IGNACIO RIBERA, CARLES HERNANDO and PEDRO AGUILERA

Transcription

1 Agabus alexandrae sp. n. from Morocco, with a molecular phylogeny of the Western Mediterranean species of the A. guttatus group (Coleoptera: Dytiscidae) IGNACIO RIBERA, CARLES HERNANDO and PEDRO AGUILERA A new species of the Agabus guttatus group, A. alexandrae sp. n., is described from the Moyen Atlas in Morocco. A phylogeny of most of the Western Mediterranean species of the group based on Cytochrome Oxydase I and 16S rrna sequences (approximately 1,250 bp) shows that A. alexandrae sp. n. is sister to the remaining species of the group. The evolutionary history of the species of the group is tentatively reconstructed, based on a Maximum Likelihood estimate of divergence time of approximately 2% per MY for the combined 16S and COI genes, similar to other estimates of evolutionary rates of the mitochondrial DNA of Coleoptera. I. Ribera, Department of Entomology, The Natural History Museum, Cromwell Road, London SW7 5BD, U.K. C. Hernando & P. Aguilera, Museu de Zoologia, P.O. Box 593, Barcelona, Spain. Introduction The genus Agabus, with ca. 180 species (Nilsson 2000), is one of the most diverse of the family Dytiscidae. It has a Holarctic distribution, with some isolated species in the Oriental and Ethiopian regions (Nilsson 1992; 2000). The phylogenetic position of the genus within the tribe Agabini, and of the species relationships within the genus, are still largely unknown, partly due to the paucity of morphological characters suitable for a phylogenetic analysis. In its most recent redefinition, the genus Agabus itself could only be characterised by a single sinapomorphy, the continuous bead on the front margin of the clypeus (Nilsson 2000). Within the genus Agabus three subgenera are currently recognised, each of them with several species groups. The Agabus guttatus group as defined by Nilsson & Holmen (1995) is part of the subgenus Gaurodytes (species with parameters stylate, Nilsson 2000). It includes species with pronotum without anterior beading, most species with anterior row of punctures broadly interrupted medially; posterolateral row of punctures on pronotum with a sublateral gap; metatibia with anteroventral row of punctures complete and almost continuous; and male mesotarsomere 3 without adhesive setae. Twenty-five species are currently recognised within this group, with a strict Palaearctic distribution centred in the Mediterranean (Nilsson 2000). Most species are rheofilous, living in mountain streams and springs, often in habitats with a reduced amount of water (Foster & Bilton 1997). A couple of specimens of an undescribed species of the group were found in the lake Afenourir, in the Moroccan Moyen Atlas, in The place had been visited by the authors in 1997 and 1998, and was revisited again in spring 2000, but no further specimens of the species were found, despite intensive search (that resulted in a list of ca. 100 species of aquatic Coleoptera). In an attempt to establish the relationships of this new species a molecular phylogeny of most of the Western Mediterranean species of the group was constructed using the mitochondrial genes 16S

2 254 rrna and Cytochrome Oxydase I (COI). The evolutionary history of the lineage is also discussed based on the present distribution of the species and the estimated time of divergence among them. Material and methods Taxon sampling. - All the Western Mediterranean species of the A. guttatus group were included in the phylogenetic analysis (Tab. 1), with the exception of A. picotae Foster & Bilton 1997 (very closely related to A. heydeni), A. africanus Pederzani & Schizzerotto, 1998 (closely related to A. binotatus), A. cephalotes Reiche, 1861, and A. maderensis Wollaston, 1854 (Nilsson 2000). The phylogenetic relationships among the species of the group are unknown, as well as the possible monophyly of the Western Mediterranean species. For most of the species more than one specimen from different populations were included, in particular for A. biguttatus (the most widespread species, and the most similar morphologically to the new species), for which ten specimens from south Spain, Morocco