Molecular Epidemiology and Antimicrobial Resistance Determinants of Multidrug-Resistant Acinetobacter baumannii in Five Proximal Hospitals in Taiwan

Transcription

1 Jpn. J. Infect. Dis., 64, , 2011 Short Communication Molecular Epidemiology and Antimicrobial Resistance Determinants of Multidrug-Resistant Acinetobacter baumannii in Five Proximal Hospitals in Taiwan Ming-Feng Lin 1,2, Kai-Chih Chang 3, Chung-Yu Lan 2, Juiling Chou 4, Jai-Wei Kuo 4, Chih-Kai Chang 5, and Ming-Li Liou 5 * 1 Department of Medicine, Chutung Hospital, Department of Health, Hsin-Chu County; 2 Institute of Molecular and Cellular Biology, National Tsing Hua University, Hsin-Chu City; 3 Department of Laboratory Medicine and Biotechnology, Tzu Chi University, Hualien; and 4 Department of Biotechnology and 5 Department of Medical Laboratory Science and Biotechnology, Yuanpei University, Hsin-Chu City, Taiwan, Republic of China (Received September 17, Accepted February 8, 2011) SUMMARY: We investigated the molecular epidemiology, antibiotic susceptibility, and antimicrobial resistance gene determinants of 23 multidrug-resistant (MDR) Acinetobacter baumannii samples that were collected from 5 proximal hospitals in Taiwan during April and May Major antibiotic resistance varied from 82.6 to 100z. Five pulsotypes were observed to spread clonally among the 5 hospitals. PCR screening revealed high distributions of inti1 (91z), bla OXA 23 (57z), bla ampc (100z), adeb (100z), adej (100z), and abem (100z) genes, which were prevalent in the MDR A. baumannii isolates. Resistance gene expression was examined by reverse transcription-pcr, and showed that increased ampc expression was associated with ceftazidime resistance, but expression of adeb, adej, or abem did not guarantee antimicrobial resistance phenotypes. In addition, imipenem resistance in some A. baumannii strains may be mainly modulated by genes other than bla OXA-51-like.Thisisthefirstdirect evidence indicating local spread of MDR A. baumannii in Taiwan. The resistance gene determinants are widely distributed in clonal and nonclonal-related isolates. *Corresponding author: Mailing address: Department of Medical Laboratory Science and Biotechnology, Yuanpei University, No. 306, Yuanpei Street, Hsin-Chu, Taiwan 30015, ROC. Tel: , Fax: , d918229@gmail.com These two authors contributed equally to this study. Acinetobacter baumannii has emerged as a leading nosocomial pathogen worldwide. Acinetobacter infections pose a challenge because nosocomial isolates exhibit a remarkable ability to develop antibiotic resistance rapidly, which leads to multidrug resistance within a few decades (1). To date, the spread of A. baumannii multidrug-resistant (MDR) determinants has been mostly through the acquisition of plasmids, transposons, or integrons that carry clusters of genes resistant to several antibiotic families (2). The most prevalent A. baumannii MDR determinants include genes for efflux pumps, class B b-lactamase (metallo-blactamase [MBL]), class C chromosomal b-lactamase AmpC, class D b-lactamase (OXA-type carbapenemase), integrons, and associated insertion sequence (IS) elements (1). Penicillin and cephalosporin resistance is usually due to class C chromosomal b-lactamase AmpC (3). Additionally, carbapenem resistance in A. baumannii is mediated by the acquisition of a class B or a class D b-lactamase (4). The increased expression of the 3 enzymes has also been linked to ISAba1 (5,6). Many recent reports have focused on the role of efflux pumps in MDR Gram-negative bacteria (7,8). Three A. baumannii efflux pumps AdeABC, AdeIJK, and AbeM reportedly confer resistance against a wide range of antibacterial agents, including b-lactams, aminoglycosides, tetracyclines, fluoroquinolones, chloramphenicol, and trimethoprim (9 11). The rapid spread of MDR A. baumannii in hospitals has been documented in several studies (12,13). Clonal spread of MDR Acinetobacter spp. has occurred in hospitals (12,14), whereas the inter-hospital spread of MDR A. baumannii clones among different wards and hospitals has been observed in several countries (15). One report from Taiwan (13) showed the inter-hospital dissemination of some extensively drug-resistant (XDR) A. baumannii clones. However, the inter-hospital spread of MDR A. baumannii was restricted to hospitals in northern, central, and southern Taiwan, consistent with the findings of our previous study (16). We hypothesized that the inter-hospital spread of MDR A. baumannii may be restricted to proximal hospitals in Taiwan. The aim of this study was to understand the molecular epidemiology of MDR A. baumannii in a local area and to determine the distribution of pulsotypes, antibiotic susceptibility, and MDR gene determinants in MDR A. baumannii among 5 proximal hospitals in the Hsin-Chu area of Taiwan. We analyzed nonduplicate MDR Acinetobacter spp. samples that were collected from 5 hospitals in the Hsin- Chu area of Taiwan between April and May The hospitals were Ton Yen General Hospital (hospital H1, 450 beds), Chutung Veterans Hospital (hospital H2,

2 beds), Catholic Mercy Hospital (hospital H3, 450 beds), Chutung Hospital (hospital H4, 316 beds), and Hsin- Chu General Hospital (Hospital H5, 699 beds). The clinical MDR Acinetobacter spp. strains were isolated and identified using the Vitek system (biomáerieux Vitek, Hazelwood, Mo., USA). Characterization of these isolates as A. baumannii or non-baumannii Acinetobacter was performed by one-tube multiplex PCR on the basis of the method of Chen et al. (14). The susceptibility of Acinetobacter isolates to antimicrobial agents was determined by performing the microdilution method in accordance with the Clinical and Laboratory Standards Institute guidlines (17). Pulsed-field gel electrophoresis (PFGE) was performed on all MDR Acinetobacter isolates genomic DNA as previously described (18). Chromosomal DNA plugs were incubated with ApaI endonuclease. Restriction fragments were separated by PFGE in 1z SeaKem Gold Agarose and electrophoresed in 0.5 Tris-borate- EDTA buffer in a CHEF-DRIII system (BioRad, Hercules, Calif., USA). The PFGE banding patterns were interpreted according to the previously described criteria (19). Gel photographs were further analyzed by Numerical Taxonomy and Multivariate Analysis System version 2.0 (Applied Biostatistics, Setauket, N.Y., USA). Isolates that exhibited PFGE band similarity À80z were classified as the same type. Colonies were picked and suspended in PCR Master Mix solution (BioKit, Moali, Taiwan). PCR amplification was performed using a GeneAmp 2720 thermal cycler (PE Applied Biosystems, Foster City, Calif., USA). The detected resistance genes included the integrase gene inti1; carbapenemases; MBL genes bla IMP and bla VIM ; OXA-type carbapenemase gene clusters bla OXA51-like, bla OXA23-like, bla OXA24-like, and bla OXA58-like ; the AmpC cephalosporinase gene bla ampc ; the associated ISAba1 elements; and the efflux genes adeb, adej, and abem. The genetic elements that contained the ISAba1/bla OXA and ISAba1/bla ampc genes were investigated using PCR mapping with ISAba1 as the forward primer and bla OXA and AmpC as the reverse primers. The primers in the PCR analyses are listed in Table 1, and PCR conditions are cited in the references (7,20 24). Total RNA was isolated from A. baumannii cells using the PureLink TM Micro-to-Midi Total RNA Purification System (Invitrogen, Carlsbad, Calif., USA) according to the manufacturer's instructions. Sample extractions were conducted in triplicate, and controls were included without reverse transcriptase, which confirmed the absence of sample DNA contaminants. RNA concentration and quality in each sam- Table 1. Primers used for amplification of resistance genes by PCR and RT-PCR in this study Primer pair Target Purpose Sequence (5? 3?) Amplicon size (bp) Reference OXA-51-like-F a OXA-51-like P, RT TAATGCTTTGATCGGCCTTG OXA-51-like-R a TGGATTGCACTTCATCTTGG OXA-23-like-F a OXA-23-like P, RT GATCGGATTGGAGAACCAGA OXA-23-like-R a ATTTCTGACCGCATTTCCAT OXA-24-like-F a OXA-24-like P, RT GGTTAGTTGGCCCCCTTAAA OXA-24-like-R a AGTTGAGCGAAAAGGGGATT OXA-58-like-F a OXA-58-like P, RT AAGTAT TGG GGC TTG TGC TG OXA-58-like-R a CCCCTCTGCGCTCTACATAC IMP-F IMP P CATGGTTTGGTGGTTCTTGT IMP-R ATAATTTGGCGGACTTTGGC VIM-F VIM P ATTGGTCTATTTGACCGCGTC VIM-R TGCTACTCAACGACTGAGCG ISAba1-F ISAba1 P AATGATTGGTGACAATGAAG ISAba1-R ATGCAGCGCTTCTTTGCCAGG Int1 F Int I intergrase P CAGTGGACATAAGCCTGTTC Int1 R CCCGAGGCATAGACTGTA AdeB-F AdeB P GTATGAATTGATGCTGC AdeB-R CACTCGTAGCCAATACC AdeJ-F AdeJ P TTCTTTGGTGGTACAACAGG AdeJ-R GCTGCAATCAGTTTCTCATG AbeM-F AbeM P TGCAACGCAGTTTCATTTTT 1, AbeM-R CGATGTTTCATCGGCTTTTT AmpC-F AmpC P TAAACACCACATATGTTCCG AmpC-R ACTTACTTCAACTCGCGACG 16s rrna-f 16s rrna P, RT GTAGCTTGCTACTGGACCTAG 580 This study 16s rrna-r CATACTCTAGCTCACCAGTATCG AmpC-F? AmpC RT TGCTATTTCAAAGGAACCTTCA AmpC-R? TTAATGCGCTCTTCATTTGG AdeB-F? AdeB RT TACGCTTATTCCAGCGATTG 99 7 AdeB-R? CCGAACATGGTGAGTACGTT AbeM-F? AbeM RT GCTATTCCGAAGCATTAGGC AbeM-R? CCAAAGCAGGTATTGGTCCT P, PCR; RT, RT-PCR. 223

3 ple was determined by measuring absorbance at 260 nm. All resulting RNA samples were adjusted to 10 ng/ml. The RT-PCR protocol used was the SuperScript First- Strand Synthesis System (Invitrogen). Target gene expression was normalized against the 16S rrna gene. The primers used to determine bla OXA23-like, bla OXA51-like, ampc, adeb, adej, andabem gene expression in RT- PCR are listed in Table 1. A total of 23 MDR Acinetobacter isolates 5,4,5,5, and 4 from hospitals H1, H2, H3, H4, and H5, respectively were collected between April and May 2009 in Taiwan. Among the 23 isolates, 13 were obtained from sputum, 5 from the central venous pressure tip, 3 from pus, and 2 from urine. According to formal chart records, none of the patients who submitted the specimens had moved between the 5 hospitals during this short period of time. The isolates were identified as A. baumannii on the basis of the presence of an internal 208-bp fragment from the intergenic spacer region previously described by Chen et al. (25). The isolates showed resistance against at least 3 classes of antibiotics. The resistance rates against the majority of the tested antibiotics varied from 82.6 to 100z. None of the isolates was susceptible to ceftazidime, ceftriaxone, ciprofloxacin, gentamicin, levofloxacin, or piperacillin/tazobactam. Moreover, less than 10z were susceptible to amikacin, tobramycin, or trimethoprim/sulfamethoxazole. As many as 3 (13.0z) and4isolates (17.4z) were susceptible to imipenem and ampicillin/ sulbactam, respectively. A total of 11 pulsotypes (A K) were identified among the 23 MDR A. baumannii isolates. Seven pulsotypes were defined that consisted of 2 or more isolates delineated with 82z similarity. The same pulsotypes were detected in the 5 hospitals from this study: pulsotypes C and D at hospitals H1 and H3; pulsotype H at hospitals H1, H3, and H5; pulsotype I at hospitals H4 and H5; and pulsotype J at hospitals H2, H3, and H5 (Fig. 1). Table 2 shows the distribution of resistance-associated genes for 23 clinical MDR A. baumannii isolates obtained from 5 proximal hospitals. Five resistance genes bla OXA-51-like, bla ampc, adeb, adej, andabem were present in all isolates. Furthermore, class 1 integrase genes were widely distributed in 91z (20,22) of the isolates. Four kinds of carbapenemase genes bla IMP, bla VIM, bla OXA-24-like,andbla OXA-58-like were not detected in the 23 MDR A. baumannii isolates. Twenty of the 23 MDR A. baumannii isolates, which contained ISAba1/bla OXA-51-like and ISAba1/bla OXA-23-like (n = 5), Fig. 1. Dendrogram illustrating the genetic relatedness of the multidrug-resistant Acinetobacter baumannii isolates. Results were obtained by pulsed-field gel electrophoresis for 23 isolates of MDR A. baumannii from 5 proximal hospitals (H1 H5) in the Hsin-Chu area of Taiwan and 2 reference strains (A. baumannii ATCC and 17978). 224

