Antimicrobial resistance of Staphylococcus aureus isolated from pork in Ho Chi Minh City, Vietnam

Transcription

1 Agricultural Science Research Journal 5(4); pp , April 2014 Available online at ISSN: International Research Journals Full Length Research Paper Antimicrobial resistance of Staphylococcus aureus isolated from pork in Ho Chi Minh City, Vietnam *Dang Thi XuanThiep, Hoang Thi Kim Ngan, VoThi Tra An Department of Veterinary Biosciences, Faculty of Animal Science and Veterinary Medicine, Nong Lam University *Corresponding Author s thiep.dangthixuan@hcmuaf.edu.vn Abstract A total of 152 pork samples were collected in Ho Chi Minh City from March to August, 2012 andthe prevalence of Staphylococcus aureus (S. aureus) was 43.4%. AllS. aureus isolated from pork were multi-resistant isolates and9.1% of the isolates were resistant against nine antibiotics. The percentage of resistance among the isolates to ampicillin, penicillin, kanamycin, erythromycin, clindamycin and cephalexin were 100%, 100%, 56.1%, 15.2%, 13.6%, and 12.1%, respectively. The blaz gene was detected with the highest percentage in 98.5% of the S. aureus isolates, followed by the lina gene which was present in 44.4% isolates. The aaca-aphd, tetm and msra genes were also detected. No meca gene was detected in the oxacillin-resistant S. aureus isolates. Most of the resistant S. aureus carried one to three resistance genes from six genes tested. Especially, the oxacillin-resistant S. aureus isolates contained two to three resistance genes. Key words: Staphylococcus aureus, antibiotic resistance, pork, resistance gene INTRODUCTION Staphylococcus aureus (S. aureus) is an important cause of food poisoning. Staphylococcal toxins are resistant to heat and cannot be destroyed by cooking. Staphylococci on contaminated pork can be derived from the pig s gastrointestinal tract, transport, personnel or the environment in slaughter houses (Lin et al, 2009). Development of antibiotic resistance in S. aureusis well known. Many isolates even became multi-drug resistant, including methicillin-resistant S. aureus (MRSA). This posesa risk for public health. In Vietnam, some studies on antibiotic resistance of S. aureus isolated from humans were performed. Results showed that many S. aureus isolates were resistant to at least one antimicrobial compound. However, studies on antimicrobial resistance of S. aureus of animal origin were limited. Porkis one of the animal products which hasa veryhighrisk of causing infections and antibioticresistant S. aureus may pose difficulties for antimicrobial therapy. Therefore, this study was conducted to determine the prevalence, pattern of antimicrobial resistance and some antimicrobial resistance genes among S. aureus isolated from pork meat. MATERIALS AND METHODS Sample collection and S. aureus identification In total 152 pork samples were collected in markets and supermarkets in Ho Chi Minh City, Vietnam from March to August, Pork samples were collected by using a sterileknifeto cut500 g porkwhich wasput into sterile bags. Samples were kept in ice-boxesandtransferredto the laboratorywithin 24 h for culturing. Culture of S. aureus isolates has been described in TCVN : Briefly, 25g of meat was cut from the sample and added with 225 pepton broth for stomaching in 1 min. An aliquot of 10 µl of sample culture was plated on Baird Parker agar and incubated at 37 o C for 24h. Colonies suspected of being S. aureus were subcultured on Baird Parker agar plates and tentatively identified according to morphologic features, pigment production, Gram staining, coagulase tube test, catalase test, and oxidase test. S.

