Article.

Transcription

1 Zootaxa 3710 (5): Copyright 2013 Magnolia Press Article A new species of Lygodactylus (Squamata: Gekkonidae) endemic to Mount Namuli, an isolated sky island of northern Mozambique ISSN (print edition) ZOOTAXA ISSN (online edition) DANIEL M. PORTIK 1,6, SCOTT L. TRAVERS 2,3, AARON M. BAUER 2 & WILLIAM R. BRANCH 4,5 1 Museum of Vertebrate Zoology and Department of Integrative Biology, 3101 Valley Life Sciences Building, University of California, Berkeley, California 94720, United States 2 Department of Biology, Villanova University, 800 Lancaster Avenue, Villanova, Pennsylvania 19085, United States 3 Biodiversity Institute and Department of Ecology and Evolutionary Biology, University of Kansas, 1345 Jayhawk Boulevard, Lawrence, Kansas 66045, United States 4 Port Elizabeth Museum, P.O. Box 13147, Humewood 6013, South Africa 5 Department of Zoology, P.O. Box 77000, Nelson Mandela Metropolitan University, Port Elizabeth 6031, South Africa 6 Corresponding author. daniel.portik@berkeley.edu Abstract A new species of high elevation dwarf gecko (Gekkonidae: Lygodactylus) is described from Mount Namuli, northern Mozambique. This new species is distinguished from other closely related species in the genus Lygodactylus by body size, scalation, and color, and is genetically divergent from congeners. The species is most similar genetically and morphologically to Lygodactylus rex, the King Dwarf Gecko, which is endemic to Mount Mulanje, Malawi. Mount Mulanje and Mount Namuli are two of several understudied inselbergs forming the southern limit of the Afromontane archipelago in Malawi and Mozambique. The sister taxon relationship of the dwarf gecko species on Mount Mulanje and Mount Namuli illustrates the historical biogeographic connections between these inselbergs, a pattern which is emerging with continued work in this region. The discovery of this new species adds to a growing list of species unique to Mount Namuli, and further establishes this montane region as a conservation priority. Key words: Gekkonidae, Lygodactylus, Mt. Namuli, Mozambique, dwarf gecko Introduction The fauna of northern Mozambique remains poorly studied, despite being a major biogeographic link between southern Africa and East Africa. This lack of study can be attributed to limited infrastructure and an extended civil war ( ), making field research largely unfeasible. This paucity of knowledge is especially relevant for the herpetofauna of the region, as the provinces of Cabo Delgado, Nampula, Niassa, and Zambézia lack even preliminary herpetological surveys (Poynton & Broadley 1991; Schneider et al. 2005). Branch et al. 2005a conducted a critically needed survey in Niassa Game Reserve, at the northern border of Mozambique, in Niassa Province (Fig. 1). Whereas much of the reserve is low elevation woodland or savannah, the Serra Mecula Plateau sits between m elevation, with granite peaks rising to 1442 m elevation, and supports several unique habitats including evergreen moist forest, an element common to Afromontane forests. Here Branch et al. 2005a recorded the highest diversity of reptiles occurring in Mozambique, discovered a new species of cordylid lizard (Branch et al. 2005b), identified many taxa of equivocal taxonomic status, and recognized faunal elements linked to other Afromontane isolates in Zimbabwe (Eastern Highlands), Malawi (Mt. Mulanje), and Tanzania (Eastern Arc Mountains). This study initially highlighted the role of inselbergs in supporting high herpetological diversity in Mozambique and demonstrated the need to sample additional montane regions further south. Northern and central Mozambique are dotted with montane inselbergs similar to the Serra Mecula Plateau, many of which have not been studied. Several of these inselbergs, including Mt. Chiperone, Mt. Inago, Mt. Mabu, and Mt. Namuli, occur in Zambézia Province, Mozambique, adjacent to Mt. Mulanje, Malawi (Fig. 1). These four Accepted by S. Carranza: 4 Sept. 2013; published: 17 Sept

