Pol., Zootechnic 2015; 14: 97 106. 18. Bhuiyn MM, Khn MH, Khn MAH, Ds BC, Lucky NS, Uddin MB, et l. A study on the comprtive performnce of different breeds of broiler ducks under frmer s condition t Frming System Reserch nd Development (FSRD) site, Sylhet, Bngldesh. Int. J. Poult. Sci. 2005; 4: 596 9. 19. El-Soukkry FAH, Mohmed HMA, Dwood AAA, Abd-El Syed SY, et l. Physicochemicl, microbiologicl nd lipid chrcteristics of duck met. Minufiy J. Agric. Res. 2005; 30: 527 48. 20. Wwro K, Wilkiewicz-Wwro E, Kleczek K, Brzozowski W, et l. Slughter vlue nd met qulity of Muscovy ducks, Pekin ducks nd their crossbreeds, nd evlution of the heterosis effect. Arch. Anim. Breed. 2004; 47: 287 99. 21. Isguzr E, Kock C, Pingel H. Growth, crcss trits nd met qulity of different locl ducks nd Turkish Pekins (short communiction). Arch. Anim. Breed. 2002; 45: 413 8.

Growth performnce, crcss trits nd economic vlues of Pekin, Muscovy, nd Mullrd ducks 365 22. Abd El-Smee LD, El-Allwy HMH, Mghrby NA, et l. Comprtive study on some productive trits of Muscovy nd Sudni ducks in Egypt. Int. J. Poult. Sci. 2012; 11: 264 8. 23. Bons A, Timmler R, Jeroch H, et l. Chnges in body composition nd crude nutrient content of Pekin ducks during growth. In Proceedings of the First World s Wterfowl Conference, 1-4 December 1999, Tichung, Tiwn, pp. 328 32. 24. Zhou H, Mitchell AD, McMurtry JP, Ashwell CM, Lmont SJ, et l. Insulin-like growth fctor-i Gene polymorphism ssocitions with growth, body composition, skeleton integrity, nd metbolic trits in chickens. Poult. Sci. 2005; 84: 212 9. 25. Amills M, Jiménez N, Villlb D, Tor M, Molin E, Cubiló D, Mrcos C, Frncesch A, Sànchez A, Estny J, et l. Identifiction of three single nucleotide polymorphisms in the chicken insulin-like growth fctor 1 nd 2 genes nd their ssocitions with growth nd feeding trits. Poult. Sci. 2003; 82: 1485 93. 26. Lei M, Peng X, Zhou M, Luo C, Nie Q, Zhng X, et l. Polymorphisms of the IGF1R gene nd their genetic effects on chicken erly growth nd crcss trits. BMC Genet. 2008; 9: 1 9. 27. Shu J, Li H, ShnY, XuW, Chen W, Song C, Song W, et l. Expression profile of IGF-I-clcineurin-NFATc3-dependentpthwy genes in skeletl muscle during erly development between duck breeds differing in growth rtes. Dev. Genes Evol. 2015; 225: 139 148. 28. Goud EM, Esswy GS. Polymorphism of insulin-like growth fctor I gene mong chicken breeds in Egypt. Z. Nturforsch. 2010; 65: 284 8. 29. Solomon JKQ, Austin R, Cumberbtch RN, Gonslves J, Seforth E, et l. A comprison of live weight nd crcss gin of Pekin, Kunshn nd Muscovy ducks on commercil rtion. livestock res. rurl dev. 2006; 18: 154.