Molecular Phylogenetics and Taxonomy of the Andean Genus Lynchius Hedges, Duellman, and Heinicke 2008 (Anura: Craugastoridae)

Transcription

1 Herpetological Monographs, 30, 2016, Ó 2016 by The Herpetologists League, Inc. Molecular Phylogenetics and Taxonomy of the Andean Genus Lynchius Hedges, Duellman, and Heinicke 2008 (Anura: Craugastoridae) ANA P. MOTTA 1,2,8,JUAN C. CHAPARRO 3,JOSÉ P. POMBAL, JR.2,JUAN M. GUAYASAMIN 4,5,IGNACIO DE LARIVA 6, AND JOSÉ M. PADIAL7 1 Departamento de Zoologia, Universidade Estadual Paulista Júlio de Mesquita Filho, , Rio Claro, SP, Brazil 2 Departamento de Vertebrados, Museu Nacional, Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ, Brazil 3 Museo de Historia Natural de la Universidad Nacional de San Antonio Abad del Cusco (MHNC), Plaza de Armas s/n (Paraninfo Universitario), Cusco, Peru 4 Colegio de Ciencias Biológicas y Ambientales, Universidad San Francisco de Quito, Diego de Robles y Vía Interoceánica, Cumbayá, , Quito, Ecuador 5 Centro de Investigación de la Biodiversidad y Cambio Climático (BioCamb), Ingeniería en Biodiversidad y Recursos Genéticos, Facultad de Ciencias de Medio Ambiente, Universidad Tecnológica Indoamérica, Calle Machala y Sabanilla, Cotocollao, Quito, Ecuador 6 Departmento de Biodiversidad y Biologia Evolutiva, Museo Nacional de Ciencias Naturales, CSIC; C/José Gutiérrez Abascal, 2, 28006, Madrid, Spain 7 Section of Amphibians and Reptiles, Carnegie Museum of Natural History, 4400 Forbes Avenue, Pittsburgh, PA 15213, USA ABSTRACT: We infer species relationships within Lynchius, a frog genus with four species distributed along the paramos and cloud forests of the Andes of northern Peru and southern Ecuador, and assess species diversity in light of comparative analyses of anatomical traits and inferred relationships. Phylogenetic analyses rely on ~7000 base pairs of mtdna and nudna sequences aligned using similarity-alignment and treealignment and optimized under maximum likelihood and parsimony criteria. Inferred relationships place Lynchius as the sister group of the widespread genus Oreobates and this clade as the sister group of the high Andean genus Phrynopus. Our analyses corroborate the dissimilar species Lynchius simmonsi as part of this clade and place it as the sister group of the remaining species of Lynchius. Parsimony and maximum likelihood analyses differ in the internal relationships of Lynchius with respect to the placement of L. flavomaculatus, L. nebulanastes, and L. parkeri, but support the existence of two unnamed species. External morphological comparisons provide diagnostic characters for the two new species, which are named and described herein. Lynchius tabaconas is sister to L. flavomaculatus and occurs at ~2800 m in the cloud forests of Santuario Nacional Tabaconas-Namballe, Cajamarca, Peru. Lynchius oblitus occurs in the same area but at a higher elevation (~3300 m) and is sister to a clade formed by L. flavomaculatus and L. tabaconas in parsimony analyses and to L. nebulanastes in maximum likelihood analyses. We provide a new diagnosis for each of the six species and for the genus, as well as some natural history notes. Key words: Brachycephaloidea; Lynchius oblitus sp. nov.; Lynchius tabaconas sp. nov.; Oreobates; Paramo; Phrynopus; Terrarana THE WET and cold grasslands and elfin forests of the high Andes have been traditionally considered poor in frog diversity. Recent surveys in northern Bolivia and in Peru have nonetheless unraveled unexpected levels of new species of terraranan frogs in different lineages (e.g., De la Riva 2007; Lehr and Catenazzi 2009; Lehr et al. 2012; Chaparro et al. 2015). Albeit these high-elevation lineages have been historically considered part of the genus Phrynopus (Lynch 1975), molecular data reveal a contrasting scenario where they have independent origins (Heinicke et al. 2007; Hedges et al. 2008; Padial et al. 2014). According to inferred relationships, species from Bolivia and southern Peru have been placed in the genera Bryophryne, Noblella, and Psychrophrynella, the radiation in the Andes of central Peru retained the name Phrynopus, and the genus Lynchius target of this study was erected to include three species distributed along the paramos and elfin forests of the Cordillera Oriental in southern Ecuador and Cordillera de Huancabamba in northern Peru (Hedges et al. 2008). Along the Cordillera de Huancabamba in northern Peru and the southern parts of the Cordillera Oriental of Ecuador the western slopes are mostly dry and covered by chaparrallike forest, while the summit and Amazonian versant are moist and covered with dense vegetation. Above ~2000 m elevation on the eastern versant, dense cloud forests and bush-like elfin forests and paramos gradually replace montane forests. Lynchius flavomaculatus, the first species 8 CORRESPONDENCE: , apmottah@gmail.com of Lynchius discovered, was found in the cloud forests and paramos of a locality 15 km east of Loja (Ecuador; Parker 1938). This locality is now part of the Podocarpus National Park, but this species is currently known to occur farther north and south within Ecuador. Lynchius nebulanastes (Cannatella 1984) and L. parkeri (Lynch 1975) were found in paramos and cloud forests, even in syntopy, but farther south, along one of the westernmost ridges of the Peruvian Cordillera de Huancabamba. An unnamed species is also known to occur in northern Peru (Lehr 2005; Hedges et al. 2008; Padial et al. 2014) in the paramos and elfin forests of an area intermediate between the southern distribution of L. nebulanastes and L. parkeri and the northern distribution of L. flavomaculatus. A fourth, and morphologically dissimilar species, L. simmonsi (Lynch 1974), was recently inferred as the sister group of Lynchius and is now considered part of this genus (Padial et al. 2012, 2014). In contrast to the other species of Lynchius, L. simmonsi occurs at lower elevations (~1800 m) along the cloud forests of the Cordillera del Cóndor, in Ecuador, on the easternmost ridges of the Amazonian versant of the Andes. Lynchius remains a poorly known Andean clade and, although its phylogenetic relationships and osteology have been studied in some detail (e.g., Lynch 1975; Duellman and Lehr 2009; Padial et al. 2014), several aspects of its systematics and natural history remain scarcely studied. For example, morphological variation within this clade is poorly understood because species were described independently and comparisons were made within a now obsolete phylogenetic framework (e.g., species of Lynchius were 119