2 inselbergs each rise to over 1500 m elevation, and support unique habitats not found in surrounding lowlands, including areas of Afromontane vegetation. The diverse herpetofauna of the neighboring Mulanje massif has been well studied (Stevens 1974; Broadley 2001; Branch & Cunningham 2006), and includes 32 amphibians and 55 reptiles, several of which are endemic. While Mt. Mulanje is the largest of the surrounding inselbergs (rising to 3002 m), the Namuli massif is Mozambique s highest and largest mountain block (rising to 2412 m). Although lacking in formal herpetological surveys, Mt. Namuli has long been recognized as supporting a diverse community of forest-dependent birds (Vincent 1933a, 1933b, 1933c; Ryan et al. 1999; Dowsett-Lemaire 2008). FIGURE 1. Map of selected inselbergs occurring in northern Mozambique and adjacent Malawi. Localities are as follows: 1) Mt. Mulanje, Malawi; 2) Mt. Chiperone; 3) Mt. Mabu; 4) Mt. Namuli; 5) Mt. Inago; 6) Serra Jeci; 7) Serra Mecula Plateau, Niassa Game Reserve. Blue circles mark localities relevant for present study, Mt. Mulanje and Mt. Namuli, and other inselbergs are shaded in green. Red outline demarcates national borders, while white dashed lines demarcate provincial borders. The first herpetological work at the Namuli massif was the opportunistic collection of single specimens of three different lizard species during an avifauna survey in 1998 (Ryan et al. 1999). These species were subsequently reported by Branch and Ryan (2001) as Trachylepis varia (Peters), Rhampholeon platyceps (Günther), and Lygodactylus rex Broadley. The latter two species were significant finds, as previously both were known to occur only on Mt. Mulanje, Malawi, and demonstrated the potential biogeographic ties between the two mountains. Subsequent work revealed the population of Rhampholeon occurring at Namuli as genetically distinct from Rhampholeon platyceps and representing an undescribed lineage (Van Noort et al. 2007; Branch & Bayliss 2009; Timberlake et al. 2009). Both Branch and Ryan (2001) and Branch and Cunningham (2006) questioned the taxonomic status of the L. rex specimen from Namuli, although a lack of additional material from Namuli precluded a thorough taxonomic assessment. Additional survey work was conducted at Mt. Namuli and several neighboring inselbergs as part of the Darwin Initiative carried out by the Royal Botanic Gardens Kew to catalogue biodiversity in montane systems (Timberlake et al. 2007; Timberlake et al. 2009; Bayliss et al. 2010, 2013). Although these formal biodiversity surveys were conducted primarily to catalogue plant, bird, and invertebrate diversity, reptiles and amphibians were collected opportunistically. This limited herpetological sampling on these inselbergs nevertheless resulted in the discovery of several new reptile species (Branch & Bayliss 2009; Branch & Tolley 2010). In addition to reporting new records of reptile and amphibian species occurring at Mt. Namuli (annotated in Portik et al. 2013), Timberlake et al also reported collecting a single specimen of Lygodactylus rex. Despite the subtle but consistent differences 416 Zootaxa 3710 (5) 2013 Magnolia Press PORTIK ET AL.

3 between the Namuli and Mulanje populations described in Branch and Ryan (2001) and Branch and Cunningham (2006), a lack of material has prevented an analysis of the phylogenetic affinities of Lygodactylus rex populations occurring at Mt. Mulanje and Mt. Namuli. Given the speciation patterns observed in co-occurring Rhampholeon and the sky island isolation of Mt. Mulanje and Mt. Namuli, it seems probable that the two populations of L. rex represent distinct lineages. The description of Lygodactylus rex Broadley (1963) was based on a series of eight geckos from the lower slopes of Mt. Mulanje. Little further material has been discussed and knowledge of the species is restricted to anecdotal observations in faunal summaries (e.g., Stevens 1974; Broadley 2001). An additional large series of L. rex was collected in a survey of the herpetofauna of Mt. Mulanje (Branch & Cunningham 2006), furnishing comparative material for assessment of the status of the Mt. Namuli population. During July August of 2011, one of us (D. M. Portik) conducted herpetological surveys in and near the Lichinga Plateau and Gurué highlands, northern Mozambique, with primary survey areas at Serra Jeci and Mt. Namuli (Portik et al. 2013). During survey work at Mt. Namuli, two adult specimens of Lygodactylus cf. rex were collected, and subsequent molecular and morphological work has confirmed speculations that the Mt. Namuli population is distinct. We describe this unique lineage below, and briefly discuss the importance of this finding in the context of other recent herpetological discoveries made in central and northern Mozambique. Material and methods Sampling. Specimens for this study were collected during July August 2011 across northern Mozambique, and the focal taxon was collected in the montane grasslands adjacent to Ukalini Forest at Mt. Namuli, Zambézia Province, Mozambique. All specimens were tissued, formalin-fixed, and transferred to 70% ethanol for long-term storage in the Museum of Vertebrate Zoology (MVZ), University of California, Berkeley. Morphological comparisons were made with other species collected in northern Mozambique (Lygodactylus angularis Günther, L. capensis (Smith)) and Malawi, including topotypic material of L. rex and L. bonsi Pasteur deposited in the Port Elizabeth Museum (PEM), South Africa, as well as paratype material of L. rex deposited in the Museum of Comparative Zoology (MCZ), Harvard University. The following ingroup species are included in the molecular analyses: L. angularis, L. bonsi, L. capensis, L. chobiensis FitzSimons, L. kimhowelli Pasteur, L. mirabilis Pasteur, L. picturatus Peters, and L. rex (Table 1). Two species, Phelsuma madagascariensis Gray and P. seippi Meier, are included as outgroup taxa (Bauer 1990; Austin et al. 2004; Röll et al. 2010; Gamble et al. 2012). Measurements. The following measurements were recorded by DMP or WRB from preserved specimens following Bauer (2002, 2003): SVL: snout-vent length; TrunkL: trunk length; CrusL: crus length; TaiIL: tail length; TaiIW: tail width; HeadL: head length; HeadW: head width; HeadH: head height; EarL: ear length; ForeaL: forearm length; OrbD: orbital diameter; NarEye: nares to eye distance; SnEye: snout to eye distance; EyeEar: eye to ear distance; Internar: internarial distance; Interorb: interorbital distance. Measurements were made with a Mitutoyo Series 500 Digimatic Caliper (Mitutoyo U.S.A., Illinois) and recorded to the nearest 0.1 millimeters. Morphology. The following morphological features were recorded from preserved specimens: number of divided subdigital lamellae below fourth finger; number of divided subdigital lamellae below fourth toe; condition of mental scale (undivided or semi-divided by a suture); number of nasals (supra- and postnasals) entering nostril; PM: number of postmentals; SL: number of supralabials; IL: number of infralabials; PCL: number of precloacal pores; and condition of contact of first infralabial with postmental or postpostmentals: 1) contact with postmental only, 2) slight contact with postpostmental, 3) < 25% overlap with postpostmental, 4) 25 50% overlap with postpostmental, 5) >50% overlap with postpostmental. Features and scale counts based on right side of animals unless otherwise noted. Color patterns are described based on Köhler (2012). Molecular data. Liver, muscle, or tail tissue was extracted from specimens collected in the field or donated by other researchers and preserved in % EtOH. Genomic DNA was isolated from tissue samples using a Qiagen DNeasy Tissue Kit (Qiagen, Valencia, CA) following the manufacturer s protocol. Double-stranded polymerase chain reaction (PCR) was used to amplify the complete mitochondrial gene ND2 and portions of two protein coding nuclear genes, RAG-1 and MXRA5, using the primers listed in Table 2. Reactions were performed in 25 μl volumes using 9.82 μl dh2o, 2.5 μl 5X Taqmaster PCR enhancer, 2.5 μl 10X PCR Buffer, 2.5 μl dntps, 2.5 μl forward primer, 2.5 μl reverse primer, 0.18 μl Taq polymerase, and 2.5 μl of extracted genomic DNA. PCR NEW SPECIES OF DWARF GECKO FROM MOZAMBIQUE Zootaxa 3710 (5) 2013 Magnolia Press 417

4 418 Zootaxa 3710 (5) 2013 Magnolia Press PORTIK ET AL.

