In vivo difference in the virulence,

Transcription

1 CVI Accepts, published online ahead of print on 12 December 2012 Clin. Vaccine Immunol. doi: /cvi Copyright 2012, American Society for Microbiology. All Rights Reserved. [First Authors Last Name] Page In vivo difference in the virulence, pathogenicity, and induced protective immunity of wboa mutants from genetically different parent Brucella spp. Zhen Wang, Jianrui Niu, Shuangshan Wang, Yanli Lu* and Qingmin Wu* Key Laboratory of Animal Epidemiology and Zoonosis of Ministry of Agriculture, College of Veterinary Medicine, China Agricultural University, Beijing , China * Corresponding authors. Key Laboratory of Animal Epidemiology and Zoonosis of Ministry of Agriculture, College of Veterinary Medicine, China Agricultural University, Beijing Phone: , FAX: wuqm@cau.edu.cn; luyanli@cau.edu.cn

2 [First Authors Last Name] Page Abstract To explore the effects of genetic backgrounds on the characteristics of wboagenedeletion rough mutants generated from different parent Brucella spp. strains, we constructed the rough mutant strains Bmel16MMB6, Bab2308SB6, BabS19RB6, and BmelNINB6 and evaluated their survival, pathogenicity, and induced protective immunity in mice and sheep. In mice, the survival time of the four mutants was much different in the virulence assay, from less than six weeks for BabS19RB6 to eleven weeks for Bab2308SB6 and BmelNINB6. However, BabS19RB6 and Bmel16MMB6, with a shorter survival time in mice, offered better protection against challenges with B. abortus 2308 in protection tests than Bab2308SB6 and BmelNINB6. It seems that the induced protective immunity of each mutant might not be associated with its survival time in vivo. In the cross protection assay, both Bmel16MMB6 and BabS19RB6 induced greater protection against homologous challenges than heterologous challenges. When pregnant sheep were inoculated with BabS19RB6 and Bmel16MMB6, BabS19RB6 did not induce abortion, whereas Bmel16MMB6 did. These results demonstrated the differences in virulence, pathogenicity, and protective immunity in vivo in the wboa deletion mutants from genetically different parent Brucella spp., and also indicated that a future rough vaccine development could be promising if the suitable parent Brucella strains and/or genes were selected.

3 [First Authors Last Name] Page 3 43 Keywords: Brucella, rough mutants, virulence, pathogenicity, protection Introduction Brucella spp. are Gramnegative, facultative, intracellular bacteria that cause brucellosis (11), which results in abortion and decreased milk production in animals and often induces fatigue and disabling sequelae in humans (34). Successful control and eradication of brucellosis depends on animal vaccinations, serological examinations, and the slaughter of infected animals followed by destruction of the carcasses (37). Live Brucella vaccines (B. abortus S19 for cattle, B. melitensis Rev.1, and B. suis S2 for cattle, sheep, and goat) induce effective immune protection against brucellosis for four years or more (5,7,29), but respective vaccination of the three vaccines may cause abortion in pregnant animals (4, 9, 31). Meanwhile, all three vaccines carry a bacterial surface antigen with an immunodominant region (Opolysaccharide; OPS), which persistently induces antibodies that interfere with the diagnosis of brucellosis. Thus, a novel, safe vaccine without the immunodominant OPS antigens is urgently needed for the brucellosis eradication campaigns. Many scientists have endeavored to improve current vaccine strains or to design novel vaccines that are devoid of OPS (rough LPS) and with satisfactory immunogenic properties (37). One of the most wellknown rough vaccine strains is B. abortus RB51, a highly attenuated rough strain evaluated in mice, cattle, and bison, which does not interfere with diagnosis and retains the capacity of inducing protection (12,35,36).

4 [First Authors Last Name] Page Another attenuated rough strain, B. melitensis B115, also confers significant protective immunity in mice against the challenge of B. melitensis 16M, B. ovis, and B. abortus 2308, equivalent to what is provided by B. melitensis Rev.1 (1, 2). A different attenuated live rough vaccine, B. abortus 45/20, confers protection in cattle, but the vaccine easily reverts to smooth pathogenic forms in vivo (26, 36). However, it was reported that the protective immunity induced by rough Brucella mutants was inferior to that induced by the smooth vaccines in sheep and goats, and several researchers started to question the feasibility of developing rough Brucella vaccines (8, 15). Consequently, the suitability of rough mutants for live vaccine development remains a topic of debate. Previous studies on the virulence and induced protective immunity of the wboa genedeletion rough mutants was performed using Brucella spp. with various genetic backgrounds, and under different experimental conditions, which made it difficult to compare their results. In this study, we selected the wboa gene, a model gene, which encodes a glycosyltransferase responsible for OPS polymerization. We then evaluated the virulence, pathogenicity, and induced protective immunity of four rough mutants derived from different parent strains under the same experimental conditions. These results will be useful to evaluate the effects of genetic backgrounds on the characteristics of wboa genedeletion rough mutants generated from the different parent Brucella spp. 2. Materials and Methods 2.1 Bacterial strains and media