2 120 Herpetological Monographs 30, 2016 thought to be part of Phrynopus, Ischnocnema, and Oreobates). After the inference of L. simmonsi as part of this clade, the patterns of distribution and morphological variation within the clade of Lynchius changed considerably. Furthermore, the phylogenetic relationships of Lynchius remain contentious. Molecular phylogenetic analyses have placed Lynchius as either the sister group of Phrynopus (Padial et al. 2009), Oreobates (Hedges et al. 2008; Padial et al. 2014), or Oreobates and Phrynopus (Padial et al. 2012). In addition to the undescribed species from northern Peru mentioned above, recent fieldwork in this region and in southern Ecuador by some of the authors of this study revealed the existence of another unnamed species of Lynchius and provided additional material for comparison and more rigorous phylogenetic analyses. Here, we present the results of our analyses of the external morphology of all available specimens and phylogenetic analyses of a matrix composed of mtdna genes (12S, 16S and intervening genes, cytb) and nudna genes (28S c-myc, H3, POMC, Rag, Rho, SIA, and Tyr). Our analyses support the existence of the two aforementioned new species, which are named and described herein. Furthermore, we provide an overview of species diversity, current understanding of morphological variation within species, phylogenetic relationships for the group, and some new natural history notes. MATERIALS AND METHODS Morphology The study of the morphology is based on external qualitative and quantitative traits. Terminology for morphological characters used in the diagnosis and descriptions follows Duellman and Lehr (2009). For morphometrics, the measurements were taken with a digital caliper to the nearest 0.01 mm, but to avoid pseudo-precision, all measurements were rounded to one decimal place. All measurements were taken by the senior author, except for Lynchius simmonsi. Measurements of the holotype of L. simmonsi were taken by J. Padial, while QCAZ vouchers were measured by J. Guayasamin. Abbreviations for measurements are as follows: snout vent length (SVL); head length (HL; from posterior margin of lower jaw to tip of snout); head width (HW; measured at level of rictus); eye length (EL; measured horizontally); eye-to-nostril distance (EN); internarial distance (IND); eye-to-eye distance (EE; measured at the anterior margins of eyes); tympanic membrane height (TyH); tympanic membrane length (TyL); width of disc of Finger III (F3); width of disc of Finger IV (F4); arm length (FA; from posterior margin of thenar tubercle to elbow); tibia length (TL); thigh length (TH; from vent to knee); foot length (FL; from proximal border of inner metatarsal tubercle to tip of fourth toe); width of disc of Toe IV (T4). Values of interorbital distance and upper eyelid width were not included because of the imprecise landmarks of the structures involved, especially in poorly preserved specimens. Descriptions of color patterns in life are based on field notes and color digital photographs. Sex and maturity were determined by dissection and direct examination of gonads or by observation of secondary sexual characters. Comparisons of external character states were based both on original descriptions and examination of museum specimens. Types of all species of Lynchius were examined. Specimens collected were photographed alive, euthanized with Lidocaine, fixed in 10% formalin, and preserved in 70% ethanol. Coordinates were obtained by means of a Garmin PSMAP 62sc Handheld Navigator Global Positioning System and further assessments for geographical data and elevation were performed in Google Earth. All geographic coordinates are based on geodetic datum WGS84. Museum acronyms are those cited by Frost (2016), except that MHNC refers to Museo de Historia Natural de Cusco, Universidad Nacional de San Antonio Abad del Cusco, Cusco, Peru (MHNCP in Frost 2016). Specimens examined are listed in Appendix I. Molecular Phylogenetics Taxon and character sampling. In order to rigorously test the phylogenetic position and monophyly of Lynchius, we broadly sampled the holoadenine genera Oreobates (22 spp.) and Phrynopus (11 spp.), because these are the two genera that have been found most closely related to Lynchius in all previous phylogenetic analyses (Hedges et al. 2008; Pyron and Wiens 2011; Padial et al. 2012, 2014). We also sampled other genera of Holoadeninae (Padial et al. 2014) by including representative species of Barycholos (2 spp.), Bryophryne (1 spp.), Euparkerella (1 spp.), Holoaden (2 spp.), Hypodactylus (2 spp.), Noblella (3 spp.), and Psychrophrynella (3 spp.). Ingroup sampling includes four terminals representing all four nominal species of Lynchius, plus eight terminals that were not part of any nominal species. Haddadus binotatus, a distant craugastorid of the Craugastorinae (Padial et al. 2014), was used to root the trees. Our matrix includes legacy (GenBank) and newly produced sequences for 16 genes. Noncoding mtdna genes include rrna genes of the heavy strand transcription unit 1 fragment (12S, 16S and the intervening trna valine, and trna leucine segments). Protein-coding mtdna genes include cytochrome b (cytb). Nuclear protein-coding genes include two exons of cellular myelocytomatosis (c-myc), histone H3 (HH3), propiomelanocortin A (POMC), recombination-activating protein 1 (RAG1), rhodopsin (Rhod), seven-in-absentia (SIA), and tyrosinase precursor (Tyr). Noncoding nuclear genes include 28S. Sequences for 12S, 16S, trna valine, trna leucine, POMC, RAG, and TYR genes were newly produced for this study. Specimen voucher numbers and locality data for sequences produced in this study are listed in Table 1. Accession numbers for all sequences used in this study are listed in Appendix II. DNA amplification and sequencing. Genomic DNA was extracted from ethanol-preserved tissues using standard phenol-chloroform extraction protocols. The standard polymerase chain reaction (PCR) amplification protocol was as follows: 958C/15 s; 35 cycles of 958C/30 s, 508C/30 s, 728C/1 min; and 728C/10 min. Cycle sequencing reactions were completed using the corresponding PCR primers (Table 2) and BigDye Terminator 3.1 chemistry (Applied Biosciences), with a standard cycle sequencing profile (968C/3 min; 35 cycles of 968C/10 s, 508C/15 s, 608C/3 min; and 728C/7 min). PCR products were visualized in agarose gels, and unincorporated primers and dntps were removed from PCR products using ExoSap purification (ExoSap-it, GE Health-

3 MOTTA ET AL. PHYLOGENETICS AND TAXONOMY OF LYNCHIUS 121 TABLE 1. Sequences of Lynchius produced in this study. All voucher specimens are from Santuario Nacional Tabaconas-Namballe, Cajamarca, Peru ( S, W). Voucher (MHNC) DNA collection (MNCN-DNA) 12S 16S POMC RAG TYR Lynchius oblitus KX KX KX KX Lynchius oblitus KX KX KX KX Lynchius oblitus KX KX KX KX Lynchius oblitus KX KX KX KX Lynchius oblitus KX KX KX KX Lynchius tabaconas KX KX KX KX KX Lynchius tabaconas KX KX KX KX KX GenBank care). Double-stranded DNA was sequenced in Macrogen. Raw sequences complementary strands were compared to generate a consensus sequence for each DNA fragment using Geneious v7.0 (Biomatters Ltd., New Zealand). Phylogenetic Analyses Parsimony analysis. Sequences were first aligned in Program MAFFT (see below) and partitioned into fragments of equal length separated by conserved regions with no gaps and few or no nucleotide substitutions. This strategy generated putatively homologous fragments where length variation among DNA sequences was only due to insertions and/or deletions of nucleotides, a requisite for treealignment in Program POY (Wheeler et al. 2006). After the removal of gaps implied by MAFFT from sequence fragments, tree-alignment of unaligned sequences was performed under parsimony with equal weights for all classes of transformations using direct optimization (Wheeler 1996; Wheeler et al. 2006) and iterative pass optimization (Wheeler 2003) algorithms in POY (Varón et al. 2010). Tree searches were first conducted using direct optimization under the command search, which implements an algorithm based on random addition sequence Wagner builds, subtree pruning and regrafting, and tree bisection and reconnection (TBR) branch swapping (see Goloboff 1996, 1999), parsimony ratcheting (Nixon 1999), and tree fusing (Goloboff 1999); then, consecutive rounds of searches are done within a specified run-time, storing the shortest trees of each independent run and performing a final round of tree-fusing on the pooled trees. The optimal tree found during driven searches was swapped using iterative pass optimization (Wheeler 2003). Tree searches were carried out using the American Museum of Natural History s high performance computing cluster ENYO (a cluster of 33 Intel Xeon 3.0GHz dual-core, 128 dual-processors, L2 cache, 64- bit and 1TB shared storage, and 16GB RAM per node). We have observed that POY or POY does not always report all equally parsimonious trees when large data sets are analyzed; therefore, the optimal alignment resulting from iterative pass optimization was converted into a data matrix, and driven searches were conducted in Program TNT (Goloboff et al. 2008) until a stable strict consensus was reached at least three times (see below for details of driven searches in TNT). We calculated Goodman Bremer values (Goodman et al. 1982; Bremer 1988; see Grant and Kluge 2008) for each supported clade in TNT using the optimal tree-alignment matrix and the parameters specified in the bremer.run macro (available with the software package at which begins by searching for trees N steps longer than the optimum (10 random addition sequence Wagner builds and TBR swapping, saving 2 trees/replicate), using inverse constraints for each node of the most parsimonious tree. Swapping of each constrained search was limited to 20 min and constrained searches were repeated three times as specified in the default settings of the bremer.run macro. We also calculated parsimony jackknife frequencies (Farris et al. 1996) for each supported clade by resampling the tree-alignment matrix. We caution that, as in analyses of similarity-alignment matrices, the resulting clade frequencies are conditional on TABLE 2. Sequence primers used in this study. Locus Primer name and priming region ( ) Source 16S 16Sar: CGCCTGTTTATCAAAAACAT Hillis et al. (1996) 16Sbr: CCGGTCTGAACTCAGATCACGT 16S 16L19: AATACCTAACGAACTTAGCGATAGCTGGTT Hedges et al. (2008) 16H24: TACCTTCGCACGGTTAGKRTACCGCGGCCGTT 16S 16S-JMP-F: CATGGTAAGTRTACCGGAAGGTG This study 16S-JMP-R: ACCAGCTATDACTAAGTTCG 12S-tRNA phe 12S-t-Phe-frog: ATAGCRCTGAARAYGCTRAGATG Wiens et al. (2005) 12S-frogRa: TCRATTRYAGGACAGGCTCCTCTAG 12S- trna val 12S-t-Val-frog: TGTAAGCGARAGGCTTTKGTTAAGCT Wiens et al. (2005) 12S-frogFa: CAAACTRGGATTAGATACCCYACTATG cmyc cmyc1u: GAGGACATCTGGAARAARTT Crawford (2003) cmyc3l: GTCTTCCTCTTGTCRTTCTCYTC POMC POMC-1: AATGTATYAAAGMMTGCAAGATGGWCCT Wiens et al. (2005) POMC-2: TAYTGRCCCTTYTTGTGGGCRTT RAG1 R182: GCCATAACTGCTGGAGCATYAT Heinicke et al. (2007) R270: AGYAGATGTTGCCTGGGTCTTC TYR Tyr1C: GGCAGAGGAWCRTGCCAAGATGT Bossuyt and Milinkovitch (2000) Tyr1G: TGCTGGGCRTCTCTCCARTCCCA