4 Table 2. Distribution of resistance-associated genes among 23 clinical isolates of multidrug-resistance Acinetobacter baumannii in 5 proximal hospitals Pulsotype (No. of isolates) Hospital int1 bla OXA-23-like bla OXA-51-like bla ampc ISAba1/ bla OXA-23-like No. of isolates positive by PCR ISAbal/ bla OXA-51-like ISAbal/ bla ampc adeb adej abem A (1) H B (2) H C (2) H1, H D (3) H1, H E (1) H F (1) H G (2) H H (5) H1, H3, H I (2) H4, H J (3) H2, H3, H K (1) H Total (23) 21 (91z) 13 (57z) 23 (100z) 23 (100z) 13 (57z) 14 (61z) 23 (100z) 23 (100z) 23 (100z) 23 (100z) Table 3. Susceptibility results of selected isolates and gene expression studies contributing to antimicrobial resistance Isolate Pulsotype MIC (mg/ml) 1) Relative expression 2) AMK TOB CAZ IMP SAM CIP SXT bla OXA-23-like bla OXA-51-like bla ampc adeb adej abem ) ) ) ) M4 D ) E1 3) G E4 3) G E3 E ) E5 I ) V3 J ) ) M1 J ) A143 J M2 H ) M5 H ) A142 H ) : AMK, amikacin; SAM, ampicillin/sulbactam; IMP, imipenem; TOB, tobramycin; SXT, trimethoprim/sulfamethoxazole; CAZ, ceftazidime;cip,ciprofloxacin. 2) : Relative expression compared to that in 16S rrna expression. 3) : Intergrase negaive. 4) : bla OXA-23-like gene negative. 5) :ISAba1/bla oxa-51-like gene negative. 6) :ISAba1/bla ampc gene negative. ISAba1/bla OXA-51-like alone (n = 7), or ISAba1/ bla OXA-23-like alone (n = 8), exhibited imipenem minimum inhibition concentrations (MICs) of greater than 16 mg/ml. However, the other 3 isolates (2 with and 1 without ISAba1/bla OXA-51-like ) exhibited imipenem MICs that were lower than 4 mg/ml. In this study, all bla ampc genes were preceded by ISAba1. Furthermore, all isolates were nonsusceptible to ceftazidime and ceftriaxone. Twelve isolates, including 11 MDR A. baumannii isolates and A. baumannii ATCC 19606, were selected to determine the association between the susceptibility results and the mrna levels of the resistant genes (Table 3). Among the 11 MDR A. baumannii isolates, 5 were not susceptible to the 7 antibiotics tested, while 6 were susceptible to at least 1 antibiotic. As shown in Table 3, increased bla ampc expression was associated with ceftazidime resistance. However, adeb, adej, and abem expression did not correlate with the number of antibiotics to which a particular strain showed resistance. For example, the expression of adeb was higher in A. baumannii ATCC than in 63z (7/11) of the clinical isolates, although the reference strain was found to be highly susceptibility to 6 out of the 7 antimicrobial agents. Six of the 8 imipenemresistant isolates showed higher expression levels (À0.02) of bla OXA-51-like genes, while the 4 imipenemsusceptible isolates (19606, M4, E3, and V3) expressed different levels of bla OXA-51-like genes. Two isolates (V3 and 19606), which lacked ISAba1 association with the bla OXA-51-like gene, did not show any bla OXA-51-like gene expression. However, the expression of bla OXA-51-like genes in 2 other isolates (M4 and E3) did not lead to imipenem resistance. Inter-hospital spread of MDR A. baumannii has been reported in several countries (15,26). In 2005, the Surveillance for Multicenter Antimicrobial Resistance in Taiwan (SMART) program observed inter-hospital dis- 225

5 semination of some XDR A. baumannii clones (13). However, clonal spread of XDR A. baumannii was restricted to hospitals in the northern, central, and southern regions of Taiwan. However, in another study conducted in 3 Taiwan medical centers, the predominant clone in all 3 regions belonged to an island-wide epidemic clone (27). In Taiwan, the local spread of MDR A. baumannii between proximal hospitals has never been demonstrated. Our results show that single or multiple clones had spread in the same or different hospitals within a local area, suggesting that the spread of isolates may play an important role in the increase of MDR A. baumannii. Thus,itis urgent to monitor and control the spread of MDR A. baumannii among proximal hospitals through real-time antimicrobial resistance surveillance and strict infection control strategies. Local dissemination of MDR A. baumannii was also supported by several studies in Taiwan. Clonal spread of bla OXA-72 genes in A. baumannii has only been observed in a hospital in southern Taiwan (28), whereas clonal-related bla OXA-23 -carrying MDR A. baumannii prevalence was observed in central and northern Taiwan (14,16). Forty-three percent of the isolates in a study conducted on MBL genes from imipenem-resistant A. baumannii in a university hospital in southern Taiwan possessed MBL genes (29). However, no MBL genes were detected in our study. Our result shows that the local spread of resistant gene-carrying Acinetobacter isolates among proximal hospitals may be common, although resistance genes are widely distributed in nonclonal related isolates. All the above study results imply that the rapid emergence and increase in A. baumannii imipenem resistance in different areas of Taiwan is due to a variety of mechanisms. Multiple factors have contributed to antimicrobial resistance in clinical A. baumannii isolates (7). Data from Yan et al. (24) and our lab reveal a high distribution of inti1, ISAba1, bla OXA-23, bla ampc, adeb, adej, andabem in genotypically related and unrelated MDR A. baumannii strains, which emphasizes the multitude of resistance genes that A. baumannii may possess along with the potential horizontal gene transfer between polyclonal MDR A. baumannii strains. The presence of class 1 integrons and ISAba1 elements are always linked to the epidemic potential of A. baumannii (30). This study shows that bla OXA-23-like carbapenemases, in addition to the bla OXA-51-like carbapenemases, are present in MDR A. baumannii in the Hsin-Chu area of Taiwan and confer resistance against imipenem. However, MBLs, including bla IMP and bla VIM, were not detected among the 23 MDR A. baumannii isolates, which differed from the results reported in previous Taiwanese studies (28,31). Expression of bla ampc was higher in ceftazidime-resistant isolates than in the reference strain in our study, which is consistent with the findings reported by H áeritier et al. (5). Previously, the increased expression level of bla OXA-51-like enzymes had been linked to ISAba1, and resulted in reduced susceptibility to carbapenems (32). However, 2 isolates (M4 and E3)thatexpressedbla OXA-51-like in our study showed imipenem MICs that were lower than 4 mg/ml, which suggests that imipenem resistance in some A. baumannii strains may be primarily modulated by genes other than bla OXA-51-like. The adeb gene products are responsible for aminoglycoside resistance and are involved in the degree of susceptibility to other drugs, including fluoroquinolones, tetracyclines, chloramphenicol, erythromycin, and trimethoprim (34). Our results suggest that adeb gene expression is not an important contributor to overt aminoglycoside resistance in 3 of our isolates (19606, E1, and E4). Instead, these 3 isolates, which lack class 1 integron, were susceptible to amikacin and tobramycin, indicating that aminoglycoside resistance in A. baumannii is chiefly mediated by integrons carrying the necessary cassette genes (26). One report conducted on the expression of adeb in tigecycline-nonsusceptible A. baumannii showed that adeb expression increased upon tigecycline exposure (33). In this study, we found that adeb, adej, orabem expression did not guarantee antibiotic resistance phenotypes. Therefore, we speculate that increased expression of efflux pump genes in A. baumannii may be associated with in vitro exposure to antibiotics. Another explanation is that efflux pump systems may play a partial role in the resistance mechanism of A. baumannii. In conclusion, the results of this study provide the first direct evidence for the clonal spread of MDR A. baumannii among proximal Taiwanese hospitals. The various resistance gene determinants are widely distributed in clonal and non-clonal isolates. The contribution and interplay of different mechanisms to the rapid increase in antibiotic resistance of A. baumannii in Taiwan warrants further investigation. Acknowledgments The authors thank the North Region Alliance Department of Health Hospital for financial support of this work. The authors thank Chutung Hospital, Chutung Veterans Hospital, Ton Yen General Hospital, Catholic Mercy Hospital, and Hsin-Chu General Hospital for providing clinical isolates of A. baumannii. Conflict of interest None to declare. REFERENCES 1. Perez, F., Hujer, A.-M., Hujer, K.-M., et al. (2007): Global challenge of multidrug-resistant Acinetobacter baumannii. Antimicrob. Agents Chemother., 51, Valenzuela, J.-K., Thomas, L., Partridge, S.-R., et al. (2007): Horizontal gene transfer in a polyclonal outbreak of carbapenemresistant Acinetobacter baumannii. J. Clin. Microbiol., 45, Bou, G. and Martinez-Beltran, J. (2000): Cloning, nucleotide sequencing, and analysis of the gene encoding an AmpC b-lactamase in Acinetobacter bauamnnii. Antimicrob. Agents Chemother., 44, Walther-Rasmussen, J. and Høiby, N. (2006): OXA-type carbapenemases. J. Antimicrob. Chemother., 57, H áeritier, C., Poirel, L. and Nordmann, P. (2006): Cephalosporinase over-expression resulting from insertion of ISAba1 in Acinetobacter baumannii. Clin. Microbiol. Infect., 12, Turton, J.-F., Ward, M.E., Woodford, N., et al. (2006): The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii. FEMS Microbiol. Lett., 258, Bratu, S., Landman, D., Martin, D.-A., et al. (2008): Correlation of antimicrobial resistance with beta-lactamases, the OmpA-like porin, and efflux pumps in clinical isolates of Acinetobacter baumannii endemic to New York City. Antimicrob. Agents Chemother., 52, Nemec, A., Maixnerov áa, M., van, der. Reijden. T.-J., et al. (2007): Relationship between the AdeABC efflux system gene content, netilmicin susceptibility and multidrug resistance in a genotypically diverse collection of Acinetobacter baumannii 226

6 strains. J. Antimicrob. Chemother., 60, Damier-Piolle, L., Magnet, S., Bráemont, S., et al. (2008): AdeIJK, a resistance-nodulation-cell division pump effluxing multiple antibiotics in Acinetobacter baumannii. Antimicrob. Agents Chemother., 52, Wieczorek, P., Sacha, P., Hauschild, T., et al. (2008): Multidrug resistant Acinetobacter baumannii the role of AdeABC (RND family) efflux pump in resistance to antibiotics. Folia Histochem. Cytobiol., 46, Su, X.-Z., Chen, J., Mizushima, T., et al. (2005): AbeM, an H + - coupled Acinetobacter baumannii multidrug efflux pump belonging to the MATE family of transporters. Antimicrob. Agents Chemother., 49, Qi, C., Malczynski, M., Parker, M., et al. (2008): Characterization of genetic diversity of carbapenem-resistant Acinetobacter baumannii clinical strains collected from 2004 to J. Clin. Microbiol., 46, Jean,S.-S.,Hsueh,P.-R.,Lee,W.-S.,etal.(2009):Nationwide surveillance of antimicrobial resistance among non-fermentative Gram-negative bacteria in intensive care units in Taiwan, SMART programme data Int. J. Antimicrob. Agents, 33, Chen, C.-M., Liu, P.-Y., Ke, S.-C., et al. (2009): Investigation of carbapenem-resistant Acinetobacter baumannii isolates in a district hospital in Taiwan. Diag. Microbiol. Infect. Dis., 63, Mendes, R.-E., Bell, J.-M., Turnidge, J.-D., et al. (2009): Emergence and widespread dissemination of OXA-23, -24/40 and -58 carbapenemases among Acinetobacter spp. in Asia-Pacific nations: report from the SENTRY Surveillance Programs. J. Antimicrob. Chemother., 63, Kuo, H.-Y., Yang, C.-M., Lin, M.-F., et al. (2010): Distribution of bla OXA -carrying imipenem-resistant Acinetobacter spp. in three hospitals in Taiwan. Diag. Microb. Infect. Dis., 66, Clinical and Laboratory Standards Institute (2009): Methods for Dilution Antimicrobial Susceptibility tests for Bacteria that Grow Areobically, Approved Standard; 8th ed. M07-A8. Clinical and Laboratory Standards Institute, Wayne, Pa. 18. Seifert, H., Dolzani, L., Bressan, R., et al. (2005): Standardization and interlaboratory reproducibility assessment of pulsedfield gel electrophoresis-generated fingerprints of Acinetobacter baumannii. J. Clin. Microbiol., 43, Tenover, F.-C., Arbeit, R.-D., Goering, R.-V., et al. (1995): Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol., 33, Woodford, N., Ellington, M.-J., Coelho, J.-M., et al. (2006): Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int. J. Antimicrob. Agents, 27, Sung, J.-Y., Kwon, K.-C., Park, J.-W., et al. (2008): Dissemination of IMP 1 and OXA type beta-lactamase in carbapenemresistant Acinetobacter baumannii. Korean J. Lab. Med., 28, Poirel, L., Figueiredo, S., Cattoir, V., et al. (2006): Acinetobacter radioresistens as a silent source of carbapenem resistance for Acinetobacter spp. Antimicrob. Agents Chemother., 52, Koeleman, J.-G., Stoof, J., Van, Der. Bijl. M.-W., et al. (2001): Identification of epidemic strains of Acinetobacter baumannii by integrase gene PCR. J. Clin. Microbiol., 39, Yan, Z.-Q., Shen, D.-X., Cao, J.-R., et al. (2010): Susceptibility patterns and molecular epidemiology of multidrug-resistant Acinetobacter baumannii strains from three military hospitals in China. Int. J. Antimicrob. Agents., 35, Chen, T.-L., Siu, L.-K., Wu, R.-C., et al. (2007): Comparison of one-tube multiplex PCR, automated ribotyping and intergenic spacer (ITS) sequencing for rapid identification of Acinetobacter baumannii. Clin. Microbiol. Infect., 13, Wang, H., Guo, P., Sun, H., et al. (2007): Molecular epidemiology of clinical isolates of carbapenem-resistant Acinetobacter spp. from Chinese hospitals. Antimicrob. Agents Chemother., 51, Huang, L.-Y., Chen, T.-L., Lu, P.-L., et al. (2008): Dissemination of multidrug-rsistant, class 1 intergron-carrying Acinetobacter baumannii isolates in Taiwan. Clin. Microbiol. Infect., 14, Lu, P.-L., Doumith, M., Livermore, D.-M., et al. (2009): Diversity of carbapenem resistance mechanisms in Acinetobacter baumannii from a Taiwan hospital: spread of plasmid-borne OXA-72 carbapenemase. J. Antimicrob. Chemother., 63, Lee, M.-F., Peng, C.-F., Hsu, H.-J., et al. (2008): Molecular characterisation of the metallo-b-lactamase genes in imipenemresistant Gram-negative bacteria from a university hospital in southern Taiwan. Int. J. Antimicrob. Agents, 32, Turton, J.-F., Kaufmann, M.-E., Glover, J., et al. (2005): Detection and typing of integrons in epidemic strains of Acinetobacter baumannii found in the United Kingdom. J. Clin. Microbiol., 43, Lee, Y.-T., Huang, L.-Y., Chiang, D.-H., et al. (2009): Differences in phenotypic and genotypic characteristics among imipenem-non-susceptible Acinetobacter isolates belonging to different genomic species in Taiwan. Int. J. Antimicrob. Agents, 34, Hu, W.-S., Yao, S.-M., Fung, C.-P., et al. (2007): An OXA- 66/OXA-51-like carbapenemase and possibly an efflux pump are associated with resistance to imipenem in Acinetobacter baumannii. Antimicrob. Agents Chemother., 51, Peleg, A.-Y., Adams, J. and Paterson, D.-L. (2007): Tigecycline efflux as a mechanism for nonsusceptibility in Acinetobacter baumannii. Antimicrob. Agents Chemother., 51, Magnet, S., Courvalin, P. and Lambert, T. (2001): Resistancenodulation-cell division-type efflux pump involved in aminoglycoside resistance in Acinetobacter baumannii strain BM4454. Antimicrob. Agents Chemother., 45,