5 reactions were executed on an Eppendorf Mastercycler gradient thermocycler with conditions differing among loci. All reactions began with an initial 2 min denaturation at 95 C followed by 95 C for 35 s, annealing for 35 s at 50 C (ND2), 48 C (RAG-1), and 55 C (MXRA5), and extension at 72 C for 1 min 35 s with 4 s added per cycle for 32 cycles for mitochondrial DNA and 34 cycles for nuclear DNA. Amplified products were visualized through 1.5% agarose gel electrophoresis. Successful PCR products were purified with AMPure magnetic bead solution (Agencourt Bioscience, Beverly, MA, USA) and sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA). Sequencing reactions were purified with CleanSeq magnetic bead solution (Agencourt Bioscience, Beverly, MA, USA) and analyzed with an ABI 3730xl DNA analyzer. Sequences were assembled and edited for ambiguous bases in Geneious v5.4 (Drummond et al. 2011), and aligned by eye. Protein-coding sequences were then translated into corresponding amino acids to confirm conservation of the amino acid reading frame. All sequences are deposited in GenBank (accession numbers: KF KF546256) (Table 1). TABLE 2. A summary of genes, associated primers, and references for the molecular data collected. Gene Primer Sequence 5'-3' Reference ND2 METF1 AAGCTTTCGGGCCCATACC Macey et al. (1997) TRPR3 TTTAGGGCTTTGAAGGC Greenbaum et al. (2007) ND2f101 CAAACACAAACCCGRAAAAT Greenbaum et al. (2007) CO1R1 AGRGTGCCAATGTCTTTGTGRTT Arevalo et al. (1994) RAG-1 RAG1pF1 YAWGTCAAATTTKCTGGAATTCAAGCT Present study RAG1pR1 GTCTYGGTCGGCCACCTTTGTT Present study RAG1 F700 GGAGACATGGACACAATCCATCCTAC Bauer et al. (2007) RAG1 R700 TTTGTACTGAGATGGATCTTTTTGCA Bauer et al. (2007) MXRA5 MXRA5F2 KGCTAGCCTKCCTGGGTGA Portik et al. (2012) MXRA5R2 YCTMCGGCCYTCTGCAACATTK Portik et al. (2012) Molecular analyses. Maximum likelihood (ML) and Bayesian analyses were conducted, and we analyzed each gene (ND2, RAG-1, MXRA5) separately and also performed a concatenated analysis. For each phylogenetic analysis, PartitionFinder v1.0.1 was used to find the most appropriate partitioning scheme and models of nucleotide evolution for each partition (Lanfear et al. 2012). The greedy algorithm was employed and model selection occurred using BIC. The analysis of the concatenated alignment resulted in five partitions: (1) ND2 codon position (cp) 1 (GTR+G+I); (2) ND2 cp 2 (HKY+G); (3) ND2 cp 3 (HKY+G+I); (4) MXRA5 cp 1, cp 2, RAG-1 cp 1, cp 2 (HKY+G); and (5) MXRA5 cp 3, RAG-1 cp 3 (HKY+I). Analyses of individual genes resulted in the selection of identical models for respective codon positions. Maximum likelihood analyses for each data set were performed using GARLI v2.0 (Zwickl 2006). For each analysis, 500 nonparametric bootstrap replicates were performed (Zwickl 2006), and a 50% majority-rule consensus tree was produced. Bayesian analyses were conducted using MrBayes v3.2 (Huelsenbeck & Ronquist 2001; Ronquist & Huelsenbeck 2003). Two parallel runs were performed with random starting trees and allowed to run for 20,000,000 generations with sampling every 1,000 generations. Stationarity was assessed by examining ESS values using the program Tracer v1.5 (Rambaut & Drummond 2009). A conservative approach to burn-in time was taken such that trees produced during the first 25% of the total number of generations were discarded, leaving 15,000 trees for each of two parallel runs. The resulting post-burn-in trees from the two parallel runs were combined and a 50% majority rule consensus tree was calculated from a total of 30,000 trees. The average p- distance values across species were estimated using Mega v5.03 (Tamura et al. 2011). Results Phylogenetic analyses. The final alignment for ND2 contains 1053 base pairs (bp) (662 variable ingroup sites, 606 parsimony-informative), MXRA5 contains 981 bp (98 variable ingroup sites, 65 parsimony-informative), RAG-1 NEW SPECIES OF DWARF GECKO FROM MOZAMBIQUE Zootaxa 3710 (5) 2013 Magnolia Press 419

6 contains 1038 bp (113 variable ingroup sites, 88 parsimony-informative), and the concatenated alignment contains 3072 bp (873 variable ingroup sites, 770 parsimony-informative). The phylogenies resulting from the concatenated analysis and the three single-gene analyses have congruent topologies, and therefore we only present results from the concatenated analysis (Fig. 2). All analyses support a clade comprising Lygodactylus bonsi, L. rex, and the form occurring at Mt. Namuli. Lygodactylus rex and the samples from Mt. Namuli are consistently recovered as sister taxa with high support, with L. bonsi being the sister taxon to this group (Fig. 2). Although our sampling is limited, we do not find evidence for the Mt. Namuli population being allied with the capensis-group, angularis-group, picturatus-group, or mirabilis-group (sensu Röll et al. 2010). Rather, we find support for a close relationship between the rex-group and bonsi-group similar to Travers (2012). As is the case in previous studies, our molecular data do not resolve deeper relationships among species groups in the genus Lygodactylus (Röll et al. 2010; Castiglia & Annesi 2011). FIGURE 2. A majority-rule consensus tree based on Bayesian analysis of the concatenated data set (ND2, RAG-1, MXRA5). Branches with < 0.90 posterior probability (PPB) are collapsed, and support values are provided (above: PPB; below: maximum-likelihood bootstrap scores). Branch lengths are proportional to substitutions/site, with scale indicated by the scale bar below. The average p-distance values between L. rex and the Mt. Namuli population are 12.9% (ND2), 1.2% (MXRA5), and 3.0% (RAG-1). Other divergences between ingroup species range between % (ND2), % (MXRA5), and % (RAG-1). The average p-distance values between species for ND2 are provided in Table 3. These p-distances are comparable to those between other species within the genus and other gekkonid genera (Bauer et al. 2010; Grismer et al. 2012; Travers 2012), and are consistent with the specific recognition of the Mt. Namuli population. Morphological variation in Lygodactylus rex. Analysis of the Mt. Mulanje L. rex material collected in 2006 reveals greater variation than discussed in the type description (Broadley 1963), as well as new details of life coloration. This is discussed below. Scalation. Details of scalation are listed in Table 4. As noted by Broadley (1963), possession of two large postmentals is the normal condition (66%, n = 15). In five geckos with three postmentals, the medial scale was usually small (corresponding to Broadley s comment often somewhat fragmented mesially ), but only slightly smaller than the lateral postmentals in two geckos. Supra- and infralabials (7 8) and scansors under 4 th toe (6 7) all 420 Zootaxa 3710 (5) 2013 Magnolia Press PORTIK ET AL.

7 show greater variation than noted by Broadley (1963). The extremes of precloacal pores, 8 and 11, were present in the smallest (43 mm SVL) and largest (53 mm SVL) sexually mature males, respectively, suggesting the possibility of an ontogenetic increase in pore number with size, which may be confirmed with the collection of additional material. In addition, mature males also had a series of 7 8 enlarged, glandular scales (β-glands, sensu Maderson 1968) along the ventral surface of the thighs (Fig. 3). TABLE 3. A summary of average between species p-distance values for the mitochondrial marker ND2 in the genus Lygodactylus. Species L. angularis 2 L. bonsi L. capensis L. chobiensis L. kimhowelli L. mirabilis L. picturatus L. regulus sp. nov L. rex FIGURE 3. Ventral scalation of Lygodactylus rex showing enlarged, glandular scales along the ventral surface of the thighs. Colour in life. Many specimens had a deep vinaceous dorsal color with darker wavy bands and bold irregular orange yellow blotches on the flanks, that were larger and more confluent on the neck, and extended as a series of lateral spots along the tail (Fig. 4). A tear-drop-shaped ocellus with a bright white center partially bounded sequentially by a thin sepia border and extensive fusions of the orange yellow lateral markings is present anterior to the forelimb insertion, and although it may be very reduced in size and intensity in juveniles, it is present even in hatchilngs. Mature males develop lemon yellow venters (between pale greenish yellow and sulphur yellow) from the chest onto the tail, with the most intense coloration around the vent and lower thighs (Fig. 5). In hatchlings the throat stripes are paler and the first behind the mental may be absent. The white throats of adults have a series of four black diagonal stripes that converge towards the midline, with the second most anterior pair fusing medially, and the lateralmost pair extending along the neck to the front of the chest (Fig. 5). Subadults lack the orange lateral markings, and in females, juveniles, and hatchlings the venter is smoky white. The iris is reddish. NEW SPECIES OF DWARF GECKO FROM MOZAMBIQUE Zootaxa 3710 (5) 2013 Magnolia Press 421

8 FIGURE 4. Adult male Lygodactylus rex, in life (PEM R16303, Lukabula Forest Station). FIGURE 5. Yellow ventral surface and black throat stripes of male Lygodactylus rex(top: PEM R16289, Lichenya Hut; bottom: PEM R9778, Lukabula Forest Station). Size. The largest male measured = mm, the greatest size recorded for the species, although this SVL was exceeded by a male with a truncated tail that had an SVL of 55 mm (Broadley 1963). Sexual dimorphism in size is evident, with males growing larger than females. The average SVL of females (n = 10, range 422 Zootaxa 3710 (5) 2013 Magnolia Press PORTIK ET AL.