4 122 Herpetological Monographs 30, 2016 this particular alignment and not the data themselves. Given that the tree-alignment matrix is derived from the optimal tree, the resulting clade frequencies are expected to be higher than would be obtained from matrices aligned according to different guide trees (e.g., a UPGMA or neighbor-joining tree, as in MAFFT and Clustal, respectively). We calculated jackknife frequencies from 1000 pseudo-replicates searches using driven searches (see below), gaps treated as fifth state, and removal probability of 0.36 ( e 1 ), which purportedly renders jackknife and bootstrap values comparable (Farris et al. 1996). Maximum likelihood. Multiple sequence alignments for maximum-likelihood analyses were performed in MAFFT online v7 using the G-INS-i strategy, which is considered appropriate for alignments that consist of large numbers of sequences (Katoh et al. 2005; Katoh and Standley 2013). The G-INS-i strategy performs global alignment with a Fast Fourier Transform approximation progressively on a guide tree (modified UPGMA) followed by iterative edge refinement that evaluates the consistency between the multiple alignment and pairwise alignments. The iterative refinement is repeated until no improvement is observed in the weighted sum-of-pairs score or 1000 cycles are completed (maxiterate ¼ 1000). We applied the default transition:transversion cost ratio of 1:2 but changed the gap opening penalty from 3 times substitutions to 1 time substitutions to avoid penalizing insertions and deletions more than we did in the parsimony analysis. We used PartitionFinder v1.0.1 (Lanfear et al. 2012) to select the optimal partition scheme and substitution models for our data set under the Akaike Information Criterion (AIC), the Bayesian Information Criterion (BIC), and the Corrected Akaike Information Criterion (AIC c ). Compared partition schemes were (1) all data combined; (2) a 2- partition, mtdna/nudna, scheme; (3) by locus (each partition corresponding to individual loci mentioned above); and, (4) by locus and codon position (for protein coding genes). Adaptive maximum-likelihood tree searches and 1000 bootstrap replicates were performed using random-addition sequence replicates in GARLI v2.0 (Zwickl 2006) through the GARLI Web Server (Bazinet et al. 2014). Gaps were treated as missing data (i.e., absence of evidence). Uncorrected p-distances were estimated in Mega v4.0 (Tamura et al. 2007) for the aligned 16S fragment (1478 bp). RESULTS Morphology The analysis of qualitative morphological characters of 350 specimens (Appendix I) supports the four currently recognized species of Lynchius: L. flavomaculatus, L. nebulanastes, L. parkeri, and L. simmonsi; and it further indicates the existence of two new species. A description of the conditions for the different characters for each species is provided in form of a new diagnosis below, and a summary of these is provided in form of a dichotomous key for rapid identification of species. Two new species are diagnosed, described, and named below. The addition of these two species along with the recent addition of L. simmonsi (Padial et al. 2012), further supported by our phylogenetic analyses, renders the current diagnosis of Lynchius (Hedges et al. 2008; Duellman and Lehr 2009) incomplete and we therefore provide a new one. Phylogenetic Analyses The final data set included 61 terminals. Parsimony tree searches identified an optimal tree of 11,274 steps that was visited 4693 times during 1441 rounds of build þ TBR, 31,013 of fusing, and 825 of ratchet. A round of swapping under iterative pass optimization recovered a single tree of 11,222 steps and a tree-alignment of 7959 characters. Additional searches of the tree-alignment in TNT rendered 6 trees of the same length and 55 nodes each (strict consensus shown as Fig. 1A). The optimal MAFFT similarity-alignment comprises 7145 character columns. The AIC, AIC c, and BIC in Partition Finder identified the 2-partition (mtdna/nudna) scheme with GTR þ I þ G substitution model for coding and noncoding mtdna and TIM þ I þ G for nudna as the most optimal partition scheme (values for the different information criteria: AIC, ; AIC c, ; BIC, ). Under the selected partition scheme and substitution models, the best maximum likelihood was found once during 10 adaptive searches in GARLI (maximum likelihood score of the optimal tree ¼ 54, ; Fig. 1B). Parsimony and maximum likelihood character optimizations recover a monophyletic Lynchius as the sister group of Oreobates. These two monophyletic genera form the sister group of Phrynopus. Within Lynchius, parsimony and maximum likelihood recover L. simmonsi as the sister group of the remaining species. Also, both analyses recover one of the new species (L. tabaconas) as the sister group of L. flavomaculatus (separated by uncorrected p-distances of 6.0%; Table 3). However, the position of L. nebulanastes and L. parkeri differ between the two analyses. Parsimony recovers L. oblitus as the sister group of L. flavomaculatus plus L. tabaconas, while it is the sister group of L. parkeri in maximum likelihood (separated by uncorrected p-distances of 9 10%; Table 3). Regardless of these discrepancies, both analyses support the monophyly of the two new species. Within Phrynopus, most relationships are identical between the two analyses, but differ with respect to the position of P. auriculatus, P. heimorum, and P. tribulosus. Several relationships also differ among species of Oreobates. Oreobates ayacucho is the sister species of O. lehri, O. machiguenga, and O. gemcare in parsimony, while it is sister to O. lundbergi and O. pereger in maximum likelihood. Also, O. remotus is the sister species of O. berdemenos in parsimony and of O. crepitans in maximum likelihood. Oreobates heterodactylus and O. crepitans are sister in parsimony, while O. heterodactylus is the sister species of O. berdemenos in maximum likelihood. Also, while O. discoidalis and O. barituensis are sister in parsimony, the latter is sister to O. ibischi in maximum likelihood. Within the rest of outgroups there are differences in the position of Bryophryne, Hypodactylus, and Psychrophrynella. Bryophryne is recovered as the sister group of Barycholos and Noblella in parsimony, while it is sister to Euparkerella and Holoaden in maximum likelihood. Hypodactylus is recovered as paraphyletic near the root of the tree in maximum likelihood analyses, while it is recovered as the sister group of the clade that includes Lynchius, Oreobates, and Phrynopus in parsimony analyses. Psychrophrynella is

5 MOTTA ET AL. PHYLOGENETICS AND TAXONOMY OF LYNCHIUS 123 FIG. 1. Phylogenetic trees resulting from the analysis of data sets of 7959 aligned bp (POY) and 7145 aligned bp (MAFFT) and composed of the mitochondrial genes 12S, 16S, the intervening trna val, and trna leu segments, a fragment of the coding mtdna gene cytb, and fragments of the nuclear protein-coding genes c-myc (exons 2 and 3), POMC, RAG1, and Tyr. (A) Maximum parsimony optimal tree of 11,222 transformations depicting the relationships of species of Lynchius and other genera of Holodeninae. Numbers above ancestral branches indicate Goodman Bremer values, and those under branches are Jackknife proportions (asterisks represent Jackknife values of 100%). (B) Maximum likelihood optimal tree (log likelihood ¼ ) and bootstrap node values.