and the Canary Islands were included (Tab. 1). Outgroup sequences were obtained from Ribera et al. (2001) (with the exception of Agabus aubei), and include several species of Agabini, of the genera Agabus, Ilybius, Ilybiosoma and Platambus (Tab. 1). Within the A. guttatus group, the species considered to be 'A. nitidus' by Milldn et al. (1992) was included as a separate entity. In Foster & Bilton (1997) and Nilsson (2000) A. nitidus is considered to be a synonymy of A. biguttatus, based mostly in the examination of northern and central European material. At present it is unknown weather 'A. nitidus' from SE Spain corresponds to the true A. nitidus, but due to its well characterised morphology and genetic differentiation (even in coexisting populations, note that one of the specimens of A. biguttatus included in the analysis was collected in the same locality and date as 'A. nitidus') it was included as a separate species. DNA extraction, PCR and sequencing. - Specimens were collected in absolute ethanol, and some muscular tissue was used for DNA isolation using a Phenol-Chlorophorm extraction as described in Vogler et al. (1993). Sequences of 16S rrna were amplified in a single fragment of ca. 510 bp, using primers 16Sa (5' ATGTTTTTGTTAAACAGGCG) for the 5' end of the gene, and 16Sb (5' CCGGTCTGAACTCA- GATCATGT) for the 3' end. A single fragment of ca. 720 bp of COI (from the middle of the region E3 to the COOH end, Lunt et al. 1996) was amplified using the primers 'Jerry' (5' CAACATT- TATTTTGATTTTTTGG) for the 5' end of the gene, and 'Pat' (5' TCCAATGCACTAATCTGC- CATATTA) for the 3' end (Simon et al. 1994). All sequences generated in this study were deposited in GenBank (Acc. Nos AY AY039277, Tab. 1). The following cycling conditions were used: 1 to 2 min at 95 C; 30 seconds at 94 C, 30 seconds at C (depending on the melting temperatures of the primer pair used), and 1-2 min at 72 C (repeated for 35 to 40 cycles); 10 min at 72 C. Amplification products were purified using a GeneClean II kit (Bio 101, Inc.) Automated DNA sequencing reagents were supplied by Perkin Elmer Applied BioSystems Ltd. (ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit). Sequencing reactions were purified by ethanol precipitation and were electrophoresed on an ABI3700 sequencer. In all cases both strands of the gene were sequenced, and sequencing errors/ambiguities were edited in the Sequencher 3.0 software package (Gene Codes Corporation). Phylogenetic analysis. - Sequences were not length variable for the ingroup, with the exception of a deletion of a single 'T' in the 16S rrna of Agabus dilatatus in position S rrna sequences of the outgroup differed in length only minimally, with a maximum difference of only four base pairs (see Results). Alignment therefore was performed manually, by maximising sequence similarities. Phylogenetic analysis was performed with PAUP4.0 (Swofford 1999), using parsimony procedures for tree reconstruction, and using gaps as a missing character. Constraint trees for determining Bremer Support values (Bremer 1994) and partitioned Bremer Support values were generated with Treerot (Sorenson 1996). The significance of the Incongruence Length Difference (ILD) (Farris et al. 1994) was assessed with the Partition Homogeneity Test as implemented in PAUP (using a heuristic search with 100 random-addition replicates). To estimate divergence times branch lengths for

3 Table 1. Material included in the molecular phylogeny, with locality data, haplotype and GenBank accession numbers. 255 the ingroup only were fitted using Maximum Likelihood (ML) as implemented in PAUP. Optimum ML models were selected using Modeltest 3.04 (Posada & Crandall 1998). To estimate node ages we fitted ML branch lengths assuming a molecular clock and compared the