2 63 aureus ATCC was used forquality control. Antimicrobial susceptibility The antimicrobial susceptibility of the isolates was determined and interpreted according to the guidelines of the Clinical and Laboratory Standards Institute (CLSI, 2012) Fifteen antimicrobial agents were tested by the Kirby Bauer disk diffusion assay on Mueller Hinton agar (Himedia, India). The antimicrobials tested were ampicillin (Am, 10µg), penicillin (Pn, 10µI), amoxicillin/clavulanic acid (Ac, 20/10µg), oxacillin (Ox, 1µg), cephalexin (Cp, 30µg), ceftazidime (Cz, 30µg), gentamicin (Ge, 10µg), kanamycin (Kn, 30µg), norfloxacin (Nr, 10µg), ciprofloxacin (Ci, 5µg), tetracycline (Te, 30µg), chloramphenicol (Ch, 30µg), erythromycin (Er, 15µg), clindamycin (Cl, 2µg), sulfamethoxazole/trimethoprim(bt, 1.25/23.75µg). S. aureus ATCC was used as quality control organism. The S. aureus isolates that were resistant to oxacillin were subjected to meca gene specific PCR toidentify MRSA. DNA extraction A rapid boiling lysis procedure was used to prepare template DNA from S. aureus isolates according to Queipo-Ortunoet al (2008). Two to three typical colonies of S. aureus isolates were taken from nutrient agar and suspended in 400 µl of nuclease-free water. The samples were centrifuged at 12,000 rpm for 15 min. The supernatant was eliminated and the pellet was resuspended in 300 µl of nuclease-free water, subjected to boiling in a water bath at 100 C for 10 min, frozen at C then thawed and centrifuged at 14,000 rpm for 10 min before the supernatants werestored at -20 C. Aliquots of 2 µl DNA were used for PCR. PCR amplification The primers used for PCR amplification are listed in Table 1. All primers were synthesized by IDT (IntegratedDNA Technologies, USA). Universal 16SrRNA gene primers were used as a control (supplied by Dr. Ho Thi Kim Hoa, Faculty of Animal Science and Veterinary Medicine, Nong Lam University). PCR reaction mixtures contained 12.5 µl Go Taq R Green Master Mix 2X (Promega, USA), 2 µl oligonucleotide primers (25pM) (IDT, USA), 2 µl DNA template and 8.5 µl nuclease-free water, in a total of 25 µl (Promega, USA). DNA fragments were examined by electrophoresis on a 1.5% agarose gel in 0.5 X TBE buffer at 100 V for 40 min and the gels were photographed under UV-light sing a Bio-Rad UV2000. A 100 bp DNA ladder was run simultaneously as marker. Sequencing Representative resistance genes (blaz, aaca-aphd, tetm and lina) were sequenced and compared with GenBank data using BLAST. If they had a high degree of similarity (> 90%) to corresponding genes in GenBank, they can confirm the presence of the expected genes in PCR positive S. aureus isolates. RESULTS AND DISCUSSION The prevalence of S. aureus isolated from pork in Ho Chi Minh City was 43.4% (66/152). S. aureus contaminated pork, which can cause food poisoning, can be derived from the pig s nose, skin surface, gastrointestinal tract, transport, personnel or the environment in slaughter houses or during storage. Some previous studies also showed the presence ofs.aureusinporksampleswith42% in the Netherlands ( van Loo et al, 2007) and 12.1% in South Korea (Hee et al, 2008). A study in Germany showed that the rate of S.aureus in pork was 51.1%.Those results indicate that S.aureus toxins may be an important cause of food poisoning in many countries with equivalent severity of C.perfringens and second only to Salmonella (Atanassova et al, 2001). The percentage of resistance to antimicrobials of S. aureus isolates is shown in Figure 1. Complete resistance to penicillin and ampicillin was found in all isolates. Penicillin and ampicillin have beenused for a