Veterinarni Medicina, 62, 2017 (02): 81 89
|
|
- Hester Ferguson
- 5 years ago
- Views:
Transcription
1 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED Characterisation of methicillinsusceptible Staphylococcus pseudintermedius isolates from canine infections and determination of virulence factors using multiplex PCR O. elter *, P. Svec, J. Tkadlec, J. Doskar, H. Kinska, R. Pantucek nd edical aculty, Charles University, Prague, Czech Republic aculty of Science, asaryk University, Brno, Czech Republic Laboratory of Veterinary edicine (Labvet), Prague, Czech Republic *Corresponding author: ABSTRACT: Staphylococcus pseudintermedius is a genuine opportunistic pathogen of the skin, especially in canids. However, characterisation of virulence, antimicrobial resistance and genotypic variability in methicillinsusceptible S. pseudintermedius isolates has not been fully explored. In this study, coagulasepositive staphylococcal isolates collected from dogs of various breeds and ages suffering from dermatitis (n = 70), pyoderma (n = 7), and otitis (n = 7), from districts of Prague (Czech Republic) and surrounding areas, were characterised using matrixassisted laser desorption/ionisation timeofflight mass spectrometry, and repetitive sequencebased PCR fingerprinting. Susceptibility to antimicrobial agents was determined, virulence factor genes for leukocidin (luksi), exfoliatins (exi, expb, and siet), enterotoxin C (sec canine ) and enterotoxinrelated genes (seint and sel) were detected using multiplex PCR and the genotypes of S. pseudintermedius isolates were determined using SmaI macrorestriction analysis. The majority of the staphylococcal isolates (n = ) were identified as S. pseudintermedius (n = 7) and all of them were susceptible to methicillin/oxacillin (SSP). About half of the strains (n = ) were resistant to macrolidelincosamidestreptogramin B antimicrobial agents and resistance was mediated in all but one of the strains by the erm(b) gene. The genes for luksi, siet, seint, and sel were detected in the majority of the SSP strains (6.%, 00%, 00%, and 7.%, respectively). Investigated canine S. pseudintermedius isolates were highly heterogeneous, which prevented the correlation of any specific lineage to a particular infection, dog breed, or region of origin. Keywords: Staphylococcus pseudintermedius; macrolide lincosamidestreptogramin B (LS B ) resistance; genotyping; virulence genes Staphylococcus pseudintermedius, a pathogen that infects dogs, is comparable to Stapylococcus aureus in humans. This analogy fits not only the phenotypic characteristics (e.g. similar colony morphology, pigment, haemolysis), but is also supported by the striking similarity in ecology/epidemiology (colonisation or infection of the skin and skin adnexa, vertical/horizontal transmission), expression of homologous virulence factors (cell wallanchored proteins such as microbial surface components recognising adhesive matrix molecules; protein A; and enzymes, e.g. coagulase; secreted toxins, such as cytotoxins, exfoliative toxins, or superantigens) and pathogenicity (skin infections or invasive infections). These two coagulasepositive species probably evolved separately through adaptation Supported by the Internal Grant Agency (IGA) of the inistry of Health of the Czech Republic (Grant No. NT /0) and the Institutional Support of otol University Hospital (Prague) for conceptual development of research organization (Grant No ).
2 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED to their respective hosts. Even today, differentiating S. pseudintermedius and S. aureus can pose a problem for diagnostic laboratories (Weese 0). A large proportion of healthy dogs (7%) and the majority of infected dogs (7%) are colonised by S. pseudintermedius (azakerley et al. 00), which also has the potential to be an agent of zoonotic infections (Borjesson et al. 0). In genotyping of S. pseudintermedius, macrorestriction analysis resolved by pulsedfield gel electrophoresis (PGE) has higher discriminatory power than staphylococcal protein A (spa) typing (oodley et al. 0) or multilocus sequence typing (Solyman et al. 0) and, therefore, is currently considered as the most suitable method for the typing of a large collection of isolates. Even though spa typing yields more stable and reproducible results and is thus superior to PGE DNA macrorestriction analysis in the determination of clonality, it is not as effective as the latter method in typing methicillinsusceptible isolates of which more than 0% are nontypeable (Bannoehr and Guardabassi 0). Only a few local studies have been performed on S. pseudintermedius isolates from Eastern and Central Europe, and infectious agents in household pets and the use of antimicrobial agents in these animals require more focus. The goal of the present study was to characterise S. pseudintermedius isolates recovered from dogs varying in breed, sex, and age and coming from various districts of the City of Prague. We here describe a newly developed multiplex PCR assay for determination of virulence factors in such isolates. ATERIAL AND ETHODS Sample collection and bacterial isolates. The dog owners presented their animals to our laboratory for identification of specific infectious agents causing secondary dermatitis or pyoderma. Samples from the affected lesions were collected in 00 using dacron swabs, stored until inoculated onto Columbia blood agar with % Sheep Blood (Oxoid, UK) and cultured in aerobic atmosphere at 7 C. Single canine coagulasepositive staphylococcal isolates (n = ) were cultured from dogs of various breeds and ages suffering from dermatitis (n = 70), pyoderma (n = 7), and otitis (n = 7) to diagnose the specific agents of canine skin or ear infections. The owners of the dogs lived in nine specified Prague City districts (n = 6), an unknown Prague district (n = 0), and surrounding areas (n = ). Samples were collected from dogs of different breeds (n = ) and four crossbred dogs. The reference strains were obtained from the Czech Collection of icroorganisms (asaryk University, Brno). Phenotypic identification. Identification of all isolates was performed using a matrixassisted laser desorption/ionisation timeofflight mass spectrometry ALDITO S system (icroflex T LT/R, database 66, Bruker, Bremen, Germany). Genotypic identification. Genotypic screening of the isolates was performed using reppcr fingerprinting with the (GTG) primer, reported as a suitable tool for the identification of Staphylococcus spp. (Svec et al. 00). The resulting fingerprints were processed using BioNumerics v. 7. software (Appliedaths, Kortrijk, Belgium) and compared to the inhouse (GTG) PCR fingerprints database (Svec et al. 00). Antimicrobial agent susceptibility. Tests for susceptibility to antimicrobial agents were performed using uellerhinton agar (C07, Oxoid, UK) and disks (Oxoid, UK) of oxacillin, cefoxitin, amoxicillin/clavulanic acid, cefalotin, ofloxacin, mupirocin, erythromycin and clindamycin and the disk diffusion method results were interpreted using the criteria of EUCAST ( and strain ATCC S. aureus as a control. Since a large proportion of the isolates were resistant to macrolidelincosamidestreptogramin B (LS B ) antimicrobial agents (erythromycin, clindamycin) the presence of the erm(a), erm(b), erm(c), and msr(a) genes was determined in the resistant isolates (Lina et al. ). acrorestriction analysis of DNA. Electrophoresis was performed using the CHE DR II system (BioRad, California, USA). All S. pseudintermedius isolates (n = 7) were typed using the SmaI restriction endonuclease and PGE in order to assess their population structure. Bacterial DNA was harvested from cultures grown on nutrient agar plates and agarose plugs were prepared according to the manufacturer s recommendations. The SmaI macrorestriction profiles of the isolates were evaluated by visual inspection and the dendrogram was constructed using BioNumerics v. 6. software (Applied aths, Kortrijk, Belgium) with the Dice similarity coefficient and unweighted pair group method with arithmetic mean (UPGA) clustering. An optimisation of.% and a position tolerance of % were allowed in the cluster analysis and calculation of the dendrogram.