4 256 likelihood to that obtained assuming no clock (Felsenstein 1981). As the ML ratio was not significant (see Results), an ultrametric tree was estimated enforcing a molecular clock. To calibrate the branch lengths two of the most extreme published estimations of the evolutionary rate of insect mitochondrial DNA were used. The faster rate estimation was the standard approximately 2% divergence per million years (MY) for mitochondrial DNA (Brower 1994), corresponding to a base rate (per branch) of 0.01 substitutions/site/r4y. The slower rate estimation was that of Gomez-Zurita et al. (2000) for the gene 16S rrna, estimated for the split among northern Moroccan and south Iberian species of the genus Timarcha (Coleoptera, Chrysomelidae), with a rate of substitutions/site/my (0.76% divergence per MY). Agabus alexandrae sp. n. (Fig. 2, 4) Description. - Length 9.5 mm (male) 9.7 mm (female), maximum width 5.3 mm (male) 5.4 mm (female). Body oval, vey convex, black, head with two rufous spots. Antenna brown, last segments darkened at apex. Palpi black, apex of last segment brown. Legs black. Elytra with weak mediolateral and subapical yellow spots. Body surface very shiny; surface of head and pronotum finely rugose; elytra with polygonal, weakly impressed irregular meshes, more impressed apically, most of meshes with interior punctures. Elytral apex with sparse, irregular punctures. Three well impressed, irregular series of setiferous punctures in each elytron. Anterior and posterior submarginal transverse rows of punctures of pronotum widely interrupted in the middle, irregular. Metacoxal plates coarsely reticulated, with irregular polygonal meshes. Abdominal stemites with progressively transverse striae towards apex; stemites 2 to 4 with a medial row of setiferous punctures. Clypeus finely but continuously bordered. Lateral beads of pronotum of uniform width; hind angle slightly obtuse. Elytral margins finely bordered. Prostemal apophysis lanceolate, pointed, with continuous lateral beads. Metastemal wings broad. Apical metatibial spur shorter than first metatarsomere. First two tarsomeres of anterior and middle legs of male dilated, with adhesive setae. Anterior claws elongated, falcifom; interior claw slightly longer, with a medial tooth. Last abdominal sternite with strongly impressed longitudinal striae. Penis regularly curved in lateral view, asymmetrical in dorsal view (Fig. 2, 4). Etymology. - Named after Alexandra 'Ali' Cieslak, for her enthusiasm to collect Agabus and Hydroporus. Type locality. - Lac Afenourir, Moyen Atlas, Morocco, 33 17'12.4"N 5 15'09.8"W, 1,800 m a.s.l. Type material. - Holotype a (Natural History Museum, London): '8 MOROCCO / Azrou: Lac Afenourir / I. Ribera leg.'. Paratype (IR Coll.), 19, same locality and data as holotype. Genomic DNA extraction of both specimens stored in the collection of the Molecular Systematic Laboratory, Department of Entomology, Natural History Museum, under reference numbers IR212 (holotype 0") and IR213 (paratype 9). Ecology. - The two known specimens were collected in a temporary, well vegetated shallow pond close to the main lake Afenourir. This suggests the possibility that the ancestral habitat of the A. guttatus group could be stagnant rather than running water, with an early transition to running waters (see the phylogenetic analysis below). However, these two specimens could also have been vagrants from some of the nearby streams - a more typical habitat of the species of the group. More captures will be necessary to establish with certainty the habitat of A. alexandrae sp. n. Remarks. - Among the Western Mediterranean species, the external morphology of A. alexandrae sp. n. seems most similar to that of A. bigutattus, from which can be differentiated by its more regular oval shape, with the maximum width in a more rear position. The edeagus is however clearly different, more regularly curved in lateral view, and less asymmetrical in dorsal view (Fig. 1-4). The shape of the aedeagus, as well as the general body shape and colour, allows a clear differentiation from the examined Central and Eastern Mediterranean species of the group (A. balcanicu.s Hlisnikovsky, 1955; A. brandti Harold, 1880; A. freudi Gueorguiev, 1975; A. glazunovi (Zaitzev, 1953); A. lobonyx Guignot, 1952; A. ommani Zaitzev, 1908 and A. svenhedini (Falkenström, 1932) could not be examined, although because of the characters given in the original descriptions and the distribution of the species - most of them from the Eastern Palaearctic - any confusion is most unlikely).