6 124 Herpetological Monographs 30, 2016 TABLE 3. Uncorrected pairwise distances (%) for a fragment of the 16S gene compared among species of Lynchius (1) Lynchius tabaconas MHNC8637 (2) Lynchius tabaconas MHNC (3) Lynchius oblitus MHNC (4) Lynchius oblitus MHNC (5) Lynchius oblitus MHNC (6) Lynchius flavomaculatus (7) Lynchius nebulanastes (8) Lynchius parkeri found as the sister group of a clade that includes Hypodactylus, Lynchius, Oreobates, and Phrynopus in parsimony, while it is sister to a clade that includes Barycholos, Bryophryne, Euparkerella, Holoaden, and Noblella in maximum likelihood. It is important to consider, however, that type species of the genera Noblella and Psychrophrynella have not yet been included in any molecular phylogenetic analysis and, therefore, the monophyly of these two genera remains to be tested. SYSTEMATIC ACCOUNTS Lynchius Hedges, Duellman and Heinicke 2008 Diagnosis. The genus Lynchius includes species with the following characteristics: skin on dorsum of head, body, and limbs shagreen with few scattered tubercles, covered with uniform-sized spicule-like warts in L. simmonsi; occipital folds /\ or \/-shaped, when present; middorsal fold present; dorsolateral fold present or absent; venter smooth to areolate; discoidal fold present; tympanic membrane and annulus distinct or indistinct; supratympanic fold and postrictal tubercles present or absent; head as long as wide or slightly longer than wide; snout round to nearly truncate in dorsal view, and rounded or curved anteroventrally in lateral profile; canthus rostralis weakly concave in dorsal view; cranial crests present or absent; upper eyelid with or without small scattered tubercles; dentigerous process of the vomers prominent, slightly oblique, situated posteromedial to choanae, each process bearing 2 8 teeth; males without nuptial pads, vocal slits present or absent; first finger as long as, shorter than, or longer than second; subarticular tubercles prominent, round or conical; supernumerary tubercles round, smaller than subarticular tubercles; tips of fingers narrowly round; pads, circumferential grooves, lateral fringes, and hand webbing usually absent (present on Fingers I and II in L. flavomaculatus); ulnar tubercle absent; palmar tubercle rounded or divided in two subunits; thenar tubercle prominent, elliptical; foot length 42 60% of SVL; Toe III longer than Toe V; tips of toes narrowly rounded, lacking pads and circumferential grooves; toe lateral fringes and webbing absent; inner metatarsal tubercle elongate, prominent; outer metatarsal tubercle round, prominent, slightly smaller than or about the same size as inner; heel and tarsal tubercles absent; frontoparietals with or without exostosis; vomers bearing a broad dentigerous process, widely separated from each other, and bearing a row of teeth. Reproduction by terrestrial eggs and direct-development. Content. Lynchius flavomaculatus (Parker 1938), L. nebulanastes (Cannatella 1984), L. oblitus, L. parkeri (Lynch 1975), L. simmonsi (Lynch 1974), and L. tabaconas. Distribution. Montane forests, cloud forests, and paramos of the Andes of Peru and Ecuador, along the Cordillera de Huancabamba, Cordillera del Cóndor, and Cordillera Oriental at elevations between 1800 m and 3300 m. Lynchius flavomaculatus (Parker 1938) (Figs. 2A B) Eleutherodactylus flavomaculatus Parker 1938 Niceforonia flavomaculata: Lynch 1969 Phrynopus flavomaculatus: Lynch 1975 Eleutherodactylus flavomaculatus: Lehr 2006 Eleutherodactylus flavomaculatus: Heinicke et al Lynchius flavomaculatus: Hedges et al Holotype. BMNH (formerly ), adult female from 15 km East of Loja City, Ecuador, 3100 m, collected by C. Carrión (Figs. 2A B). Diagnosis. A large Lynchius (adult females SVL ¼ mm, n ¼ 31; adult males SVL ¼ mm, n ¼ 27) characterized as follows: (1) skin on dorsum of head, body, and limbs shagreen, with few scattered tubercles that are more abundant posteriorly; occipital folds absent; middorsal fold complete or incomplete when present; dorsolateral folds absent; venter smooth to weakly areolate; groin smooth; discoidal and thoracic folds present; (2) tympanic membrane and annulus distinct, its diameter 42 53% of eye diameter; supratympanic fold low; postrictal tubercles present; (3) head as long as wide or slightly longer than wide (HW/HL ¼ ); snout round in dorsal and lateral views; canthus rostralis weakly concave in dorsal view; loreal region concave, sloping gradually toward the lips; lips not flared; (4) cranial crests present; upper eyelid covered by small scattered tubercles; (5) dentigerous process of vomers prominent, slightly oblique, situated posteromedial to choanae, each process bearing 5 6 teeth; (6) males with vocal slits on each side of the tongue and no nuptial pads; (7) fingers long and slender, first finger as long as second; subarticular tubercles prominent, round; supernumerary tubercles round, smaller than subarticular tubercles; tips of fingers narrowly round; pads present in Fingers I and II; circumferential grooves, lateral fringes, and hand webbing absent; (8) ulnar tubercle absent; (9) palmar tubercle divided in two subunits, the inner subunit much larger than the outer; thenar tubercle prominent, elliptical; (10) foot length ~50% of SVL, lateral fringes and webbing absent; Toe III longer than Toe V; Toe III usually reaching the distal border of second subarticular tubercle oftoeiv,toevreachingtheproximalborderofsecond subarticular tubercle of Toe IV; subarticular tubercles prominent, round; supernumerary tubercles absent; tips of

7 MOTTA ET AL. PHYLOGENETICS AND TAXONOMY OF LYNCHIUS 125 FIG. 2. Adult female holotype of Lynchius flavomaculatus (BMNH , SVL ¼ 39.4 mm; A B), adult female holotype of L. nebulanastes (KU , SVL ¼ 35.0 mm; C D), and adult male holotype of L. parkeri (KU , SVL 22.2 mm; E F). A color version of this figure is available online.

8 126 Herpetological Monographs 30, 2016 FIG. 3. Geographic distribution of six species of Lynchius. Solid symbols represent the type locality of each species. Area above 500 m in light gray and area above 1000 m in dark gray. toes narrowly rounded, lacking pads and circumferential grooves; (11) inner metatarsal tubercle elongate, prominent; outer metatarsal tubercle slightly smaller, round, prominent; subarticular tubercles round, prominent; supernumerary tubercles absent; (12) heel and tarsal tubercles absent; (13) in life, dorsum mottled dark yellow and reddish brown with indistinct yellow bars on limbs, head, and upper lips; dark brown transversal bars on limbs; flanks yellow with brown spots; venter grayish brown, belly with conspicuous yellow blotches, also present on ventral surfaces of limbs; yellow blotches on groin and anterior surfaces of thighs; Fingers I and II yellow dorsally and ventrally; iris pale green with black reticulations; in preservative, dorsum dark brown with a light brown spotted pattern; indistinct cream bars on limbs and upper lips; interorbital bar light brown, when present; some specimens with a cream middorsal stripe extending to posterior surface of thigh; throat and belly brown; belly with conspicuous cream blotches (yellow in life), in some specimens coalescing completely, turning belly uniformly cream; cream blotches on groin and ventral surface of limbs; Fingers I and II white. Distribution and ecology. Lynchius flavomaculatus is known to occur in paramos at m on the Cordillera Occidental in southeastern Ecuador (provinces of Loja, Zamora-Chinchipe, and Morona-Santiago; Fig. 3). Lehr (2006) recorded one specimen from the Río Blanco Basin (3100 m) in Province of Huancabamba, Department of Piura, Peru. This species is terrestrial, occurring in grasslands of the Paramo ecoregion (Lynch 1975; Duellman and Lehr 2009). Females produce large unpigmented eggs, suggesting that they undergo direct development without larval phase (Lynch 1969). Remarks. Parker (1938) provided an accurate description of the holotype and also described the intraspecific variation, especially regarding coloration. He described the skin as smooth in ventral and dorsal surfaces, although our observations indicate otherwise (see diagnoses). Lynch (1969) noted that males lack nuptial pads, while Lehr (2006) mentioned the presence of nuptial pads in males. Our re-examination of specimens (including KU119737, the specimen in fig. 6, Lehr 2006:339) failed to find nuptial pads. Lynch (1975) provided a brief description of the cranial osteology (only four characters) and a drawing of the skull in dorsal view. Duellman and Lehr (2009) list the discoidal fold as absent and eyelid as lacking tubercles, but our examination of specimens (listed in Appendix I) indicates otherwise. They also provide a picture of a live specimen from the type locality (their fig. 71, 2009:87).