3 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED Detection of virulence factor genes. ultiplex PCR assays I and II to detect virulence genes were carried out using a ultiplex PCR kit (Qiagen, Hilden, Germany) in a final volume of µl, which contained µl aliquots of the crude boiledcell lysates. The primers used for the PCR assays were designed specifically for this study as detailed in Table. Primers targeting the S. intermedius group (SIG) thermonuclease gene (si nuc) were used as an internal positive control (Baron et al. 00). The PCR assays were performed using a TGradient thermal cycler (Biometra, Goettingen, Germany) set to the following parameters: cycles of denaturation ( C, 0 s), annealing ( C, 0 s), and extension (7 C, 60 s). The efficiency of the PCR assay was evaluated by performing reactions using 0fold serial dilutions of purified genomic DNA. RESULTS Phenotypic identification Using ALDITO S we identified the majority (n = 7; %) of the staphylococcal isolates (n = ) as S. pseudintermedius and only sporadic isolates as Staphylococcus schleiferi (n = ) and S. aureus (n = ). Species level identification revealed minor differences between the results obtained for the top score corresponding to S. pseudintermedius, and the second match Staphylococcus intermedius. Therefore, reppcr genotypic identification was carried out. S. aureus was identified as described previously (Stepan et al. 00). Genotypic identification using reppcr with the (GTG) primer Numerical analysis of reppcr fingerprints confirmed the identification results obtained by ALDITO S analysis. All S. pseudintermedius isolates revealed visually similar fingerprints matching with the database fingerprint entries for the S. pseudintermedius reference strains and were grouped in a single cluster (igure ). Similarly, S. schleiferi and S. aureus isolates matched the reference fingerprints representing these taxa. oreover, the reppcr analysis of S. schleiferi strains assigned all three isolates as representatives of S. schleiferi subsp. coagulans. Table. Primers used for multiplex PCR assays targeting toxinrelated genes Primer Sequence Product (bp) Primer concentration GenBank accession No. Target gene ultiplex PCR I luksig_ AGCCAATAGTTTTATTATCTGTG lukssig_r AAATTAAAGTAAAGGGGCAT 00n X7 luksi and luki gama haemolysin components exi_ exi_r expb_ expb_r se_sig_ se_sig_r AGTAACAAACTATCACATAGCG TTAACAGGTTATAACGTCCCC AAATTATTTTCACTCCAGCTT CATGTATACCTATTAGTTCCCC CATTTGAAATACAAGCCGAC TGATTAAAATTATTACCCGGTG 0n AB0 exi gene for exfoliative toxin 0n AB607 expb gene for exfoliative toxin n AB67 enterotoxinrelated gene sein ultiplex PCR II et_sig_ et_sig_r sel_sig_ sel_sig_r sec_can_ sec_can_r GATAAAATTTATGCGGGTCCT ATTACTTTCTTCAGGGTCGAA TCTTTTTGTGGTGCCTGA ATGTCTTTATCATTATCCCCA CAGCAACTAAAGTTAAGTCTG ACATACAAGTTTTACCACCT 7 0n AB070 siet gene for exfoliative toxin 06 00n CP00 and CP007 n U6 conserved region of genes SPSINT_00 and SPSE_7 for superantigen like proteins sec canine gene for type C enterotoxin SInuc SInuc CAATGGAGATGGCCCTTTTA AGCGTACACGTTCATCTTG 0n X6767 nuc gene for S. intermedius group thermonuclease
4 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED Similarity (%) Similarity (%) (bp) SP CC SP CC SP CC SP CC SP CC 70 SI CC 7 SI CC 7 olecular size marker igure. Dendrogram based on reppcr fingerprints obtained from S. pseudintermedius (SP) canine isolates and reference strains of S. intermedius (SI) and S. pseudintermedius. The dendrogram was calculated using Pearson s correlation coefficients with the UPGA clustering method (r, expressed as percentage similarity values) Antimicrobial agent resistance and detection of LS B determinants All of the S. pseudintermedius isolates tested were susceptible to methicillin/oxacillin (SSP), amoxicillin/clavulanic acid, cefalotin, and ofloxacin; however, half of the isolates (n = ; %) were constitutively resistant to erythromycin and clindamycin. Testing for the presence of the erm(a), erm(b), erm(c) and msr(a) genes revealed that, in all but one of the isolates, resistance was mediated by erm(b). Only sporadic isolates (n = ) were resistant to mupirocin. acrorestriction analysis of DNA The macrorestriction patterns of 77 typeable isolates of S. pseudintermedius revealed 6 clusters when the similarity threshold value of % proposed by Paul et al. (0) was used (igure ). Closely related isolates from the present study were not breedrelated. Each fingerprint cluster in the present study included from one to six S. pseudintermedius strains. All isolates in our study shared a similarity of higher than 7%. requency and distribution of virulence factors Seven virulence genes were found in this study: the enterotoxinrelated gene seint and the siet gene for exfoliative toxin were detected in all S. pseudintermedius isolates. The genes for twocomponent leukotoxin (luksi and luki) were also frequently detected (n = 76; 6.%). The majority of the analysed isolates (n = ; 7.%) carried another enterotoxinrelated gene, sel. The remaining genes exi, sec canine, and expb were detected in (.%), (6.%), and six (7.6%) isolates, respectively. These genes were found in different combinations, defining different toxinrelated genotypes (igure and Table ). The combination of luksi, seint, siet, and sel was the most common and was detected in.% of the isolates. The distribution of the virulence genes in relation to clinical diagnosis was not statistically evaluated due to the relatively high number of different combinations of toxin genes and the small numbers of isolates from pyoderma and otitis cases. Genotyping revealed that more
5 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED Similarity (%) igure. Dendrogram illustrating the similarity (based on the Dice coefficients and UPGA clustering) of SmaI macrorestriction profiles (PGE) of S. pseudintermedius canine isolates. Symbols denote from left to the right: number of isolate, dog breed, collection date (00), origin, sex, age (years), and virulence genotype (C, sec canine ; E, sel; L, luksi; N, si nuc; P, expb; S, seint; T, siet; X, exi) Pekinese En. cocker spaniel Hovawart En. bull terrier Afghan hound Ger. mastiff Ger. shep. dog Dachshund Am. Stafford. terrier Crossbreed Chihuahua Ridgeback Shar Pei Bichon frise Pug En. bulldog Crossbreed Weimaraner En. dog Am. pitbull Ger. boxer Ridgeback Am. cocker spaniel Bordeauxdog Ger. shep. dog Cane corso Crossbreed Dachshund Tosa Inu En. cocker spaniel En. bull terrier Dachshund Poodle Poodle Ger. pinscher Pekingese r. bulldog Welsh terrier Ger. boxer Poodle Irish setter Dalmatin Rottweiler Am. Stafford. terrier Ger. shep. dog Yorkshire terrier Am. cocker spaniel Am. pitbull Ger. pinscher Bernese mountain Vizsla Am. cocker spaniel Dachshund Doberman Crossbreed Cesky terier r. bulldog Boston terrier Ger. boxer Am. bulldog altese Ridgeback Am. cocker spaniel Poodle Afghan hound Irish wolfhound unsterlander Chrastena Prague 0 Prague Prague Prague Prague Prague Horovice Prague Prague Pilsen Prague Prague Prague Prague Prague Prague Prague Prague Petrov 7 Prague Prague 0 Prague 6 Prague Prague Prague Kladno Prague Kostelec n/l Prague 6 Prague Prague 7 Prague Ujezd n/l Losiny Ujezd n/l Prague Prague LXPSTECN STN LXPSTN LXSTECN LXPSTCN LXSTECN LXSTECN LPSTEN LXPSTECN LPSTEN LXSTECN LXSTEN LXSTEN
6 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED (bp) (bp) W W luksi exi expb seint siet sel sec canine nuc igure. Representative agarose gel electrophoretic patterns revealing the different toxinrelated gene profiles generated using multiplex PCR assays I and II in S. pseudintermedius strains. Profile numbers correspond to Table. W, olecular Weight arker (00 bp DNA Ladder, New England BioLabs) than half of the S. pseudintermedius isolates (n = ) carried four virulence genes encoding leukotoxin (luksi), enterotoxin (seint), exfoliative toxin (siet), and superantigenlike protein (sel). Thus, it can be presumed that these four genes play a major role in pathogenesis. Other virulence profiles could only be seen in a few isolates. I II DISCUSSION ALDITO S analysis, recommended by other authors (Decristophoris et al. 0) for identification of the SIG species, correctly identified all S. pseudintermedius isolates and two other staphylococcal species in this study. Interestingly, the proportion of S. aureus (n = ;.%) and S. schleiferi subsp. coagulans (n = ;.%) differs from that reported by Slettemeas et al. 00 (0.%) and Chanchaithong and Prapasarakul 0 (0.%) for S. aureus strains and also from that described by Slettemeas et al. 00 (7%) and Kawakami et al. 00 (0.%) for S. schleiferi subsp. coagulans strains. The reppcr fingerprinting method proved to be useful for the identification of all isolates; its advantage over ALDITO S is that it allowed for the unambiguous differentiation between S. pseudintermedius and S. intermedius and final identification of S. schleiferi subsp. coagulans to the subspecies level. The study isolates were collected in 00; therefore, it is not surprising that no RSP isolates were found, as methicillinresistant S. pseudintermedius (RSP) emerged in Europe in (Loeffler et al. 007; Schwarz et al. 00; Ruscher et al. 00; Ruscher et al. 00). The resistance to LS B antimicrobial agents in half of the S. pseudintermedius isolates revealed in this study is close to the.7% reported by Garbacz et al. (0), and the % and approximately % methicillinsusceptible isolates found by Kawakami et al. (00) and Haenni et al. (0), respectively. Table. Prevalence of toxinrelated genotypes in Staphylococcus pseudintermedius isolates Profile No. of genes No. (%) of isolates (n = 7) No. (%) of isolates by clinical sample dermatitis (n = 66) pyoderma (n = 6) otitis (n = 7) Gene combination luksi exi expb seint siet sel sec canine (.) (7.6) (6.7) (7.) (0.) (.) (0.) (6.) (0.0) (.) (6.) (7.6) (.) (.) (.) (.) (.0) (.) (.0) (.) (.) (.) (.0) (.) (.) (.) (.) (.) (.)