5 257 Figures 1-4. Aedeagus of Agabus biguttatus (1, 3) and A. alexandrae sp. n. (2, 4), lateral and dorsal views, traced from photographs. Scale bar 0.5 mm. Phylogeny of the Western Mediterranean species of the A. guttatus group 16S rrna. - All the ingroup sequences of the 16S rrna fragment had the same length, 512 bp. Among the outgroups, the longest were I. albarracinensis and L chalconatus (513 bp), and the shortest L lugens (508). All specimens of A. biguttatus had the same haplotype, with the exception of the ones from the Canary Islands (Gomera and Tenerife, Tab. 1). The two specimens of A. binotatus, A. heydeni and A. alexandrae had the same haplotype respectively (Tab. 1). The aligned sequences had 515 characters, of which 418 were constant and 63 parsimony informative. Minimum distance within the ingroup corresponded to 'A. nitidus' - A. biguttatus 1 (see Tab. 1 for the haplotype codes) (uncor- rected 'p' distance 0.008, corresponding to 4 bp). The maximum ingroup distance was that of A. heydeni - A. biguttatus 2 (p = 0.025, corresponding to 13 bp). The maximum overall distance was between P. maculatus and L angustior (p = 0.11, corrresponding to 54 bp). A Tree-Bisection-Reconnection (TBR) search of 1,000 replicas produced 32 trees of a consistency index (CI) of 0.62 and a length of 181 steps. The topology of the strict consensus tree was compatible with that of the combined analysis (see below), with the only difference of the sister relationship between A. heydeni and A. binotatus. The position of A. aubei, A. didymus and A. bipustulatus among the outgroups, and A. guttatus, A. dilatatus and A. alexandrae within the ingroup, was unresolved (i.e. forming a polytomy at the base of the genus Agabus and the A. guttatus group respectively).

6 258 Figure 5. Phylogram of one of the two most parsimonious trees of the combined (16S rrna + COI) analysis (in the strict consensus tree node 15 is collapsed). In square brackets, node numbers. Bootstrap support values (> 50%) on top left of the nodes (see Tab. 2 for Bremer support values).

7 259 Cytochrome Oxydase L - All the studied sequences had 723 base pairs, with no length variation. Of them, 494 were constant and 171 parsimony informative. Both specimens of A. alexandrae and A. binotatus had the same haplotype, and there were four different haplotypes within A. biguttatus (Tab. l ). The minimum distance within the ingroup corresponded to A. biguttatus 1 and 2 (p = , corresponding to 1 bp). The maximum distance within the ingroup corresponded to A. dilatatus - A. biguttatus 2 (p = 0.07, 54 bp). The maximum distance overall corresponded to P. maculatus - L angustior (p = 0.15, 112 bp). A TBR search of 1,000 replicas resulted in a single tree of 628 steps with a CI = The topology of the ingroup was the same as that of the combined analysis (i.e. with A. guttatus sister to A. binotatus), but the relationships among the outgroups were slightly different (mainly the position of the other species of Agabus). Combined analysis. - A TBR search with 1,000 replicas on the combined data set (all characters equally weighted) resulted in two trees of 815 steps and a CI = 0.53 (Fig. 5). The Partition Table 2. Bremer Partitioned Support values for the nodes of one of the two combined ( 16S rrna + COI) trees. See Fig. 5 for the number of the nodes. Values refer to the relative Bremer Support Value (i.e. the difference between the value obtained for the constrained node and the value obtained for the unconstrained tree, for each gene separately and for the combined analysis). Unresolved nodes in the strict consensus tree have a Bremer Support Value of 0 (node 15). Homogeneity Test was not significant (p = 0.72, 100 random-addition replicates), indicating a high congruence between both genes. In the combined tree all included genera are monophyletic, with the possible exception of Agabus (the position of A. didymus is unresolved). The species formerly included in the Agabus chalconatus and A. erichsoni groups (L subtilis, L