Protective Live Oral Brucellosis Vaccines Stimulate Th1 and Th17 Cell Responses

Transcription

1 INFECTION AND IMMUNITY, Oct. 2011, p Vol. 79, No /11/$12.00 doi: /iai Copyright 2011, American Society for Microbiology. All Rights Reserved. Protective Live Oral Brucellosis Vaccines Stimulate Th1 and Th17 Cell Responses Beata Clapp, Jerod A. Skyberg, Xinghong Yang, Theresa Thornburg, Nancy Walters, and David W. Pascual* Department of Immunology and Infectious Diseases, Montana State University, Bozeman, Montana Received 16 March 2011/Returned for modification 12 April 2011/Accepted 7 July 2011 Zoonotic transmission of brucellosis often results from exposure to Brucella-infected livestock, feral animals, or wildlife or frequently via consumption of unpasteurized milk products or raw meat. Since natural infection of humans often occurs by the oral route, mucosal vaccination may offer a means to confer protection for both mucosal and systemic tissues. Significant efforts have focused on developing a live brucellosis vaccine, and deletion of the znua gene involved in zinc transport has been found to attenuate Brucella abortus. A similar mutation has been adapted for Brucella melitensis and tested to determine whether oral administration of znua B. melitensis can confer protection against nasal B. melitensis challenge. A single oral vaccination with znua B. melitensis rapidly cleared from mice within 2 weeks and effectively protected mice upon nasal challenge with wild-type B. melitensis 16M. In 83% of the vaccinated mice, no detectable brucellae were found in their spleens, unlike with phosphate-buffered saline (PBS)-dosed mice, and vaccination also enhanced the clearance of brucellae from the lungs. Moreover, vaccinated gamma interferon-deficient (IFN- / ) mice also showed protection in both spleens and lungs, albeit protection that was not as effective as in immunocompetent mice. Although IFN-, interleukin 17 (IL-17), and IL-22 were stimulated by these live vaccines, only RB51- mediated protection was codependent upon IL-17 in BALB/c mice. These data suggest that oral immunization with the live, attenuated znua B. melitensis vaccine provides an attractive strategy to protect against inhalational infection with virulent B. melitensis. Brucellae are Gram-negative intracellular bacterial pathogens of both humans and animals. Brucellosis, caused primarily by Brucella melitensis, Brucella abortus, Brucella ovis, and Brucella suis (12, 22), is still common in the Middle East, Asia, Africa, South and Central America, the Mediterranean Basin, and the Caribbean (45, 53). Although it is estimated that approximately 500,000 new cases occur annually, the number of cases reported is considered to be highly underestimated (50). Human disease usually results (i) from zoonotic exposure to Brucella-infected livestock, feral animals, or wildlife, (ii) frequently from ingestion of unpasteurized milk products or raw meat, (iii) from handling infected livestock (an occupational hazard), or (iv) from incidental exposure to live attenuated vaccines (8, 10, 21). Brucellosis is also one of the most easily acquired laboratory infections (41). While brucellosis in humans is rarely lethal, it can be severely debilitating and disabling. Acute brucellosis is associated with nonspecific flu-like symptoms, such as intermittent fever, headache, malaise, back pain, and myalgia (50). The pathological manifestations of chronic infection are diverse and include arthritis, spondylitis, endocarditis, meningitis, and chronic fatigue (61). Treatment of brucellosis involves various antibiotic regimens (3); however, despite available antibiotic treatment, relapses are still observed (7). Since airborne transmission of brucellosis has been reported (31, 35), there is growing concern about its use as a potential * Corresponding author. Mailing address: Department of Immunology and Infectious Diseases, Montana State University, P.O. Box , Bozeman, MT Phone: (406) Fax: (406) dpascual@montana.edu. Published ahead of print on 18 July agent in bioterrorism attacks, and coupled with the lack of currently licensed vaccines, there is a significant need for effective vaccines for human brucellosis. Although efforts have consistently shown that live, attenuated vaccines provide the best protection against brucellosis challenge (18), the current live animal vaccines for brucellosis, S19 and RB51 for cattle and Rev1 for small ruminants, remain less than ideal (51). These vaccine strains have some disadvantages, including residual virulence, pathogenicity in accidental hosts (including humans), limited efficacy (9, 42, 58), antibiotic resistance (39), and interference with statutory diagnostic and surveillance measures (4). While development of live attenuated Brucella vaccines continues to focus on deleting various genes required for survival, including znua (32), pure (1, 25), wbka (38), and asp24 (30), these vaccines show variable protection. Identifying such mutant strains is important, but consideration of alternate routes of vaccination may also be equally relevant. We have previously reported that the znua B. abortus mutant is attenuated, as evidenced by its reduced growth in macrophages and in mice relative to the growth of wild-type (wt) and vaccine strains (60). In addition, intraperitoneal (i.p.) immunization of mice with znua B. abortus decreases the number of CFU by log units after i.p. challenge with wt strain 2308 (60). Despite these data demonstrating attenuation and efficacy following parenteral immunization, the natural route of infection for humans and animals is often the oral route (14, 51). Thus, mucosal vaccination can represent a useful alternative for the induction of protection against this disease because it can induce an immune response at the site of primary infection. Taking into account our previous findings, we queried whether the znua B. abortus mutant could be successfully 4165