9 MOTTA ET AL. PHYLOGENETICS AND TAXONOMY OF LYNCHIUS 127 Lynchius nebulanastes (Cannatella 1984) (Figs. 2C D) Phrynopus nebulanastes Cannatella 1984 Eleutherodactylus nebulanastes: Lehr 2005 Eleutherodactylus nebulanastes: Heinicke et al Lynchius nebulanastes: Hedges et al Holotype. KU , adult female from El Tambo, 31.5 km East of Conchaque, 2700 m, Departamento Piura, Peru (Figs. 2C D), collected by T.J. Berger, D.C. Cannatella, and W.E. Duellman on 27 February 1979 (fig. 72 in Duellman and Lehr 2009). Diagnosis. A moderately large species of Lynchius (adult females SVL ¼ mm, n ¼ 10; adult males SVL ¼ mm, n ¼ 10) characterized as follows: (1) skin on dorsum of head, body, and limbs shagreen, with scattered tubercles, more abundant posteriorly; shanks bearing abundant small tubercles, in some specimens larger and wart-like; occipital folds absent; middorsal fold from the end of head to cloacal region; lateral folds present; dorsolateral fold long and discontinuous; venter and groin smooth; discoidal and thoracic folds present; (2) tympanic membrane and annulus indistinct; supratympanic fold low, extending behind the tympanic region; postrictal tubercles present, in a row; (3) head as long as wide or slightly longer than wide (HW/HL ¼ ); snout short, round in dorsal and lateral views; canthus rostralis weakly concave in dorsal view; (4) cranial crests absent; upper eyelid covered by small scattered tubercles; (5) dentigerous process of vomers prominent, slightly oblique, situated posteromedial to choanae, each process bearing 3 5 teeth; (6) males lacking vocal slits and nuptial pads; (7) fingers long and slender, first finger as long as second; subarticular tubercles prominent, round; supernumerary tubercles large, round, smaller than subarticular tubercles; tips of fingers narrowly round; pads, circumferential grooves, lateral fringes, and hand webbing absent; (8) ulnar tubercle absent; (9) palmar tubercle divided in two subunits, inner subunit much larger than outer; thenar tubercle prominent, elliptical; (10) foot length 50 60% of SVL, lateral fringes and foot webbing absent; Toe III longer than Toe V; Toe III usually reaching distal margin of second subarticular tubercle of Toe IV, Toe V reaching middle of second subarticular tubercle of Toe IV; subarticular tubercles prominent, round; supernumerary tubercles absent; tips of toes narrowly rounded, lacking pads and circumferential grooves; (11) inner metatarsal tubercle elongate, prominent; outer metatarsal tubercle smaller, round, prominent; subarticular tubercles round, prominent; supernumerary tubercles absent; (12) heel and tarsal tubercles absent; (13) in life, dorsum brown, reddish brown or dark green; some specimens with cream middorsal stripe extending to posterior surface of thigh and shank, sometimes reaching plantar surface; flanks cream with black mottling; limbs light brown; canthus rostralis dark brown to black; light brown bar parallel to upper lip; venter greenish yellow with brown or gray mottling; ventral surfaces of limbs and spots on groin and thighs bright yellow; iris dull bronze; in preservative, dorsum brown with black and pale spots; canthus rostralis dark brown; belly cream; throat light brown to pale. Distribution and ecology. Lynchius nebulanastes occurs in humid forests from 2779 m to 2820 m elevation on the western slopes of the Cordillera de Huancabamba (Fig. 3). According to Cannatella (1984), specimens were found under rocks in disturbed elfin forests, and the male advertisement call sounds like a tick tick tick. Remarks. Cannatella (1984) provided an accurate description of this species, but our diagnosis (based on specimens listed in Appendix I) includes several characters that differ from the original description in some respects (Cannatella s observations in parenthesis): dorsal skin shagreen with scattered tubercles (skin of dorsum smooth); palmar tubercle divided (not bifid); and snout round (subacuminate in dorsal view and sloping in lateral profile). According to the original description, L. nebulanastes has tympanic annulus, columella, and cavum tympanum, its tympanum is concealed by the skin, and males lack vocal sacs (Cannatella 1984). The original description also includes a picture of the holotype and a male paratype, a drawing of dorsal and ventral view of the cranium, and a brief description of cranial osteology, including the description of the frontoparietal as not rugose. Although the drawings show the nasals without contact (state observed by us after examination of the same specimen, KU ), Cannatella (1984) described the nasals as having median contact. Lehr (2005) noted that circumferential grooves were present on fingers and toes, as well as lateral fringes, but our observations contradict those character states. Duellman and Lehr (2009) report the discoidal fold as absent and eyelid as lacking tubercles, but our examination of specimens reveals both structures to be present. They also provide a picture of a live specimen from the type locality (their fig. 72, 2009:89). Lynchius oblitus sp. nov. (Figs. 4, 5) Phrynopus sp. n. 1: Lehr et al Phrynopus parkeri: Lehr 2006 [misidentification]. Lynchius sp.: Hedges et al Lynchius sp.: Padial et al Holotype. MHNC 8674, an adult female from Quebrada del Vino, 22 km West from San Ignacio, inside of National Sanctuary of Tabaconas-Namballe (NSTN), District Namballe, Province San Ignacio, Department of Cajamarca, Peru, 3270 m ( S, W; Figs. 4, 5), collected by A. Pari and K. Pino, on 26 October Paratypes. Five adult males: MHNC 8614 from Laguna Victoria (NSTN), District Tabaconas, Province San Ignacio, Department of Cajamarca, Peru, 3297 m ( S, W), collected by J. Delgado, on 5 October 2009; MHNC 8652 from Quebrada del Vino, 22 km West from San Ignacio (NSTN), District Namballe, Province San Ignacio, Department of Cajamarca, Peru, 2950 m ( S, W), collected by J.C. Chaparro, on 18 October 2009; MHNC 8676 from Quebrada del Vino, 22 km West from San Ignacio (NSTN), District Namballe, Province San Ignacio, Department of Cajamarca, Peru, 3270 m ( S, W), collected by A. Pari and K. Pino, on 7 October 2009; MHNSM and MTD from Lagunas Arrebiatadas (NSTN), Province San Ignacio,

10 128 Herpetological Monographs 30, 2016 FIG. 4. Adult female holotype of Lynchius oblitus (MHNC 8674, SVL ¼ 25.5 mm) from Santuario Nacional Tabaconas-Namballe, Cajamarca, Peru, 3300 m ( S, W). A color version of this figure is available online. Department of Cajamarca, Peru. Three adult females: MHNC 8601 (Fig. 6) from Laguna Victoria (NSTN), District Tabaconas, Province San Ignacio, Department of Cajamarca, Peru, 3291 m ( S, W), collected by J. Delgado, on 4 October 2009; MHNC 8675 and MHNC 8677 from Quebrada del Vino, 22 km West from San Ignacio (NSTN), District Namballe, Province San Ignacio, Department of Cajamarca, Peru, 3291 m ( S, W), collected by A. Pari and K. Pino, on 7 October Referred specimens. Six specimens: MHNC , MHNC 8602, MHNC 8606, MHNC from the same locality and data as paratype MHNC Four specimens: MHNC , MHNC from Quebrada del Vino, 22 km West from San Ignacio (NSTN), District Namballe, Province San Ignacio, Department of Cajamarca, Peru, 2950 m ( S, W), collected by J.C. Chaparro, on 17 October Diagnosis. A small Lynchius (SVL of adult females mm, n ¼ 4; adult male 21.7 mm; see Table 4), characterized as follows: (1) skin on dorsum of head, body, and limbs shagreen, with few scattered tubercles; occipital folds \/-shaped; middorsal fold present; middorsum bearing folds,.-shaped or w-shaped; dorsolateral folds long and discontinuous; venter smooth; groin smooth; discoidal and thoracic folds present; (2) tympanic membrane and annulus distinct, its diameter 45 56% of eye diameter; supratympanic fold poorly defined; postrictal tubercles absent; (3) head as long as wide or slightly longer than wide (HW/ HL ¼ 1.0); snout broadly rounded in dorsal view and curved anteroventrally in lateral profile; canthus rostralis weakly concave in dorsal view; (4) cranial crests present; upper eyelid without tubercles; (5) dentigerous process of vomers prominent, slightly oblique, situated posteromedial to choanae, each process bearing 2 3 teeth; (6) males lacking vocal slits and nuptial pads; (7) hands with short fingers, first finger as long as or shorter than second; subarticular tubercles prominent, round; supernumerary tubercles present; tips of fingers narrowly round; pads, circumferential grooves, lateral fringes, and hand webbing absent; (8) ulnar tubercle absent; (9) palmar tubercle divided in two subunits, inner subunit much larger than outer; thenar tubercle prominent, elliptical; (10) foot length ~45% of SVL; lateral fringes and toe webbing absent; Toe III longer than Toe V; Toe III usually reaching middle of second subarticular tubercle of Toe IV, Toe V reaching proximal border of second subarticular tubercle of Toe IV; subarticular tubercles low, round; supernumerary tubercles absent; tips of toes narrowly rounded, lacking pads and circumferential grooves; (11) inner metatarsal tubercle elongate, prominent;