albarracinensis and L chalconatus), and transferred to flybius by Nilsson (2000), were placed as sister to L angustior. The species of the A. guttatus group were monophyletic and closest to A. bipustulatus. Within the group, A. alexandrae was basal, and sister to two main clades: that formed by the species with a denticle in the apex of the aedeagus (A. guttatus complex: A. dilatatus, A. binotatus, A. heydeni and A. guttatus, see Foster & Bilton 1997), and that formed by the A. biguttatus complex (A. biguttatus sensu lato and A. `nitidus'). When gaps were considered as a 5th character, the search resulted in 4 trees of 830 steps and a CI of The topology was identical, with the exception of the collapse of nodes 8 and 9 (Fig. 5) (i.e., the position of A. dilatatus was unresolved, resulting in a polytomy at the base of the A. guttatus gr.). Bootstrap values were very high for most of the nodes (Fig. 5). Bremer Support values were equally high for most of the nodes (Tab. 2). Partitioned Bremer Support values were negative (i.e. indicating that the gene in question did not supported the final topology) for the sister relationship between A. guttatus and A. binotatus (node 5); the position of A. dilatatus (node 9) and for the position of A. didymus (node 15). The highest support values (other that for haplotypes of the same species) were those of the genera Ilybiosoma (node 13) and Ilybius (node 12), and the A. guttatus gr. (node 18). The genus Agabus (node 15) had no support, due to the inconsistency in the position of A. didymus. Rate of evolution. - For the combined data set (ingroup only), the optimal ML model as selected by Modeltest used the observed base frequencies, an estimated substitution model and equal rates of variation for all sites. Estimations for both genes independently gave similar models, with the difference of unequal rates for COI. The maximum likelihood of the single combined tree under the assumption of a molecular clock was not significantly different to that of the same tree and model

8 260 Figure 6. Ultrametric tree obtained with a Maximum Likelihood model on the combined data set. Numbers above branches refer to branch lengths. The scale shows an estimated rate of evolution for the combined data set of approximately 0.01 substitutions/site/my (see text). without enforcing a molecular clock (-logl (no clock) = ; -LogL (clock) = ; 2 x difference in LogL has a chi-square distribution with 9 degrees of freedom, p = 0.18). Both when the model estimated for the combined data was applied to the genes separately, and when the

9 261 models estimated for each gene separately were applied to the combined data set, there were no significant differences between the likelihood enforcing and not enforcing a molecular clock. A single ultrametric tree was thus produced using the ML estimated model for the combined data set (Fig. 6). The use of the standard 2% divergence per million years (MY) for insect mitochondrial DNA (Brower 1994) gives a minimum estimated age of the A. guttatus group of 3.6 MY (Fig. 6). The origin of the species (with the exception of A. alexandrae) would be much younger, 2.3 MY for A. nitidus, and ca. 1.7 MY for A. biguttatus, A. binotatus, A. guttatus and A. heydeni. The use of the much slower estimate of Gomez-Zurita et al. (2000) for the genus Timarcha gives an age of the divergence of A. alexandrae of 9.4 MY, and an approximate age of the most recent species of ca. 4.2 MY. However, this latter estimate was based on the gen 16S rrna, which has a much lower evolutionary rate than Cytochrome Oxydase I. If only the gene 16S is taken into account, the estimated branch length of A. alexandrae is 0.013, which would correspond to 3.4 MY - much closer to the 3.6 MY obtained with the standard rate. Discussion Phylogenetic analysis. - The phylogenetic relationships of some of the Western Mediterranean species not included in the analysis can be deduced from their morphology. Agabus cephalotes has an apical tooth in the aedeagus (Foster & Bilton 1997), and it is likely to be included in the A. guttatus complex. Similarly, A. africanus has been hypothesised to be sister to A. binotatus (Pederzani & Schizzeroto 1998). The position of A. maderensis is less clear, although it seems likely to be a member of the A. biguttatus complex, probably close to A. biguttatus. The south Portugese A. picotae is undoubtedly closely related to A. heydeni (Foster & Bilton 1997), a species with a scattered distribution in Iberia and Morocco, with main populations in central Spain, north and central Portugal and Sierra Nevada (Rico et al. 1990). Until more molecular data is available it is not possible to ascertain their taxonomic status. The specific identity of A. 'nitidus' is clear, both for the age of the separation with A. biguttatus (similar or older to that of other well defined species, Fig. 6) and for the fact that both coexist (although it would be necessary to study more specimens to be certain). Similarly, differences between the populations of A. biguttatus from Gomera and Tenerife and that of Morocco and the Iberian Peninsula seem to be deep enough to warrant a specific status, to which the name A. consanguineus Woollaston, 1864 could be applied. According to Machado (1987) two forms can be found in the Canary Islands, A. nitidus and A. biguttatus. More data is necessary to assess the possible differences between the two, and if any, to which would correspond A. consanguineus. Evolutionary history. -According to the estimated rates, the split between A. alexandrae and the remaing species of the group would correspond to ca. 3.5 MY. This is younger that the age of the end of Messinian crisis, with the separation of the Iberian Peninsula and north Morocco after the reopening of the Gibraltar straits (5.33 MY, Krijgsman et al. 1999) (which was used by Gomez-Zurita et al as a calibration point for their estimation). If we accept this estimation, all speciation events across the Mediterranean (and in islands) would be the result of colonisation, either from Europe or North Africa (depending on the geographical origin of the group). Similarly, the separation of the populations of A. heydeni from Morocco and Central Spain would have taken place approximately 100,000 years BP, even if the species can be considered a mountain specialist and has so far never been recorded to fly. Similarly, our data suggest that the large range of A. biguttatus (the most extense of the group) is the result of a recent expansion. Differences among COI haplotypes were small (with the exception of the populations in the Canary Islands, with an estimated age of isolation of no less than 1.6 MY), but had some geographical structure: all Iberian Specimens had the same haplotype, and all Moroccan specimens another one with the exception of A. biguttatu.s 8, with a unique haplotype (Tab. 1). The topology of the tree suggests the paraphyly of the Moroccan populations, although the small amount of variation (between 1 and 3 base pairs) does not allow any strong conclusion. According to our evolutionary hypotheses, A. binotatus would have a continental origin, with a posterior colonisation of the Mediterranean islands (the present distribution includes Corsica,

10 262 Sardinia, Sicily and mainland Italy, Franciscolo 1979). The species is too young to have been originated as a Corsican or Sardinian endemic by a vicariant split. The last connection of Corsica with mainland was at the end of the Messinian crisis 5.33 MY ago, as seen above, and the geological formation of the islands dates approximately MY (see e.g. Steinfartz et al and references therein). Acknowledgements We thank Hans Fery (Berlin), S. Ericsson and Anders Nilsson (Umea) and Keith Miller (Cyprus) for providing some specimens, and Alfried Vogler, Txus G6mez- Zurita and Andr6s Millan for comments and suggestions. Grant support was through NERC GR9/4735 to Alfried Vogler (NHM). IR is a Leverhulme Special Research Fellow. Bremer, K. (1994) Branch support and tree stability. Cladistics 