7 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED Substantially lower rates of LS B resistance, i.e. 6.7% and 7.7%, were reported by Onuma et al. (0) in dogs with pyoderma in two periods. The constitutive resistance of all LS B resistant isolates was mediated almost exclusively by the erm(b) gene, as reported also by others (Kadlec and Schwarz 0). The mechanism of resistance to LS B antimicrobial agents could not be identified in one of the resistant isolates, even when tested for additional resistance determinants (erm(a), erm(c), and msr(a)). The heterogenic pulsotypes of the isolates fully correspond with the literature data indicating high genetic diversity of methicillinsusceptible S. pseudintermedius (SSP) isolates (Norstrom et al. 00) compared with that of clonally related methicillinresistant isolates of S. pseudintermedius (RSP; Hesselbarth et al. ; Bannoehr et al. 007; azakerley et al. 00; Perreten et al. 00; Garbacz et al. 0; GomezSanz et al. 0; Couto et al. 0). However, some authors failed to observe any diversity of S. pseudintermedius strains in healthy and diseased dogs (Sasaki et al. 00). A newly designed PCR assay, based on two multiplex reactions, confirmed the presence of virulence factor genes in all S. pseudintermedius isolates and would be suitable for use in diagnostic laboratories. The prevalence of the siet gene (00%) was higher than described by others, e.g. 6.6% (Lautz et al. 006), but almost equal to the percentage reported by Yoon et al. (00). The occurrence of the exi gene (.%) was similar to that observed by utagawa Saito et al. (00) and the prevalence of the expb gene (7.6%) was lower than the % indicated by Iyori et al. (00). The prevalence of the enterotoxinrelated gene sec canine (6.%) was close to the.6% reported by Becker et al. (00) but lower than the % described by Yoon et al. (00) and other authors who confirmed its presence in all tested isolates (utagawasaito et al. 00). The enterotoxin production rate was previously described to be significantly higher in isolates from diseased dogs in comparison with healthy dogs (Sasaki et al. 00), but not in all studies (Tanabe et al. 0). The role of S. pseudintermedius enterotoxinrelated toxins in the pathogenesis of dog skin infections is still not fully clarified. However, strain superantigenicity, ability to induce cytokine production, pyrogenicity, lymphocyte proliferation and immunosuppression could potentiate the skin inflammation process (Hendricks et al. 00). In conclusion, the reppcr method employed here was superior to ALDITO S in its ability to identify canine coagulasepositive staphylococci to the subspecies level. Constitutive resistance to LS B antimicrobial agents (erythromycin, clindamycin) in half of the S. pseudintermedius isolates ( from a total of 7) was determined by the presence of the ermb gene in all but one isolate. oreover, macrorestriction analysis of DNA of the S. pseudintermedius isolates using pulsed field gel electrophoresis revealed their high genotypic heterogeneity. A newly designed PCR assay was used to detect numerous virulence factor genes, of which four encoding leukotoxin (luksi), enterotoxin (seint), exfoliative toxin (siet), and superantigenlike protein (sel) were detected together in the majority of the isolates (n = ), suggesting a significant role for these factors in the pathogenesis of canine skin infections. Acknowledgement We thank E. Kodytkova from the National Institute of Public Health, Prague, for linguistic revision of the manuscript. REERENCES Bannoehr J, Guardabassi L (0): Staphylococcus pseudintermedius in the dog: taxonomy, diagnostics, ecology, epidemiology and pathogenicity. Veterinary Dermatology, 66. Bannoehr J, Ben Zakour NL, Waller AS, Guardabassi L, Thoday KL, van den Broek AH, itzgerald JR (007) Population genetic structure of the Staphylococcus intermedius group: insights into agr diversification and the emergence of methicillinresistant strains. Journal of Bacteriology, 6 6. Baron, Cochet, Pellerin JL, Ben Zakour N, Lebon A, Navarro A, Proudy I, Le Loir Y, Gautier (00): Development of a PCR test to differentiate between Staphylococcus aureus and Staphylococcus intermedius. Journal of ood Protection 67, 0 0. Becker K, Keller B, von Eiff C, Bruck, Lubritz G, Etienne J, Peters G (00): Enterotoxigenic potential of Staphylococcus intermedius. Applied and Environmental icrobiology 67, 7. Borjesson S, GomezSanz E, Ekstrom K, Torres C, Gronlund U (0): Staphylococcus pseudintermedius can be mis 7
8 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED diagnosed as Staphylococcus aureus in humans with dog bite wounds. European Journal of Clinical icrobiology and Infectious Diseases,. Chanchaithong P, Prapasarakul N (0): Biochemical markers and protein pattern analysis for canine coagulasepositive staphylococci and their distribution on dog skin. Journal of icrobiological ethods 6, 7. Couto N, Belas A, Couto I, Perreten V, Pomba C (0): Genetic relatedness, antimicrobial and biocide susceptibility comparative analysis of methicillinresistant and susceptible Staphylococcus pseudintermedius from Portugal. icrobial Drug Resistance 0, 6 7. Decristophoris P, asola A, Benagli C, Tonolla, Petrini O (0): Identification of Staphylococcus intermedius Group by ALDITO S. Systematic and Applied icrobiology,. azakerley J, Williams N, Carter S, cewan N, Nuttall T (00): Heterogeneity of Staphylococcus pseudintermedius isolates from atopic and healthy dogs. Veterinary Dermatology, 7. utagawasaito K, Suzuki, Ohsawa, Ohshima S, Sakurai N, BaThein W, ukuyasu T (00): Identification and prevalence of an enterotoxinrelated gene, seint, in Staphylococcus intermedius isolates from dogs and pigeons. Journal of Applied icrobiology 6, utagawasaito K, akino S, Sunaga, Kato Y, Sakurai Komada N, BaThein W, ukuyasu T (00): Identification of first exfoliative toxin in Staphylococcus pseudintermedius. ES icrobiology Letters 0, Garbacz K, Piechowicz L, Zarnowska S, Haras K, DabrowskaSzponar (0): Heterogeneity of methicillinsensitive Staphylococcus pseudintermedius strains isolated from diseased dogs. Polish Journal of Veterinary Sciences,. GomezSanz E, Torres C, Lozano C, Zarazaga (0): High diversity of Staphylococcus aureus and Staphylococcus pseudintermedius lineages and toxigenic traits in healthy petowning household members. Underestimating normal household contact? Comparative Immunology icrobiology and Infectious Diseases 6,. Haenni, de oraes NA, Chatre P, edaille C, oodley A, adec JY (0): Characterisation of clinical canine meticillinresistant and meticillinsusceptible Staphylococcus pseudintermedius in rance. Journal of Global Antimicrobial Resistance,. Hendricks A, Schuberth HJ, Schueler K, Lloyd DH (00): requency of superantigenproducing Staphylococcus intermedius isolates from canine pyoderma and proliferationinducing potential of superantigens in dogs. Research in Veterinary Science 7, Hesselbarth J, Witte W, Cuny C, Rohde R, Amtsberg G (): Characterization of Staphylococcus intermedius from healthy dogs and cases of superficial pyoderma by DNA restriction endonuclease patterns. Veterinary icrobiology, 66. Iyori K, Hisatsune J, Kawakami T, Shibata S, urayama N, Ide K, Nagata, ukata T, Iwasaki T, Oshima K, Hattori, Sugai, Nishifuji K (00): Identification of a novel Staphylococcus pseudintermedius exfoliative toxin gene and its prevalence in isolates from canines with pyoderma and healthy dogs. ES icrobiology Letters, 6 7. Kadlec K, Schwarz S (0): Antimicrobial resistance of Staphylococcus pseudintermedius. Veterinary Dermatology, 76. Kawakami T, Shibata S, urayama N, Nagata, Nishifuji K, Iwasaki T, ukata T (00): Antimicrobial susceptibility and methicillin resistance in Staphylococcus pseudintermedius and Staphylococcus schleiferi subsp. coagulans isolated from dogs with pyoderma in Japan. Journal of Veterinary edical Science 7, 6 6. Lautz S, Kanbar T, Alber J, Lammler C, Weiss R, Prenger Berningho E, Zschock (006): Dissemination of the gene encoding exfoliative toxin of Staphylococcus intermedius among strains isolated from dogs during routine microbiological diagnostics. Journal of Veterinary edicine Series B,. Lina G, Quaglia A, Reverdy E, Leclercq R, Vandenesch, Etienne J (): Distribution of genes encoding resistance to macrolides, lincosamides, and streptogramins among staphylococci. Antimicrobial Agents and Chemotherapy, Loeffler A, Linek, oodley A, Guardabassi L, Sung J, Winkler, Weiss R, Lloyd DH (007): irst report of multiresistant, mecapositive Staphylococcus intermedius in Europe: cases from a veterinary dermatology referral clinic in Germany. Veterinary Dermatology,. oodley A, Riley C, Kania SA, Guardabassi L (0): Genome sequence of Staphylococcus pseudintermedius strain E0, an ST7 Europeanassociated methicillinresistant isolate. Genome Announcements. Available at pdf+html Norstrom, Sunde, Tharaldsen H, ork T, Bergsjo B, Kruse H (00): Antimicrobial resistance in Staphylococcus pseudintermedius in the Norwegian dog population. icrobial Drug Resistance,. Onuma K, Tanabe T, Sato H (0): Antimicrobial resistance of Staphylococcus pseudintermedius isolates from healthy dogs and dogs affected with pyoderma in Japan. Veterinary Dermatology, 7.
9 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED Paul NC, Bargman SC, oodley A, Nielsen SS, Guardabassi L (0): Staphylococcus pseudintermedius colonization patterns and strain diversity in healthy dogs: A cross sectional and longitudinal study. Veterinary icrobiology 60, 0 7. Perreten V, Kadlec K, Schwarz S, Andersson UG, inn, Greko C, oodley A, Kania SA, rank LA, Bemis DA, ranco A, Iurescia, Battisti A, Duim B, Wagenaar JA, van Duijkeren E, Weese JS, itzgerald JR, Rossano A, Guardabassi L (00): Clonal spread of methicillinresistant Staphylococcus pseudintermedius in Europe and North America: an international multicentre study. Journal of Antimicrobial Chemotherapy 6,. Ruscher C, LubkeBecker A, Wleklinski CG, Soba A, Wieler LH, Walther B (00): Prevalence of methicillinresistant Staphylococcus pseudintermedius isolated from clinical samples of companion animals and equidaes. Veterinary icrobiology 6, 7 0. Ruscher C, LubkeBecker A, Semmler T, Wleklinski CG, Paasch A, Soba A, Stamm I, Kopp P, Wieler LH, Walther B (00): Widespread rapid emergence of a distinct methicillin and multidrugresistant Staphylococcus pseudintermedius (RSP) genetic lineage in Europe. Veterinary icrobiology, 0 6. Sasaki A, Shimizu A, Kawano J, Wakita Y, Hayashi T, Ootsuki S (00): Characteristics of Staphylococcus intermedius isolates from diseased and healthy dogs. Journal of Veterinary edical Science 67, Schwarz S, Kadlec K, Strommenger B (00): ethicillinresistant Staphylococcus aureus and Staphylococcus pseudintermedius detected in the BfTGermVet monitoring programme in Germany. Journal of Antimicrobial Chemotherapy 6,. Slettemeas JS, ikalsen J, Sunde (00): urther diversity of the Staphylococcus intermedius group and heterogeneity in the boi restriction site used for Staphylococcus intermedius species identification. Journal of Veterinary Diagnostic Investigation, Solyman S, Black CC, Duim B, Perreten V, van Duijkeren E, Wagenaar JA, Eberlein LC, Sadeghi LN, Videla R, Bemis DA, Kania SA (0): ultilocus sequence typing for characterization of Staphylococcus pseudintermedius. Journal of Clinical icrobiology, Stepan J, Pantucek R, Ruzickova V, Rosypal S, Hajek V, Doskar J (00): Identification of Staphylococcus aureus based on PCR amplification of species specific genomic 6 bp sequence derived from a common kb SmaI restriction fragment. olecular Cellular Probes, 7. Svec P, Pantucek R, Petras P, Sedlacek I, Novakova D (00): Identification of Staphylococcus spp. using (GTG) PCR fingerprinting. Systematic and Applied icrobiology, 6. Tanabe T, Toyoguchi, Hirano, Chiba, Onuma K, Sato H (0): Prevalence of staphylococcal enterotoxins in Staphylococcus pseudintermedius isolates from dogs with pyoderma and healthy dogs. icrobiology and Immunology 7, 6 6. Weese JS (0): Phenotypic identification of Staphylococcus intermedius may be inaccurate. Journal of Clinical icrobiology, 7 7. Yoon JW, Lee GJ, Lee SY, Park C, Yoo JH, Park H (00): Prevalence of genes for enterotoxins, toxic shock syndrome toxin and exfoliative toxin among clinical isolates of Staphylococcus pseudintermedius from canine origin. Veterinary Dermatology,. Received: June, 06 Accepted after corrections: December, 06
Int.J.Curr.Microbiol.App.Sci (2018) 7(8):
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 08 (2018) Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2018.708.378
More informationCharacterization of Staphylococcus pseudintermedius isolated from diseased dogs in Lithuania
Polish Journal of Veterinary Sciences Vol. 19, No. 1 (2016), 7 14 DOI 10.1515/pjvs-2016-0002 Original article Characterization of Staphylococcus pseudintermedius isolated from diseased dogs in Lithuania
More informationProceedings of the Southern European Veterinary Conference - SEVC -
www.ivis.org Proceedings of the Southern European Veterinary Conference - SEVC - Sep. 29-Oct. 2, 2011, Barcelona, Spain Next SEVC Conference: Oct. 18-21, 2012 - Barcelona, Spain Reprinted in the IVIS website
More informationCharacterization of Methicillin-Resistant Staphylococcus pseudintermedius Isolated from Dogs in Veterinary Hospitals in Korea
Characterization of Methicillin-Resistant Staphylococcus pseudintermedius Isolated from Dogs in Veterinary Hospitals in Korea Chan Hee Lee 1 Young Kyung Park 1 Sook Shin 1 Yong Ho Park 1 * Kun Taek Park
More informationReflection paper on meticillin-resistant Staphylococcus pseudintermedius
20 September 2010 EMA/CVMP/SAGAM/736964/2009 Committee for Medicinal Products for Veterinary Use (CVMP) Reflection paper on meticillin-resistant Staphylococcus pseudintermedius Agreed by SAGAM (Scientific
More informationStaphylococcus pseudintermedius: Population Genetics and Antimicrobial Resistance
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange Masters Theses Graduate School 5-2013 Staphylococcus pseudintermedius: Population Genetics and Antimicrobial Resistance
More informationMethicillin-Resistant Staphylococcus aureus
Methicillin-Resistant Staphylococcus aureus By Karla Givens Means of Transmission and Usual Reservoirs Staphylococcus aureus is part of normal flora and can be found on the skin and in the noses of one
More informationPrevalence & Risk Factors For MRSA. For Vets
For Vets General Information Staphylococcus aureus is a Gram-positive, aerobic commensal bacterium of humans that is carried in the anterior nares of approximately 30% of the general population. It is
More informationMethicillin-resistant Staphylococcus pseudintermedius Clonal Groups Isolated from Canine Pyoderma in Brazil
Acta Scientiae Veterinariae, 2015. 43: 1338. RESEARCH ARTICLE Pub. 1338 ISSN 1679-9216 Methicillin-resistant Staphylococcus pseudintermedius Clonal Groups Isolated from Canine Pyoderma in Brazil Graciela
More informationMRSA surveillance 2014: Poultry
Vicky Jasson MRSA surveillance 2014: Poultry 1. Introduction In the framework of the FASFC surveillance, a surveillance of MRSA in poultry has been executed in order to determine the prevalence and diversity
More informationNasal Carriage Rates of Methicillin Resistant Staphylococcus aureus in Healthy Individuals from a Rural Community in Southeastern United States
World Journal of Medical Sciences 4 (2): 65-69, 2009 ISSN 1817-3055 IDOSI Publications, 2009 Nasal Carriage Rates of Methicillin Resistant Staphylococcus aureus in Healthy Individuals from a Rural Community
More informationABSTRACT. In the paper, there are 56 figures and 33 tables, and the thesis was documented with a total of 164 references.
ABSTRACT The doctoral thesis entitled Studies Regarding the Laboratory Diagnosis, Classical and Nonconventional Therapy of Dermatitis with Bacterial Substrate in Dogs and Cats consists of 136 pages and,
More informationFirst there was Staphylococcus intermedius.
What is Staphylococcus pseudintermedius Andrew Hillier BVSc, MACVSc, Dipl. ACVD The Ohio State University First there was Staphylococcus intermedius. Hillier Cremona March 2011 1 Then came Staphylococcus
More informationOntario Breeders Association Fri, Mar 3, 2017 to Sun, Mar 5, 2017 JUDGING SCHEDULE
Ontario Breeders Association Fri, Mar 3, 2017 to Sun, Mar 5, 2017 JUDGING SCHEDULE LINDSAY CENTRAL EXHIBITION GROUNDS THE COMMONWELL MUTUAL BUILDING 354 Angeline Street South, Lindsay, ON K9V 4W9 Please
More informationPresence of extended spectrum β-lactamase producing Escherichia coli in
1 2 Presence of extended spectrum β-lactamase producing Escherichia coli in wild geese 3 4 5 A. Garmyn* 1, F. Haesebrouck 1, T. Hellebuyck 1, A. Smet 1, F. Pasmans 1, P. Butaye 2, A. Martel 1 6 7 8 9 10
More informationDetection of Methicillin Resistant Strains of Staphylococcus aureus Using Phenotypic and Genotypic Methods in a Tertiary Care Hospital
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 7 (2017) pp. 4008-4014 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.607.415
More informationPlease include the dog breed and whether the dog was recovered for each case.
Freedom of Information Request Reference No: I note you seek access to the following information: How many dogs were reported stolen in 2013? Please include the dog breed and whether the dog was recovered
More informationState Veterinary Institute Olomouc, Czech Republic 2. National Institute of Public Health, Prague, Czech Republic 4
ACTA VET. BRNO 2012, 81: 219 223; doi:10.2754/avb201281030219 Occurrence and characteristic of methicillin-resistant Staphylococcus aureus on pig farms in the Czech Republic Jan Bardoň 1,2, Milan Kolář
More informationSCOTTISH MRSA REFERENCE LABORATORY
Title SCOTTISH MRSA REFERENCE LABORATORY LABORATORY PROCEDURE NUMBER / VERSION User Manual DATE OF ISSUE 20/01/2017 REVIEW INTERVAL AUTHORISED BY AUTHOR 1 Year Dr. B. Jones Dr E. Dickson COPY 1 of 1 Master
More informationMalaysian Journal of Microbiology
Malaysian Journal of Microbiology, Vol XX(X) 201x, pp. XXX-XXX Malaysian Journal of Microbiology Published by Malaysian Society for Microbiology (In since 2011) Antibiotic resistance profiles of Staphylococcus
More informationStaphylococcus aureus
Staphylococcus aureus Significant human pathogen. SSTI Biomaterial related infections Osteomyelitis Endocarditis Toxin mediated diseases TSST Staphylococcal enterotoxins Quintessential Pathogen? Nizet
More informationSignificant human pathogen. SSTI Biomaterial related infections Osteomyelitis Endocarditis Toxin mediated diseases TSST Staphylococcal enterotoxins
Staphylococcus aureus Significant human pathogen. SSTI Biomaterial related infections Osteomyelitis Endocarditis Toxin mediated diseases TSST Staphylococcal enterotoxins Quintessential Pathogen? Nizet
More informationBiomedical Science, Murdoch University, Murdoch, WA, Australia. Royal Perth Hospital, Wellington Street, Perth, WA, Australia
Journal of Medical Microbiology (2014), 63, 1228 1233 DOI 10.1099/jmm.0.076117-0 Characterization of meticillin-resistant and meticillin-susceptible isolates of Staphylococcus pseudintermedius from cases
More informationKUSA Statistics. Page 1
Statistics for Calender years 2016 and 2017 Breed 2017 2016 1 BULLDOG 1317 1278 2 ROTTWEILER 1188 1140 3 BULL TERRIER 889 855 4 STAFFORDSHIRE BULL TERRIER 878 908 5 RETRIEVER (LABRADOR) 774 1144 6 RETRIEVER
More informationFRIDAY, FEBRUARY 22, 2019 SATURDAY, FEBRUARY 23, 2019 SUNDAY, FEBRUARY 24, 2019
JUDGING SCHEDULE ANNUAL ALL BREED CHAMPIONSHIP DOG SHOWS OXFORD AUDITORIUM 875 Nellis Street Woodstock, Ontario FRIDAY, FEBRUARY 22, 2019 SATURDAY, FEBRUARY 23, 2019 SUNDAY, FEBRUARY 24, 2019 NO PRIVATE
More informationMethicillin-resistant Staphylococcus aureus (MRSA) on Belgian pig farms
Methicillinresistant Staphylococcus aureus (MRSA) on Belgian pig farms Dewaele I., De Man I., Stael A., Delputte P., Butaye P., Vlaemynck G., Herman L., Heyndrickx M., Rasschaert G. 1 ILVO: Institute for
More informationSALON 4 Week 6 Week New/Over 6 Week. MOBILE Affenpinscher Clipdown/Scissor Full Service Bath
Affenpinscher Clipdown/Scissor 38.00 42.00 46.00 60.00 Afghan Hound Bath & Comb 95.00+ 105.00+ 120.00+ 150.00+ Clipdown 82.00 95.00 115.00 Scissor 95.00+ 105.00+ 120.00+ 150.00+ Full Service Bath 40.00
More informationCornwall District Kennel Club Thursday, August 30, 2018 to Sunday, September 2, 2018 JUDGING SCHEDULE
Cornwall District Kennel Club Thursday, August 30, 2018 to Sunday, September 2, 2018 JUDGING SCHEDULE Farran Park 14704 County Road 2 Ingleside, Ontario Conformation - Thursday, August 30, 2018 12:00 PM
More informationFRIDAY, MARCH 8, 2019 SATURDAY, MARCH 9, 2019 SUNDAY, MARCH 10, 2019
JUDGING SCHEDULE FRIDAY, MARCH 8, 2019 SATURDAY, MARCH 9, 2019 SUNDAY, MARCH 10, 2019 Orangeville Agriculture Building Orangeville Fairgrounds, 247090 5th Sideroad, Mono ON THE BUILDING WILL BE OPEN TO
More informationSCOTTISH MRSA REFERENCE LABORATORY
Title SCOTTISH MRSA REFERENCE LABORATORY LABORATORY PROCEDURE NUMBER / VERSION User Manual DATE OF ISSUE 17/05/2014 REVIEW INTERVAL AUTHORISED BY AUTHOR 2 Years Dr. B. Jones B. Cosgrove COPY 1 of 1 Master
More informationLIMESTONE CITY OBEDIENCE AND KENNEL CLUB MAP
LIMESTONE CITY OBEDIENCE AND KENNEL CLUB MAP THURSDAY, JULY 22, 2010 RING 1 - Judge: Mr. T. Burke 10:00 a.m. 4 Boston Terrier 1-3-0-0 3 Chinese Shar-Pei 1-1-0-1 1 Chow Chow 0-0-1-0 1 Dalmatian 0-0-1-0
More informationMicrobiological Surveillance of Methicillin Resistant Staphylococcus aureus (MRSA) in Belgian Hospitals in 2003
Microbiological Surveillance of Methicillin Resistant Staphylococcus aureus (MRSA) in Belgian Hospitals in 3 Final report Olivier Denis and Marc J. Struelens Reference Laboratory for Staphylococci Department
More informationL HORAIRE JUDGING SCHEDULE
United Kennel Club Inc. vendredi le 2 novembre à dimanche le 4 novembre Friday, November 2, 2018 to Sunday, November 4, 2018 L HORAIRE JUDGING SCHEDULE Complexe Sportif St-Lazare 1850, rue des Loisirs
More informationINCIDENCE OF MUPIROCIN RESISTANCE IN STAPHYLOCOCCUS PSEUDINTERMEDIUS ISOLATED FROM A HEALTHY DOG. A Thesis STACEY MARIE GODBEER
INCIDENCE OF MUPIROCIN RESISTANCE IN STAPHYLOCOCCUS PSEUDINTERMEDIUS ISOLATED FROM A HEALTHY DOG A Thesis by STACEY MARIE GODBEER Submitted to the Office of Graduate Studies of Texas A&M University in
More informationSALON 4 Week 6 Week New/Over 6 Week Affenpinscher Clipdown/Scissor Full Service Bath 25.00
Affenpinscher Clipdown/Scissor 42.00 46.00 51.00 Afghan Hound Bath & Comb 105.00+ 115.00+ 132.00+ Clipdown 83.00 90.00 105.00 Scissor 105.00+ 116.00+ 132.00+ Airedale Terrier Clipdown 72.00 79.00 90.00
More informationResearch Article Genotyping of Methicillin Resistant Staphylococcus aureus Strains Isolated from Hospitalized Children
International Pediatrics, Article ID 314316, 4 pages http://dx.doi.org/10.1155/2014/314316 Research Article Genotyping of Methicillin Resistant Staphylococcus aureus Strains Isolated from Hospitalized
More informationTable of Contents. Parts of a Dog 8. External Parts 9. Internal Organs 10. Skeletal Parts
Table of Contents Information and Rules Breed Identification 1. Herding Group 2. Hound Group 3. Non-Sporting Group 4. Sporting Group 5. Terrier Group 6. Toy Group 7. Working Group Parts of a Dog 8. External
More informationEscapes at the Ledges Owners Association Pet Policy Amendment
Escapes at the Ledges Owners Association Pet Policy Amendment Pet Limitation. No animal shall be raised, bred, or kept in any Unit, except that of usual household pets such as domestic dogs, cats, fish,
More informationAPRIL 5, 6 & 7, 2013
THE RED DEER AND DISTRICT KENNEL CLUB Our 26 th, 27 th, & 2 th Annual Shows 3 ALL BREED CHAMPIONSHIP SHOWS 3 LICENSED OBEDIENCE TRIALS 3 LICENSED RALLY O TRIALS APRIL 5, 6 & 7, 203 FEATURING: Thursday
More informationAntimicrobial Resistance and Molecular Epidemiology of Staphylococcus aureus in Ghana
Antimicrobial Resistance and Molecular Epidemiology of Staphylococcus aureus in Ghana Beverly Egyir, PhD Noguchi Memorial Institute for Medical Research Bacteriology Department, University of Ghana Background
More informationStaphylococcus 8/30/2011. The Genus Staphylococcus. Cell wall. S. aureus. + - Bunch of grapes + berry. Gram-positive aerobic cocci
The Genus Staphylococcus Gram-positive aerobic cocci Staphylococcus Staphylococcus: Micrococcus Peptidococcus Pediococcus Catalase (2H2O2 2H2O + O2) + - Bunch of grapes + berry You will learn soon S. aureus
More informationSupplemental Information. A Deletion in the Canine POMC Gene. Is Associated with Weight and Appetite. in Obesity-Prone Labrador Retriever Dogs
Cell Metabolism, Volume 23 Supplemental Information A Deletion in the Canine POMC Gene Is Associated with Weight and Appetite in Obesity-Prone Labrador Retriever Dogs Eleanor Raffan, Rowena J. Dennis,
More informationWildwood Kennel Club Thursday, February 7, 2019 to Sunday, February 10, 2019 JUDGING SCHEDULE
Wildwood Kennel Club Thursday, February 7, 2019 to Sunday, February 10, 2019 JUDGING SCHEDULE WOODSTOCK FAIRGROUNDS 875 Nellis Street Woodstock, Ontario N4S 4C6 The building will be open for handlers/exhibitors
More informationSOUTH WALES KENNEL ASSOCIATION. 7th - 9th October 2016
SOUTH WALES KENNEL ASSOCIATION 7th - 9th October 2016 SUMMARY OF ENTRIES GUNDOG GROUP Bracco Italiano 24 33 Brittany 15 17 English Setter 63 78 German Shorthaired Pointer 45 64 German Wirehaired Pointer
More informationEDUCATIONAL COMMENTARY - Methicillin-Resistant Staphylococcus aureus: An Update
EDUCATIONAL COMMENTARY - Methicillin-Resistant Staphylococcus aureus: An Update Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain
More informationSOUTH WALES KENNEL ASSOCIATION. 6th - 8th October 2017
SOUTH WALES KENNEL ASSOCIATION 6th - 8th October 2017 SUMMARY OF ENTRIES HOUND GROUP Afghan Hound 70 82 Basenji 2 2 Basset Fauve de Bretagne 17 29 Basset Griffon Vendeen (Grand) 12 16 Basset Griffon Vendeen
More informationHochelaga Kennel Club Samedi le 19 mai à lundi le 21 mai, 2018 Saturday, May 19, 2018 to Monday, May 21, 2018 JUDGING SCHEDULE
Hochelaga Kennel Club Samedi le 19 mai à lundi le 21 mai, 2018 Saturday, May 19, 2018 to Monday, May 21, 2018 JUDGING SCHEDULE Complexe Sportif St-Lazare 1850, rue des Loisirs St-Lazare, Quebec J7T 3B4
More informationKINGSTON & DISTRICT KENNEL CLUB
Friday, June 15 #1 GROUP 1 - RING 1 8:00 am 1 Griffon (WHP) 1-0-0-0 3 Pointers 0-0-1-2 4 Retriever (Flat-Coat) 0-3-1-0 5 Retriever (Golden) 2-1-1-1 4 Retriever (Labrador) 3-1-0-0 1 Retriever (NSDT) 0-0-1-0
More informationJUDGING SCHEDULE. Friday, September 9, 2016 Saturday, September 10, 2016 Sunday, September 11, 2016
JUDGING SCHEDULE Friday, September 9, 2016 Saturday, September 10, 2016 Sunday, September 11, 2016 INTERNATIONAL CENTRE - HALLS 3 & 4 6900 Airport Road, Mississauga ON The site will be open for exhibitors
More information1HP 110V AC 10 A (MAX) 60 cm 20 kg 41 cm x 73.5 cm 1-12 km/hr NO NO YES (Infra-red spectrum) 53 cm x 110 cm x 38 cm 63 cm x 119 cm x 27 cm 28.
PR700 SMALL The PR 700 is recommended for small dogs, less than 24 long and weighing up to 44lbs. $589.00 60 cm 20 kg 41 cm x 73.5 cm (Infra-red spectrum) 53 cm x 110 cm x 38 cm 63 cm x 119 cm x 27 cm
More informationChanges in the population of methicillin-resistant Staphylococcus pseudintermedius and the
JCM Accepted Manuscript Posted Online 18 November 2015 J. Clin. Microbiol. doi:10.1128/jcm.01288-15 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 2 Changes in the population
More informationBreed Bath Face Feet Fanny Full Body Cut
Bath Includes: Wash, Toenail Trim, Ear Care, and Anal Glands Face Feet & Fanny Includes: Wash, Toenail Trim, Ear Care, Anal Glands, Face, Feet, and Fanny trim Full Body Cut Includes: Wash, Toenail Trim,
More informationFCI group: 1. Kyivska Rus Crystal Cup of Ukraine 2018
FCI group: 1 BORDER COLLIE 5 4 9 MAREMMA AND THE ABRUZZES SHEEPDOG 9 11 20 WELSH CORGI PEMBROKE 39 31 70 SLOVAKIAN CHUVACH 1 1 2 GERMAN SHEPHERD DOG / Long coat 9 14 23 AUSTRALIAN SHEPHERD 7 3 10 GERMAN
More informationPLEASE WATCH FOR YOUR BREED JUDGING. SOME BREEDS ARE NOT JUDGED WITH THEIR GROUPS
Official Judging Schedule KAMLOOPS & DISTRICT KENNEL CLUB 47th Annual Show AUGUST 29, 30, 31, SEPTEMBER 1, 2014 4 All Breed Championship Shows Flat Coat Retriever Club Canada National Specialty Afghan
More informationNovember 6, 7 & 8, 2015
THE RED DEER AND DISTRICT KENNEL CLUB Our 23 st, 232 nd & 233 rd Annual Shows 3 ALL BREED CHAMPIONSHIP SHOWS 3 LICENSED OBEDIENCE TRIALS 3 LICENSED RALLY O TRIALS November 6, 7 & 8, 205 FEATURING: RDDKC
More informationMarch 23, 24 and 25, 2018 in Camrose, Alberta
Official Judging Schedule Battle River Canine Association March 23, 24 and 25, 2018 in Camrose, Alberta All-breed Championship Shows (Fri, Sat, & Sunday) All-breed Obedience Trials (Fri, Sat, & Sunday)
More informationDetection of inducible clindamycin resistance among clinical isolates of Staphylococcus aureus in a tertiary care hospital
ISSN: 2319-7706 Volume 3 Number 9 (2014) pp. 689-694 http://www.ijcmas.com Original Research Article Detection of inducible clindamycin resistance among clinical isolates of Staphylococcus aureus in a
More informationOBEDIENCE OVERLOAD ON SATURDAY Please see attached Judging Schedule Per rules withdrawn entries must be received prior to start of trial
JUDGING SCHEDULE BATTLE RIVER CANINE ASSOCIATION OCTOBER 26, 27 & 28, 2012 CAROSE REGIONAL EXHIBITION East end of Camrose on Highway 13 Camrose, Alberta BOOSTERS American Cocker Spaniel Club of Canada
More informationEVELYN KENNY KENNEL & OBEDIENCE CLUB THREE ALL BREED CHAMPIONSHIP SHOWS February 4, 5, and 6, 2011 held at the Big Four Building, Stampede Park
EVELYN KENNY KENNEL & OBEDIENCE CLUB THREE ALL BREED CHAMPIONSHIP SHOWS February 4, 5, and 6, 2011 held at the Big Four Building, Stampede Park along Macleod Trail between 12 Avenue S.E. and 25 Avenue
More informationBurn Infection & Laboratory Diagnosis
Burn Infection & Laboratory Diagnosis Introduction Burns are one the most common forms of trauma. 2 million fires each years 1.2 million people with burn injuries 100000 hospitalization 5000 patients die
More information2) If recorded, the breed of dog stolen and numbers for each breed for 2016 (1 January 1 December) and in 2017 from (1 January to 30 September.
Freedom of Information Request Reference No: I note you seek access to the following information: 1) The number of stolen pets OR crimes reported involving stolen pets in 2016 (1 January 31 December) and
More informationOfficial Judging Schedule THREE ALL BREED CHAMPIONSHIP SHOWS. We re back at our old show grounds!!! * NUNNS CREEK PARK * July 30, 31 & August 1, 2011
Official Judging Schedule THREE ALL BREED CHAMPIONSHIP SHOWS We re back at our old show grounds!!! * NUNNS CREEK PARK * July 30, 31 & August 1, 2011 Juvenile Sweepstakes 2 Junior Males 3 Senior Males Sunday,
More informationAnnual survey of methicillin-resistant Staphylococcus aureus (MRSA), 2015
Annual survey of methicillin-resistant Staphylococcus aureus (MRSA), 2015 Helen Heffernan and Sarah Bakker Nosocomial Infections Laboratory, Institute of Environmental Science and Research Limited (ESR);
More informationChamplain Dog Club. Friday, Apr 21, 2017 to Sunday, Apr 23, 2017 JUDGING SCHEDULE. Petawawa Civic Centre 16 Civic Centre Rd Petawawa, Ontario K8H 3H5
Champlain Dog Club Friday, Apr 21, 2017 to Sunday, Apr 23, 2017 JUDGING SCHEDULE Petawawa Civic Centre 16 Civic Centre Rd Petawawa, Ontario K8H 3H5 1 Conformation - Friday, April 21, 2017 - Show #1 Group
More informationJanet Allen Elliott Weiss Mary Ann Alston Jean Fournier Peggy Haas Elaine Mathis Robert Indeglia Chris Walkowicz Janet Allen Elliott Weiss
Sunday, December 12, 2010 Best in Show Group 1 (Sporting) Group 2 (Hound) Group 3 (Working) Group 4 (Terrier) Group 5 (Toy) Group 6 (Non-Sporting) Group 7 (Herding) Misc. Class Junior Showmanship Sporting
More informationDistribution of coagulase-positive staphylococci in humans and dogs. Jurate Sleiniute, Jurate Siugzdaite
ACTA VET. BRNO 2015, 84: 313 320; doi:10.2754/avb201584040313 Distribution of coagulase-positive staphylococci in humans and dogs Jurate Sleiniute, Jurate Siugzdaite Lithuanian University of Health Sciences,
More informationTested in 15 years Tested in Breed
Dog Health Group report 2014 HIP SCORES BY BREED Data Calculated to 01/11/14 The following is an annual summary that is now prepared for the BVA, covering all breeds, using data from the current approximated
More informationArnprior Canine Association Fri, May 12, 2017 to Sun, May 14, 2017 JUDGING SCHEDULE. NICK SMITH CENTER 77 James St.
Arnprior Canine Association Fri, May 12, 2017 to Sun, May 14, 2017 JUDGING SCHEDULE NICK SMITH CENTER 77 James St. Arnprior, Ontario Sanction Match Sponsored by OVASA Saturday following BIS CANADA 150
More informationCa-MRSA Update- Hand Infections. Washington Hand Society September 19, 2007
Ca-MRSA Update- Hand Infections Washington Hand Society September 19, 2007 Resistant Staph. Aureus Late 1940 s -50% S.Aureus resistant to PCN 1957-80/81 strain- of S.A. highly virulent and easily transmissible
More informationOfficial Judging Schedule SEPTEMBER 4, 5, 6 & 7, All Breed Championship Shows
Official Judging Schedule KAMLOOPS & DISTRICT KENNEL CLUB 48th Annual Show SEPTEMBER 4, 5, 6 & 7, 2015 4 All Breed Championship Shows Rhodesian Ridgeback Club of British Columbia Regional Specialty Dogwood
More informationAbsence of LA-MRSA CC398 as nasal colonizer of pigs raised
AEM Accepts, published online ahead of print on 9 December 2011 Appl. Environ. Microbiol. doi:10.1128/aem.07260-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationJudging Schedule Saturday & Sunday March 22, 23, 2014 St. Clair College of Applied Arts & Technology, 2000 Talbot Rd. W., Windsor, Ontario.
WINDSOR ALL BREED T & T CLUB Judging Schedule Saturday & Sunday March 22, 23, 2014 St. Clair College of Applied Arts & Technology, 2000 Talbot Rd. W., Windsor, Ontario. Canada DIRECTIONS TO THE SHOW SITE
More informationTitle. CitationJapanese Journal of Veterinary Research, 62(4): 163- Issue Date DOI. Doc URL. Type. File Information /jjvr.62.4.
Title Characterization of methicillin-resistant Staphyloco Author(s)Jang, Yunho; Bae, Dong hwa; Cho, Jae-Keun; Bahk, Gyu CitationJapanese Journal of Veterinary Research, 62(4): 163- Issue Date 2014-11
More informationJUDGING SCHEDULE FRIDAY, SEPTEMBER 21, 2018 SATURDAY, SEPTEMBER 22, 2018 SUNDAY, SEPTEMBER 23, 2018
JUDGING SCHEDULE FRIDAY, SEPTEMBER 21, 2018 SUNDAY, SEPTEMBER 23, 2018 WEST NIAGARA FAIRGROUNDS 7402 Mud Street Grassie, Ontario L0R 1M0 SHOW SECRETARY MJN Show Services 9 Samya Court Scarborough ON M1R
More informationTerrier AIRDALE TERRIER
AFFENPINSCHER Toy Hound AFGHAN HOUND Terrier AIRDALE TERRIER Working AKITA Working Alaskan Malamute Non-Sporting AMERICAN ESKIMO DOG AMERICAN STAFFORDSHIRE TERRIER Terrier Sporting AMERICAN WATER SPANIEL
More informationGROUP No. 1 SPORTING BREEDS. GROUP No. 1 SPORTING BREEDS
No. 1 SPORTING BREEDS No. 1 SPORTING BREEDS BARBET BRAQUE FRANCAIS GRIFFON (Wiredhaired Pointing) KLEINER MUNSTERLANDER LAGOTTO ROMAGNOLO POINTER POINTER (German Longhaired) POINTER (German Shorthaired)
More informationMethicillin and Clindamycin resistance in biofilm producing staphylococcus aureus isolated from clinical specimens
Original article Methicillin and Clindamycin resistance in biofilm producing staphylococcus aureus isolated from clinical specimens Pankaj A. Joshi, Dhruv K.Mamtora,. Neeta PJangale., Meena N.Ramteerthakar,
More information"SPOOKTACULAR EVENT "
Official Judging Schedule Battle River Canine Association (These events held under The Rules of the Canadian Kennel Club Unbenched and unexamined) October 27, 28, and 29, 2017 in Camrose, Alberta Lets
More informationDog Grooming Prices. The price range I give you is only valid if the dog is groomed on a regular basis of
Dog Grooming Prices The price range I give you is only valid if the dog is groomed on a regular basis of at least every 6-8 weeks. If the dog isn t groomed regularly then the price will be adjusted according
More informationWendy & Richard Paquette Box 640 Azilda ON P0M 1B0 Canada
FCI GROUPS As of November 2005 Group 1 SHEEPDOGS AND CATTLE DOGS (except Swiss Cattle Dogs) & Paquette wenrick@wenrick.ca Box 640 Azilda ON P0M 1B0 Canada Australian Kelpie Corgi (Pembroke) Australian
More informationSTATISTICS 01 SEPTEMBER AUGUST 2017
STATISTICS 0 SEPTEMBER 206 3 AUGUST 207 TOP 0 REGISTERED BREEDS BREED 206/207 205/206 204/205 203/204 202/203 20/202 200/20 2009/200 2008/2009 BULLDOG 278 35() 244(2) 66(2) 093(4) 20(3) 275(3) 46(3) 475(3)
More informationTHE ROYAL COLLEGE OF VETERINARY SURGEONS DIPLOMA EXAMINATION IN VETERINARY DERMATOLOGY. Tuesday 22 August PAPER 1 (3 hours)
DIPLOMA EXAMINATION IN VETERINARY DERMATOLOGY Tuesday 22 August 2000 PAPER 1 Candidates are required to answer FOUR questions only. 1. What is meant by the term staphylococcal virulence factors. Indicate
More informationKilbride & District Kennel Club Friday, August 10, 2018 to Monday, August 13, 2018 JUDGING SCHEDULE
Kilbride & District Kennel Club Friday, August 10, 2018 to Monday, August 13, 2018 JUDGING SCHEDULE CALEDONIA FAIRGROUNDS 151 Caithness Street East, Caledonia, Ontario N3W 1C2 Kilbride & District Kennel
More informationL HORAIRE JUDGING SCHEDULE
Societe Canine De Quebec Inc. Vendredi le 3 août à Dimanche le 5 août, 2018 Friday, August 3, 2018 to Sunday, August 5, 2018 L HORAIRE JUDGING SCHEDULE Base de Plein Air de Saint-Foy 3180 Rue Laberge Saint-Foy,
More informationNANAIMO KENNEL CLUB JUDGING SCHEDULE JUNE 16, 17, 18, 19, 2016
NANAIMO KENNEL CLUB JUDGING SCHEDULE JUNE 16, 17, 18, 19, 2016 ARBUTUS MEADOWS EQUESTRIAN CENTRE 1515 Island Hwy E, E Nanoose Bay Regional District of Nanaimo, BC V9P 9A3 ON SITE FOOD VENDORS: Sau with
More informationDOG GROOMING PRICES. Each dog will be assessed on an individual basis and prices adjusted accordingly.
DOG GROOMING PRICES The price list is only a guideline, and prices may vary depending on several contributing factors. e.g: the size of your dog, coat condition, and behaviour. These factors all add to
More information213 Setter, Black & White. 975 Shih-Tzu - Red & White. 978 Staffordshire Bull Terrier Blk & White. 214 Setter, Brown & White
213 Setter, Black & White 214 Setter, Brown & White 725 Great Dane, Fawn-Uncropped 900 Bassett Hound - Tricolor 903 Bearded Collie Blue/Wh Blk/White 906 Border Terrier - Grizzle 909 Border Terrier - Wheaton
More informationAnnual survey of methicillin-resistant Staphylococcus aureus (MRSA), 2014
Annual survey of methicillin-resistant Staphylococcus aureus (MRSA), 2014 Helen Heffernan, Sarah Bakker, Kristin Dyet, Deborah Williamson Nosocomial Infections Laboratory, Institute of Environmental Science
More information1 ページ. Supplementary Table 1 The Number of each breed and sex in Japan and the United States
Comparison of owner-reported behavioral characteristics among genetically clustered breeds of dog (Canis familiaris). Akiko Tonoike, Miho Nagasawa, Kazutaka Mogi, James A. Serpell, Hisashi Ohtsuki, Takefumi
More information213 Setter, Black & White. 975 Shih-Tzu - Red & White. 978 Staffordshire Bull Terrier Blk & White. 214 Setter, Brown & White
213 Setter, Black & White 214 Setter, Brown & White 725 Great Dane, Fawn-Uncropped 900 Bassett Hound - Tricolor 903 Bearded Collie Blue/Wh Blk/White 906 Border Terrier - Grizzle 909 Border Terrier - Wheaton
More informationCharacterization of SCCmec elements in methicillin resistant S. intermedius in healthy pets from Southeastern United States
International Scholars Journals African Journal of Infectious Diseases Research ISSN 4729-6836 Vol. 3 (5), pp. 120-124, December, 2016. Available online at www.internationalscholarsjournals.org International
More informationOntario County Kennel Club Friday, June 8, 2018 to Sunday, June 10, 2018 JUDGING SCHEDULE. ORONO FAIRGROUNDS 2 Princess St. Orono, Ontario L0B 1M0
Ontario County Kennel Club Friday, June 8, 2018 to Sunday, June 10, 2018 JUDGING SCHEDULE ORONO FAIRGROUNDS 2 Princess St. Orono, Ontario L0B 1M0 Eastlake Cavalier Club All Breed Sanction Match Friday,
More informationThursday, February 5, 2015 Friday, February 6, 2015 Saturday, February 7, 2015 Sunday, February 8, 2015
JUDGING SCHEDULE OXFORD AUDITORIUM WOODSTOCK FAIRGROUNDS 875 Nellis Street, Woodstock, Ontario Thursday, February 5, 2015 Friday, February 6, 2015 Saturday, February 7, 2015 Sunday, February 8, 2015 BRED
More informationSCOTTISH KENNEL CLUB. 18th - 20th May 2018
SCOTTISH KENNEL CLUB 18th - 20th May 2018 SUMMARY OF ENTRIES WORKING GROUP Alaskan Malamute 46 54 Bernese Mountain Dog 43 46 Bouvier des Flandres 17 22 Boxer 121 131 Bullmastiff 29 33 Canadian Eskimo Dog
More informationOfficial Judging Schedule For
Official Judging Schedule For Elsie Murray Canine Centre Society Two All Breed Championship Shows November 12 & 13, 2017 Two All Breed Licenced Obedience Trials November 11 & 12, 2017 Junior Handling Held
More informationPaw Prints - Mobile Grooming Starting Rates + Add $5 Travel Fee
Paw Prints - Mobile Grooming Starting Rates + Add Travel Fee Updated 1/1/2017 Breed Bath Basic Full Shed Less Breed Bath Basic Full Shed Less Affenpinscher 5 $60 $65 Chihuahua - Long Hair 0 5 $65 Afghan
More informationBermuda Domestic Animal Registry Counts of Live Dogs and Cats, in Bermuda, by Breed
GOVERNMENT OF BERMUDA Ministry of Health and Environment Department of Environmental Protection Dogs Unspecified 302 3.7% Affenpinscher 1 0.0% Afghan 1 0.0% Airedale Terrier 14 0.2% Akita 23 0.3% Alaskan
More informationTues., Fri., Sun. Phone (785)
Grooming Pricing Hours of Operation for Grooming Mon., Wed., Thurs. 11 am-6 pm Sat. 11 am-4 pm Tues., Fri., Sun. Closed Phone (785) 242-2967 #1 : Wash, Toenail Trim, Ear Care, and Anal Glands #2: Wash,
More informationNational MRSA Reference Laboratory
Author: Gráinne Brennan Date: 23/02/2017 Date of Issue: 23/02/2017 National MRSA Reference Laboratory User s Manual NMRSARL Users Manual Page 1 of 12 Table of Contents Page 1. Location... 3 2. Contact
More informationNICOLA VALLEY KENNEL CLUB
Official Judging Schedule NICOLA VALLEY KENNEL CLUB Four All-Breed Championship Shows, Puppy Sweepstakes & Junior Handling Booster BC Labrador Retriever Club (1995) Society Specialty Canadian West Highland
More information