11 MOTTA ET AL. PHYLOGENETICS AND TAXONOMY OF LYNCHIUS 129 FIG. 5. Lynchius oblitus sp. nov. Ventral views of left hand (A) and right foot (B) of holotype (MHNC 8674). outer metatarsal tubercle round, about the same size as inner; subarticular tubercles round, low; supernumerary tubercles absent; (12) heel and tarsal tubercles absent; (13) in preservative, dorsal surfaces brown; light brown,.- shaped or w-shaped occipital mark; canthus rostralis dark brown, a dark brown stripe posterior to eyes; hind limbs brown with dark brown bars; throat cream with brown mottling or uniformly cream; belly and ventral surfaces of limbs cream with dark brown blotches. Coloration in life (based on MHNC 8601) follows the same pattern observed in specimens in preservative. However, in life the cream areas are yellowish, dorsal surfaces are light brown to orange, and dorsal marks are cream and surrounded by dark brown. Iris greenish brown with dark brown reticulations. Comparisons. The new species differs from Lynchius flavomaculatus (characters of this and other species in parentheses) by its small size, with SVL,29 mm in females and,21.7 mm in male (females SVL ¼ mm; males SVL ¼ mm) and by bearing occipital folds and folds on middorsum (absent). Lynchius oblitus can be distinguished from L. nebulanastes and L. parkeri by having a distinct tympanum (indistinct), cranial crests (absent), yellow mottling on venter (absent), and by bearing occipital folds and folds on middorsum (absent). From L. simmonsi, it differs by its small size, with SVL,29 mm in females and,21.7 mm in male (females SVL ¼ mm; male SVL ¼ 28.3 mm), rounded plantar tubercles (conical), skin on dorsum shagreen with scattered tubercles (dorsum covered with uniform-sized spicule-like warts), occipital and dorsolateral folds (absent), folds on middorsum (absent), lateral fringes on fingers and toes absent (present), and yellow mottling on venter (venter brown). Lynchius oblitus differs from L. tabaconas by having occipital folds, folds on middorsum, and cranial crests (absent). Description of holotype. Head as long as wide (HW/ HL ¼ 1.0); snout rounded in dorsal view and curved anteroventrally in lateral profile; nostrils not protuberant, oriented laterally; canthus rostralis weakly concave in dorsal view, round in frontal profile; loreal region concave; lips not flared; upper eyelid with few small granules; cranial crests present. Supratympanic fold weakly distinct; tympanic membrane and annulus distinct; tympanic membrane nearly round, its length more than half of eye length; postrictal tubercles absent. Choanae not concealed by palatal shelf of the maxillary arch when roof of mouth is viewed from below; choanae small, round, separated by a distance equal to six times the diameter of choana; dentigerous process of the vomers prominent, oblique, situated posteromedial to choanae (posterior margin at level of choanae), their width approximately two times diameter of choanae, bearing 2 or 3 vomerine teeth. Skin of dorsal surfaces shagreen, with few scattered tubercules on dorsum; ventral surfaces smooth; thighs coarsely areolate posteriorly in ventral view; occipital fold \/-shaped; middorsum bearing folds,.-shaped; dorsolateral folds present, complete; discoidal fold poorly defined; thoracic fold present. Ulnar tubercle absent; palmar tubercle completely divided in two subunits, inner subunit much larger than outer; thenar tubercle prominent, elliptical; subarticular tubercles round, larger than supernumerary tubercles; finger tips narrowly rounded; pads weakly present, circumferential grooves absent; fingers lacking lateral fringes and webbing; relative length of fingers: I, II, III. IV. Foot length 45% of SVL; heel and tarsus lacking tubercles or

12 130 Herpetological Monographs 30, 2016 FIG. 6. Adult female paratype of Lynchius oblitus (MHNC 8601) from Santuario Nacional Tabaconas-Namballe, Cajamarca, Peru, 3300 m ( S, W). Dorsal (A) and ventral (B) views. Photo: Nature Consulting SAC. A color version of this figure is available online. folds; inner metatarsal tubercle oval, prominent, larger than outer metatarsal tubercle; outer metatarsal tubercle round; toes lacking lateral fringes and webbing; toe tips narrowly rounded; pads and circumferential grooves absent; relative length of toes: I, II, III. V, IV; Toe V reaching proximal margin of second subarticular tubercle of Toe IV, and Toe III reaching its middle. In preservative, dorsal surfaces brown, a cream,.-shaped occipital mark; head as dorsum, canthus rostralis dark brown, almost black; dark brown stripes posterior to eye. Hind limbs brown with dark brown bars; forelimbs light brown with dark brown spots. Throat and belly brown with cream mottling; ventral surfaces of limbs dark brown with cream blotches that run together on thighs and forelimbs. Variation. The only male examined (MTD 45954) has a brown venter with few cream dots, cream mottling posterior to eyes, and hind limbs brown without bars. For variation in measurements, see Table 4. Etymology. The specific epithet oblitus, a Latin verb in the past participle form meaning forgotten, neglected, refers to the fact that this species has been known to exist for.10 TABLE 4. Morphometrics of Lynchius oblitus (in mm). MHNC 8674 MHNC 8601 Females MHNC 8675 MHNC 8677 Male MTD Snout vent length Head length Head width Eye length Eye-to-nostril distance Internarial distance Eye-to-eye distance Tympanic membrane height Tympanic membrane length Width of disc of Finger III Width of disc of Finger IV Arm length Tibia length Thigh length Foot length Width of disc of Toe IV yr, but was not named and described until now. We wish to highlight the fact that an increasing number of species are being labeled as candidate species while their formal descriptions are neglected or postponed, hampering the incorporation of these species into empirical analyses of species diversity, evolution, and conservation. Distribution and ecology. This species is known from the type locality, which belongs to sector Namballe, in Tabaconas-Namballe National Sanctuary, and an area between 2800 m to 3297 m in sector Tabaconas, within the ecotone of paramo (above 3100 m) and dwarf forest or montane evergreen forest (below 3100 m; Fig. 3) in the northern Andes. Specimens were observed walking on the leaf litter during the night in montane cloud forests and paramo. They were captured by hand or pitfall traps. Females lay eggs under leaf litter and inside of plant roots and the eggs undergo direct development. Lynchius oblitus occurs in sympatry with Gastrotheca monticola and Pristimantis bellator in sector Tabaconas and with G. monticola, P. bustamante, P. schultei, and L. tabaconas in sector Namballe. Remarks. Specimens MTD and MHSNM were first identified as Phrynopus sp. 1 by Lehr et al. (2005). Subsequently, Lehr (2006) considered them males of Lynchius parkeri and reported them as the first record of this species for the Departamento of Cajamarca, Peru. Hedges et al. (2008) and Padial et al. (2014) referred to MTD as Lynchius sp. ; they did not find it nested with L. parkeri, but as the sister group of a clade formed by L. flavomaculatus, L. parkeri, and L. nebulanastes. We consider MHSNM as part of L. oblitus based on phylogenetic analyses, and MTD to be L. oblitus based on both phylogenetic analyses and external morphology. Lynchius parkeri (Lynch 1975) (Figs. 2E F) Phrynopus parkeri Lynch 1975 Lynchius parkeri: Hedges et al Holotype. KU , adult male from the summit of the cordillera between Canchaque and Huancabamba,