5 [First Authors Last Name] Page The virulent B. abortus 2308, B. melitensis 16M, and B. canis RM6/66 and the vaccine B. abortus S19 were all kindly donated by Dr. Qianni He (Institute of Veterinary Research, Xinjiang Academy of Animal Sciences, China). The strains mentioned above were originally collected and preserved in the Chinese Veterinary Culture Collection Center (CVCC). The epidemic strain B. melitensis NI was isolated from an aborted bovine fetus from Inner Mongolia by our laboratory. This strain, also referred to as the smooth virulent B. melitensis strain biovar 3, induced abortion in pregnant cattle, sheep and goats. The NI complete genomes were sequenced and GenBank accession numbers are CP and CP All Brucella strains, including the parent strains and the derived mutants, were routinely grown in tryptic soy broth (TSB) or tryptic soy agar (TSA) at 37 C. Escherichia coli stains were grown on LuriaBertani (LB) plates overnight at 37 C, with or without supplemental ampicillin (100 mg/liter) and Chloromycetin (30 mg/liter) (Table 1). All work with live Brucella virulent strains was performed in Biosafety Level 3 facilities at China Agricultural University. 2.2 Animals Four to sixweekold female BALB/c mice were purchased from Weitong Lihua Laboratory Animal Services Centre (Beijing, China), bred in individually ventilated cage rack systems, and subsequently transferred to the Biosafety Level 3 facilities of China Agricultural University at the onset of experiments. Pregnant female sheep at days of gestation were obtained from brucellosisfree regions and determined to be seronegative with the brucellosis RoseBengal plate agglutination test (RBT) (31) and a

6 [First Authors Last Name] Page 6 standard tube agglutination test (SAT). The animals were housed in restricted access, largeanimal isolation facilities. At the end of the experiments, all of the animals were euthanized by an animal culling device and disposed of according to relevant national regulations. All experiments involving animals followed the regulations enacted by the Beijing Administration Office of Laboratory Animals. 2.3 Construction of wboa deletion mutants and their complementary strains To construct the recombinant plasmid for deleting the wboa gene (the accession numbers of the wboa gene in the genomes of B. abortus 2308, B. melitensis 16M, B. melitensis NI and B. abortus S19 are BAB1_0999, BMEI0998, BMNI_I0963, and BabS19_I09300, respectively), the 5 and 3 fragments flanking the gene of interest were amplified with the primers shown in Table 2. According to the methods and procedures of Kahl McDonagh (20), the recombinant plasmid pex18apdwboa was created by a tworound PCR amplification, restricted digestion and ligation, and then introduced into B. abortus 2308 and S19 and B. melitensis 16M and NI by electroporation. Brucella colonies sensitive to ampicillin (Amp s ) were selected on a sucrosecontaining medium, (Suc r ). The wboadeletion mutants were then verified by PCR and sequencing analysis, and referred to as Bab2308SB6, BabS19 RB6, Bmel16M MB6 and BmelNI NB6. To construct complementation strains, primers were designed to amplify the whole wboa gene. The resulting PCR products were digested with BamHI and HindIII, and then ligated into a pbbr1mcs plasmid (21) digested with the same enzymes. The resultant recombinant vector, pbbrwboa, was then electroporated into Bab2308SB6,

7 [First Authors Last Name] Page BabS19RB6, Bmel16MMB6 and BmelNINB6. The complementation strains loaded with pbbrwboa were selected on TSA plates containing chloromycetin, Lastly, the selected complementation strains were verified by PCR and designated as CBab2308SB6, CBabS19RB6, CBmel16MMB6 and CBmelNINB Phenotypic characterization of the mutants The phenotypes of the mutants and their complementation strains were characterized by a coagglutination of the killed bacterial suspensions with the acriflavine solution, the antisera against smooth and rough Brucella, and by colony staining with the crystal violet solution(6). B. abortus 2308 (smooth) and B. canis RM6/66 (rough) were used for phenotype controls. 2.5 Virulence in BALB/c mice Twentyfive mice were intraperitoneally inoculated with a dose of 10 6 CFU in 0.1 ml PBS for each strain (including the rough mutants, the complementation strains and parent strains). Another twentyfive mice received 0.1 ml PBS per mouse, as a control. Five infected mice from each infected group or from the control group were randomly selected and euthanized via carbon dioxide asphyxiation at 1, 3, 6, 9 and 11 weeks postinoculation. At each time point, spleens were collected aseptically and homogenized in 1 ml of PBS, and then serially diluted (1/10, 1/100, 1/1000). A 200 μl aliquot of each dilution and undiluted spleen homogenates were plated onto TSA plates, incubated for 35 days at 37 C with 5% (v/v) CO2,, and checked daily for growth. The bacteria recovered from the spleens were enumerated to evaluate the survival of each strain in mice (10, 20). The

8 [First Authors Last Name] Page results are presented as the mean±sd of CFU/spleen in each group. If no bacteria grew in the undiluted homogenized sample, the spleen was assumed to contain less than 5 bacteria, below the limit of detection of 5 CFU/spleen. 2.6 Protection test in mice Experiments were performed according to the procedure in the Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (31). Five mice were intraperitoneally inoculated at a dose of 10 6 CFU/mouse for each rough mutant or vaccine strain B. abortus S19, respectively. Another five mice were intraperitoneally inoculated with 0.1 ml PBS as a control. Each mouse was challenged with CFU of wildtype strain B. abortus 2308 at fourteen weeks after vaccination. Two weeks later, the challenged mice were euthanized as described above. Spleens were collected and homogenized in 1 ml of PBS, serially diluted, and plated onto TSA. The challenged bacterial burden of the spleen was used to measure the protective immunity index. 2.7 Cross protection test in mice In this experiment, the mutants that conferred a high level of protection in the protection test were selected for a cross protection assay. Fifteen mice were intraperitoneally vaccinated at a dose of 10 6 CFU/mouse for BabS19RB6 or Bmel16MMB6, respectively. Another fifteen mice were intraperitoneally inoculated with 0.1 ml of PBS, as a control. At twelve weeks postinoculation, five vaccinated mice from each group were randomly challenged at a dose of CFU/mouse with B. abortus 2308, B. melitensis 16M or B. melitensis NI, respectively. Two weeks later, the

9 [First Authors Last Name] Page challenged mice were euthanized as described above. The spleens were collected and homogenized in 1 ml of PBS, serially diluted, and plated onto TSA. The challenged bacterial burden of the spleen was used to measure the protective immunity index. 2.8 Pathogenicity study in sheep To compare the pathogenicity of BabS19RB6 and Bmel16MMB6 with that of B. melitensis 16M, the three strains were subcutaneously inoculated into five pregnant female sheep ( days of gestation on average) at a dose of 10 9 CFU, which is considered the standard dose of B. melitensis Rev.1 vaccine for the immunization of sheep and goats (31). The inoculated sheep were observed daily until abortion or delivery, and the lambs were euthanized immediately after birth. Throughout the period of observation, the samples of afterbirths, including lung, liver, spleens and abomasal fluid, were aseptically collected from the aborted fetuses and lambs for bacteriological examination. Approximately 30 days after delivery, the sheep were euthanized and necropsied. Samples of the liver, spleen, mammary gland, supramammary lymph nodes, and parotid lymph nodes were collected for bacteriological examination. Afterwards, the samples were aseptically removed from storage bags, submerged in 70% ethanol, and placed on a sterile petri plate. A sample of approximately 0.5 g of tissue was aseptically extracted from each sample. Each section was then homogenized in a 50 ml sterile tube containing 1 ml of PBS, and 200 μl of the homogenates was plated onto TSA. The plates were incubated for 35 days at 37 C with 5% (v/v) CO 2 and checked daily for growth.

10 [First Authors Last Name] Page The animals were considered infected based upon the presence of 1 CFU of Brucella in any tissue (27). 2.9 Serological tests To evaluate the antibody response induced by BabS19RB6 and Bmel16MMB6, a sample of approximately 5 ml of blood was collected from the jugular vein of each vaccinated sheep at 7, 15, 30, 45, and 60 days postinoculation. The presence of OPSspecific antibodies in the sera was determined by the smooth Brucella antigen (from the China Institute of Veterinary Drug Control) according to the standard tube agglutination test (SAT) procedure (6, 14). To detect antibodies against rough LPS antigens, SAT was performed with the rough Brucella antigen (from the Chinese Centers for Disease Control Prevention) based on the same procedure. 2.9 Statistical analysis A Student s ttest was performed to analyze the data from the mice virulence and protection experiments, and a pvalue of <0.05 was considered significant. 3. Results 3.1 Construction of rough Brucella wboadeletion mutants Brucella wboa genedeletion mutants were constructed via a double recombination event and confirmed by PCR with the primers in Table 2 (Fig 1) and by sequencing analysis (data not shown). Genetic complementation strains corresponding to each mutant were constructed by electroporating pbbrwboa into Bab2308SB6, BabS19RB6, Bmel16MMB6 and BmelNINB6. The four mutants were determined to be rough

11 [First Authors Last Name] Page phenotypes based on the results of the coagglutination assay, crystal violet colony staining, and acriflavine agglutination assay, whereas the genetic complementation strains CBab2308SB6, CBabS19RB6, CBmel16MMB6 and CBmelNINB6 regained their smooth phenotype. This confirmed that the four wboadeletion mutants and their corresponding genetic complementation strains were successfully constructed. 3.2 The virulence difference in wboadeletion mutants derived from different genetic backgrounds We further determined the in vivo survival time and bacterial load in mice harboring the four wboadeletion mutants. The number of viable bacteria recovered was found to be much lower from the spleens of Bab2308SB6, BmelNINB6, Bmel16MMB6, and BabS19RB6 inoculated mice compared to that from mice infected with the respective parent strains. As shown in Fig. 1A, mutant BabS19RB6 was not detected from the inoculated mice at 6 weeks postinoculation, whereas the B. abortus S19 parent strain persisted for 11 weeks (Fig. 1B). BmelNINB6 and Bmel16MMB6 were completely cleared at 9 weeks postinoculation, whereas Bab2308SB6 had the longest survival time of all the mutants and persisted for 11 weeks in mice (Fig. 1A and 1B). At the end of the test, B. melitensis 16M, B. abortus 2308, and B. melitensis NI were recovered at 10 4 CFU, 10 5 CFU, and 10 4 CFU from the spleens of the inoculated mice, respectively. The virulence of the corresponding complementation strains was similar to that of the parent strains (data not shown). These results indicated that the four Brucella wboadeletion mutants were attenuated in mice, and that the

12 [First Authors Last Name] Page virulence was significantly different in the wboadeletion mutants derived from different genetic backgrounds. 3.3 The difference of protective efficacy in wboadeletion mutants with different genetic backgrounds To evaluate the potential protective immunity induced by the mutants against the virulent strain challenge, the numbers of recovered challenge strains from the spleens of all the vaccinated mice were compared to the numbers from the control mice. The challenge strain B. abortus 2308 was expected to be recovered in all of the control mice. Protective immunity was expressed as log 10 units of protection (38). As shown in Table 3, BabS19RB6 and Bmel16MMB6 (protection units: 1.53 and 1.42, respectively) conferred relatively higher protection than BmelNINB6 and Bab2308SB6 (protection units: 0.82 and 0.90, respectively) (p<0.05). Meanwhile, the challenge strain B. abortus 2308 was recovered in all of the challenge control mice, and there was a statistically significant difference (p<0.05) between the mutant groups and the challenge control groups in the protective immunity. 3.4 Cross protection of Bmel16MMB6 and BabS19RB6 mutants against challenge with different Brucella spp. To explore the crossprotective immunity induced by the rough mutants, Bmel16MMB6 and BabS19RBvaccinated mice were challenged with the virulent B. abortus 2308, B. melitensis 16M, and B. melitensis NI. The virulent strains were recovered from the spleens of the challenged mice, and the results are presented in Table

13 [First Authors Last Name] Page Bmel16MMB6 induced better protection against the homologous B. melitensis 16M and B. melitensis NI challenges than against the heterologous B. abortus 2308 challenge. The protection units against the homologous B. melitensis 16M and B. melitensis NI challenges were 2.17 and 2.06, respectively, which were significantly higher than that against the heterologous B. abortus 2308 challenge (protection unit, 1.08) (p<0.001). In contrast, BabS19RB6 induced greater protection against the homologous B. abortus 2308 challenge (protection units, 1.94) than against the heterogeneous B. melitensis 16M and B. melitensis NI challenges (protection units, 1.03 and 0.63, respectively) (p<0.05). 3.5 Pathogenicity of Bmel16MMB6 and BabS19RB6 mutants in pregnant sheep The pathogenicity of Brucella strains in pregnant ruminants includes persistent infection, stillbirth and abortion (3). In this study, two groups of pregnant sheep were inoculated with Bmel16MMB6 and BabS19RB6, respectively. During nearly three months of observation, only one sheep (S3) aborted at 28 days after infection in the Bmel16MMB6inoculated group, whereas all of the other four sheep in this group and all of the BabS19RB6 inoculated sheep gave normal lambs after 4060 days postinoculation. Abortion was defined as the premature expulsion of a nonviable fetus, whereas premature live lambs, who were hypoactive and difficult to suck colostrum, were regarded as weak lambs (41). To determine the survival in vivo of Bmel16MMB6 and BabS19RB6, bacteria from the maternal sheep, fetus, and lambs were recovered, and the animals with one or more isolated Brucella colonies in any tissue were considered bacteriologically positive.

14 [First Authors Last Name] Page Our results showed that only the afterbirth and fetus from the aborted sheep in the Bmel16MMB6inoculated group was positive, and no mutant was recovered from the lambs and afterbirths of the normal delivered sheep at the time of euthanasia (Table 5). These results indicated that BabS19RB6 was a safe strain for pregnant sheep, whereas the Bmel16MMB6 remained somewhat pathogenic in the pregnant sheep. 3.6 Antibody response in Bmel16MMB6 and BabS19RB6inoculated sheep The antibody responses in the Bmel16MMB6 and BabS19RB6inoculated sheep are presented in Fig. 3. In sheep inoculated with either Bmel16MMB6 or BabS19RB6, no antibodies against OPS were detected by the smooth antigenbased SAT at different time points postinoculation. However, antibodies against rough Brucella were detected in the sera of the BabS19RB6 and Bmel16MMB6inoculated sheep with 1:25 to 1:50 titers at 15 days postinoculation. The antibody titers peaked at 30 days postinoculation, with titers ranging from 1:50 to 1:100. At 60 days postinfection, the sera samples from all of the inoculated sheep agglutinated with the rough Brucella antigens at 1:25 to 1:50 dilution. 4. Discussion In the recent decades, numerous rough mutants have been generated by disrupting LPS synthesis genes, including wboa, wbob, wbka, gmd, per, wzm, pgm, wa**, and manb cor e. However, none of these artificially constructed rough mutants are equivalent to B. melitensis Rev.1 in the induced protective immunity in animal models (17). One rough vaccine candidate, B. melitensis BmH38RwbkF,,induced 54% protection, whereas B.

15 [First Authors Last Name] Page melitensis Rev.1 afforded 100% protection in sheep (8). The wboadisrupted rough derivative of B. melitensis 16M also induced only partial protection against both infection and abortion following challenges in goats (15). However, the rough vaccines RB51 and strain 45/20 have been reported to confer longterm protection against brucellosis in animals. Shumilov also reported that an inactivated adjuvant vaccine prepared from rough B. abortus KB 17/100 had superior immunogenic properties, allowing all vaccinated heifers to resist experimental infection by a virulent Brucella spp. (37). As mentioned above, there are disputes over the feasibility of inducing protective immunity by rough Brucella mutants in the Brucella vaccine research field. We hypothesized that the rough vaccines should be acceptably used in brucellosis eradication campaigns if these vaccines yield good protective immunity for over six months. According to a report by González, the genetic background (i.e., B. melitensis 16M and B. melitensis H38) affects the properties of rough mutants, as B. melitensis H38 rough mutants were more effective vaccine candidates than their B. melitensis 16M counterparts in mice (17). Thus, when the effective rough vaccine candidates were screened, the impact of genetic backgrounds of different parent strains on the rough Brucella mutants should be considered. Although the wboa mutants have been evaluated in the backgrounds of B. melitensis, B. abortus and B. suis, different experimental conditions were used. For example, the inoculation doses were 10 5 CFU/mouse by Nikolich (30) and CFU/mouse by McQuiston and Monreal (24, 25) whereas the challenge doses were CFU/mouse by Monreal (25) and CFU/mouse by

16 [First Authors Last Name] Page González (17). There were also variations in the vaccinated time before challenge, e.g., 8 weeks by Winter (40) and 4 weeks by Monreal (25). Therefore, these variations in experimental conditions pose difficulties in comparing the virulence and protective immunity conferred by these mutants, leaving questions about the novel rough vaccines unresolved. In this study, B. melitensis 16M, B. abortus 2308, B. abortus vaccine strain S19, and B. melitensis NI were used as the parent strains for generation of wboadeletion rough mutants. In the mouse survival assays, the survival times were compared among the four mutants Bmel16MMB6, Bab2308SB6, BabS19RB6 and BmelNINB6 (Fig. 2A &B). Tcellmediated immunity has been reported to be the primary mode of immune protection against Brucella (13, 18, 22), and thus, the rough mutants that persisted for the longest time in the vaccinated animals were expected to be the best vaccine candidates. However, Bab2308SB6, with the longest survival time of all the mutants, conferred the worst protection against B. abortus 2308 challenge in mice. In contrast, BabS19RB6 was cleared from mice in less than 6 weeks but yielded relatively good protection. These results suggest that the protective efficacy of rough wboa deletion mutants is less closely associated with their survival time in mice, but more closely associated with the genetic backgrounds of the parent strain. Moreover, Bmel16MMB6 and BabS19RB6 yielded better protection against challenge with B. abortus 2308 than Bab2308SB6 and BmelNINB6, suggesting that not all B. abortusderived rough mutants could induce similar protective immunity against

17 [First Authors Last Name] Page homologous challenge to B. abortus Therefore, it was required to screen the parent strains for the novel rough Brucella vaccine development in the future. In the crossprotection assay, Bmel16MMB6 and BabS19RB6 were selected to use in both homologous and heterologous challenges, because they yielded relatively better protection than the other two mutants in the protective efficacy assay. But both Bmel16MMB6 and BabS19RB6 only yielded relatively greater protection against homologous challenges than against heterologous challenges. A similar phenomenon was also observed by Winter in the evaluation of the protective efficacy of B. melitensis VTRM1 and B. suis VTRS1 (both wboadisrupted mutants) in mice (40). Moreover, B. abortus RB51 has been reported to induce a good protective immunity in cattle against B. abortus (32), but it is not effective against B. suis infection in cattle (33) and ovine brucellosis caused by either B. melitensis or B. ovis (16, 19). Similar to the smooth vaccines, such as B.abortus S19 (which failed to protect heifers against experimental infection with B. suis biovar 1(39)), the rough Brucella mutants had differences of crossprotective immunity. The results in pathogenicity examination indicated that not all of the Brucella spp. could be used as parent strains for generating safe vaccines. For instance, BabS19RB6, which was derived from the vaccine strain B. abortus S19, exhibited a high level of safety in pregnant sheep. However, the inoculation of pregnant sheep with Bmel16MMB6 induced abortion in one of the five animals in this study, suggesting that this rough mutant was still somewhat pathogenic to pregnant animals. Since the

18 [First Authors Last Name] Page glycosyltransferase encoded by wboa is responsible for OPS polymerization, we hypothesized that there are components other than OPS associated with the pathogenicity of Brucella in pregnant animals. In support of this hypothesis, available Brucella vaccines, such as B. abortus S19 and B. melitensis Rev.1, are attenuated in vivo but induce abortion when they are subcutaneously inoculated into pregnant animals, and a naturally occurring rough virulent strain, Brucella ovis, can induce abortion in ewes (23). As the transplacental transmitting mechanism of Brucella is not clearly understood, it is necessary to identify factors affecting the prevalence of abortion for the development of safer Brucella vaccines. Therefore, in specific regions and countries, the generation of a good rough vaccine may depend on the genetic backgrounds of the parent strains and/or the epidemic Brucella strains, as each vaccine provides effective protection against a specific Brucella species in the preferred host (2). In conclusion, there were noticeable differences in virulence, pathogenicity, and induced immunity protection among the four wboadeletion mutants generated from different parent strains with diverse genetic backgrounds. Although the wboa mutants were not ideal vaccine candidates in this study, our results suggested that it is necessary to consider the parent strains (the reference strains or the epidemic Brucella strains in the different animal herds) as well as the desired target genes when developing novel rough Brucella vaccines. Acknowledgments

19 [First Authors Last Name] Page We thank Dr. Qianni He from the Institute of Veterinary Research, Xinjiang Academy of Animal Sciences, China, for kindly providing us with Brucella strains. This work was supported by the National Basic Research Program of China (973 Program; 2010CB530202), the Special Fund for Agroscientific Research in the Public Interest ( ), and the Beijing Science Foundation of China (Project no )

