Methicillin-resistant coagulase-negative Staphylococcus spp. prevalence in Lithuanian dogs: a cross-sectional study

Transcription

1 . VETERINARSKI ARHIV 85 (2), , 2015 Methicillin-resistant coagulase-negative Staphylococcus spp. prevalence in Lithuanian dogs: a cross-sectional study Modestas Ruzauskas 1 *, Natacha Couto 2, Rita Siugzdiniene 3, Irena Klimiene 3, Marius Virgailis 3, Lina Vaskeviciute 3, Raimundas Mockeliunas 3, and Constança Pomba 2 1 Department of Anatomy and Physiology, Veterinary Academy, Lithuanian University of Health Sciences, Kaunas, Lithuania 2 Laboratory of Antimicrobial and Biocide Resistance, Faculty of Veterinary Medicine, University of Lisboa, Portugal 3 Microbiology and Virology Institute, Lithuanian University of Health Sciences, Kaunas, Lithuania RUZAUSKAS, M., N. COUTO, R. SIUGZDINIENE, I. KLIMIENE, M. VIRGAILIS, L. VASKEVICIUTE, R. MOCKELIUNAS, C. POMBA: Methicillinresistant coagulase-negative Staphylococcus spp. prevalence in Lithuanian dogs: a cross-sectional study. Vet. arhiv 85, , ABSTRACT The aim of this study was to investigate the presence and frequency of methicillin-resistant coagulase negative staphylococci in dogs in Lithuania and to characterize them regarding antimicrobial resistance. In clinical material was collected from 400 dogs. Three hundred samples from diseased dogs with different clinical conditions (dermatitis, otitis, wound infections, gastrointestinal and respiratory tract infections) as well as 100 samples from pure-breed bitches with reproductive disorders (pyometritis, metritis, partus praematurus), used as breeding animals in kennels, were selected. Twenty MRCNS isolates were obtained from 18 dogs out of 400 tested. All isolates harboured the meca gene while the mecc (meclga251) gene was not found. Ten isolates were detected in vaginal samples of the bitches within 3 large kennels. The prevalence of MRCNS in dogs kept in households was 3.3 % i.e. significantly lower (P<0.01) than in dogs kept in large kennels (10 %). Ten different MRCNS species were detected with the highest prevalence for Staphylococcus haemolyticus. MRCNS isolates were resistant to macrolides (75 %) due to erm(c) and msra genes, and to tetracycline (65 %) due to tet(k) and/or tet(m) genes. The rate of resistance to gentamicin was 50 % (attributed to aac(6 )-Ieaph(2 )-Ia, aph(3 )-IIIa), and to co-trimoxazole - 40 % (dfrg gene). One isolate of S. lentus harboured the dfrk gene. All isolates were susceptible to linezolid, daptomycin and vancomycin. This study revealed that breeding kennels might be a reservoir of MRCNS strains and may pose a risk for the spread of such strains during mating. The focus on the possible spread of multi-resistant S. haemolyticus between companion-animals and humans should be foreseen, as this species plays an important role in human infections as well. Key words: resistance, genes, pure-breed dogs, kennels, Staphylococcus haemolyticus *Corresponding author: Modestas Ruzauskas, DVM., PhD., Veterinary Academy, Lithuanian University of Health Sciences, Tilzes g. 18, Kaunas, Lithuania, Phone: ; veterinarija@kaunas.init.lt ISSN Printed in Croatia 175

2 Introduction Although coagulase-positive staphylococci (CPS) are regarded as the most important group in severe infections, coagulase-negative staphylococci (CNS) have emerged as important pathogens as well. Moreover, all species of staphylococci, regardless of their coagulase activity, could be resistant to different classes of antimicrobials used for human and animal treatment. About 80 to 90 % of CNS isolates associated with human hospital infections are methicillin-resistant coagulase-negative staphylococci (MRCNS) (DE MATTOS et al., 2003). Staphylococci resistant to methicillin and other antibiotics have been frequently reported in pets worldwide (COHN and MIDDLETON, 2010; MALIK et al., 2005; MATANOVIĆ et al., 2012). CNS are known as a part of the normal bacterial community of skin and mucosae of pets, but can develop resistance mechanisms to various antibiotics (BAGCIGIL et al., 2007). Nevertheless, their pathogenic potential and the capacity to transfer resistance genes to the CPS species are still under-investigated (MALIK et al., 2005; GANDOLFI-DECRISTOPHORIS et al., 2013). In pets, the pathogenic potential of CNS microorganisms remains to be clearly defined, although there are some reports of infections related to methicillin-resistant CNS in cats and dogs (VAN DUIJKEREN et al., 2004; LITSTER et al., 2007). Development of new molecular techniques allows accurate identification of CNS (CARBONELLE et al., 2007). This will eventually lead to a better understanding and knowledge of these bacterial species (GANDOLFI-DECRISTOPHORIS et al., 2013). It is assumed that methicillin-resistance genes evolved in coagulase-negative staphylococci (CNS) and then were horizontally transferred across staphylococci (BARBI ER et al., 2010). Particularly Staphylococcus sciuri and S. fleurettii are d iscussed as natural reservoirs of the methicillin-resistance gene meca (HUBER et al., 2011). The meca gene is located on a mobile genetic element called the staphylococcal cassette chromosome (SCC) and confers resistance to methicillin by encoding an altered penicillinbinding protein (PBP2α), which shows limited affinity to beta-lactam antibiotics. There are data about the horizontal gene transfer of SCCmec between CPS and CNS species (HANSSEN and ERICSON SOLLID, 2006). The meca gene is widely present among both coagulase-positive and negative staphylococcal species (CATRY et al., 2010; TULINSKI et al., 2012) although knowledge about meca gene distribution in CNS isolated from pets is still sparse. VAN DUIJKEREN et al. (2004) detected methicillin-resistant S. haemolyticus in cats with cystitis and rhinitis, in dogs with bronchitis and pyoderma, and in a mare with vaginitis. Other authors found other MRCNS species in pets. For example, NAKAMURA et al. (2012) isolated methicillin resistant S. lugdunensis from a dog with endocarditis, while KERN and PERRETEN (2013) isolated S. epidermidis, S. warneri, S. hominis, as well as some other MRCNS, from dogs and horses. 176 Vet. arhiv 85 (2), , 2015

3 The aim of this study was to investigate the presence and frequency of MRCNS in dogs with a variety of clinical conditions in Lithuania, and to characterize them regarding antimicrobial resistance. Materials and methods Location and samples. In clinical material was collected from 400 dogs in Lithuania. Three hundred samples from diseased dogs with different clinical conditions (dermatitis, otitis, wound infections, gastrointestinal and respiratory tract infections), as well as 100 samples from pure-breed bitches with reproductive disorders (pyometritis, metritis, partus praematurus), used as breeding animals in kennels, were selected for this study. Samples were collected using sterile Amies media swabs (Liofilchem, Italy) or other necessary instruments, under aseptic conditions. Samples were delivered to the laboratory the same day. Isolation and identifi cation of CNS. Clinical material was inoculated onto 5 % Sheep Blood Agar, Mannitol Salt Agar (Liofilchem, Italy), Mannitol Salt Agar supplemented with 4 mg/l cefoxitin (Sigma-Aldrich), Brilliance MRSA 2 Agar (Oxoid, Thermo Scientific) as well as onto Contrast MRSA Broth (Oxoid, Thermo Scientific). Staphylococci were identified up to the genus level according to morphology characteristics, catalase production, gram-staining, and susceptibility to furazolidone, as well as other generally accepted methods. Species identification was performed according to pigment and coagulase production, the presence of protein A and clumping factor, as well as biochemical properties using RapID Staph Plus (Thermo Scientific) identification system (QUINN et al., 2013). DNA extraction. DNA material for molecular testing was obtained after bacterial lysis, according to the extraction protocol prepared by the Community Reference Laboratory for Antimicrobial Resistance (ANONYMOUS, 2009) with slight modifications. Briefly, a loopful of colonies were taken from the surface of the Mueller Hinton Agar and transferred to phosphate buffered saline (ph 7.3). The content was centrifuged for 5 min. Then the supernatant was discarded and the pellet re-suspended in Tris-EDTA (TE) buffer. The suspension was heated using a thermomixer at 100 C degrees for 10 minutes. The boiled suspension was transferred directly onto ice and diluted to 1:10 in TE. Taxonomic verifi cation. The genus specific 16S rrna gene was investigated by PCR (Table 1). 16S rrna sequencing for species confirmation was performed using an ABI3730XL sequencer. The universal primers 27F and 515R were used as described previously (KIM et al., 2008). Sequences were analysed using Molecular Evolutionary Genetic Analysis software (MEGA, version 6). A basic local alignment search tool Vet. arhiv 85 (2), ,

4 (BLAST) was used for comparison of obtained sequences with sequences presented in the database of the National Centre of Biotechnology Information (NCBI, 2014). Table 1. Oligonucleotide primers used in this study Primer name Sequence (5-3 ) Size, bp and T(ºC) Target gene Source meca1 GGGATCATAGCGTCATTATTC meca2 AACGATTGTGACACGATAGCC 527 (61) meca Anonymous, 2009 mecc1 GCTCCTAATGCTAATGCA mecc2 TAAGCAATAATGACTACC 204 (50) meclga251 Cuny et al., 2011 blaz1 CAGTTCACATGCCAAAGAG Schnellmann et 772 (50) blaz blaz2 TACACTCTTGGCGGTTTC al., 2006 tetm1 GTTAAATAGTGTTCTTGGAG Aarestrup et al., 656 (45) tet(m) tetm2 CTAAGATATGGCTCTAACAA 2000 tetk1 TTAGGTGAAGGGTTAGGTCC Aarestrup et al., 718 (55) tet(k) tetk2 GCAAACTCATTCCAGAAGCA 2000 aac6-aph2f CAGAGCCTTGGGAAGATGAAG aac(6 )-Ieaph(2 )-Ia 2005 Perreten et al., 348 (61) aac6-aph2r CCTCGTGTAATTCATGTTCTGGC aph3-iif CCGCTGCGTAAAAGATAC Perreten et al., 609 (57) aph(3 )-IIIa aph3-iir GTCATACCACTTGTCCGC 2005 dftrg1 TTTCTTTGATTGCTGCGATG dfrg2 AACGCACCCGTTAACTCAAT 501 (51) dfrg Couto et al., 2014 dfrk1 GCTGCGATGGATAAGAACAG Kadlec et al., 214 (50) dfrk dfrk2 GGACGATTTCACAACCATTAAAGC 2010b erma1 AAGCGGTAAAACCCCTCTGAG erma2 TCAAAGCCTGTCGGAATTGG 442 (53) erm(a) Jensen et al., 2002 ermc1 ATCTTTGAAATCGGCTCAGG ermc2 CAAACCCGTATTCCACGATT 295 (48) erm(c) Jensen et al., 2002 msra1 GCTTAACATGGATGTGG Perreten et al., 1230 (55) msra msra2 GATTGTCCTGTTAATTCCC S1 GTGCCAGCAGCCGCGGTAA 16S2 AGACCCGGGAACGTATTCAC 886 (61) 16S staph Anonymous, 2009 Antimicrobial susceptibility testing. Antimicrobial susceptibility testing was performed using the broth microdilution method. Sensititre plates and the ARIS 2X automated system (Thermo Scientific) were used with the following antimicrobials: daptomycin, ciprofloxacin, clindamycin, erythromycin, gentamicin, levofloxacin, linezolid, oxacillin, penicillin, tetracycline, quinupristin/dalfopristin, vancomycin, co-trimoxazole and rifampin. Interpretation of results was carried out using the manufacturer s software 178 Vet. arhiv 85 (2), , 2015

5 (SWIN ) adapted to the clinical breakpoints of the European Committee on antimicrobial susceptibility testing (EUCAST). The quality control strain S. aureus ATCC was included in each assay for validation purposes. PCR assay for antimicrobial genes. Detection of genes encoding antimicrobial resistance (meca, mecc, blaz, tet(k), tet(m), erm(a), erm(c), msra, aac(6 )-Ie-aph(2 )- Ia, aph(3 )-IIIa, dfrg and dfrk) was performed by PCR. Annealing temperatures and oligonucleotides used are presented in Table 1. Statistical analysis. Statistical analysis was performed using the R package ( The comparison between categorical variables was calculated by chi-square and Fisher s exact test. Results were considered statistically significant if P<0.05. Results The rate of Staphylococcus spp. isolation from the clinical material from the dogs was 86.5 %. Twenty MRCNS isolates were obtained from 18 dogs out of the 400 tested, i.e. the prevalence rate of dogs carrying MRCNS isolates was 4.5 %. All isolates harboured the meca gene, while the mecc (meclga251) gene was not found. Ten isolates were detected in vaginal samples of bitches from 3 large kennels. The prevalence of MRCNS in dogs kept in households was 3.3 % i.e. significantly lower (P<0.01) than in dogs kept in large kennels (10 %). Biochemical testing correctly identified only 12 of the 20 CNS to the species level, compared to 16S RNA gene sequencing. Species distribution, antimicrobial susceptibility phenotypes and genes encoding resistance in MRCNS isolates are presented in Table 2. Ten different MRCNS species were detected, with the highest prevalence was of S. haemolyticus (35 %). Different resistance profiles were determined in the isolates of this species (Table 2). Six isolates of S. haemolyticus demonstrated resistance to at least three different classes of antimicrobials, and only a single isolate showed resistance to betalactams and macrolides alone. The resistance to non-beta-lactamic antimicrobials of isolated MRCNS depended on the class of antimicrobials. The highest resistance prevalence was demonstrated to macrolides (75 %) due to the ermc and msra genes, and to tetracycline (65 %) due to tet(k) and/or tet(m) genes. The rate of resistance to gentamicin was 50 % (attributed to aac(6 )-Ie-aph(2 )-Ia, aph(3 )-IIIa), and to co-trimoxazole - 40 % (dfrg gene). One isolate of S. lentus harboured the novel dfrk gene encoding resistance to trimethoprim. Half of the isolates were resistant to fluoroquinolones. All isolates were susceptible to linezolid, daptomycin and vancomycin. Two isolates were resistant to rifampin and two isolates were intermediately susceptible to quinupristin/dalfopristin. The minimum inhibitory concentration (MIC) distributions of antimicrobials tested are presented in Table 3. Vet. arhiv 85 (2), ,

6 Table 2. Resistance profiles and source of the Staphylococcus spp. canine isolates Species Phenotype 1 Genotype Source S. equorum OX meca nares S. capitis OX,CIP, LE, CLI, ERY, GEN, TE, SXT meca, dfrg, aac(6 )-Ie-aph(2 )-Ia vagina S. capitis OX meca, nares S. schleiferi OX, CLI, ERY, GEN, TE meca, aac(6 )-Ie-aph(2 )-Ia, tetm vagina S. lentus OX, CLI, ERY, TE, SXT meca, dfrg, ermc, tetk, tetm, vagina S. lentus OX, CIP, LE, CLI, ERY, meca, aac(6 )-Ie-aph(2 )-Ia, aph(3 )- GEN, TE, SXT IIIa, dfrk vagina S. epidermidis OX,CIP, LE, GEN, TE meca, blaz, aac(6 )-Ie-aph(2 )-Ia skin S. epidermidis OX, CLI, ERY meca, vagina S. sciuri OX, CLI, ERY, TE meca, blaz skin S. sciuri OX, CIP, LE, CLI, ERY, meca, erma, aac(6 )-Ie-aph(2 )-Ia, GEN, RIF, TE tetm vagina S. xylosus OX, CIP, LE, CLI, ERY, GEN, TE, SXT meca, dfrg, ermc, tetk vagina S. felis OX meca vagina S. chromogenes OX, GEN. TE, SXT meca, dfrg, blaz, ermc, msra, aac(6 )-Ie-aph(2 )-Ia, aph(3 )-IIIa vagina S. haemolyticus OX, CLI, ERY, TE meca, tetk, blaz nares S. haemolyticus CIP, LE, CLI, ERY, RIF, meca, dfrg, blaz, msra, tetk, tetm, TE, SXT aac(6 )-Ie-aph(2 )-Ia, aph(3 )-IIIa mouth S. haemolyticus OX, CIP, CLI, ERY, GEN, meca, dfrg, blaz, ermc, msra, TE, SXT aac(6 )-Ie-aph(2 )-Ia, aph(3 )-IIIa vagina S. haemolyticus OX, CLI, ERY meca, msra skin S. haemolyticus OX, CIP, LE, CLI, ERY, meca, dfrg, blaz, msra, aac(6 )-Ieaph(2 )-Ia, aph(3 )-IIIa GEN, SXT skin S. haemolyticus OX, CIP, LE, CLI, ERY, GEN, TE meca, blaz, tetm, aph(3 )-IIIa skin OX, CIP, LE, CLI, ERY, S. haemolyticus GEN meca, aac(6 )-Ie-aph(2 )-Ia skin 1 OX - oxacillin; CIP - ciprofloxacin; LE - levofloxacin; CLI - clindamycin; ERY - erythromycin; GEN - gentamicin; TE - tetracycline; SXT - co-trimoxazole; RIF - rifampin 180 Vet. arhiv 85 (2), , 2015

7 Table 3. Minimum inhibitory concentration distributions of the methicillin-resistant CNS isolates MIC values (mg/l), percentage of isolates, (n = 20) Antimicrobial CIP CLI DAP ERY GEN LEV LZD OXA PEN SYN RIF TET SXT VAN grey cells - susceptible; white cells - intermediate susceptible; dark cells - resistant the marginal numbers on the right side mean MIC value ; CIP - ciprofloxacin; CLI - clindamycin; DAP - daptomycin; ERY - erythromycin; GEN - gentamicin; LEV - levofloxacin; LZD - linezolid; OXA - oxacillin; PEN - penicillin; SYN - quinupristin/dalfopristin; RIF - rifampin; TET - tetracycline; SXT - co-trimoxazole; VAN - vancomycin Discussion Bacteria from the genus Staphylococcus are highly prevalent in clinical samples of small animals. Here we found a prevalence of 86.5 %, similar to data obtained by other authors (PENNA et al., 2010). We focused on CNS -species that are often resistant to beta-lactams (DETWILER et al., 2013). Moreover, CNS are often reported as methicillinresistant with co-resistance to different classes of antimicrobials other than beta-lactams (HUBER et al., 2011; VAN DUIJKEREN et al., 2004). The number of MRCNS isolates revealed that at least 4.5 % of the diseased dogs carried staphylococci resistant to all beta-lactams. Species diversity was high: 10 different species of MRCNS were detected, including species previously rarely isolated from dogs. Classical biochemical tests for species identification are not always capable of identifying staphylococci to the species level (VAN DUIJKEREN et al., 2011) and this was proven in this study as well. Certain substrates (carbohydrates and amino acids) are weakly fermented, thus interpretation of these according to the colour index is subjective. Additionally we tried different commercially available biochemical systems for identification of Staphylococcus (data Vet. arhiv 85 (2), ,

8 not presented). However, all of them were unable to identify all CNS species as reliably as PCR or sequence analysis of 16S rrna subunit. It is interesting that the most prevalent CNMRS species in dogs was S. haemolyticus, the species that is identified as the second most prevalent species of CNS in human-blood cultures (TAKEUCHI et al., 2005) and the one that shows the highest level of antimicrobial resistance (BARROS et al., 2012). Thus, the findings of this study are important for a better understanding of antimicrobial resistance spread between companion-animals and their owners. In our study CNS were isolated from dogs with different clinical manifestations (3.3 %), although the highest number of MRCNS carriers was detected in kennels holding pure-breed dogs (10 %). Data on antimicrobial susceptibility revealed that MRCNS most frequently demonstrated resistance against antimicrobials that are used for treatment of dogs, including penicillins (resistance attributed to blaz gene), macrolides (erma and ermc genes) and tetracyclines (tetk and tetm genes). A high rate of resistance to fluoroquinolones (50 %) was also recorded. The MICs of ciprofloxacin and levofloxacin were 4 mg/l and 8 mg/l respectively. Resistance mechanisms to fluoroquinolones of staphylococci have been well described (DESCLOUX et al., 2008). Resistance occurs as a result of mutational amino acid substitutions in the subunits of the most sensitive (or primary-target) enzyme within the cell (HOOPER, 2000). The high frequency of phenotypical resistance to fluoroquinolones found in our study could be explained by at least two reasons: firstly, fluoroquinolones are frequently used to treat dog infections especially in cases with unsatisfactory clinical practice where broad-spectrum antimicrobials are selected for treatment without sending clinical material to a laboratory for diagnosis and antibiogram; secondly, according to previous data, fluoroquinolones have been extensively used in domestic animals in Lithuania (SEPUTIENE at al., 2006; RUZAUSKAS et al., 2010a). Moreover, poultry products intended for human consumption (that are sometimes used for feeding dogs) are highly contaminated with fluoroquinolone-resistant bacteria (RUZAUSKAS et al., 2010b). A high rate (50 %) of resistance to gentamicin by MRCNS isolates was also found. The genes encoding resistance to aminoglycosides aac(6 )-Ie-aph(2 )-Ia and aph(3 )-IIIa were detected in this study. The same genes were recently found in most isolates of enterococci isolated from diseased cows, pigs and poultry in Lithuania (SEPUTIENE et al., 2012). Those genes encoding resistance to aminoglycosides were found in S. pseudintermedius - a species that is also highly prevalent in companion animals (KADLEC et al., 2010b; VAN DUIJKEREN et al., 2011). This study is the first study in Lithuania where MRCNS were detected in dogs using both phenotypical and genotypical methods. Recently we have detected MRSA ST398 strains in pigs (RUZAUSKAS et al., 2013). In our opinion, the most important reason for the prevalence of methicillin resistant staphylococci in 182 Vet. arhiv 85 (2), , 2015

9 dogs is associated with the inappropriate usage of fluoroquinolones and cephalosporins in breeding kennels. The anamnesis of the diseases demonstrated periodical usage of those classes of antimicrobials in kennels where reproductive disorders have been prevalent. It is proved that usage of fluoroquinolones as well as cephalosporins might lead to for antimicrobial resistant bacteria (GRECO et al., 2009; VAN DUIJKEREN et al., 2011). Our study revealed that breeding kennels might be a reservoir of MRCNS strains and may pose a risk for spreading such strains during mating. There is no requirement to report methicillin-resistant strain prevalence in kennel, thus other breeders have no information about the microbiological hazards associated with resistant bacteria. Attention should be paid to this problem as methicillin-resistant staphylococci pose a risk not only for animals but also for humans (CATRY et al., 2010; STEGMANN et al., 2010). Conclusions Coagulase-negative staphylococci are highly prevalent in dogs with various clinical conditions. Methicillin-resistant staphylococci are mostly distributed in breeding kennels and pose a risk for spreading resistant strains to other pure-breed dogs, their offspring, owners and other animals in close contact. Attention should be paid to the possible spread of resistant Staphylococcus haemolyticus between companion-animals and humans. Acknowledgements This research was funded by a grant (MIP-061/2012) from the Research Council of Lithuania References AARESTRUP, F. M., Y. AGERSO, P. GERNER-SMIDT, M. MADSEN, L. B. JENSEN (2000): Comparison of antimicrobial resistance phenotypes and resistance genes in Enterococcus faecalis and Enterococcus faecium from humans in the community, broilers, and pigs in Denmark. Diagn. Microbiol. Infect. Dis. 37, ANONYMOUS (2009): Protocol for PCR for meca, nuc and 16S. Community Reference Laboratory - Antimicrobial Resistance. CRL course Copenhagen April BAGCIGIL, F. A., A. MOODLEY, K. E. BAPTISTE, V. F. JENSEN, L. GUARDABASSI (2007): Occurrence, species distribution, antimicrobial resistance and clonality of methicillin- and erythromycin-resistant staphylococci in the nasal cavity of domestic animals. Vet. Microbiol. 121, BARBIER, F., E. RUPPE, D. HERNANDEZ, D. LEBEAUX, P. FRANCOIS, B. FELIX, A. DESPREZ, A. MAIGA, P. L. WOERTHER, K. GAILLARD, C. JEANROT, M. WOLFF, J. SCHRENZEL, A. ANDREMONT, R. RUIMY (2010): Methicillin-resistant coagulase-negative staphylococci in the community: high homology of SCCmec IVa between Staphylococcus epidermidis and major clones of methicillin-resistant Staphylococcus aureus. J. Infect. Dis. 202, Vet. arhiv 85 (2), ,

10 BARROS, E. M., H. COETTO, M. C. F. BASTOS, K. R. N. DOS SANTOS, M. GIAMBIAGI- DEMARVAL (2012): Staphylococcus haemolyticus as an important hospital pathogen and carrier of methicillin resistance genes. J. Clin. Microbiol. 50, CARBONNELLE, E., J. L. BERETTI, S. COTTYN, G. QUESNE, P. BERCHE, X. NASSIF, A. FERRONI (2007): Rapid identification of staphylococci isolated in clinical microbiology laboratories by matrix-assisted laser desorption ionization-time off light mass spectrometry. J. Microbiol. 45, CATRY, B., E. VAN DUIJKEREN, C. POMBA, C. GRECO, M. MORENO ROMO, S. PYÖRÄLÄ, M. RUZAUSKAS, P. SANDERS, E. THRELFALL, F. UNGEMACH, K. TÖRNEKE, C. MUNOZ MADEIRO, J. TORREN EDO (2010): Reflection paper on MRSA in food producing and companion animals: epidemiology and control options for human and animal health. Epidemiol. Infect. 138, COHN, L. A., J. R. MIDDLETON (2010): A veterinary perspective on methicillin-resistant staphylococci. J. Vet. Emerg. Crit. Care. 20, COUTO, N., A. BELAS, I. COUTO, V. PERRETEN, C. POMBA (2014): Genetic relatedness, antimicrobial and biocide susceptibility comparative analysis of methicillin-resistant and -susceptible Staphylococcus pseudintermedius from Portugal. Microb. Drug Resist. 20, CUNY, C., F. LAYER, B. STROMMENGER, W. WITTE (2011): Rare occurrence of methicillinresistant Staphylococcus aureus CC130 with a novel meca homologue in humans in Germany. PLoS ONE. 6, e DE MATTOS, E. M., L. A. TEIXEIRA, V. M. ALVES, C. A. REZENDA E RESENDE, M. V. DA SILVA COIMBRA, M. C. DA SILVA-CARVALHO, B. T. FERREIRA-CARVALHO, A. M. FIGUEIREDO (2003): Isolation of methicillin-resistant coagulase-negative staphylococci from patients undergoing continuous ambulatory peritoneal dialysis (CAPD) and comparison of different molecular techniques for discriminating isolates of Staphylococcus epidermidis. Diagn. Microbiol. Infect. Dis. 45, DESCLOUX, S., A. ROSSANO, V. PERRETEN (2008): Characterization of new staphylococcal cassette chromosome mec (SCCmec) and topoisomerase genes in fluoroquinolonesand methicillin-resistant Staphylococcus pseudintermedius. J. Clin. Microbiol. 46, DETWILER, A., P. BLOOM, A. PETERSEN, E. J. ROSSER Jr. (2013): Multi-drug and methicillin resistance of staphylococci from canine patients at a veterinary teaching hospital ( ). Vet. Q. 33, GANDOLFI-DECRISTOPHORIS, P., G. REGULA, O. PETRINI, J. ZINSSTAG, E. SCHELLING (2013): Prevalence and risk factors for carriage of multi-drug resistant staphylococci in healthy cats and dogs. J. Vet. Sci. 14, GRECO, C., J. I. BADIOLA, B. CATRY, E. VANDUIJKEREN, M. A. MORENO, C. MATIAS FERREIRA, S. POMBA, S. PYOROLA, M. RUZAUSKAS, P. SANDERS, E. J. THRELFALL, F. UNGEMACH, K. TORNEKE, J. E. TORREN (2009): Reflection paper on the use of third and fourth generation cephalosporins in food producing animals in the European Union: development of resistance and impact on human and animal health. J. Vet. Pharmacol. Ther. 32, Vet. arhiv 85 (2), , 2015

11 HANSSEN, A. M., J. U. ERICSON SOLLID (2006): SCCmec in staphylococci: genes on the move. FEMS Immunol. Med. Microbiol. 46, HOOPER, D. (2000): Mechanisms of action and resistance of older and newer fluoroquinolones. Clin. Infect. Dis. 31 (suppl. 2), HUBER, H., D. ZIEGLER, V. PFLUGER, G. VOGEL, C. ZWEIFEL, R. STEPHAN (2011): Prevalence and characteristics of methicillin-resistant coagulase-negative staphylococci from livestock, chicken carcasses, bulk tank milk, minced meat, and contact persons. BMC Vet. Res. 7, 6. JENSEN, L. B., A. M. HAMMERUM, F. BAGER, F. M. AARESTRUP (2002): Streptogramin resistance among Enterococcus faecium isolated from production animals in Denmark in Microb. Drug Resist. 8, KADLEC, K., S. SCHWARZ (2010a): Identification of the novel dfrk-carrying transposon Tn559 in a porcine methicillin-susceptible Staphylococcus aureus ST398 strain. Antimicrob. Agents Chemother. 54, KADLEC, K., S. SCHWARZ, V. PERRETEN, U. G. ANDERSSON, M. FINN, C. GREKO, A. MOODLEY, S. A. KANIA, L. A. FRANK, D. A. BEMIS, A. FRANCO, M. IURESCIA, A. BATTISTI, B. DUIM, J. A. WAGENAAR, E. VAN DUIJKEREN, J. S. WEESE, J. R. FITZGERALD, A. ROSSANO, L. GUARDABASSI (2010b): Molecular analysis of methicillin-resistant Staphylococcus pseudintermedius of feline origin from different European countries and North America. J. Antimicrob. Chemother. 65, KERN, A., V. PERRETEN (2013): Clinical and molecular features of methicillin-resistant, coagulase-negative staphylococci of pets and horses. Antimicrob. Chemother. 68, KIM, J. H., J. Y. LEE, H. R. KIM, K. W. HEO, S. K. PARK, J. N. LEE, S. M. YU, J. H. SHIN (2008): Acute lymphadenitis with cellulitis caused by Staphylococcus lugdunensis. Korean Lab. J. Med. 28, LITSTER, A., S. M. MOSS, M. HONNERY, B. REES, D. J. TROTT (2007): Prevalence of bacterial species in cats with clinical signs of lower urinary tract disease: recognition of Staphylococcus felis as a possible feline urinary tract pathogen. Vet. Microbiol. 121, MALIK, S., H. PENG, M. D. BARTON (2005): Antibiotic resistance in staphylococci associated with cats and dogs. J. Appl. Microbiol. 99, MATANOVIĆ, K., S. MEKIĆ, B. ŠEOL (2012): Antimicrobial susceptibility of Staphylococcus pseudintermedius isolated from dogs and cats in Croatia during a six-month period. Vet. Arhiv 82, NAKAMURA, R. K., S. A. ZIMMERMAN, A. J. LANGE, M. B. LESSER (2012): Isolation of methicillin-resistant Staphylococcus lugdunensis in a dog with endocarditis. J. Vet. Cardiol. 14, PENNA, B., R. VARGES, L. MEDEIROS, G. M. MARTINS, R. R. MARTINS, W. LILENBAUM (2010): Species distribution and antimicrobial susceptibility of staphylococci isolated from canine otitis externa. Vet. Dermatol. 21, Vet. arhiv 85 (2), ,

12 PERRETEN, V., L. VORLET-FAWER, P. SLICKERS, R. EHRICHT, P. KUHNERT, J. FREY (2005): Microarray-based detection of 90 antibiotic resistance genes of gram-positive bacteria. J. Clin. Microbiol. 43, QUINN, P. J., B. K. MARKEY, F. C. LEONARD, E. S. FITZPATRICK, S. FANNING, P. J. HARTIGAN (2013): Veterinary Microbiology and Microbial Disease. Staphylococcus species. 2 d ed., Willey-Blackwell, West Sussex, UK, pp RUZAUSKAS, M., N. COUTO, A. BELAS, I. KLIMIENE, R. SIUGZDINIENE, C. POMBA (2013): First report of swine-associated methicillin-resistant Staphylococcus aureus ST398 in Lithuania. Pol. J. Vet. Med. 16, RUZAUSKAS, M., R. SIUGZDINIENE, V. SEPUTIENĖ, V. SUZIEDELIENE, M. VIRGAILIS, R. DAUGELAVICIUS, V. SPAKAUSKAS, D. ZIENIUS, J. SENGAUT, A. PAVILONIS (2010a): The situation of antimicrobial resistance of enteric bacteria isolated from animal origin to quinolones and fluoroquinolones. Vet. Med. Zoot. 50, RUZAUSKAS, M., R. SIUGZDINIENE, E. SUZIEDELIENE, V. SEPUTIENE, J. POVILONIS (2010b): Antimicrobial resistance of Enterococcus spp. spread in poultry products in Lithuania. J. Food Saf. 30, SCHNELLMANN, C., V. GERBER, A. ROSSANO, V. JAQUIER, Y. PANCHAUD, M. G. DOHERR, A. THOMANN, R. STRAUB, V. PERRETEN (2006): Presence of new meca and mph(c) variants conferring antibiotic resistance in Staphylococcus spp. isolated from the skin of horses before and after clinic admission. J. Clin. Microbiol. 44, SEPUTIENĖ, V., J. POVILONIS, M. RUZAUSKAS, M. VIRGAILIS, P. ZLABYS, E. SUZIEDELIENE (2006): Quinolone resistance among Salmonella enterica and Escherichia coli in Lithuania. Biologija 3, SEPUTIENE, V., A. BOGDAITE, M. RUZAUSKAS, E. SUZIEDELIENE (2012): Antibiotic resistance genes and virulence factors in Enterococcus faecium and Enterococcus faecalis from diseased farm animals: pigs, cattle and poultry. Pol. J. Vet. Sci. 15, STEGMANN, R., A. BURNENS, C. A. MARANTA, V. PERRETEN (2010): Human infection associated with methicillin-resistant Staphylococcus pseudintermedius ST71. J. Antimicrob. Chemother. 65, TULINSKI, P., A. C. FLUIT, J. A. WAGENAAR, D. MEVIUS, L. VAN DE VIJVER, B. DUIM (2012): Methicillin-resistant coagulase-negative staphylococci on pig farms as a reservoir of heterogeneous staphylococcal cassette chromosome mec elements. Appl. Environ. Microbiol. 78, TAKEUCHI, F., S. WATANABE, T. BABA, H. YUZAWA, T. ITO, Y. MORIMOTO, M. KURODA, L. CUI, M. TAKAHASHI, A. ANKAI, S. BABA, S. FUKUI, J. C. LEE, K. HIRAMATSU (2005): Whole-genome sequencing of Staphylococcus haemolyticus uncovers the extreme plasticity of its genome and the evolution of human-colonizing staphylococcal species. J. Bacteriol. 187, VAN DUIJKEREN, E., C. BOUDEWIJN, C. GREKO, M. MORENO, C. POMBA, S. PYORALA, M. RUZAUSKAS, S. PASCAL, J. THRELFALL, J. TORREN EDO, K. TÖRNEKE (2011): 186 Vet. arhiv 85 (2), , 2015

13 Review on methicillin-resistant Staphylococcus pseudintermedius. J. Antimicrob. Chemother. 66, VAN DUIJKEREN, E., A. T. BOX, M. E. HECK, W. J. WANNET, A. C. FLUIT (2004): Methicillinresistant staphylococci isolated from animals. Vet. Microbiol. 103, Received: 18 February 2014 Accepted: 11 July 2014 RUZAUSKAS, M., N. COUTO, R. SIUGZDINIENE, I. KLIMIENE, M. VIRGAILIS, L. VASKEVICIUTE, R. MOCKELIUNAS, C. POMBA: Presječno istraživanje prevalencije koagulaza negativnih izolata safilokoka, otpornih na meticilin, izdvojenih iz pasa u Litvi. Vet. arhiv 85, , SAŽETAK Cilj ovog istraživanja bio je ustanoviti prisutnost i učestalost koagulaza negativnih stafilokoka otpornih na meticilin (MRKNS) izdvojenih iz pasa u Litvi te odrediti njihovu otpornost na antimikrobne tvari. Klinički materijal bio je prikupljen iz 400 pasa i godine. Tri stotine uzoraka bilo je uzeto iz bolesnih pasa s različitim kliničkim znakovima (dermatitis, otitis, infekcije rana, infekcije probavnog i dišnog sustava) te 100 uzoraka iz kuja čistih pasmina s reprodukcijskim poremećajima (pyometritis, metritis, partus praematurus) upotrebljavanih za rasplod u štenarama. Od 400 pretraženih, 20 koagulaza negativnih izolata stafilokoka otpornih na meticilin bilo je izdvojeno iz 18 pasa. Svi izolati imali su gen meca, dok gen mecc (meclga251) nije bio dokazan. Deset izolata bilo je izdvojeno iz uzoraka rodnice kuja iz triju velikih uzgoja. Prevalencija MRKNS u pasa držanih u domaćinstvima iznosila je 3,3 %, tj. bila je značajno manja (P<0,01) nego u pasa držanih u velikim uzgajivačnicama (10 %). Dokazano je 10 različitih vrsta koagulaza negativnih stafilokoka otpornih na meticilin s najvećom prevalencijom za vrstu Staphylococcus haemolyticus. MRKNS izolati bili su otporni na makrolide (75 %) zbog erm(c) i msra gena i tetraciklin (65 %) zbog posjedovanja tet(k) i/ili tet(m) gena. Stopa otpornosti na gentamicin bila je 50 % (što se pripisuje genima aac(6 )-Ie-aph(2 )-Ia, aph(3 )-IIIa) i na ko-trimoksal 40 % (gen dfrg). Jedan izolat vrste S. lentus imao je gen dfrk. Svi izolati bili su osjetljivi na linezolid, daptomicin i vankomicin. Ovo istraživanje pokazuje da uzgojne štenare mogu biti rezervoar sojeva MRKNS i mogu predstavljati rizik za širenje takvih sojeva za vrijeme parenja. Treba se usredotočiti na mogući prijenos višestruko otpornih sojeva vrste S. haemolyticus s kućnih ljubimaca na čovjeka s obzirom na to da ta vrsta ima važnu ulogu kao uzročnik infekcija u ljudi. Ključne riječi: otpornost, geni, psi čistog uzgoja, štenare, Staphylococcus haemolyticus Vet. arhiv 85 (2), ,

14 .