13 MOTTA ET AL. PHYLOGENETICS AND TAXONOMY OF LYNCHIUS 131 Departamento of Piura, Peru, 3100 m (Figs. 2E F), collected by Thomas H. and P.R. Fritts on 11 May Diagnosis. A small Lynchius (adult females SVL ¼ mm, n ¼ 40; adult males SVL ¼ mm, n ¼ 35) characterized as follows: (1) skin on dorsum of head, body, and limbs shagreen, with few scattered tubercles; shank with transversal folds; occipital folds /\-shaped, when present; middorsal and dorsolateral folds long and discontinuous; when present; venter smooth to weakly areolate; discoidal and thoracic folds present; (2) tympanic membrane and annulus indistinct; supratympanic fold poorly defined; postrictal tubercles present, forming a low row; (3) head as long as wide or slightly longer than wide (HW/HL ); snout round in dorsal and lateral views; canthus rostralis weakly concave in dorsal view; (4) cranial crests absent; upper eyelid tubercles absent; (5) dentigerous process of vomers prominent, slightly oblique, situated posteromedial to choanae, each process bearing 2 4 teeth; (6) males lacking vocal slits and nuptial pads; (7) hands with long and slender fingers, first finger as long as or shorter than second; subarticular tubercles prominent, round; supernumerary tubercles round, smaller than subarticular tubercles; tips of fingers narrowly round; pads, circumferential grooves, lateral fringes, and hand webbing absent; (8) ulnar tubercle absent; (9) palmar tubercle completely divided in two subunits, inner subunit much larger than outer; thenar tubercle prominent, elliptical; (10) foot length 42 51% of SVL, lateral fringes and webbing absent; Toe III longer than Toe V; Toe III usually reaching distal margin of second subarticular tubercle of Toe IV, Toe V reaching middle of second subarticular tubercle of Toe IV; subarticular tubercles prominent, round; supernumerary tubercles present; tips of toes narrowly rounded, lacking pads and circumferential grooves; (11) inner metatarsal tubercle elongate, prominent; outer metatarsal tubercle round, prominent, about the same size as inner; subarticular tubercles round, prominent; supernumerary tubercles usually absent; (12) heel and tarsal tubercles absent; (13) in life, dorsum coloration gray, reddish or grayish brown, or dark brown; flanks dark brown with metallic green mottling; posterior surfaces of thighs dark brown to black with yellow spots and blotches; venter dark gray to black with large yellow blotches on belly in males, yellow with brown reticulations on belly in females; canthus rostralis dark brown; cream labial stripe present; iris dark brown; in preservative, dorsum light brown to grayish brown; dorsum usually lighter than flanks; some specimens with two cream dorsal bars on middorsum; light brown bar parallel to upper lip; belly cream mottled with brown; throat light brown; some specimens with a middorsal stripe extending to posterior surface of thigh and shank, sometimes reaching plantar surface. Distribution and ecology. Lynchius parkeri is known at elevations from 2700 m to 3100 m on the Cordillera de Huancabamba in Peru (Fig. 3). It occurs in cloud forests and paramos, where it has been found under rocks and within low vegetation. The advertisement call is a soft chirp (Duellman and Lehr 2009). Remarks. Lynch (1975) provides an accurate description of this species, but our diagnosis includes a larger number of characters and differs from the original description in that we report dorsal skin texture as shagreen. Also, according to the original description, Lynchius parkeri has a tympanum concealed by skin. Lynch (1975) described males as having vocal slits and subgular vocal sac, whereas Cannatella (1984) failed to find vocal slits. Our observations also failed to find vocal slits. Lehr (2006) noted that males have nuptial pads, but we observed that both males and females have some rugosity on the dorsal surface of Finger I that does not constitute glandular tissue (observation based on specimens listed in Appendix I). Lynch (1975) presented a brief description of cranial osteology and a drawing of the skull in dorsal view. He considered the frontoparietals lacking rugosities, and they are shown as smooth on the drawing (Lynch 1975:26, his fig. 10). However, Cannatella (1984) found the frontoparietals to be rugose, an observation that agrees with our examination of the skull of two specimens (KU and KU ; Fig. 7). Lynchius simmonsi (Lynch 1974) (Fig. 8) Ischnocnema simmonsi Lynch 1974 Oreobates simmonsi: Caramaschi and Canedo 2006 Lynchius simmonsi: Padial et al Holotype. KU , young female from Río Piuntza, Cordillera del Cóndor, Provincia Morona-Santiago, Ecuador, 1830 m, collected by J.E. Simmons and B. MacBryde on 4 January Diagnosis. A moderately large Lynchius (adult females SVL ¼ mm, n ¼ 3; adult male SVL ¼ 28.3 mm; Table 5) characterized as follows: (1) skin on dorsum of head, body, and limbs covered with uniformly sized spicule-like warts, which are larger in males than in females; warts on flanks slightly flatter than those of dorsum; occipital folds absent; middorsal fold present on head of females and along head and body of males; dorsolateral folds absent; venter areolate, discoidal fold present; (2) tympanic membrane and annulus distinct, its length 54 57% of eye length; supratympanic fold low, covering upper-posterior margin of tympanic annulus; postrictal tubercles present; (3) head large, as wide as long; snout short, round to nearly truncate in dorsal view and rounded in lateral view; canthus rostralis weakly concave in dorsal view; loreal region concave; lips not flared; (4) cranial crests absent; upper eyelid covered by same spicule-like warts as in dorsum; (5) dentigerous process of vomers large, situated posteromedial to choanae, each process bearing 4 8 teeth; (6) males with small vocal slits and no nuptial pads; (7) hands with long and slender fingers, first finger longer than second; subarticular tubercles large, prominent, conical; supernumerary tubercles large, prominent, round to conical, smaller than subarticular tubercles; skin on palmar surface covered by small, round warts; tips of fingers narrowly rounded, lacking pads and circumferential grooves; fingers with keel-like lateral fringes; (8) ulnar tubercles absent; (9) palmar tubercle prominent, bifid distally, with inner subunit larger than outer; thenar tubercle prominent, elliptical; (10) foot length 45 49% of SVL, lateral fringes present, webbing absent; Toe III longer than Toe V; Toe III usually reaching midpoint of second subarticular tubercle of Toe IV, Toe V reaching or nearly reaching proximal border of second subarticular tubercle of Toe IV; subarticular tubercles prominent, conical; supernumerary tubercles present; tips of toes narrowly rounded, lacking pads and circumferential grooves; (11) inner metatarsal

14 132 Herpetological Monographs 30, 2016 Finally, most specimens have a black dorsal coloration without evident dorsal marks. In the holotype description, Lynch (1974) mentioned that the dorsum is brownish black with diffuse brown areas (interocular bar, blotches on back) in preservative; this description is accurate for one of the newly collected specimens (QCAZ 30828), but the other three specimens have an almost solid black dorsum (Fig. 8). Distribution and ecology. Lynchius simmonsi was only known from the type locality. Here we report two additional populations along the Cordillera del Cóndor (Provincia Zamora-Chinchipe, Ecuador): Cóndor Mirador ( S, W, 1850 m), and Alto Miazi ( S, W, 1300 m; Fig. 3). This species probably occurs in adjacent Peru. Remarks. Lynchius simmonsi was first described by Lynch (1974) based on two specimens, a juvenile female (KU , holotype) and an unsexed juvenile from the same locality (KU ). No other information on L. simmonsi had been reported ever since. The diagnosis provided herein is based on the type material, three adult females (QCAZ 30828, 30829, 41639), and one adult male (QCAZ 41640) from Cordillera del Cóndor. Lynchius tabaconas sp. nov. (Figs. 9, 10, 11) FIG. 7. Skull of Lynchius parkeri. (A) KU in dorsal view (modified from Lynch, 1975:26, his fig. 10) and (B) a picture of the same skull; note ornamentation in frontoparietals. tubercle elongate, prominent; outer metatarsal tubercle smaller, round, prominent; subarticular tubercles prominent, conical; supernumerary tubercles smaller than subarticular tubercles; (12) heel and tarsal tubercles absent; (13) in life, dorsum brownish black to black, with or without dark brown marks (interorbital bar, occipital and sacral blotches); venter brown with small cream flecks; iris black with minute light blue spots and an orange circumpupilar ring; in preservative, dorsal coloration dark brown to black with or without diffuse brown areas (interocular bar, dorsal blotches), face with two or three diffuse labial bars and with or without small white spots; throat, chest, and belly pale brown to brown with small cream flecks. Variation. The specimens revised herein differ in some aspects from those described by Lynch (1974). Lynch (1974) mentioned a short sagittal interocular ridge; the trait is present in all females, but the only male known (QCAZ 41640) has a middorsal ridge that extends along the head and body. Low discoidal and supratympanic folds are evident in all examined specimens (reported as absent by Lynch 1974). Holotype. MHNC 8637, an adult female from Quebrada del Vino (NSTN), District Tabaconas, Province San Ignacio, Department of Cajamarca, Peru, 2745 m ( S, W), collected by J.C. Chaparro, on 16 October 2009 (Figs. 9, 10, 11A B). Paratype. MHNC 8650, an adult male, from Quebrada del Vino (NSTN), District Tabaconas, Province San Ignacio, Department of Cajamarca, Peru, 3115 m ( S, W), collected by J.C. Chaparro, on 17 October 2009 (Fig. 11C D). Referred specimen. MHNC 8649 from the same locality as the holotype. Diagnosis. A small Lynchius (adult female SVL ¼ 28.5 mm; adult male SVL ¼ 18.6 mm), characterized as follows: (1) skin on dorsum of head, body, and limbs shagreen, with few scattered tubercles; occipital folds absent; middorsal fold complete; dorsolateral folds present, complete; venter smooth; posterior ventral region of thighs coarsely areolate; groin smooth; discoidal fold present posteriorly, weak; thoracic fold absent; (2) tympanic membrane and annulus distinct, its diameter 48 58% of eye diameter; supratympanic fold poorly defined; postrictal tubercles present; (3) head slightly longer than wide (HW/HL ¼ ); snout broadly rounded in dorsal view, short and rounded in lateral profile; canthus rostralis weakly concave in dorsal view; (4) cranial crests absent; upper eyelid bearing few minute tubercles; (5) dentigerous process of vomers prominent, slightly oblique, situated posteromedial to choanae, each process bearing 5 or 6 teeth; (6) males lacking vocal slits and nuptial pads; (7) hands with slender fingers, first finger longer than second; subarticular tubercles prominent, round; supernumerary tubercles round, smaller than subarticular tubercles; tips of fingers narrowly round; pads, circumferential grooves, lateral fringes, and hand webbing absent; (8) ulnar tubercle absent; (9) palmar tubercle undivided, rounded; thenar tubercle prominent, elliptical; (10) foot

15 MOTTA ET AL. PHYLOGENETICS AND TAXONOMY OF LYNCHIUS 133 FIG. 8. Adult female of Lynchius simmonsi from Alto Miazi, 1300 m ( S, W), Zamora-Chinchipe, Ecuador (QCAZ 41639, SVL ¼ 40.1 mm). Dorsal (A) and ventral (C) views; ventral view of left hand (B). Photos: Santiago R. Ron. A color version of this figure is available online.

16 134 Herpetological Monographs 30, 2016 FIG. 9. Adult female holotype of Lynchius tabaconas (MHNC 8637, SVL ¼ 28.5 mm) from Santuario Nacional Tabaconas-Namballe, Cajamarca, Peru, 2745 m ( S, W). A color version of this figure is available online. length ~45% of SVL; lateral fringes and foot webbing absent; Toe III longer than Toe V; Toe III usually reaching middle of second subarticular tubercle of Toe IV, Toe V reaching proximal border of second subarticular tubercle of Toe IV; subarticular tubercles low, round; supernumerary tubercles absent; tips of toes narrowly rounded, lacking pads and circumferential grooves; (11) inner metatarsal tubercle elongate; outer metatarsal tubercle round, about the same size as inner; subarticular tubercles round, low; supernumerary tubercles absent; (12) heel and tarsal tubercles absent; (13) in life, dorsum of head, body, and limbs dark green with reddish-brown tubercles; canthus rostralis slightly darker than dorsum; middorsal stripe and dorsal surface of forelimbs reddish brown; males with transversal black bars on flanks, hind limbs, and groin; throat grayish brown with white and yellow mottling; belly grayish brown, female with dense yellow blotches and male with white and yellow mottling; ventral surfaces of limbs grayish brown with yellow blotches; yellow blotches also present on axillary region and groin; iris cooper or cooper with greenish border. In preservative, dorsum and dorsal surfaces of limbs grayish brown; middorsal stripe cream; flanks light brown with lighter spots; throat light brown with cream mottling; belly grayish brown, with yellow blotches and mottling cream. Comparisons. Lynchius tabaconas differs from L. flavomaculatus (characters of this and other species in parentheses) by its small size, with SVL ¼ 28.5 mm in female and 18.6 mm in male (females SVL ¼ mm; males SVL ¼ mm) and by lacking cranial crests (present). From L. nebulanastes and L. parkeri it differs by having the tympanum distinct (indistinct), lacking supernumerary tubercles (present), and having yellow blotches and/ or mottling on venter (absent). Lynchius tabaconas differs from L. simmonsi by its small size, with SVL ¼ 28.5 mm in female and 18.6 mm in male (females SVL ¼ mm; male SVL ¼ 28.3 mm), having rounded plantar tubercles (conical), skin on dorsum shagreen with scattered tubercles (dorsum covered with uniform-sized spicule-like warts), dorsolateral folds (absent), lateral fringes on fingers and toes absent (present), and yellow blotches and/or mottling on venter (absent). It differs from L. oblitus by lacking occipital folds, folds on middorsum, and cranial crests (present). Description of holotype. Head as long as wide (HW/ HL ¼ 1.0); snout rounded in dorsal view and in lateral profile; nostrils slightly protuberant, oriented laterally; canthus rostralis weakly concave in dorsal view, round in frontal profile; loreal region concave; lips not flared; upper eyelid with few small tubercles; cranial crests absent. Supratympanic fold indistinct; tympanic membrane and annulus weakly distinct; tympanic membrane nearly round, its length less than half of eye length; two small postrictal tubercles. Choanae not concealed by palatal shelf of the maxillary arch when roof of mouth is viewed from below; choanae small, round, separated by distance equal to six times the diameter of choana; dentigerous process of vomers prominent, oblique, situated posteromedial to choanae

17 MOTTA ET AL. PHYLOGENETICS AND TAXONOMY OF LYNCHIUS 135 TABLE 5. Morphometrics of Lynchius simmonsi (in mm). KU QCAZ Females QCAZ QCAZ Male QCAZ Snout vent length Head length Head width Eye length Eye-to-nostril distance 2.3 Internarial distance 2.2 Eye-to-eye distance 3.7 Tympanic membrane height 2.2 Tympanic membrane length Width of disc of Finger III 6.7 Width of disc of Finger IV Arm length 13.8 Tibia length 14.6 Thigh length FIG. 10. Lynchius tabaconas sp. nov. Ventral views of right hand (A) and right foot (B) of holotype (MHNC 8637). (posterior margin at level of choanae), their width about three times the diameter of choanae, bearing 5 or 6 vomerine teeth. Ulnar tubercle absent; palmar tubercle undivided, rounded; thenar tubercle prominent, elliptical; subarticular tubercles round, prominent, larger than supernumerary tubercles; finger tips narrowly rounded; pads and circumferential grooves absent; fingers lacking lateral fringes and webbing; relative length of fingers: I. II, III. IV. Toes slender (foot length 46% of SVL); heel and tarsus lacking tubercles or folds; inner metatarsal tubercle oval, prominent, about the same size as outer metatarsal tubercle; outer metatarsal tubercle round, low; toes lacking lateral fringes and webbing; toe tips narrowly rounded; pads and circumferential grooves absent; relative length of toes: I, II, III. V, IV; Toe V reaching proximal margin of second subarticular tubercle of Toe IV, and Toe III reaching its middle. Skin of dorsum and limbs shagreen with scattered tubercles; ventral surfaces smooth; thighs coarsely areolate posteriorly in ventral view; occipital fold absent; dorsolateral folds present, complete; discoidal fold present; no thoracic fold. In life, dorsum and dorsal surfaces of limbs dark green; a reddish-brown middorsal stripe extending along posterior surface of thigh and shank, here becoming lighter, and reaching plantar surface; head as dorsum, canthus rostralis slightly darker. Throat grayish brown with yellow spots; belly gray with dense yellow blotches; ventral surfaces of limbs grayish brown with yellow blotches; yellow blotches also present on axillary region and groin. In preservative, dorsum and dorsal surfaces of limbs grayish brown; middorsal stripe cream; flanks light brown with lighter spots; throat light brown, belly grayish brown with cream blotches and spots. Measurements (in mm, data for female holotype followed by male paratype in parentheses). SVL 28.5 (18.6), HL 10.8 (6.8), HW 10.4 (6.4), EL 3.2 (2.0), EN 3.0 (2.0), IND 2.4 (1.7), EE 4.4 (3.2), TyH 1.8 (1.4), TyL 1.5 (1.2), F3 0.5 (0.3), F4 0.4 (0.3), FA 6.1 (4.4), TB 12.3 (8.6), TH 12.5 (8.5), FL 13.2 (8.3), T4 0.5 (0.4). Variation. Based only on a single female and a single male, females are larger than males. In life, the male had dark ventral surfaces mottled with yellow and white and black bars on the flanks, groin, and hind limbs (absent in the female). Etymology. The specific epithet tabaconas is a noun that refers to the area of the type locality, Tabaconas-

18 136 Herpetological Monographs 30, 2016 FIG. 11. Adult female holotype of Lynchius tabaconas (MHNC 8637, SVL ¼ 28.5 mm; A B) and adult male paratype of Lynchius tabaconas (MHNC 8650, SVL ¼ 18.6 mm; C D) from Santuario Nacional Tabaconas-Namballe, Cajamarca, Peru, 2745 m ( S, W). A color version of this figure is available online. Namballe National Sanctuary, which was established in 1988 to protect the biodiversity and the role of the paramo ecosystem in the Cordillera de Huacabamba. Distribution and ecology. This species is only known from the type locality in the sector of Namballe inside Tabaconas-Namballe National Sanctuary, in an area between 2960 m and 3115 m, within the ecotone between the dwarf forest or montane evergreen forest (above 2700 m) and paramo (above 3100 m; Fig. 3) from northern Andes. Specimens were found on the ground of forests and captured through pitfall traps in the paramo. The new species occurs in sympatry with Gastrotheca monticola, Pristimantis bustamante, P. schultei, and Lynchius oblitus. See more details about vegetation in Chaparro et al. (2012). KEY TO SPECIES OF LYNCHIUS 1. Skin of dorsum covered with uniformly sized spicule-like warts; palmar and plantar tubercles conical... L. simmonsi Skin of dorsum shagreen, with scattered tubercles; palmar and plantar tubercles rounded Tympanic membrane and annulus distinct (i.e., not differentiated from surrounding skin)... 3 Tympanic membrane and annulus indistinct, tympanum concealed by skin Occipital folds \/-shaped; middorsum bearing,.- shaped or w-shaped folds... L. oblitus Occipital folds absent; middorsum lacking folds Large (adult females SVL ¼ mm; adult males SVL ¼ mm); cranial crests present; males with vocal slits...l. flavomaculatus Small (adult female SVL ¼ 28.5 mm; adult male SVL ¼ 18.6 mm); cranial crests absent; males lacking vocal slits...l. tabaconas 5. Legs long (TB/SVL, TH/SVL, and FL/SVL ¼ ); upper eyelid covered by small scattered tubercles; frontoparietals not rugose... L. nebulanastes Legs short (TB/SVL, TH/SVL, and FL/SVL ¼ ); upper eyelid not covered by small scattered tubercles; frontoparietals rugose... L. parkeri DISCUSSION The clade containing Lynchius, Oreobates, and Phrynopus constitutes a morphologically and ecologically diverse group of frogs with a broad distribution in South America.