long time in veterinary medicine in Vietnam. This may explain why almost complete resistance to those antibiotics is observed. Resistance to beta-lactam antibiotics in S. aureus is caused either by the production of beta-lactamases which inactivate the antibiotic or by modification of the target of the antibiotic. Moreover, results of this study showed that 6.1% of the S. aureus isolates is resistant to amoxicillin/clavulanic acid although clavulanic acid has the ability to occupy the position of antibiotic binding sites for beta-lactamase or penicillinase leads to inactivating antibiotic (Weber et al, 1984). More than half of the isolates were resistant to kanamycin. In Vietnam, kanamycin is used quite commonly in pig production, especially in the treatment of genital infections. This most likely explains why the sensitivity of S.aureus isolated from pork to kanamycin was also decreased. Resistance to tetracycline of S. aureus isolates was mainly intermediate. This may be explained by the fact that the use of antibiotics such as tetracycline is no longer dominant. Thus, this reduced the pressure on bacteria by this antibiotic. The percentage of resistance among S. aureus isolates to erythromycin, clindamycin and cephalexin were 15.2%,

3 % and 12.1%, respectively. No isolate was resistant against ceftazidime, which is a third-generation cephalosporin with a broader spectrum activity than the first and second generation cephalosporin. This antibiotics usually not first choice and typically used in severe infections. However, the current market has many products containing ceftiofur (a thirdgeneration cephalosporin). We should be concerned about the development of resistance to this antibiotic in the near future. The antimicrobial resistance patterns of the S. aureus isolates are shown Table 2. All 66 isolates were resistant against at least two antimicrobials. Thus, they were all multiple resistant. In particular, the number of S.aureus isolates resistant to three or more antibiotics accounted for over two thirds of the total number of S.aureus isolates. One sixth of the isolates showed resistance to five to nine antibiotics. Those multi-drug resistant isolates would be a concern to public health in case they infect humans. Remarkably, 9.1% of the S.aureus isolates from pork showed resistance to nine antibiotics. Resistance to the older generations of antibiotics like ampicillin, penicillin, kanamycin were present in most of the resistance phenotype patterns. Phenotypic antibiotic resistance against seven or more antibiotics for a number of S.aureus included resistance against new regenerations of antibiotics such as norfloxacin, ciprofloxacin,and sulfamethoxazole/trimethroprim. Currently, new antibiotics like norfloxacin are effective in prevention and treatment of respiratory and urinary infections. The presence of fluoroquinol one resistance in these isolates is a concern. The antimicrobial resistance patterns of oxacillinresistant S. aureus isolates from pork is shown in Table % of S. aureus isolates were resistant to oxacillin. Most of the oxacillin-resistant S.aureus isolates were resistant to five to ten antibiotics. Phenotypic resistance against most beta-lactam antibiotics was observed, except ceftazidime. Fortunately, the isolates were still susceptible to ciprofloxacin and norfloxcin. Thus, this study showed that ceftazidime, ciprofloxacin and norfloxacin were highly effective against the oxacillinresistant S.aureus isolates. These antibiotics can be the drug of choice in the case of infection of oxacillinresistant S.aureus. The detected resistance genes are shown in Table 4. Results showed thatfor four ofsix resistances a target gene was detected in S.aureus.The blaz gene was detected with the highest rate (98.5%), followed by aacaaphd, lina, and tetm. Nomec Agene was detected in the oxacillin-resistant S.aureus isolates. Thus, although the S.aureus isolates expressed phenotypic resistance tooxacillinthey are notmrsa. A study from Korea (Heeet al,2008) also showed that the S.aureus resistant to methicillin and oxacillin, but the mecagene was not detected bypcr. Previous literature indicated that methicillin-resistant S.aureus isolates sometimes were not completely resistant and can be affected by many different factors such as temperature, ph, and salt concentration in the medium etc. The blaz gene was detected among a high percentage of S.aureus isolates from pork(98.5%). All oxacillin-resistant S.aureus isolates were found to carry the blaz resistance gene. A number of previous studiesshowed high percentages of the blaz gene: e.g., 68% in Egypt (Hanaa and Samah, 2011) and63.6% in Italy (Desjet al, 2008). A different percentage was found ina study among humans in Vietnam. A study of Kinh Van Nguyen et al performed in 2012 showed that nasopharyngeal carriage of S. aureus is present in one-third of the Vietnamese population. MRSA was detected in 7.9% of the samples. Pham Hung Van et al (local publication) reported that 47% of 235 S. aureus isolates from patients of seven hospitals in Da Nang City, Can Tho City and Ho Chi Minh City were resistant against methicillin. Therefore, MRSA may arise from the misuse of antibiotic in human medicine. Of the S.aureusisolatesfrompork21.6% that were resistant to gentamicin/streptomycin/kanamycin carry the aaca-aphd genes, which code for the bifunctional among lycosideacetyl transferase (AAC(6')) and among lycoside phospho transferase(aph(2")) (Strommenger et al, 2003). It has also been detected among S.aureus in many studies in high percentages, e.g.,97-100% of S. aureus from human (Strommenger et al, 2003; Nakaminamet al, 2008). One third of tetracycline-resistant S. aureus isolates contained the tetm gene. This gene encodes resistance to all tetracycline antibiotics, including minocycline (Trzcinskiet al, 2000).TetM codes for tetracycline resistance by modifying the binding sites of tetracycline on theribosome. Nearly half of the clindamycin-resistant S. aureus isolates carried the lina gene. The LinA gene codes for resistance to lincomycin and clindamycin by changing the location of the binding of antibiotics on ribosomes (Novotnaet al, 2005). Resistance to lincosamide may also be encoded by the msra gene. This gene encodes crossresistance between macrolides, lincosamides and streptogramins by an efflux pump mechanism. The dfra gene coding for trimethoprim resistance was not found among S.aureus isolates in this study. Correlation between phenotype and genotype of S. aureus isolatesis shown in Table 5. CONCLUSIONS This study showed that the percentage of pork contaminated with S.aureus in Ho Chi MinhCity was43.2%. All S.aureus isolated from pork were multiresistant. They were resistant to older and newer generation antibiotics such as ampicillin, penicillin,

4 65 amoxicillin/clavulanic acid, cephalexin, kanamycin, erythromycin, clindamycin, sulfamethoxazole/ trimethoprim. Ceftazidime, norfloxacin, ciprofloxacin, tetracycline and gentamicin are still effective treatment. For most of the S. aureus isolates one to three resistance genes could be detected from six genes tested..the blaz gene was detected in almost all isolates. ACKNOWLEDGEMENT This study is a part of projects of Dr. Vo ThiTra An supported by IFS (International Foundation for Science).We wish to thankdr. Ad Fluit, Eijkman-Winkler Institute, University Medical Center Utrecht, The Netherlandsfor kindly providing some control strains and revising the manuscript. REFERENCES Atanassova V., Meindl A. and Ring C., (2001). Prevalence of Staphylococcus aureus and staphylococcal enterotoxins in raw pork and uncooked smoked ham-a comparison of classical culturing detection and RFLP-PCR.Int J Food Microbiol, CLSI, 2012 (M100-S22).Perfomance standards for antimicrobial susceptibility testing, twenty- second information supplement. Wayne, Pennsylvania USA. Desj S., Lucia R., Piersandro C., Simona G., Franco D. and Sandra T., (2008). Antibiotic resistance genes and identification of staphylococci collected from the production chain of swine meat commodities. Food Microbiol 25: Hanaa A. E. and Samah F. D., (2011). Phenotypic and genotypic detection of both meca and blaz genes mediated beta-lactam resistance in Staphylococcus strains isolated from bovine mastitis. Global Veterinaria 6: Hee J. H., Bok K. K., Dong H. B., Cheong K. P. and Young J. L., (2008). Antimicrobial resistance of Staphylococcusaureus isolated from domestic and imported raw meat in Korea. KoreanJVet Res 48: Lin J., Sheng K., Liu H. T. and Lin J. H., (2009).Staphylococcus aureusisolated from pork and chicken carcasses in Taiwan: prevalence and antimicrobial susceptibility. J Food Prot 72: Lina G., Quaglia A., Reverdy M. E., Leclercq R., Vandenesch F. and Etienne J., (1999). Distribution of genes encoding resistance to macrolides lincosamides and streptogramins among staphylococci.antimicrob Agents Chemother 43: Martineau F., Picard F. J., Lansac N., Ménard C., Roy P. H., Ouellette M. and Bergeron M. G., (2000). Correlation between the resistance genotype determined by multiplex PCR assays and the antibiotic susceptibility patterns of Staphylococcus aureus and Staphylococcus epidermidis. Antimicrob AgentsChemother 44: Meshref A. A. and Omer M. K., (2011).Detection of (meca) gene in methicillin-resistant Staphylococcus aureus(mrsa) at Prince A/RhmanSidery Hospital, Al-Jouf, Saudi Arabia.J Med Genet Genomics 3: Catarina M., Ana P., Ludwig K., Hermínia L.andDuarte C. O., 2011.Evidence for a purifying selection acting on the ß- lactamase locus in epidemic clones of methicillin-resistant Staphylococcus aureus.bmc Microbiol11: 76. Nakaminam H., Norihisa N., Masami I., Mikiko H., Minoru S., Shinji Y., Tomoko Y., Takashi A., Mitsura S. and Masanori S., (2008). Molecular epidemiology and antimicrobial susceptibilities of 273 exfoliative toxin encoding gene positive Staphylococcus aureus isolates from patients with impetigo in Japan. J Med Microbiol 57: Novotna G., Adamkova V., Jiri J., Melter O. and Spizek J.,(2005). Prevalence of resistance mechanisms against macrolides and lincosamides in methicillin-resistant coagulase-negative staphylococci in the Czech Republic and occurrence of an undefined mechanism of resistance to lincosamides.antimicrob Agents Chemother 49: Queipo-Ortuno M. I., Colmenero D. D., Macias M., Bravo M. J. and Morata P., (2008). Preparation of bacterial DNA template by boiling and effect of immunoglobulin G as an inhibitor in real-time PCR for serum samples from patients with brucellosis. Clin Vaccine Immunol 15: Quinn P.J., Carter M.E., Markey B., Carter G.R. (2004). Clinical veterinary microbiology, MOSBY, Edinburgh, Harcourt PublishersLtd, pp Ho H. T.,Lipman L. J.and Gaastra W., (2008). The introduction of Arcobacter spp. in poultry slaughter houses. Int J Food Microbiol125: CLSI, (2012).(M100-S22). Performance standards for antimicrobial susceptibility testing, twenty- second information supplement. Wayne, Pennsylvania USA. Shittu A. O., OkonK., Adesida S., Oyedara O.,Witte W., Strommenger B., Layer F. and Nübel U.,(2011). Antibiotic resistance and molecular epidemiology of Staphylococcus aureus in Nigeria.BMCMicrobiol 11: Strommenger B., Kettlitz C., Werner G. and Witte W., (2003).Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus. J ClinMicrobiol41: TCVN : 2005 (ISO : 1999, Amd-1: 2003). National standard method for qualification coagulase positive Staphylococci (Staphylococcus aureusand other species) in agar plate (in Vietnamese). Trzcinski K., Cooper B. S., Hryniewicz W. and Dowson C. G. (2000).Expression of resistance to tetracyclines in strains of methicillin-resistant of S. aureus.j AntimicrobChemother 45: van Loo I.,Huijsdens X., Tiemersma E.,Neeling A., Bruinsma N. S.,Beaujean D., Voss A. and Kluytmans J., (2007). Emergence of methicillin-resistant Staphylococcus aureus of animal origin in humans.emerg Infect Dis 13: Van Nguyen K., Zhang T., Thi Vu B. N., Dao T. T., Tran T. K., Thi Nguyen D. N., Thi Tran H, K., Thi Nguyen C. K., Fox A.,Horby P.and Wertheim H., (2014). Staphylococcus aureus nasopharyngeal carriage in rural and urban northernvietnam.trans R Soc Trop Med Hyg. 108:783-90

5 66 Table 1.Primers used in PCR amplification Gene Primer Primer sequence (5-3 ) Product size (bp) References meca A22 F AAA ATC GAT GGT AAA GGT TGGC Meshref and 532 R AGT TCT GCA GTA CCG GAT TTG C Omer, 2011 blaz blaz F GAT AAG AGA TTT GCC TAT GC Milheiriço 533 R GCA TAT GTT ATT GCT TGA CC et al, 2011 tetm tetm F AGT GGA GCG ATT ACA GAA Strommenger 158 R CAT ATG TCC TGG CGT GTC TA et al, 2003 aaca-aphd aacaaphd R GCC ACA CTA TCA TAA CCA CTA et al, 2003 F TAA TCC AAG AGC AAT AAG GGC Strommenger 227 lina lina F GGTGGCTGGGGGGTAGATGT ATTAACTGG Lina 323 R GCTTCTTTTG AAATACATGG TATTTTTCGA TC et al, 1999 msra msra F TCC AAT CAT TGC ACA AAA TC Lina 163 R AAT TCC CTC TAT TTG GTG GT et at, 1999 dfra tmp F CTC ACG ATA AAC AAA GAG TCA Shittu 201 R CAA TCA TTG CTT CGT ATA ACG et at, 2011 Universal 27F AGA GTT TGA TCM TGG CTC AG Hoa 492 eubacteria 519R GWA TTA CCG CKG CTG et al, 2008 Table 2..Antimicrobial resistance patterns of S. aureus isolates from pork No. of antimicrobials Antimicrobial agents No. of isolates Percentage (%) No resistance AmPn AmPnKn 25 3 AmPnTe 1 AmPnCp AmPnCh 1 4 AmPnKnTe 1 AmPnGeKn AmPnAcGeKn 1 AmPnOxErCl AmPnOxCpTeEr AmPnOxCpErClBt 1 AmPnKnNrCiErCl AmPnCpGeKnNrCiErCl 2 9 AmPnAcOxCpKnErClBt AmPnGeKnNrCiErClBt 1 Total 66 Table 3. Antimicrobial resistance patterns of oxacillin-resistant S. aureus isolates from pork No. of antimicrobials Isolate Antimicrobial agents Percentage (%) 5 H.103 PnAmOxErcL 6 H.77 PnAmOxCpTeEr 7 H.87 PnAmOxCpErcLBt 9 H.93 PnAmAcOxCpGecLClBt H.102 PnAmAcOxCpGecLClBt 9 H.114 PnAmAcOxCpGecLClBt

6 67 Table 4. Percentage of the detection of resistance gene in the S. aureus isolates Gene Number of S. aureus Number of S. aureus isolates Percentage (%) isolates perform PCR detected resistance gene meca blaz aaca-aphd tetm lina msra Table 5. Correlation between phenotype and genotype of S. aureus isolates No. of antibiotics Phenotype Genotype No. of S. aureus isolates 2 PnAm blaz 23 3 PnAmKn blaz 22 aaca-aphd 1 blaz, aaca-aphd 2 PnAmTe blaz, tetm 1 PnAmCp blaz 1 PnAmCl blaz 1 PnAmKnTe blaz, aaca-aphd 1 4 blaz, aaca-aphd 1 PnAmKnGe blaz 2 PnAmAcKnGe blaz 1 5 PnAmOxErcL blaz, lina 1 6 PnAmOxCpTeEr blaz PnAmOxCpErcLBt blaz 1 PnAmKnNrCiErcL blaz, aaca-aphd, lina 1 PnAmCpKnGeCiNrErcL blaz 1 blaz, aaca-aphd, lina 1 blaz, lina 1 PnAmAcOxCpKnErcLBt blaz 1 blaz, aaca-aphd 1 PnAmKnGeCiNrErcLBt blaz 1 Total 66