20 [First Authors Last Name] Page References 1. Adone R, Francia M, Ciuchini F Evaluation of Brucella melitensis B115 as roughphenotype vaccine against B. melitensis and B. ovis infections. Vaccine. 26(38): Adone R, Francia M, Pistoia C, Pesciaroli M, Pasquali P B. melitensis rough strain B115 is protective against heterologous Brucella spp. Infections.Vaccine. 29(14): Carvalho Neta AV, Mol JP, Xavier MN, Paixão TA, Lage AP, Santos RL Pathogenesis of bovine brucellosis. Vet J. 184(2): Alton GG, Elberg SS Rev. 1 Brucella melitensis vaccine: a review of ten years of study. Vet Bull. 371: Alton GG Further studies on the duration of the immunity produced in goats by the Rev. 1 Brucella melitensis vaccine. Journal of Comparative Pathology. 78(2): Alton G G, Jones L M, Pietz D E Laboratory techniques in brucellosis.[j]. Monogr Ser World Health Organ. (55): Alton GG Brucella melitensis. In: Nielsen, K., Duncan, J.R. Editors, Animal Brucellosis. CRC Press, Boca Raton, pp Barrio MB, Grilló MJ, Muñoz PM, Jacques I, González D, de Miguel MJ, Marín CM, Barberán M, Letesson JJ, Gorvel JP, Moriyón I, Blasco JM, Zygmunt MS Rough mutants defective in core and Opolysaccharide synthesis and export induce antibodies reacting in an indirect ELISA with smooth lipopolysaccharide and are less effective than arev 1vaccine against Brucella melitensis infection of sheep.vaccine. 27(11) : Blasco JM A review of the use of Brucella melitensis Rev 1 vaccine in adult sheep and goats. Prev Vet Med. 31: Briones G, Iñón de Iannino N, Roset M, Vigliocco A, Paulo PS, Ugalde RA Brucella abortus cyclic beta1,2glucan mutants have reduced virulence in mice and are defective in intracellular replication in HeLa cells. Infect Immun. 69(7): p Corbel MJ Brucellosis: an overview. Emerg Infect Dis, (2): p Cheville NF Development, testing and commercialization of a new brucellosis vaccine for cattle. Ann N Y Acad Sci. 916: Collins FM Vaccines and cellmediated immunity. Bacteriol Rev. 38(4): Elfaki MG, AlHokail AA, Nakeeb SM, AlRabiah FA Evaluation of culture, tube agglutination, and PCR methods for the diagnosis of brucellosis in humans. Med Sci Monit. 11(11): p. MT Elzer PH, Enright FM, McQuiston JR, Boyle SM, Schurig GG Evaluation of a rough mutant of Brucella melitensis in pregnant goats. Res Vet Sci. 64(3): El Idrissi AH, Benkirane A, El Maadoudi M, Bouslikhane M, Berrada J, Zerouali A Comparison of the efficacy of Brucella abortus strain RB51 and Brucella

21 [First Authors Last Name] Page 21 melitensis Rev. 1 live vaccines against experimental infection with Brucella melitensis in pregnant ewes. Rev Sci Tech Off Int Epiz. 20: González D, Grilló MJ, De Miguel MJ, Ali T, ArceGorvel V, Delrue RM, CondeAlvarez R, Muñoz P, LópezGoñi I, Iriarte M, Marín CM, Weintraub A, Widmalm G, Zygmunt M, Letesson JJ, Gorvel JP, Blasco JM, Moriyón I Brucellosis vaccines: assessment of Brucella melitensis lipopolysaccharide rough mutants defective in core and Opolysaccharide synthesis and export. PLoS ONE. 3(7): p. e Jiang, X., and Baldwin C L Effects of cytokine on intracellular growth of Brucella abortus. Infect. Immun. 61: Jiménez de Bagüés MP, Barberán M, Marín CM, Blasco JM The Brucella abortus RB51 vaccine does not confer protection against Brucella ovis in rams. Vaccine. 13: KahlMcDonagh MM, Ficht TA Evaluation of protection afforded by Brucella abortus and Brucella melitensis unmarked deletion mutants exhibiting different rates of clearance in BALB/c mice. Infection and immunity. p Kovach ME, Phillips RW, Elzer PH, Roop RM 2nd, Peterson KM pbbr1mcs: a broadhostrange cloning vector.[j]. Biotechniques. 16(5): Ko J, Splitter G A Molecular HostPathogen interaction in brucellosis: current understanding and future approaches to vaccine development for mice and humans. Clinical Microbiology Reviews. p Libal MC, Kirkbride CA Brucella ovisinduced abortion in ewes. J Am Vet Med Assoc.183(5): McQuiston JR, Vemulapalli R, Inzana TJ, Schurig GG, Sriranganathan N, Fritzinger D, Hadfield TL, Warren RA, Lindler LE, Snellings N, Hoover D, Halling SM, Boyle SM Genetic characterization of a Tn5disrupted glycosyltransferase gene homolog in Brucella abortus and its effect on lipopolysaccharide composition and virulence. Infect Immun. 67(8): Monreal D, Grilló MJ, González D, Marín CM, De Miguel MJ, LópezGoñi I, Blasco JM, Cloeckaert A, Moriyón I Characterization of Brucella abortus Opolysaccharide and core lipopolysaccharide mutants and demonstration that a complete core is required for rough vaccines to be efficient against Brucella abortus and Brucella ovis in the mouse model.infect Immun.71(6): Moriyón I, Grilló MJ, Monreal D, González D, Marín C, LópezGoñi I, MainarJaime RC, Moreno E, Blasco JM Rough vaccines in animal brucellosis: structural and genetic basis and present status. Vet Res. 35(1): p KahlMcDonagh MM, Elzer PH, Hagius SD, Walker JV, Perry QL, Seabury CM, den Hartigh AB, Tsolis RM, Adams LG, Davis DS, Ficht TA Evaluation of novel Brucella melitensis unmarked deletion mutants for safety and efficacy in the goat model of brucellosis. Vacccine Murphy K C, Campellone K G, Poteete A R PCRmediated gene replacement in Escherichia coli.[j]. Gene. 246(12):

22 [First Authors Last Name] Page Nicoletti P Vaccination. In: Nielsen K, Duncan JR. (Eds.), Animal Brucellosis. CRC Press, Boca Raton, pp Nikolich MP, Warren RL, Lindler LE, Izadjoo MJ, Hoover DL Attenuation of defined Brucella melitensis wboa mutants.vaccine. 5:F Office international des epizoonties. Manual of diagnostic tests and vaccines for terrestrial animals, 5th ed, Office international des epizooties. 32. Olsen SC, Bricker B, Palmer MV, Jensen AE, Cheville NF Responses of cattle to two dosages of Brucella abortus strain RB51: serology, clearance and efficacy. Res Vet Sci. 66(2): p Olsen SC, Hennager SG Immune response and protection against experimental Brucella suis biovar 1 challenge in nonvaccinated or RB51vaccinated cattle. Clin Vaccine Immunol /CVI Rice TB Brucellosis in human beings. Mon Bull Indiana State Board Health. 49: p Schurig GG, Roop RM 2nd, Bagchi T, Boyle S, Buhrman D, Sriranganathan N Biological properties of RB51; a stable rough strain of Brucella abortus. Vet Microbiol. 28(2): p Schurig GG, N. Sriranganathan, and M.J. Corbel Brucellosis vaccines: past, present and future. Vet Microbiol. 90(14): p Shumilov KV, O. Sklyarov, and A. Klimanov Designing vaccines against cattle brucellosis. Vaccine. 28 Suppl 5: p. F Ugalde JE, Comerci DJ, Leguizamón MS, Ugalde RA Evaluation of Brucella abortus phosphoglucomutase (pgm) mutant as a new live roughphenotype vaccine. Infect Immun. 71(11): p USDA, APHIS, NVSL Standard operating procedures. SOPSero1022, 1024, 1025, 1026, 1027 and Dayton Avenue, Ames, IA : National Veterinary Services Laboratory. 40. Winter AJ, Schurig GG, Boyle SM, Sriranganathan N, Bevins JS, Enright FM, Elzer PH, Kopec JD Protection of BALB/c mice against homologous and heterologous species of Brucella by rough strain vaccines derived from Brucella melitensis and Brucella suis biovar 4. Am J Vet Res. 57(5): Xavier MN, Paixão TA, Poester FP, Lage AP, Santos RL Pathological, immunohistochemical and bacteriological study of tissues and milk of cows and fetuses experimentally infection. J.Comp.Path.140:

23 [First Authors Last Name] Page Figure legends Figure 1. PCR identification of Bab2308SB6 (A), BabS19RB6 (B), Bmel16MMB6 (C) and BmelNINB6 (D). (A) Lane 1: DNA marker, lane 2: PCR products of B. abortus 2308, lane 3: PCR products of pex18apdwboa, lane 4: PCR products of Bab2308SB6 (B) Lane 1: DNA marker, lane 2: PCR products of B. abortus S19, lane 3: PCR products of pex18apdwboa, lane 4: PCR products of BabS19RB6 (C) Lane 1: DNA marker, lane 2: PCR products of pex18apdwboa, lane 3: PCR products of Bmel16MMB6, lane 4: PCR products of B. melitensis 16M (D) Lane 1: DNA marker, lane 2: PCR products of B. melitensis NI, lane 3: PCR products of pex18apdwboa, lane 4: PCR products of BmelNINB6. Figure 2. Kinetics of (A) BabS19RB6, Bab2308SB6, BmelNINB6, Bmel16MMB6 and (B) the parent strains B. abortus S19 and 2308, B. melitensis NI and 16M in mice. Twentyfive mice were inoculated with each strain at a dose of 10 6 CFU/mouse. Five mice/group were euthanized at 1, 3, 6, 9 and 11 weeks postinoculation, and the virulence of each strain was determined based on the number of CFU recovered from the spleen, which was expressed as the mean ±SD (n=5) of individual log 10 CFU/spleen.

24 [First Authors Last Name] Page Figure 3. Antibody response in sheep subcutaneously infected with (A) 10 9 CFU BabS19RB6 and (B) Bmel16MMB6. Titers of specific antismooth and rough antigens were determined by SAT as described in the Materials and Methods section. Horizontal bars represent the average titer values for each group. *, p<0.05 and **, p<0.001: the roughantigenbased SAT results were compared with the smoothantigenbased SAT results for each mutant group. Downloaded from on October 22, 2018 by guest

25 Table 1. Bacterial strains and plasmids Strain or Plasmid Characteristic(s) Source or Reference Bacterial strains B. abortus 2308 Wildtype, smooth, virulent Qianni He lab B. melitensis 16M Wildtype, smooth, virulent Qianni He lab B. melitensis NI Epidemic strain, smooth, virulent This lab B. abortus S19 Vaccine strain, smooth Qianni He lab B. canis RM6/66 Wild type, rough, virulent Qianni He lab BabS19RB6 wboadeletion mutant of S19 This work Bab2308SB6 wboadeletion mutant of 2308 This work Bmel16MMB6 wboadeletion mutant of 16M This work BmelNINB6 wboadeletion mutant of NI This work DH10B F mcra Δ(mrrhsdRMSmcrBC) Invitrogen Φ80dlacZΔM15 ΔlacX74 enda1 reca1 deor Δ(ara,leu)7697 arad139 galu galk nupg rpsl(strr) nupg Plasmids pex18ap sacb, bla, Amp r (28) pbbr1mcs Broadhostrange plasmid, Cm r (21) pex18apwboa pwuo359pwuo360/pwuo361pwuo362 This study cloned into pex18ap for wboa gene deletion pbbrwboa pwuo359cpwuo362c cloned into pbbr1mcs for complementation assay This study

26 Table 2. Primers used in this study Primer Name Genetic Sequence Site (restriction enzyme used) Fragment pwuo359 5' GGAATTCATCGACGGCGGAACTGG 3' (EcoRI) wboa upstream pwuo360 5' AAGCTTCGCCTCGGTACTTAACTGG 3'(HindIII) pwuo361 5' CCGAGGCGAAGCTTGGGCAGCGGCATGAATA 3' (HindIII) pwuo362 5' CGGGATCCAGCCGACGAGCAAATAGAA 3'(BamHI ) pwuo359c 5' CGGGATCCTCCAACTTCATAACTCTAG 3' (BamHI ) pwuo362c 5' AAGCTTTCATGCCGCTGCCCTCACG 3' (HindIII) wboa upstream wboa downstream wboa downstream wboa operon wboa operon

27 Table 3. Protection against challenge with B. abortus 2308 Treatment Group (n=5) log 10 CFU in the Spleen (X±SD) UP a Bmel16MMB6 3.52±0.33 b 1.42 Bab2308SB6 4.12±0.11 b 0.82 BmelNINB6 4.04±0.05 b 0.90 BabS19RB6 3.41±0.36 b 1.53 S ±0.32 b 1.65 PBSControl 4.94±0.07 X±SD: the mean and SD of the log 10 of CFU per spleen UP a : Units of protection a Average of log 10 CFU in the spleens of PBSinoculated mice minus average of log 10 CFU in the spleens of vaccinated mice b p<0.05 (significant) compared with the value for the PBS control group Downloaded from on October 22, 2018 by guest

28 Table 4. Crossprotection of Bmel16MMB6 and BabS19RB6 against challenge with homologous and heterologous strains in mice Treatment Group (n=5) log 10 CFU in the Spleen (X±SD) UP a 16M challenge Bmel16MMB6 3.44±0.27 b,c 2.17 BabS19RB6 4.58±0.57 b,d 1.03 PBSControl 5.61±0.41 NI challenge Bmel16MMB6 3.14±0.57 b,c 2.06 BabS19RB6 4.57±0.60 b,d 0.63 PBSControl 5.20± challenge Bmel16MMB6 4.79±0.11 b 1.08 BabS19RB6 3.93±0.12 b 1.94 PBSControl 5.87±0.22 X±SD: the mean and SD of the log 10 of CFU per spleen UP a : Units of protection a Average of log 10 CFU in the spleens of PBSinoculated mice minus average of log 10 CFU in the spleens of vaccinated mice b p<0.05 (significant) compared with the value for the PBS control in each challenge group c p<0.001 (significant) compared to the 2308 challenge group in the Bmel16MMB6inoculated group d p<0.05 (significant) compared to the 2308 challenge group in the BabS19RB6inoculated group

29 Table 5. Pathogenicity of the rough mutants in pregnant sheep Pregnant Sheep Number Sheep Culture Results a Fetus or Lamb Status Delivery Time pi. Afterbirths Tissues Birth Status Tissues a Bmel16MMB6inoculated group S1 S3 S5 S7 S9 + BabS19RB6inoculated group S2 S4 S6 S8 S10 2 Healthy 1 Aborted 2 Healthy 1 Healthy 3 Healthy 2 Healthy 1 Healthy 1 Healthy 2 Healthy 2 Healthy + 49 days pi. 28 days pi. 45 days pi. 54 days pi. 52days pi. 43 days pi. 50 days pi. 55 days pi. 48 days pi. 45 days pi. a Isolation of 1 CFU Brucella from any tissue indicated that the animal was positive (+). Samples designated with negative () indicate that the organism was not cultured from the tissue.

30

31

32

33

34 from spleen Brucella recovered f (log10) A BabS19RB6 Bab2308SB6 BmelNINB6 4 Bmel16MMB6 weeks postinoculation

35 nbb Bruc cella reco overed fro om spleen (log10) weeks postinoculation S NI 16M

36 Antibo ody titer A ** ** * * Days post infection Smoothantigen Roughantigen

37 ibody titer Ant B ** ** * * Days post infection Smoothantigen Roughantigen