10: Brower, A. V. Z. (1994) Rapid morphological radiation and convergence among races of the butterfly Heliconius erato inferred from patterns of mitochondrial DNA evolution. Proceedings of the National Academy of Sciences, USA 91: Farris, J. S., Källersjö, M., Kluge, A. G. & Bult, C. (1994) Testing significance of incongruence. Cladistics 10: Felsenstein, J. (1981) Evolutionary trees from DNA sequences : a maximum likelihood approach. Journal of Molecular Evolution 17: Foster, G. N. & Bilton, D. T. (1997) A new species of Agabus from south-west Portugal (Coleoptera: Dytiscidae). Koleopterologische Rundschau 67: Franciscolo, M. E. (1979) Coleoptera Haliplidae, Hygrobiidae, Gyrinidae, Dytiscidae. Fauna d'italia 14: 804 pp. Edizioni Calderini, Bologna. Gómez-Zurita, J., Juan, C. & Petitpierre, E. (2000) The evolutionary history of the genus Timarcha (Coleoptera, Chrysomelidae) inferred from Mitochondrial COII gene and partial 16S rdna sequences Molecular Phylogenetics and Evolution 4: Krijgsman, W., Hilgen, F. J., Raffi, I., Sierro, F. J. & Wilson, D. S. (1999) Chronology, causes and progression of the Messinian salinity crisis. Nature 400: Lund, D. H., Zhang, D. X., Szymura, J. M. & Hewitt, G. M. (1996) The insect cytochrome oxidase I gene: evolutionary patterns and conserved primers for phylogenetic studies.insectmolecularbiology 5 : Machado, A. (1987) Los ditiscidos de las Islas Canarias (Coleoptera, Dytiscidae). Instituto de Estudios Canarios, La Laguna. Millán, A., Velasco, J. & Soler, A. G. (1992) Los coleópteros Hydradephaga de la cuenca del rio Segura (SE de la Peninsula Ibérica). Aspectos faunísticos más relevantes (Coleoptera). Anales de Biología, Universidad de Murcia 18: Nilsson, A. N. (1992) A revision of Afrotropical Agabus Leach (Coleoptera, Dytiscidae), and the evolution of tropicoalpine super specialists. Systematic Entomology 17: Nilsson, A. N. (2000) A new view on the generic classification of the Agabus-group of genera of the Agabini, aimed at solving the problem with a paraphyletic Agabus (Coleoptera: Dytiscidae). Koleopterologische Rundschau 70: Nilsson, A. N. & Holmen, M. (1995) The aquatic Adephaga (Coleoptera) of Fennoscandia and Denmark. II. Dytiscidae. Fauna entomologica scandinavica 32: 188 pp. E. J. Brill, Leiden. Pederzani, F. & Schizzeroto, A. (1998) Description of Agabus (Dichonectes) africanus n. sp. from northwest Tunisia and notes on the cohabiting species of Hydradephaga (Coleoptera Haliplidae, Gyrinidae & Dytiscidae). Atti dell'accademia Roveretana degli Agiati (7) 8B: Posada, D. & Crandall, K. A. (1998) Modeltest: testing the model of DNA substitution. Bioinformatics 14: Ribera, I., Barraclough, T. G. & Vogler, A. P. (2001) The effect of habitat type on speciation rates and range movements in aquatic beetles: inferences from species-level phylogenies. Molecular Ecology 10: Rico, E., Pérez, L. C. & Montes, C. (1990) Lista faunística y bibliográfica de los Hydradephaga (Coleoptera : Haliplidae, Hygrobiidae, Gyrinidae, Noteridae, Dytiscidae) de la Peninsula Ibérica e islas Baleares. Asociación Espanola de Limnologia, Listas de la Flora y Fauna de las Aguas Continentales de la Peninsula Ibérica n 7, Madrid. Simon, C., Frati, F., Beckenbach, A. T., Crespi, B., Liu, H. & Flook, P. (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87: Sorenson, M. D. (1996) TreeRot. University of Michigan, Ann Arbor. Steinfartz, S., Veith, M. & Tautz, D. (2000) Mitochondrial sequence analysis of Salamandra taxa suggests old splits of major lineages and postglacial recolonizations of Central Europe from distinct source populations of Salamandra salamandra. Molecular Ecology 9: Swofford, D. L. (1999) PAUP*: Phylogenetic Analysis using Parsimony. Version 4.0b2a. Sinauer Associates, Sunderland, Massachusetts. Vogler, A. P., DeSalle, R., Assmann, T., Knisley, C. B. & Schultz, T. D. (1993) Molecular population genetics of the endangered tiger beetle, Cicindela dorsalis (Coleoptera: Cicindelidae). Annals of the Entomological Society of America 86: