Veterinarni Medicina, 62, 2017 (02): 81 89

Transcription

1 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED Characterisation of methicillinsusceptible Staphylococcus pseudintermedius isolates from canine infections and determination of virulence factors using multiplex PCR O. elter *, P. Svec, J. Tkadlec, J. Doskar, H. Kinska, R. Pantucek nd edical aculty, Charles University, Prague, Czech Republic aculty of Science, asaryk University, Brno, Czech Republic Laboratory of Veterinary edicine (Labvet), Prague, Czech Republic *Corresponding author: ABSTRACT: Staphylococcus pseudintermedius is a genuine opportunistic pathogen of the skin, especially in canids. However, characterisation of virulence, antimicrobial resistance and genotypic variability in methicillinsusceptible S. pseudintermedius isolates has not been fully explored. In this study, coagulasepositive staphylococcal isolates collected from dogs of various breeds and ages suffering from dermatitis (n = 70), pyoderma (n = 7), and otitis (n = 7), from districts of Prague (Czech Republic) and surrounding areas, were characterised using matrixassisted laser desorption/ionisation timeofflight mass spectrometry, and repetitive sequencebased PCR fingerprinting. Susceptibility to antimicrobial agents was determined, virulence factor genes for leukocidin (luksi), exfoliatins (exi, expb, and siet), enterotoxin C (sec canine ) and enterotoxinrelated genes (seint and sel) were detected using multiplex PCR and the genotypes of S. pseudintermedius isolates were determined using SmaI macrorestriction analysis. The majority of the staphylococcal isolates (n = ) were identified as S. pseudintermedius (n = 7) and all of them were susceptible to methicillin/oxacillin (SSP). About half of the strains (n = ) were resistant to macrolidelincosamidestreptogramin B antimicrobial agents and resistance was mediated in all but one of the strains by the erm(b) gene. The genes for luksi, siet, seint, and sel were detected in the majority of the SSP strains (6.%, 00%, 00%, and 7.%, respectively). Investigated canine S. pseudintermedius isolates were highly heterogeneous, which prevented the correlation of any specific lineage to a particular infection, dog breed, or region of origin. Keywords: Staphylococcus pseudintermedius; macrolide lincosamidestreptogramin B (LS B ) resistance; genotyping; virulence genes Staphylococcus pseudintermedius, a pathogen that infects dogs, is comparable to Stapylococcus aureus in humans. This analogy fits not only the phenotypic characteristics (e.g. similar colony morphology, pigment, haemolysis), but is also supported by the striking similarity in ecology/epidemiology (colonisation or infection of the skin and skin adnexa, vertical/horizontal transmission), expression of homologous virulence factors (cell wallanchored proteins such as microbial surface components recognising adhesive matrix molecules; protein A; and enzymes, e.g. coagulase; secreted toxins, such as cytotoxins, exfoliative toxins, or superantigens) and pathogenicity (skin infections or invasive infections). These two coagulasepositive species probably evolved separately through adaptation Supported by the Internal Grant Agency (IGA) of the inistry of Health of the Czech Republic (Grant No. NT /0) and the Institutional Support of otol University Hospital (Prague) for conceptual development of research organization (Grant No ).

2 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED to their respective hosts. Even today, differentiating S. pseudintermedius and S. aureus can pose a problem for diagnostic laboratories (Weese 0). A large proportion of healthy dogs (7%) and the majority of infected dogs (7%) are colonised by S. pseudintermedius (azakerley et al. 00), which also has the potential to be an agent of zoonotic infections (Borjesson et al. 0). In genotyping of S. pseudintermedius, macrorestriction analysis resolved by pulsedfield gel electrophoresis (PGE) has higher discriminatory power than staphylococcal protein A (spa) typing (oodley et al. 0) or multilocus sequence typing (Solyman et al. 0) and, therefore, is currently considered as the most suitable method for the typing of a large collection of isolates. Even though spa typing yields more stable and reproducible results and is thus superior to PGE DNA macrorestriction analysis in the determination of clonality, it is not as effective as the latter method in typing methicillinsusceptible isolates of which more than 0% are nontypeable (Bannoehr and Guardabassi 0). Only a few local studies have been performed on S. pseudintermedius isolates from Eastern and Central Europe, and infectious agents in household pets and the use of antimicrobial agents in these animals require more focus. The goal of the present study was to characterise S. pseudintermedius isolates recovered from dogs varying in breed, sex, and age and coming from various districts of the City of Prague. We here describe a newly developed multiplex PCR assay for determination of virulence factors in such isolates. ATERIAL AND ETHODS Sample collection and bacterial isolates. The dog owners presented their animals to our laboratory for identification of specific infectious agents causing secondary dermatitis or pyoderma. Samples from the affected lesions were collected in 00 using dacron swabs, stored until inoculated onto Columbia blood agar with % Sheep Blood (Oxoid, UK) and cultured in aerobic atmosphere at 7 C. Single canine coagulasepositive staphylococcal isolates (n = ) were cultured from dogs of various breeds and ages suffering from dermatitis (n = 70), pyoderma (n = 7), and otitis (n = 7) to diagnose the specific agents of canine skin or ear infections. The owners of the dogs lived in nine specified Prague City districts (n = 6), an unknown Prague district (n = 0), and surrounding areas (n = ). Samples were collected from dogs of different breeds (n = ) and four crossbred dogs. The reference strains were obtained from the Czech Collection of icroorganisms (asaryk University, Brno). Phenotypic identification. Identification of all isolates was performed using a matrixassisted laser desorption/ionisation timeofflight mass spectrometry ALDITO S system (icroflex T LT/R, database 66, Bruker, Bremen, Germany). Genotypic identification. Genotypic screening of the isolates was performed using reppcr fingerprinting with the (GTG) primer, reported as a suitable tool for the identification of Staphylococcus spp. (Svec et al. 00). The resulting fingerprints were processed using BioNumerics v. 7. software (Appliedaths, Kortrijk, Belgium) and compared to the inhouse (GTG) PCR fingerprints database (Svec et al. 00). Antimicrobial agent susceptibility. Tests for susceptibility to antimicrobial agents were performed using uellerhinton agar (C07, Oxoid, UK) and disks (Oxoid, UK) of oxacillin, cefoxitin, amoxicillin/clavulanic acid, cefalotin, ofloxacin, mupirocin, erythromycin and clindamycin and the disk diffusion method results were interpreted using the criteria of EUCAST ( and strain ATCC S. aureus as a control. Since a large proportion of the isolates were resistant to macrolidelincosamidestreptogramin B (LS B ) antimicrobial agents (erythromycin, clindamycin) the presence of the erm(a), erm(b), erm(c), and msr(a) genes was determined in the resistant isolates (Lina et al. ). acrorestriction analysis of DNA. Electrophoresis was performed using the CHE DR II system (BioRad, California, USA). All S. pseudintermedius isolates (n = 7) were typed using the SmaI restriction endonuclease and PGE in order to assess their population structure. Bacterial DNA was harvested from cultures grown on nutrient agar plates and agarose plugs were prepared according to the manufacturer s recommendations. The SmaI macrorestriction profiles of the isolates were evaluated by visual inspection and the dendrogram was constructed using BioNumerics v. 6. software (Applied aths, Kortrijk, Belgium) with the Dice similarity coefficient and unweighted pair group method with arithmetic mean (UPGA) clustering. An optimisation of.% and a position tolerance of % were allowed in the cluster analysis and calculation of the dendrogram.

3 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED Detection of virulence factor genes. ultiplex PCR assays I and II to detect virulence genes were carried out using a ultiplex PCR kit (Qiagen, Hilden, Germany) in a final volume of µl, which contained µl aliquots of the crude boiledcell lysates. The primers used for the PCR assays were designed specifically for this study as detailed in Table. Primers targeting the S. intermedius group (SIG) thermonuclease gene (si nuc) were used as an internal positive control (Baron et al. 00). The PCR assays were performed using a TGradient thermal cycler (Biometra, Goettingen, Germany) set to the following parameters: cycles of denaturation ( C, 0 s), annealing ( C, 0 s), and extension (7 C, 60 s). The efficiency of the PCR assay was evaluated by performing reactions using 0fold serial dilutions of purified genomic DNA. RESULTS Phenotypic identification Using ALDITO S we identified the majority (n = 7; %) of the staphylococcal isolates (n = ) as S. pseudintermedius and only sporadic isolates as Staphylococcus schleiferi (n = ) and S. aureus (n = ). Species level identification revealed minor differences between the results obtained for the top score corresponding to S. pseudintermedius, and the second match Staphylococcus intermedius. Therefore, reppcr genotypic identification was carried out. S. aureus was identified as described previously (Stepan et al. 00). Genotypic identification using reppcr with the (GTG) primer Numerical analysis of reppcr fingerprints confirmed the identification results obtained by ALDITO S analysis. All S. pseudintermedius isolates revealed visually similar fingerprints matching with the database fingerprint entries for the S. pseudintermedius reference strains and were grouped in a single cluster (igure ). Similarly, S. schleiferi and S. aureus isolates matched the reference fingerprints representing these taxa. oreover, the reppcr analysis of S. schleiferi strains assigned all three isolates as representatives of S. schleiferi subsp. coagulans. Table. Primers used for multiplex PCR assays targeting toxinrelated genes Primer Sequence Product (bp) Primer concentration GenBank accession No. Target gene ultiplex PCR I luksig_ AGCCAATAGTTTTATTATCTGTG lukssig_r AAATTAAAGTAAAGGGGCAT 00n X7 luksi and luki gama haemolysin components exi_ exi_r expb_ expb_r se_sig_ se_sig_r AGTAACAAACTATCACATAGCG TTAACAGGTTATAACGTCCCC AAATTATTTTCACTCCAGCTT CATGTATACCTATTAGTTCCCC CATTTGAAATACAAGCCGAC TGATTAAAATTATTACCCGGTG 0n AB0 exi gene for exfoliative toxin 0n AB607 expb gene for exfoliative toxin n AB67 enterotoxinrelated gene sein ultiplex PCR II et_sig_ et_sig_r sel_sig_ sel_sig_r sec_can_ sec_can_r GATAAAATTTATGCGGGTCCT ATTACTTTCTTCAGGGTCGAA TCTTTTTGTGGTGCCTGA ATGTCTTTATCATTATCCCCA CAGCAACTAAAGTTAAGTCTG ACATACAAGTTTTACCACCT 7 0n AB070 siet gene for exfoliative toxin 06 00n CP00 and CP007 n U6 conserved region of genes SPSINT_00 and SPSE_7 for superantigen like proteins sec canine gene for type C enterotoxin SInuc SInuc CAATGGAGATGGCCCTTTTA AGCGTACACGTTCATCTTG 0n X6767 nuc gene for S. intermedius group thermonuclease

4 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED Similarity (%) Similarity (%) (bp) SP CC SP CC SP CC SP CC SP CC 70 SI CC 7 SI CC 7 olecular size marker igure. Dendrogram based on reppcr fingerprints obtained from S. pseudintermedius (SP) canine isolates and reference strains of S. intermedius (SI) and S. pseudintermedius. The dendrogram was calculated using Pearson s correlation coefficients with the UPGA clustering method (r, expressed as percentage similarity values) Antimicrobial agent resistance and detection of LS B determinants All of the S. pseudintermedius isolates tested were susceptible to methicillin/oxacillin (SSP), amoxicillin/clavulanic acid, cefalotin, and ofloxacin; however, half of the isolates (n = ; %) were constitutively resistant to erythromycin and clindamycin. Testing for the presence of the erm(a), erm(b), erm(c) and msr(a) genes revealed that, in all but one of the isolates, resistance was mediated by erm(b). Only sporadic isolates (n = ) were resistant to mupirocin. acrorestriction analysis of DNA The macrorestriction patterns of 77 typeable isolates of S. pseudintermedius revealed 6 clusters when the similarity threshold value of % proposed by Paul et al. (0) was used (igure ). Closely related isolates from the present study were not breedrelated. Each fingerprint cluster in the present study included from one to six S. pseudintermedius strains. All isolates in our study shared a similarity of higher than 7%. requency and distribution of virulence factors Seven virulence genes were found in this study: the enterotoxinrelated gene seint and the siet gene for exfoliative toxin were detected in all S. pseudintermedius isolates. The genes for twocomponent leukotoxin (luksi and luki) were also frequently detected (n = 76; 6.%). The majority of the analysed isolates (n = ; 7.%) carried another enterotoxinrelated gene, sel. The remaining genes exi, sec canine, and expb were detected in (.%), (6.%), and six (7.6%) isolates, respectively. These genes were found in different combinations, defining different toxinrelated genotypes (igure and Table ). The combination of luksi, seint, siet, and sel was the most common and was detected in.% of the isolates. The distribution of the virulence genes in relation to clinical diagnosis was not statistically evaluated due to the relatively high number of different combinations of toxin genes and the small numbers of isolates from pyoderma and otitis cases. Genotyping revealed that more

5 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED Similarity (%) igure. Dendrogram illustrating the similarity (based on the Dice coefficients and UPGA clustering) of SmaI macrorestriction profiles (PGE) of S. pseudintermedius canine isolates. Symbols denote from left to the right: number of isolate, dog breed, collection date (00), origin, sex, age (years), and virulence genotype (C, sec canine ; E, sel; L, luksi; N, si nuc; P, expb; S, seint; T, siet; X, exi) Pekinese En. cocker spaniel Hovawart En. bull terrier Afghan hound Ger. mastiff Ger. shep. dog Dachshund Am. Stafford. terrier Crossbreed Chihuahua Ridgeback Shar Pei Bichon frise Pug En. bulldog Crossbreed Weimaraner En. dog Am. pitbull Ger. boxer Ridgeback Am. cocker spaniel Bordeauxdog Ger. shep. dog Cane corso Crossbreed Dachshund Tosa Inu En. cocker spaniel En. bull terrier Dachshund Poodle Poodle Ger. pinscher Pekingese r. bulldog Welsh terrier Ger. boxer Poodle Irish setter Dalmatin Rottweiler Am. Stafford. terrier Ger. shep. dog Yorkshire terrier Am. cocker spaniel Am. pitbull Ger. pinscher Bernese mountain Vizsla Am. cocker spaniel Dachshund Doberman Crossbreed Cesky terier r. bulldog Boston terrier Ger. boxer Am. bulldog altese Ridgeback Am. cocker spaniel Poodle Afghan hound Irish wolfhound unsterlander Chrastena Prague 0 Prague Prague Prague Prague Prague Horovice Prague Prague Pilsen Prague Prague Prague Prague Prague Prague Prague Prague Petrov 7 Prague Prague 0 Prague 6 Prague Prague Prague Kladno Prague Kostelec n/l Prague 6 Prague Prague 7 Prague Ujezd n/l Losiny Ujezd n/l Prague Prague LXPSTECN STN LXPSTN LXSTECN LXPSTCN LXSTECN LXSTECN LPSTEN LXPSTECN LPSTEN LXSTECN LXSTEN LXSTEN

6 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED (bp) (bp) W W luksi exi expb seint siet sel sec canine nuc igure. Representative agarose gel electrophoretic patterns revealing the different toxinrelated gene profiles generated using multiplex PCR assays I and II in S. pseudintermedius strains. Profile numbers correspond to Table. W, olecular Weight arker (00 bp DNA Ladder, New England BioLabs) than half of the S. pseudintermedius isolates (n = ) carried four virulence genes encoding leukotoxin (luksi), enterotoxin (seint), exfoliative toxin (siet), and superantigenlike protein (sel). Thus, it can be presumed that these four genes play a major role in pathogenesis. Other virulence profiles could only be seen in a few isolates. I II DISCUSSION ALDITO S analysis, recommended by other authors (Decristophoris et al. 0) for identification of the SIG species, correctly identified all S. pseudintermedius isolates and two other staphylococcal species in this study. Interestingly, the proportion of S. aureus (n = ;.%) and S. schleiferi subsp. coagulans (n = ;.%) differs from that reported by Slettemeas et al. 00 (0.%) and Chanchaithong and Prapasarakul 0 (0.%) for S. aureus strains and also from that described by Slettemeas et al. 00 (7%) and Kawakami et al. 00 (0.%) for S. schleiferi subsp. coagulans strains. The reppcr fingerprinting method proved to be useful for the identification of all isolates; its advantage over ALDITO S is that it allowed for the unambiguous differentiation between S. pseudintermedius and S. intermedius and final identification of S. schleiferi subsp. coagulans to the subspecies level. The study isolates were collected in 00; therefore, it is not surprising that no RSP isolates were found, as methicillinresistant S. pseudintermedius (RSP) emerged in Europe in (Loeffler et al. 007; Schwarz et al. 00; Ruscher et al. 00; Ruscher et al. 00). The resistance to LS B antimicrobial agents in half of the S. pseudintermedius isolates revealed in this study is close to the.7% reported by Garbacz et al. (0), and the % and approximately % methicillinsusceptible isolates found by Kawakami et al. (00) and Haenni et al. (0), respectively. Table. Prevalence of toxinrelated genotypes in Staphylococcus pseudintermedius isolates Profile No. of genes No. (%) of isolates (n = 7) No. (%) of isolates by clinical sample dermatitis (n = 66) pyoderma (n = 6) otitis (n = 7) Gene combination luksi exi expb seint siet sel sec canine (.) (7.6) (6.7) (7.) (0.) (.) (0.) (6.) (0.0) (.) (6.) (7.6) (.) (.) (.) (.) (.0) (.) (.0) (.) (.) (.) (.0) (.) (.) (.) (.) (.) (.)

7 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED Substantially lower rates of LS B resistance, i.e. 6.7% and 7.7%, were reported by Onuma et al. (0) in dogs with pyoderma in two periods. The constitutive resistance of all LS B resistant isolates was mediated almost exclusively by the erm(b) gene, as reported also by others (Kadlec and Schwarz 0). The mechanism of resistance to LS B antimicrobial agents could not be identified in one of the resistant isolates, even when tested for additional resistance determinants (erm(a), erm(c), and msr(a)). The heterogenic pulsotypes of the isolates fully correspond with the literature data indicating high genetic diversity of methicillinsusceptible S. pseudintermedius (SSP) isolates (Norstrom et al. 00) compared with that of clonally related methicillinresistant isolates of S. pseudintermedius (RSP; Hesselbarth et al. ; Bannoehr et al. 007; azakerley et al. 00; Perreten et al. 00; Garbacz et al. 0; GomezSanz et al. 0; Couto et al. 0). However, some authors failed to observe any diversity of S. pseudintermedius strains in healthy and diseased dogs (Sasaki et al. 00). A newly designed PCR assay, based on two multiplex reactions, confirmed the presence of virulence factor genes in all S. pseudintermedius isolates and would be suitable for use in diagnostic laboratories. The prevalence of the siet gene (00%) was higher than described by others, e.g. 6.6% (Lautz et al. 006), but almost equal to the percentage reported by Yoon et al. (00). The occurrence of the exi gene (.%) was similar to that observed by utagawa Saito et al. (00) and the prevalence of the expb gene (7.6%) was lower than the % indicated by Iyori et al. (00). The prevalence of the enterotoxinrelated gene sec canine (6.%) was close to the.6% reported by Becker et al. (00) but lower than the % described by Yoon et al. (00) and other authors who confirmed its presence in all tested isolates (utagawasaito et al. 00). The enterotoxin production rate was previously described to be significantly higher in isolates from diseased dogs in comparison with healthy dogs (Sasaki et al. 00), but not in all studies (Tanabe et al. 0). The role of S. pseudintermedius enterotoxinrelated toxins in the pathogenesis of dog skin infections is still not fully clarified. However, strain superantigenicity, ability to induce cytokine production, pyrogenicity, lymphocyte proliferation and immunosuppression could potentiate the skin inflammation process (Hendricks et al. 00). In conclusion, the reppcr method employed here was superior to ALDITO S in its ability to identify canine coagulasepositive staphylococci to the subspecies level. Constitutive resistance to LS B antimicrobial agents (erythromycin, clindamycin) in half of the S. pseudintermedius isolates ( from a total of 7) was determined by the presence of the ermb gene in all but one isolate. oreover, macrorestriction analysis of DNA of the S. pseudintermedius isolates using pulsed field gel electrophoresis revealed their high genotypic heterogeneity. A newly designed PCR assay was used to detect numerous virulence factor genes, of which four encoding leukotoxin (luksi), enterotoxin (seint), exfoliative toxin (siet), and superantigenlike protein (sel) were detected together in the majority of the isolates (n = ), suggesting a significant role for these factors in the pathogenesis of canine skin infections. Acknowledgement We thank E. Kodytkova from the National Institute of Public Health, Prague, for linguistic revision of the manuscript. REERENCES Bannoehr J, Guardabassi L (0): Staphylococcus pseudintermedius in the dog: taxonomy, diagnostics, ecology, epidemiology and pathogenicity. Veterinary Dermatology, 66. Bannoehr J, Ben Zakour NL, Waller AS, Guardabassi L, Thoday KL, van den Broek AH, itzgerald JR (007) Population genetic structure of the Staphylococcus intermedius group: insights into agr diversification and the emergence of methicillinresistant strains. Journal of Bacteriology, 6 6. Baron, Cochet, Pellerin JL, Ben Zakour N, Lebon A, Navarro A, Proudy I, Le Loir Y, Gautier (00): Development of a PCR test to differentiate between Staphylococcus aureus and Staphylococcus intermedius. Journal of ood Protection 67, 0 0. Becker K, Keller B, von Eiff C, Bruck, Lubritz G, Etienne J, Peters G (00): Enterotoxigenic potential of Staphylococcus intermedius. Applied and Environmental icrobiology 67, 7. Borjesson S, GomezSanz E, Ekstrom K, Torres C, Gronlund U (0): Staphylococcus pseudintermedius can be mis 7

8 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED diagnosed as Staphylococcus aureus in humans with dog bite wounds. European Journal of Clinical icrobiology and Infectious Diseases,. Chanchaithong P, Prapasarakul N (0): Biochemical markers and protein pattern analysis for canine coagulasepositive staphylococci and their distribution on dog skin. Journal of icrobiological ethods 6, 7. Couto N, Belas A, Couto I, Perreten V, Pomba C (0): Genetic relatedness, antimicrobial and biocide susceptibility comparative analysis of methicillinresistant and susceptible Staphylococcus pseudintermedius from Portugal. icrobial Drug Resistance 0, 6 7. Decristophoris P, asola A, Benagli C, Tonolla, Petrini O (0): Identification of Staphylococcus intermedius Group by ALDITO S. Systematic and Applied icrobiology,. azakerley J, Williams N, Carter S, cewan N, Nuttall T (00): Heterogeneity of Staphylococcus pseudintermedius isolates from atopic and healthy dogs. Veterinary Dermatology, 7. utagawasaito K, Suzuki, Ohsawa, Ohshima S, Sakurai N, BaThein W, ukuyasu T (00): Identification and prevalence of an enterotoxinrelated gene, seint, in Staphylococcus intermedius isolates from dogs and pigeons. Journal of Applied icrobiology 6, utagawasaito K, akino S, Sunaga, Kato Y, Sakurai Komada N, BaThein W, ukuyasu T (00): Identification of first exfoliative toxin in Staphylococcus pseudintermedius. ES icrobiology Letters 0, Garbacz K, Piechowicz L, Zarnowska S, Haras K, DabrowskaSzponar (0): Heterogeneity of methicillinsensitive Staphylococcus pseudintermedius strains isolated from diseased dogs. Polish Journal of Veterinary Sciences,. GomezSanz E, Torres C, Lozano C, Zarazaga (0): High diversity of Staphylococcus aureus and Staphylococcus pseudintermedius lineages and toxigenic traits in healthy petowning household members. Underestimating normal household contact? Comparative Immunology icrobiology and Infectious Diseases 6,. Haenni, de oraes NA, Chatre P, edaille C, oodley A, adec JY (0): Characterisation of clinical canine meticillinresistant and meticillinsusceptible Staphylococcus pseudintermedius in rance. Journal of Global Antimicrobial Resistance,. Hendricks A, Schuberth HJ, Schueler K, Lloyd DH (00): requency of superantigenproducing Staphylococcus intermedius isolates from canine pyoderma and proliferationinducing potential of superantigens in dogs. Research in Veterinary Science 7, Hesselbarth J, Witte W, Cuny C, Rohde R, Amtsberg G (): Characterization of Staphylococcus intermedius from healthy dogs and cases of superficial pyoderma by DNA restriction endonuclease patterns. Veterinary icrobiology, 66. Iyori K, Hisatsune J, Kawakami T, Shibata S, urayama N, Ide K, Nagata, ukata T, Iwasaki T, Oshima K, Hattori, Sugai, Nishifuji K (00): Identification of a novel Staphylococcus pseudintermedius exfoliative toxin gene and its prevalence in isolates from canines with pyoderma and healthy dogs. ES icrobiology Letters, 6 7. Kadlec K, Schwarz S (0): Antimicrobial resistance of Staphylococcus pseudintermedius. Veterinary Dermatology, 76. Kawakami T, Shibata S, urayama N, Nagata, Nishifuji K, Iwasaki T, ukata T (00): Antimicrobial susceptibility and methicillin resistance in Staphylococcus pseudintermedius and Staphylococcus schleiferi subsp. coagulans isolated from dogs with pyoderma in Japan. Journal of Veterinary edical Science 7, 6 6. Lautz S, Kanbar T, Alber J, Lammler C, Weiss R, Prenger Berningho E, Zschock (006): Dissemination of the gene encoding exfoliative toxin of Staphylococcus intermedius among strains isolated from dogs during routine microbiological diagnostics. Journal of Veterinary edicine Series B,. Lina G, Quaglia A, Reverdy E, Leclercq R, Vandenesch, Etienne J (): Distribution of genes encoding resistance to macrolides, lincosamides, and streptogramins among staphylococci. Antimicrobial Agents and Chemotherapy, Loeffler A, Linek, oodley A, Guardabassi L, Sung J, Winkler, Weiss R, Lloyd DH (007): irst report of multiresistant, mecapositive Staphylococcus intermedius in Europe: cases from a veterinary dermatology referral clinic in Germany. Veterinary Dermatology,. oodley A, Riley C, Kania SA, Guardabassi L (0): Genome sequence of Staphylococcus pseudintermedius strain E0, an ST7 Europeanassociated methicillinresistant isolate. Genome Announcements. Available at pdf+html Norstrom, Sunde, Tharaldsen H, ork T, Bergsjo B, Kruse H (00): Antimicrobial resistance in Staphylococcus pseudintermedius in the Norwegian dog population. icrobial Drug Resistance,. Onuma K, Tanabe T, Sato H (0): Antimicrobial resistance of Staphylococcus pseudintermedius isolates from healthy dogs and dogs affected with pyoderma in Japan. Veterinary Dermatology, 7.

9 Veterinarni edicina, 6, 07 (0): doi: 0.7/0/06VETED Paul NC, Bargman SC, oodley A, Nielsen SS, Guardabassi L (0): Staphylococcus pseudintermedius colonization patterns and strain diversity in healthy dogs: A cross sectional and longitudinal study. Veterinary icrobiology 60, 0 7. Perreten V, Kadlec K, Schwarz S, Andersson UG, inn, Greko C, oodley A, Kania SA, rank LA, Bemis DA, ranco A, Iurescia, Battisti A, Duim B, Wagenaar JA, van Duijkeren E, Weese JS, itzgerald JR, Rossano A, Guardabassi L (00): Clonal spread of methicillinresistant Staphylococcus pseudintermedius in Europe and North America: an international multicentre study. Journal of Antimicrobial Chemotherapy 6,. Ruscher C, LubkeBecker A, Wleklinski CG, Soba A, Wieler LH, Walther B (00): Prevalence of methicillinresistant Staphylococcus pseudintermedius isolated from clinical samples of companion animals and equidaes. Veterinary icrobiology 6, 7 0. Ruscher C, LubkeBecker A, Semmler T, Wleklinski CG, Paasch A, Soba A, Stamm I, Kopp P, Wieler LH, Walther B (00): Widespread rapid emergence of a distinct methicillin and multidrugresistant Staphylococcus pseudintermedius (RSP) genetic lineage in Europe. Veterinary icrobiology, 0 6. Sasaki A, Shimizu A, Kawano J, Wakita Y, Hayashi T, Ootsuki S (00): Characteristics of Staphylococcus intermedius isolates from diseased and healthy dogs. Journal of Veterinary edical Science 67, Schwarz S, Kadlec K, Strommenger B (00): ethicillinresistant Staphylococcus aureus and Staphylococcus pseudintermedius detected in the BfTGermVet monitoring programme in Germany. Journal of Antimicrobial Chemotherapy 6,. Slettemeas JS, ikalsen J, Sunde (00): urther diversity of the Staphylococcus intermedius group and heterogeneity in the boi restriction site used for Staphylococcus intermedius species identification. Journal of Veterinary Diagnostic Investigation, Solyman S, Black CC, Duim B, Perreten V, van Duijkeren E, Wagenaar JA, Eberlein LC, Sadeghi LN, Videla R, Bemis DA, Kania SA (0): ultilocus sequence typing for characterization of Staphylococcus pseudintermedius. Journal of Clinical icrobiology, Stepan J, Pantucek R, Ruzickova V, Rosypal S, Hajek V, Doskar J (00): Identification of Staphylococcus aureus based on PCR amplification of species specific genomic 6 bp sequence derived from a common kb SmaI restriction fragment. olecular Cellular Probes, 7. Svec P, Pantucek R, Petras P, Sedlacek I, Novakova D (00): Identification of Staphylococcus spp. using (GTG) PCR fingerprinting. Systematic and Applied icrobiology, 6. Tanabe T, Toyoguchi, Hirano, Chiba, Onuma K, Sato H (0): Prevalence of staphylococcal enterotoxins in Staphylococcus pseudintermedius isolates from dogs with pyoderma and healthy dogs. icrobiology and Immunology 7, 6 6. Weese JS (0): Phenotypic identification of Staphylococcus intermedius may be inaccurate. Journal of Clinical icrobiology, 7 7. Yoon JW, Lee GJ, Lee SY, Park C, Yoo JH, Park H (00): Prevalence of genes for enterotoxins, toxic shock syndrome toxin and exfoliative toxin among clinical isolates of Staphylococcus pseudintermedius from canine origin. Veterinary Dermatology,. Received: June, 06 Accepted after corrections: December, 06