2 4166 CLAPP ET AL. INFECT. IMMUN. Primer Enzyme site restriction TABLE 1. Primers and enzyme restriction sites used for cloning Primer sequence a Size of DNA fragment (bp) 16Z-up-F SacI GAGCTCTTCAACGTGGCAATGTCCC 16Z-up-R XbaI TCTAGAAACAATCGAGTGAAGCGGC 1,185 16Z-dn-F XbaI TCTAGACAACTCATCCGCAATCTGGC 16Z-dn-R SalI GTCGACCAGCGTCCTCGTTTGCTTG 1,178 Z-ck-F2 ATTGCTCAAGAGAGATACCATG Z-ck-R2 CTCACCTTTACCGGCAAGAC 1,107 or 273 b a The integrated enzyme sites are in boldface. b The wild-type 16M znua fragment is 1,107 bp, while the znua B. melitensis mutant of 16M is 273 bp. adapted for B. melitensis and found that oral immunization with this vaccine protects mice against nasal B. melitensis challenge. MATERIALS AND METHODS Development of the znua B. melitensis mutant. Using the B. melitensis 16M genome sequence (GenBank accession number NC_003318), two pairs of primers were designed for amplification of the znua upstream and downstream sequences spanning the ATG and the stop codon, respectively. Restriction enzyme sites of SacI and XbaI were integrated to the 5 ends of upstream primers 16Z-up-F and 16Z-up-R, and XbaI and SalI were fused to the 5 ends of the downstream primers of 16Z-dn-F and 16Z-dn-R, respectively (Table 1). The 1,185-bp and 1,178-bp DNA fragments of the upstream and downstream znua DNA sequences were amplified by PCR. These fragments were cloned into the suicide plasmid pcvd442 and cut with SacI and SalI to form plasmid pud_znua. Because of the fusion at the XbaI site in pud_znua, an 834-bp DNA fragment of the znua inner sequence was deleted. Suicide plasmid pud_znua was transferred to wt 16M via Escherichia coli S17-1 pir, and the znua mutation selection was conducted as previously described (60). Selection of the znua B. melitensis mutant was confirmed by PCR using a pair of primers, Z-ck-F2 and Z-ck-R2 (Table 1). Through PCR verification, a znua mutant colony was identified with a DNA fragment of 273 bp, compared with a wt znua gene of 1,107 bp. Thus, an 834-bp in-frame DNA deletion was successfully accomplished for our mutant strain, znua B. melitensis 16M. Evaluation of znua B. melitensis replication in RAW264.7 macrophages. RAW264.7 cells (American Type Culture Collection, Manassas, VA) were used to assess znua B. melitensis mutant survival in macrophages compared to those of the wt B. melitensis 16M strain and RB51 vaccine strain. Infections were conducted as previously described (47). Briefly, cells/well in complete medium (CM; RPMI 1640, 10% fetal bovine serum [Atlanta Biologicals, GA], 10 mm HEPES buffer, 10 mm nonessential amino acids, 10 mm sodium pyruvate) without antibiotics were allowed to adhere to plastic in 24-well microtiter dishes (B-D Labware, Franklin, NJ) for 3hat37 C. Wells were washed, and the nonadherent cells were collected and counted to determine cell numbers that remained plastic adherent. After overnight culture, cells were infected with bacterium-to-macrophage ratios of 30:1 for1hat37 C. Wells were washed twice with CM without antibiotics and then incubated with 50 g/ml of gentamicin (Life Technologies) for 30 min at 37 C. After two washings, as described above, fresh CM without antibiotics (1.0 ml/well) was added, and cells were incubated for an additional 4, 24, or 48 h. Infected macrophages were water lysed, and supernatants were diluted for CFU enumeration. Animals. All experiments with live brucellae were performed in biosafety level 3 facilities. Female BALB/c mice (Frederick Cancer Research Facility, National Cancer Institute, Frederick, MD) and breeding pairs of gamma interferonnegative (IFN- / ) mice on a BALB/c background (59) were maintained at the Montana State University Animal Resource Center in individually ventilated cages under HEPA-filtered barrier conditions of 12 h of light and 12 h of darkness and provided with food and water ad libitum. Experiments were conducted with 7- to 9-week-old age-matched mice. All animal care and procedures were in accordance with institutional policies for animal health and well-being. Inoculation with Brucella strains. For oral inoculation, the wt B. melitensis 16M, znu B. melitensis mutant, RB51, and S19 strains were grown overnight in shaker flasks in Brucella broth (BB; BD Diagnostic Systems, Franklin Lakes, NJ) at 37 C. A total of 2 to 3 ml of these broth cultures was plated on multiple 15-cm-diameter petri dishes containing Brucella agar (BA). After 3 days of incubation at 37 C with 5% CO 2, plates were harvested with saline. Cells were pelleted, washed twice in sterile phosphate-buffered saline (spbs), and diluted to cells/200 l in spbs. The actual number of viable inoculum CFU was confirmed by serial dilution tests on potato infusion agar (PIA), and 0.2 ml of this suspension was administered to mice 15 min after oral administration of 0.2 ml of sterile 2.5% sodium bicarbonate via a 20-gauge stainless steel feeding tube attached to a 1-ml syringe. For nasal challenge, 30 l ofb. melitensis 16M suspension containing CFU of bacteria was administered with a micropipette dropwise into the anterior nares of mice. The challenge dose was confirmed by plating B. melitensis on PIA. In vivo colonization studies. The persistence of brucellae following oral inoculation with znua B. melitensis, RB51, and S19 was evaluated. At 1, 2, 3, and 4 weeks after inoculation, spleens, Peyer s patches (PPs), and mesenteric lymph nodes (MLNs) were collected and bacterial colonies were enumerated. Efficacy studies. To assess the protective efficacy of the znu mutant, BALB/c and IFN- / mice were orally immunized on day 0 with znua B. melitensis (n 12), RB51 (n 12), or PBS (n 12). Mice were subsequently challenged nasally with wt B. melitensis strain 16M at 8 weeks postvaccination. Four weeks after virulent challenge, the animals were euthanized, individual spleens and lungs were removed, and bacterial colonies were enumerated. Upon termination of study, individual tissues were removed. Organs were suspended in 1 ml of sterile Milli-Q water and mechanically homogenized in tissue grinders. A total of 20 l of undiluted homogenates and serial 10-fold dilutions of homogenates were grown in cultures on BA. After incubation for 3 to 5 days at 37 C in 5% CO 2 on PIA, Brucella colonies were enumerated, and numbers of CFU per spleen were calculated. In vivo IL-17 neutralization study. To assess the role of interleukin 17 (IL-17) during challenge, groups of BALB/c mice were orally immunized with znua B. melitensis (n 16), RB51 (n 16), or PBS (n 10), and similar vaccination groups of IFN- / mice were immunized with znua B. melitensis (n 18), RB51 (n 18), or PBS (n 17), as described above, rested for 4 weeks, and then subjected to IL-17 neutralization. Twenty-four hours prior to the day of challenge, half of the mice in each immunization group were treated with 250 g of anti-mouse IL-17 monoclonal antibody (MAb) (Bio X Cell, West Lebanon, NH) or mouse IgG (Rockland, Gilbertsville, PA) in 200 l of spbs. After nasal challenge with wt B. melitensis 16M, anti-il-17 MAb or isotype control antibody (Ab) treatment was continued every 7 days for the duration of the experiment. Four weeks after challenge, individual spleens were removed, and bacterial colonies were enumerated. Ab ELISA. To determine levels of Abs induced to heat-killed RB51, an enzyme-linked immunosorbent assay (ELISA) was used to measure immune serum IgG, IgG1, IgG2a, and IgG2b levels. Heat-killed RB51 was used to avoid evaluation of antilipopolysaccharide (anti-lps) Ab responses. To generate heatkilled RB51, RB51 was cultured in BB, and cells were subsequently heat killed by boiling them for 20 min; they were washed 5 times with spbs prior to being aliquoted and stored at 70 C until use. The absence of RB51 viability was determined subsequent to heat killing by observing the absence of bacterial growth on BA (BD Diagnostic Systems). Heat-killed RB51 ( CFU/ml) was used to coat MaxiSorp microtiter plates (Nunc, Roskilde, Denmark) at 50 l/well overnight at 4 C. Plates were washed four times with a wash buffer (Tris-buffered saline [ph 7.4] with 0.05% Tween 20), blocked with 2% milk in Tris-buffered saline for 2 h at 37 C, and then incubated with serial dilutions of the sera from mice for 3 h at room temperature and washed three times. Horseradish peroxidase-conjugated goat anti-mouse IgG, IgG1, IgG2a, or IgG2b Abs (Southern Biotechnology Associates, Birmingham, AL) were used for detection. After 90 min of incubation at 37 C and a washing step, the specific reactivity was determined by the addition of an enzyme substrate, ABTS {[2,2_azinobis(3-ethylbenzthiazolinesulfonic acid)] diammonium} (Moss, Inc.,

3 VOL. 79, 2011 ORAL VACCINE FOR BRUCELLOSIS 4167 Pasadena, CA) at 50 l/well. The absorbance was measured at 415 nm on a BioTek Instruments ELx808 plate reader (Winooski, VT). Endpoint titers were defined as the highest reciprocal of dilution of sample giving an optical density at 415 nm of U above that of negative controls after 1hofincubation at 25 C. Cytokine ELISA. Cytokine responses were measured 3 weeks after oral immunization with the znua B. melitensis vaccine or 4 weeks after B. melitensis 16M challenge. Splenic, head and neck lymph node (HNLN), and lower respiratory LN (LRLN) lymphocytes were pressed through a cell strainer (BD Falcon) into CM. Cells were pelleted at 1,700 rpm for 10 min; 10 ml ACK red blood cell lysis buffer (0.15 M NH 4 Cl, 10 mm KHCO 3, 0.1 mm Na 2 -EDTA) was added to the lymphocyte pellet for 5 min. In each experiment, splenic lymphocytes were pooled from 2 to 3 mice (8 to 9 mice/experiment), and all LN lymphocytes were pooled from a single experiment. Lymphocytes were pelleted and washed with PBS, enumerated, and then resuspended in CM to be cultured in 24-well tissue plates at cells/ml alone or restimulated with heat-killed RB51 ( CFU/ml) in triplicate for 3 days at 37 C. Supernatants were collected at day 3 and frozen at 80 C. Capture ELISAs were performed on supernatants for IFN-, IL-17, and IL-22 using MAb pairs, as previously described (54). Statistical analysis. To evaluate differences among Ab titers, cytokine responses, in vitro levels of infection, and in vivo splenic weights, as well as levels of colonization by RB51, znua B. melitensis, or wt 16M, an analysis of variance (ANOVA) followed by Tukey s method was used, and results were discerned to the 95% confidence interval. RESULTS znua B. melitensis growth is attenuated in RAW264.7 macrophages. The generation of the znua B. melitensis strain was similar to that previously described for znua B. abortus (60), and PCR was used to confirm successful deletion. To assess whether this mutant was attenuated, RAW264.7 macrophages were infected with znua B. melitensis at a 30:1 ratio of bacteria to macrophages, and their ability to replicate was compared to that of wt strain B. melitensis 16M and the RB51 vaccine at three time points, 4, 24, and 48 h (Fig. 1). At 0 h, there were no differences in the numbers of bacterial CFU among wt 16M, the znua mutant, and RB51. At 4 h, the number of RB51 CFU was significantly greater than those of the other two strains (P 0.05). By 24 h, the znua B. melitensis mutant s growth in macrophages was significantly arrested compared to that of wt 16M or RB51 (P 0.001), and growth remained arrested at 48 h (P 0.001). These results demonstrate that the znua B. melitensis mutant has a reduced ability to replicate in RAW264.7 macrophages compared to that of virulent B. melitensis or the RB51 vaccine strain. znua B. melitensis is attenuated in BALB/c mice. To access its virulence in vivo, a kinetic analysis was performed to ascertain the rate that the znua B. melitensis strain was eliminated from the host. BALB/c mice (n 12) were orally infected with CFU of the znua B. melitensis strain, the smooth S19 vaccine strain, or the rough RB51 vaccine strain, and the colonization of spleens, PPs, and MLNs was evaluated at 1, 2, 3, and 4 weeks postinfection. By 2 weeks postinfection, znua B. melitensis was undetectable in spleens and PPs (Fig. 2A and B). The mutant strain could not be recovered from MLNs, even 1 week postinfection (Fig. 2C). While not as rapidly cleared as znua B. melitensis, RB51 was effectively cleared from all of these tissues by week 3 postinfection (Fig. 2A to C). In contrast, mice infected with S19 showed progressively elevated levels of colonization of the spleen, PPs, and MLNs by week 2 (Fig. 2A to C). These results show that znua B. melitensis is FIG. 1. The znua B. melitensis mutant is attenuated in RAW264.7 macrophages. Wild-type (wt) B. melitensis 16M, RB51, and znua B. melitensis were used to infect RAW264.7 macrophages at a bacteriumto-macrophage ratio of 30:1. After 1hofincubation followed by a 30-min treatment with gentamicin, infected RAW264.7 cells were incubated in fresh medium for 0, 4, 24, or 48 h. Infected macrophages were water lysed, and cell lysates were diluted for CFU enumeration. The results show that znua B. melitensis is unable to replicate as effectively as the B. melitensis 16M or RB51 strain. Values are the means of results from quadruplicate wells standard errors of the means (SEM) of two independent experiments. Differences in levels of macrophage colonization between znua B. melitensis and wt B. melitensis ( *, P 0.001) or RB51 (, P 0.001;, P 0.05) are indicated. more rapidly cleared from the host than the S19 and RB51 strains. znua B. melitensis confers protection in BALB/c and IFN- / mice. To assess its protective efficacy, groups of BALB/c and IFN- / mice were orally immunized (n 12) with znua B. melitensis, RB51 (n 12), or PBS (n 12) on day 0. Mice were nasally challenged 8 weeks postimmunization with cells of wt B. melitensis strain 16M. Four weeks after challenge, mouse spleens and lungs were evaluated for their extent of colonization by wt B. melitensis strain 16M. Immunization of BALB/c mice with znua B. melitensis conferred significant (P 0.001) protection, by as much as 3 log units, against colonization by wt B. melitensis relative to that of PBS controls (Fig. 3A). This observed protection was significantly greater than that of RB51-immunized mice (P 0.05). Importantly, the znua B. melitensis vaccine conferred sterile immunity (no detectable CFU) in 10/12 orally immunized mice (a protective efficacy of 83%) compared to 0/12 PBS-dosed mice or 5/12 RB51-vaccinated mice (a protective efficacy of 42%) (Fig. 3A). In addition, both znua B. melitensis and RB51 conferred significant (P 0.05) protection in BALB/c lungs (Fig. 3B). Sterile immunity was observed in 7/12 mice orally immunized with znua B. melitensis, compared to 2/12 mice in a PBS control group (a protective efficacy of 42%) (Fig. 3B). Impressively, oral immunization of IFN- / mice with znua B. melitensis conferred protection in lungs (1.85 log units of protection; P 0.001) that was greater than in RB51-vaccinated mice

4 4168 CLAPP ET AL. INFECT. IMMUN. FIG. 2. znua B. melitensis is effectively cleared from the host by 2 weeks postinfection. BALB/c mice (3 mice/group/time point) were orally dosed with CFU of znua B. melitensis or the RB51 or S19 vaccine. At weeks 1, 2, 3, and 4, individual spleens (A), Peyer s patches (PPs) (B), and mesenteric lymph nodes (MLNs) (C) were evaluated for colonization. Values are the means of results from individual mice SEM, and differences in colonization from that with znua B. melitensis were determined. *, P 0.001; **, P (0.9 log units of protection; P 0.05) (Fig. 3D). Both znua B. melitensis and RB51 conferred protection against splenic colonization of wt B. melitensis in IFN- / mice (1.3 and 1.4 log units of protection, respectively; P 0.001) (Fig. 3C). Both znua B. melitensis- and RB51-vaccinated BALB/c (Fig. 3E) and IFN- / (Fig. 3F) mice showed significantly lower splenic weights (P 0.05) than PBS-immunized mice. No differences in lung weights could be determined (data not shown). FIG. 3. znua B. melitensis protects against wt B. melitensis challenge. BALB/c (A, B, E) and IFN- / (H-2 d ) (C, D, F) mice were orally immunized with CFU of znua B. melitensis (12 mice/group), RB51 (12 mice/group), or spbs (12 mice/group). After 8 weeks, mice were nasally challenged with CFU of wt B. melitensis 16M. Four weeks postchallenge, their spleens and lungs were assessed for CFU levels (A to D) and splenic weights (E, F). Data are means SEM of tissue CFU levels and splenic weights from two independent experiments. The limit of detection was 15 CFU/organ. *, P 0.001; **, P 0.05 (log numbers of CFU or splenic weights that were significantly different from those of PBS-immunized mice);, P (splenic weights that were significantly different from those of znua B. melitensis-vaccinated mice).

5 VOL. 79, 2011 ORAL VACCINE FOR BRUCELLOSIS 4169 znua B. melitensis induces proinflammatory cytokines. Th1-type cytokines, such as IFN-, are well recognized for being crucial in the cell-mediated response to Brucella spp.; however, the importance of other inflammatory mediators is unclear. Thus, we questioned whether other proinflammatory cytokines, particularly the Th17 cell-associated cytokines, IL-17 and IL-22, contribute to a vaccine-induced immune response. Splenic lymphocytes from RB51- and znua B. melitensis-immunized BALB/c and IFN- / mice were stimulated in vitro with heat-killed RB51. Following restimulation, lymphocytes from both RB51- and znua B. melitensis-vaccinated BALB/c mice showed enhanced production of IFN- (Fig. 4A) (P 0.001), as well as modest increases in IL-17 (P 0.001) (Fig. 4E) and IL-22 (P 0.001) (Fig. 4I) relative to levels of naive lymphocytes from PBS-dosed mice. When similar evaluations were performed with the same vaccination groups, but 8 weeks after wt challenge, all BALB/c mice showed elevated IFN- (Fig. 4C) and IL-22 (Fig. 4K) production, and both RB51- and znua B. melitensis-vaccinated mice showed enhanced IFN- and IL-22 production relative to their prechallenge levels (P 0.001) (Fig. 4A, C, I, and K). Moreover, RB51-vaccinated mice showed modestly more IFN- than znua B. melitensis-vaccinated mice (P 0.001) (Fig. 4C), but there were no differences in IL-22 levels for these vaccinated groups (Fig. 4K). In contrast, at postchallenge, znua B. melitensis-vaccinated BALB/c mice showed enhanced IL-17 production relative to prechallenge and RB51- vaccinated mice (P 0.001) (Fig. 4E and G). To ascertain whether IL-17 and IL-22 could possibly compensate for the absence of IFN-, similar studies were conducted using IFN- / mice. IL-17 was significantly enhanced at prechallenge in RB51- and znua B. melitensis-vaccinated IFN- / mice by 15- and 5.4-fold, respectively, relative to levels in similarly vaccinated BALB/c mice (Fig. 4E and F). At postchallenge, IL-17 levels were 3-fold greater in znua B. melitensis-vaccinated IFN- / mice than in RB51-vaccinated IFN- / mice (P 0.001) (Fig. 4H) and enhanced relative to prechallenge levels (Fig. 4F and H). On the other hand, at prechallenge, IL-22 stimulated by either RB51- or znua B. melitensis-vaccinated IFN- / lymphocytes showed significant increases relative to lymphocytes from PBS-dosed mice (P 0.001) (Fig. 4J); however, there were no significant differences in the levels of production of IL-22 between vaccinated BALB/c and IFN- / mice. At postchallenge, the znua B. melitensis-vaccinated IFN- / mice showed slightly more IL-22 than RB51-vaccinated mice, relative to prechallenge levels (Fig. 4J and L). Ag-stimulated lymphocytes from the respiratory LNs (combined HNLNs and LRLNs) from RB51- and znua B. melitensis-vaccinated mice failed to produce detectable levels of IFN-, IL-17, or IL-22 (data not shown), which is understandable, since mice were orally vaccinated and not expected to stimulate these distal sites. Thus, prechallenge cytokine levels are not shown. However, following challenge with B. melitensis 16M, lymphocytes from BALB/c respiratory LNs showed some induction of IL-17 (Fig. 5A), but IL-22 showed a more robust induction, especially by znua B. melitensis-vaccinated mice, and more so than levels induced by RB51-vaccinated mice (P 0.001) (Fig. 5C). As with the splenic IFN- responses, both RB51- and znua B. melitensis-vaccinated mice showed elevated IFN- production (Fig. 5E). In the absence of IFN-, although IL-17 was robustly induced, it did not appear modulated by Ag restimulation since in the absence of heat-killed RB51, IL-17 remained elevated (Fig. 5B). In a similar fashion, both unvaccinated and RB51-vaccinated IFN- / mice showed IL-22 production (Fig. 5D), but znua B. melitensisvaccinated IFN- / mice showed enhanced IL-22 production (P 0.001) upon Ag restimulation (Fig. 5D). Immunization with znua B. melitensis induces specific humoral immune responses to heat-killed RB51. To determine the type of Ab responses, BALB/c and IFN- / mice were orally immunized with znua B. melitensis or RB51, and 3 weeks later, serum samples were evaluated for Ag-specific endpoint titers. RB51- and znua B. melitensis-vaccinated BALB/c mice developed modest anti-rb51 IgG endpoint titers of 2 10 and 2 14, respectively (Fig. 6A). Similarly, RB51- vaccinated IFN- / mice showed equivalent IgG titers of 2 15, but the znua B. melitensis-vaccinated mice showed a lower IgG titer of 2 7 (Fig. 6B). Analysis of subclass titers in BALB/c and IFN- / mice revealed that IgG2a and IgG2b responses dominated with both vaccines (P 0.05) (Fig. 6A and B). IL-17 has a supportive role in protection conferred by oral immunization with RB51. To determine the contribution of IL-17 in resistance to wt B. melitensis, BALB/c and IFN- / mice were orally immunized with znua B. melitensis, RB51, or PBS. Half the mice were treated with mouse IgG or mouse anti-mouse IL-17 MAb 1 day prior to nasal challenge with wt B. melitensis 16M, as well as on the day of challenge and weekly thereafter until study termination 4 weeks later. At 4 weeks postchallenge, mouse spleens were evaluated for their extent of colonization by wt B. melitensis strain 16M. Neutralization of IL-17 in RB51-vaccinated BALB/c mice resulted in a significant loss in protection by 2 log 10 units (P 0.017) compared to that in RB51-immunized/IgG-treated mice (Table 2). In contrast, IL-17 neutralization had no significant impact upon znua B. melitensis-vaccinated mice or unvaccinated (PBSdosed/IgG-treated) mice (Table 2). However, IL-17 neutralization of RB51-vaccinated IFN- / mice had a minor effect (0.43 log 10 units of protection) (P 0.001), but it did reduce protection by 2.4 log 10 units (P 0.009) in znua B. melitensisvaccinated IFN- / mice (Table 2). In addition, PBS-dosed IFN- / mice treated with anti-il-17 MAb showed increased CFU burdens in their spleens relative to PBS-dosed/IgGtreated IFN- / mice (P 0.001) (Table 2). Oral immunization with znua B. melitensis or RB51 had minimal impact on splenic weights in this experiment (Table 2). These data show that IL-17 can contribute to adaptive immune responses against B. melitensis, but its role in protection against wt B. melitensis is varied and dependent upon the vaccine used. Interestingly, IL-17 was important for protection mediated by RB51 in BALB/c mice. DISCUSSION Brucellosis remains a global health problem (19, 45), and there are no vaccines available for humans. Infection usually occurs following mucosal exposure, yet brucellosis is predominantly a systemic disease (7, 36). As such, oral delivery of brucellosis vaccines is an appealing method of immunization since vaccination should stimulate the mucosal immune system

6 4170 CLAPP ET AL. INFECT. IMMUN. FIG. 4. The znua B. melitensis and RB51 vaccines stimulate enhanced IFN- production by BALB/c splenocytes and IL-17 and IL-22 production by BALB/c and IFN- / splenocytes before and after challenge with wt B. melitensis. BALB/c and IFN- / (H-2 d ) mice (18/group) were orally vaccinated with CFU of the znua B. melitensis vaccine, the RB51 vaccine, or spbs. Three weeks after immunization, half of the mice were evaluated for IFN- (A, B), IL-17 (E, F), and IL-22 (I, J) production. Pooled splenic lymphocytes from 2 to 3 mice/culture and at least three cultures/experiment were restimulated with media or CFU of heat-killed RB51 for 3 days. The remaining half of the mice were nasally challenged with CFU of wt B. melitensis 16M 8 weeks after immunization. Four weeks postchallenge, pooled splenic lymphocytes from 2 to 3 mice/culture and at least three cultures/experiment were restimulated with media or CFU of heat-killed RB51 for 3 days, and culture supernatants were evaluated for IFN- (C, D), IL-17 (G, H), and IL-22 (K, L) production. Cytokine production was measured by cytokine-specific ELISAs. Results are expressed as the means SEM of results from triplicate cultures from two independent experiments. Significant differences in IFN-, IL-17, or IL-22 production were determined. *, P 0.001; **, P 0.05 (versus PBS-immunized mice);, P 0.001;, P 0.05 (versus the prechallenge level for the same vaccinated group);, P 0.001;, P 0.05 (between RB51- and znua B. melitensis-vaccinated mice). ND, none detected. to eliminate brucellae before they become systemic and possibly should stimulate the systemic immune compartment to prevent dissemination into host tissues. Oral vaccines are relatively easy to administer, and their use avoids working with contaminated needles and syringes. Also, the simple logistics of oral vaccines are highly compatible with mass immunization campaigns, and in most societies, adults and children are more readily compliant with oral vaccines than with parenteral injections (34). A variety of live, attenuated vaccines have been tested in humans against different bacterial diseases, including tuberculosis (57), tularemia (37, 44), cholera (11), and typhoid fever

7 VOL. 79, 2011 ORAL VACCINE FOR BRUCELLOSIS 4171 FIG. 5. The znua B. melitensis and RB51 vaccines stimulate IFN-, IL-17, and IL-22 production by respiratory lymph nodes before and after challenge with wt B. melitensis 16M. BALB/c (A, C, E) and IFN- / (B, D) mice (18/group) were orally immunized with CFU of znua B. melitensis, RB51, or spbs, as described in the legend to Fig. 4. Head and neck lymph nodes (HNLNs) and lower respiratory tract LNs (LRLNs), collectively termed here respiratory LNs, were collected from the same vaccinated mice described in Fig. 4 s legend. Three weeks after vaccination, half of the mice were evaluated for IL-17, IL-22, and IFN- production, but none could be detected (data not shown). The remaining mice were nasally challenged with wt B. melitensis 16M, as described in the legend to Fig. 4. Respiratory LN lymphocytes isolated 4 weeks after challenge were restimulated with Ag or media, as described in the legend to Fig. 4, and evaluated for IL-17 (A, B), IL-22 (C, D), and IFN- (E) production, as measured by cytokine-specific ELISAs. Results are expressed as means SEM of results from triplicate cultures from two independent experiments. Significant differences in IL-17, IL-22, or IFN- production were determined. *, P 0.001; **, P 0.05 (versus PBS-immunized mice);, P (between RB51- and znua B. melitensis-vaccinated mice). (20, 29). Similarly, live attenuated vaccines are generally considered to be the type of vaccine of choice for intracellular bacteria, such as Brucella spp. (50). To investigate whether oral vaccination can confer protective immunity, the znua B. melitensis vaccine was constructed based on findings obtained from a related B. abortus mutant shown to be experimentally as effective as the cattle vaccine RB51 in mice when given parenterally (60). Our results here demonstrated that a single oral dose of znua B. melitensis vaccine significantly protects mice from dissemination of infection to the spleen following nasal challenge with wt B. melitensis 16M. Moreover, the majority of vaccinated animals showed no live brucellae in their tissues, resulting in a protective efficacy of 83%. Oral immunization has also been proven to be effective against nasal B. melitensis 16M challenge using the purek B. melitensis 16M mutant (WR201) strain (28). In addition to protecting against systemic disease, oral immunization with znua B. melitensis had a significant effect upon brucella replication in the lungs of BALB/c mice. These findings are similar to those by Izadjoo et al. (28), who used their purek B. melitensis 16M mutant; however, i.p. immunization with the same vaccine confers only modest protection in the lungs (25). Oral immunization with znua B. melitensis of immunocompromised IFN- / mice shows significant protection in the lungs and spleens, suggesting that in the absence of IFN-, additional cellular mechanisms are activated, possibly via Th17 cells. A variety of attenuated Brucella mutants which are able to persist in host tissues following infection have been identified (2, 17, 24), and a positive correlation was found between vaccine persistence and protection (30). Although Brucella vaccines can persist for an extended period of time, providing protection against wt Brucella challenge, a potential disadvantage of using live attenuated Brucella vaccines in humans is the possibility of incomplete clearance of the vaccine (50). Persistent infections with vaccine strains have occasionally been reported to occur in vaccinated animals. These strains can be shed into the milk or aborted fetuses and can infect humans (5). Our findings were particularly encouraging in that the

8 4172 CLAPP ET AL. INFECT. IMMUN. FIG. 6. Oral immunization with znua B. melitensis elicits modest serum IgG antibody responses. BALB/c (A) and IFN- / (B) mice (9/group) were orally immunized with the znua B. melitensis or RB51 vaccine, as described in the legend to Fig. 4, and 3 weeks after immunization, serum IgG and IgG subclass responses against heat-killed RB51 were measured by a standard ELISA. Results are expressed as means SEM of results from two independent experiments. **, P 0.05 (significant differences from IgG1 endpoint titers for the same vaccinated group). znua B. melitensis strain was effectively cleared from the host within 2 weeks and yet still able to sustain a long-term protective immunity, as evident from the challenge studies 2 months after immunization. Although it is well recognized that CD4 T cells and Th1- type cytokines, such as IFN- (48), are essential for the cellmediated immune responses to Brucella, a recent study has shown that patients with focal complications of brucellosis are more likely to have IFN- gene polymorphisms associated with lessened IFN- responses (23). Moreover, chronic brucellosis patients have been shown to have impaired IFN- responses, unlike in the acute phase of disease (52). Thus, there can be instances when IFN- responses are impaired in humans. Given these possibilities, other cell types of the same and different cytokine preferences may also contribute (16). The discovery of a new Th cell subset, Th17 cells (27), has been implicated in a wide range of autoimmune and autoinflammatory diseases (6, 26, 33, 40, 43), and it also has been shown to be important for protective immunity to a variety of extracellular and intracellular pathogens (13, 46). Currently, the role of Th17 cell cytokines in Brucella immunity is largely unknown. A possible mechanism for Th17 cell involvement in protection against Brucella is that pathogenspecific Th17 cells may enhance or work synergistically with Th1 cells for optimal protection. It has been shown that IL-17 induces the expression of the CXCR3 ligands in the lungs of vaccinated animals after challenge with the intracellular pathogen Mycobacterium tuberculosis, thus regulating the trafficking of Th1 cells to the site of infection (13). The same study shows that an accelerated Th1 memory cell response in the lungs of vaccinated mice challenged with M. tuberculosis is IL-23 and IL-17 dependent (13). Examining Th1 s role in vaccination, Pasquevich et al. (49) has recently shown that their soluble subunit vaccine could stimulate IL-17 responses, but neutralization of IL-17 only slightly reduces vaccine efficacy. In contrast, our results showed that oral immunization with the live TABLE 2. Role of IL-17 in protection from B. melitensis 16M infection in BALB/c and IFN- / (H-2 d ) mice orally vaccinated with znua B. melitensis and RB51 a Vaccine and treatment Log 10 no. of CFU of B. melitensis in spleens (mean SEM) Spleen wt (mg) (mean SEM) BALB/c mice IFN- / mice BALB/c mice IFN- / mice PBS IgG PBS anti-il * znua B. melitensis IgG * * znua B. melitensis anti-il-17 * *, RB51 IgG * RB51 anti-il a Mice were orally immunized with CFU of znua B. melitensis and RB51, allowed to rest for 4 weeks, and then treated with 250 g of anti-il-17 MAb or normal IgG 24 h prior to and at the time of nasal challenge with wt B. melitensis. Mice were given three additional antibody treatments on days 7, 14, and 21, and spleens were evaluated for differences in colonization levels and splenic weights. *, P 0.001, compared to PBS-immunized mice treated with IgG;, P 0.017,, P 0.001, compared to RB51-immunized mice treated with IgG;, P 0.009, compared to znua B. melitensis-immunized mice treated with IgG.

9 VOL. 79, 2011 ORAL VACCINE FOR BRUCELLOSIS 4173 vaccine znua B. melitensis stimulates a mixed Th1/Th17 cell response and that in vivo neutralization of IL-17 has a detrimental impact upon mice orally immunized with RB51 in resisting B. melitensis challenge. In addition, we queried the role of Th17 cells as possibly an additional mechanism supporting Th1 cell responses. As anticipated, in immunocompetent mice, IFN- was potently induced, particularly by lymphocytes after wt Brucella challenge. However, IL-17 production was markedly enhanced by RB51- and znua B. melitensis-vaccinated IFN- / mice and remained markedly enhanced by lymphocytes from znua B. melitensis-vaccinated IFN- / mice. The role of IL-17 may be more important when IFN- production is compromised, as suggested from the IL-17 levels produced by IFN- / mice subsequently challenged with Brucella, particularly in znua B. melitensis-vaccinated IFN- / mice. These increased levels of IL-17 accounted for the enhanced protection, since in vivo neutralization of IL-17 in IFN- / mice abrogated protection, although it did not affect the efficacy of RB51 vaccination in mice. However, in immunocompetent mice, IL-17 neutralization reduced protection elicited by RB51 immunization and did not influence the protection obtained by the znua B. melitensis vaccine. This suggests that the protection conferred by these two vaccines may occur via different mechanisms. The role of the Th17 cell cytokine IL-22 is even less well understood in the context of Brucella infections. It has been shown that IL-22 is produced by memory CD4 T cells and may be important for adaptive immunity against the intracellular pathogen Mycobacterium (55). Another study suggests that IL-22 diminishes the growth of M. tuberculosis in monocyte-derived human macrophages by enhancing cellular phagolysosomal fusion (15). Given IL-22 s role in Mycobacterium, we queried whether it would be specifically enhanced by our live vaccine. Both RB51- and znua B. melitensis-vaccinated BALB/c and IFN- / mice showed significantly enhanced IL-22 production prior to and after challenge. Interestingly, IL-22 was induced upon vaccination of BALB/c mice with either vaccine, and both vaccines potently induced IL-22 after a subsequent wt Brucella challenge. Evaluation of cytokine responses by BALB/c respiratory LNs showed similar trends in the vaccinated mice postchallenge, with znua B. melitensis-vaccinated mice showing the greatest elevations in IL-22 production. Although IL-22 was also induced upon Ag restimulation of these LNs from znua B. melitensis-vaccinated IFN- / mice, IL-17 levels remained unchanged in all of the vaccinated groups. Of the three experiments, lymphocytes from respiratory LNs from any of the (prechallenge) vaccinated groups were unable to produce detectable cytokine responses. This was not totally unexpected since the respiratory LN lymphocytes had not seen brucellae. Nonetheless, these data demonstrate that, indeed, Th17 cells are stimulated subsequent to oral vaccination and following challenge with B. melitensis 16M, and additional studies will be important to elucidate the role of IL-22 in brucellosis and brucellosis vaccination. The protective immunity observed could possibly be attributed to other cellular sources, including T cells, NKT cells, and CD8 T cells. Alternatively, the stimulation of Th17 cells may be influenced by routes of immunization or challenge. Studies evaluating other lung pathogens have found that Th17 cells exert a more prominent role for pulmonary protection against bacterial pathogens (reviewed in reference 56), which could account for the elevated IL-17 and IL-22 responses in addition to IFN- after nasal B. melitensis 16M challenge. These findings suggest that the induced IL-17 and IL-22 potentially support Th1 cell-dependent immunity. Additional studies are needed to further dissect the importance of the induced Th17 cells. In conclusion, our findings reveal that the oral live vaccine candidate znua B. melitensis induces protection against nasal challenge with wt B. melitensis 16M by inducing both systemic and mucosal Th1 and Th17 cells, with the latter producing IL-17 and IL-22. This is the first demonstration that oral vaccination with a live brucellosis vaccine is capable of stimulating potent Th17 cell responses, which contribute to the protection conferred by RB51. ACKNOWLEDGMENTS This work was supported by USDA-NIFA grant , USDA grant , NIH/National Center for Research Resources, Centers of Biomedical Excellence grant P20 RR , and, in part, the Montana Agricultural Station and USDA Formula. REFERENCES 1. Alcantara, R. B., R. D. A. Read, M. W. Valderas, T. D. Brown, and R. M. Roop Intact purine biosynthesis pathways are required for wild-type virulence of Brucella abortus 2308 in the BALB/c mice model. Infect. Immun. 72: Allen, C. A., L. G. Adams, and T. A. Ficht Transposon-derived Brucella abortus rough mutants are attenuated and exhibit reduced intracellular survival. Infect. Immun. 66: Al-Tawfiq, J. A Therapeutic options for human brucellosis. Expert Rev. Anti Infect. Ther. 6: Alton, G. G Control of Brucella melitensis infection in sheep and goats a review. Trop. Anim. Health Prod. 19: Alton, G. G., and W. Elberg Rev. 1 Brucella melitensis vaccine. A review of ten years of study. Vet. Bull. 37: Andoh, A., et al Interleukin-22, a member of the IL-10 subfamily, induces inflammatory responses in colonic subepithelial myofibroblasts. Gastroenterology 129: Ariza, J., et al Characteristics of and risk factors for relapse of brucellosis in humans. Clin. Infect. Dis. 20: Ashford, D. A., et al Adverse events in humans associated with accidental exposure to the livestock brucellosis vaccine RB51. Vaccine 22: Blasco, J. M., and R. Diza Brucella melitensis Rev-1 vaccine as a cause of human brucellosis. Lancet 342: Chomel, B. B., et al Changing trends in the epidemiology of human brucellosis in California from 1973 to 1992: a shift toward foodborne transmission. J. Infect. Dis. 170: Chowdhury, M. I., A. Sheikh, and F. Quadri Development of Peru-15 (CholeraGarde), a live-attenuated oral cholera vaccine: Vaccine 8: Corbel, M Brucellosis: an overview. Emerg. Infect. Dis. 3: Curtis, M. M., and S. S. Way Interleukin-17 in host defence against bacterial, mycobacterial and fungal pathogens. Immunology 2: Delpino, M. V., et al A bile salt hydrolase of Brucella abortus contributes to the establishment of a successful infection through the oral route in mice. Infect. Immun. 75: Dhiman, R., et al IL-22 produced by human NK cells inhibits growth of Mycobacterium tuberculosis by enhancing phagolysosomal fusion. J. Immunol. 183: Durward, M. A., J. Harms, D. M. Magnani, L. Eskra, and G. A. Splitter Discordant Brucella melitensis antigens yield cognate CD8 T cells in vivo. Infect. Immun. 78: Ficht, T. A Discovery of Brucella virulence mechanisms using mutational analysis. Vet. Microbiol. 90: Ficht, T. A., M. M. Kahl-McDonagh, A. M. Arenas-Gamboa, and A. C. Rice-Ficht Brucellosis: the case for live, attenuated vaccines. Vaccine 27(Suppl. 4): Franco, M. P., M. Mulder, R. H. Gilman, and H. L. Smits Human brucellosis. Lancet Infect. Dis. 7: Galen, J. E., et al Salmonella enterica serovar Typhi live vector vaccines finally come of age. Immunol. Cell Biol. 87:

10 4174 CLAPP ET AL. INFECT. IMMUN. 21. Godfroid, J., et al From the discovery of the Malta fever s agent to the discovery of a marine mammal reservoir, brucellosis has continuously been re-emerging zoonosis. Vet. Res. 36: Gorvel, J. P Brucella: a Mr Hide converted into Dr Jekyll. Microbes Infect. 10: Hedayatizadeh-Omran, A., A. Rafiei, M. Hajilooi, and M. Haghshenas Interferon- low producer genotype 5644 over presented in patients with focal brucellosis. Pak. J. Biol. Sci. 13: Hong, P. C., R. M. Tsolis, and T. A. Ficht Identification of genes required for chronic persistence of Brucella abortus in mice. Infect. Immun. 62: Hoover, D. L., et al Protection of mice against brucellosis by vaccination with Brucella melitensis WR201 (16M purek). Infect. Immun. 67: Ikeuchi, H., et al Expression of IL-22 in rheumatoid arthritis: potential role as a proinflammatory cytokine. Arthritis Rheum. 52: Infante-Duarte, C., H. F. Horton, M. C. Byrne, and T. Kamradt Microbial lipopeptides induce the production of IL-17 in Th cells. J. Immunol. 165: Izadjoo, M. J., A. K. Bhattacharjee, C. M. Paranavitana, T. L. Hadfield, and D. L. Hoover Oral vaccination with Brucella melitensis WR201 protects mice against intranasal challenge with virulent Brucella melitensis 16M. Infect. Immun. 72: Jain, S. K M-01ZH09, an oral live attenuated Salmonella enterica serovar Typhi vaccine for the prevention of typhoid fever. BMC Biol. 11: Kahl-McDonagh, M. M., and T. A. Ficht Evaluation of protection afforded by Brucella abortus and Brucella melitensis unmarked deletion mutants exhibiting different rates of clearance in BALB/c mice. Infect. Immun. 7: Kerem, E., O. Diav, P. Navon, and D. Branski Pleural fluid characteristics in pulmonary brucellosis. Thorax 49: Kim, S., K. Watanabe, T. Shirahata, and M. Watarai Zinc uptake system ( znua locus) of Brucella abortus is essential for intracellular survival and virulence in mice. J. Vet. Med. Sci. 66: Langrish, C. L., et al IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J. Exp. Med. 201: Levine, M. M Immunogenicity and efficacy of oral vaccines in developing countries: lessons from live cholera vaccine. BMC Biol. 8: Lubani, M. M., et al Pulmonary brucellosis. Q. J. Med. 71: Lulu, A. R., et al Human brucellosis in Kuwait: a prospective study of 400 cases. Q. J. Med. 66: Mann, B. J., and N. M. Ark Rationally designed tularemia vaccines. Expert Rev. Vaccines 8: Monreal, D., et al Characterization of Brucella abortus O-polysaccharide and core lipopolysaccharide mutants and demonstration that a complete core is required for rough vaccines to be efficient against Brucella abortus and Brucella ovis in the mouse model. Infect. Immun. 71: Moriyon, I., et al Rough vaccines in animal brucellosis: structural and genetic basis and present status. Vet. Res. 35: Nakae, S., A. Nambu, K. Sudo, and Y. Iwakura Suppression of immune induction of collagen-induced arthritis in IL-17-deficient mice. J. Immunol. 171: Noviello, S., et al Laboratory-acquired brucellosis. Emerg. Infect. Dis. 10: Olsen, S. C., B. Bricker, M. V. Palmer, A. E. Jensen, and N. F. Cheville Responses of cattle to two dosages of Brucella abortus strain RB51: serology, clearance and efficacy. Res. Vet. Sci. 66: Ooi, J. D., A. R. Kitching, and S. R. Holdsworth Review: T helper 17 cells: their role in glomerulonephritis. Nephrology 5: Oyston, P. C Francisella tularensis vaccines. Vaccine 27(Suppl. 4): Pappas, G., P. Papadimitriou, N. Akritidis, L. Christou, and E. V. Tsianos The new global map of human brucellosis. Lancet Infect. Dis. 6: Paranavitana, C., E. Zelazowska, L. DaSilva, P. R. Pittman, and M. Nikolich Th17 cytokines in recall responses against Francisella tularensis in humans. J. Interferon Cytokine Res. 7: Pascual, D. W., T. Trunkle, and J. Sura Fimbriated Salmonella enterica serovar Typhimurium abates the initial inflammatory responses by macrophages. Infect. Immun. 70: Pasquali, P., A. Rosanna, C. Pistoia, P. Petrucci, and F. Ciuchini Brucella abortus RB51 induces protection in mice orally infected with the virulent strain B. abortus Infect. Immun. 5: Pasquevich, K. A., et al An oral vaccine based on U-Omp 19 induces protection against B. abortus mucosal challenge by inducing an adaptive IL-17 immune response in mice. PLoS One 6:e Perkins, S. D., S. J. Smither, and H. S. Atkins Towards a Brucella vaccine for humans. FEMS Microbiol. Rev. 34: Pontes, D. S., et al Induction of partial protection in mice after oral administration of Lactococcus lactis producing Brucella abortus L7/L12 antigen. J. Drug Target. 11: Rafiei, A., et al Dominant Th1 cytokine production in early onset of human brucellosis followed by switching towards Th2 along prolongation of disease. J. Infect. 53: Roth, F., et al Human health benefits from livestock vaccination for brucellosis: case study. Bull. World Health Organ. 81: Rynda, A., M. Maddaloni, J. Ochoa-Repáraz, G. Callis, and D. W. Pascual IL-28 supplants requirement for T reg cells in protein 1-mediated protection against murine experimental autoimmune encephalomyelitis (EAE). PLoS One 5:e Scriba, T. J., et al Distinct, specific IL-17 and IL-22 producing CD4 T cell subset contribute to the human anti-mycobacterial immune response. J. Immunol. 3: Sonnenberg, G. F., and D. B. Weiner Manipulation of Th17 responses in pulmonary immunity and disease through vaccination. Hum. Vaccine 8: Walker, K. B., et al The second Geneva Consensus: recommendations for novel live TB vaccines. Vaccine 28: Wallach, J. C., M. C. Ferrero, M. V. Delpino, C. A. Fossati, and P. C. Baldi Occupational infection due to Brucella abortus S19 among workers involved in vaccine production in Argentina. Clin. Microbiol. Infect. 14: Wang, X., D. M. Hone, A. Haddad, M. T. Shata, and D. W. Pascual M cell DNA vaccination for CTL immunity to HIV. J. Immunol. 171: Yang, X., T. Becker, S. M. Jun, N. Walters, and D. W. Pascual Deletion of znua virulence factor attenuates Brucella abortus and confers protection against wild-type challenge. Infect. Immun. 74: Young, E. J Human brucellosis. Rev. Infect. Dis. 5: Editor: R. P. Morrison