9 mm) was 40.7 mm, which is considerably smaller than that of males, which have an average SVL of 47.0 mm (n = 6, range mm). Broadley (1963) records a female with a SVL of 46.0 mm. A series of eggs and hatchlings (all PEM R16835) measured (in mm): eggs 7.7x x6.6; hatchling SVL: (mean 16.8); TL: (mean 169.3). Systematics Lygodactylus regulus sp. nov. Prince Dwarf Gecko (Figs. 6 8) Holotype. MVZ , Adult male, Mozambique, Zambézia Province, Mt. Namuli (15 23'15"S, 37 04'24"E, 1281 m a.s.l.), collected by D. M. Portik, 10 August 2011 (Fig. 6). Paratypes. Three specimens: MVZ , adult male, Mozambique, Zambézia Province, Mt. Namuli ( S, E, 1421 m a.s.l.), collected by D. M. Portik, 10 August 2011 (Fig. 7); PEM R14922, adult female, Mozambique, Zambézia Province, Mt. Namuli, Ridge leading to Marakuni Ridge (1537AC, 1800 m a.s.l.), collected by P. Ryan, 30 November 1998; PEM R20277, adult female, Mozambique, Zambézia Province, Mt. Namuli, Muretha Plateau ( S, E, 1878 m a.s.l.), collected by J. Bayliss, 27 May 2007 (Fig. 8). Etymology. The specific epithet is derived from Latin regulus = petty king, prince. The closest relative of this species is Lygodactylus rex, the King Dwarf Gecko or Regal Dwarf Gecko, which exhibits a larger body size and inhabits nearby Mt. Mulanje, Malawi, an overall larger massif than Mt. Namuli, Mozambique. Given the smaller body size, smaller size of the massif inhabited, and close relationship with the King Dwarf Gecko, we recommend the common name Prince Dwarf Gecko for this species. Diagnosis. Lygodactylus regulus sp. nov. differs from all other species in the genus Lygodactylus, except for L. angularis, L. picturatus, and L. rex, in its larger body size (males mm SVL, females mm SVL). Lygodactylus regulus sp. nov. differs from both L. angularis and L. picturatus by having a mental with shallow lateral fissures (mental entire in L. angularis and L. picturatus), and by having a conspicuous ocellus above the shoulder, a trait shared with L. rex. From the latter it can be distinguished by having an overall smaller body size (L. regulus sp. nov.: males mm SVL, females mm SVL; L. rex: males mm SVL, females mm SVL), often having a condition of three postmentals rather than two postmentals (L. regulus sp. nov.: 75%, n = 4; L. rex: 37.5%, n = 16), males possessing a greater number of precloacal pores (L. regulus sp. nov.: 12 13; L. rex: 8 11), having more variability in the condition of contact of first infralabial with the postmental or postpostmentals (L. regulus sp. nov.: ranging from contact with postmental only to < 25% overlap with postpostmental; L. rex: ranging from < 25% overlap with postpostmental to 50% overlap with postpostmental), and sometimes displaying a pale dorsolateral stripe originating behind the eye and extending down the trunk. These two species can also be distinguished genetically using mitochondrial or nuclear markers, with average p-distance values between L. regulus sp. nov. and L. rex being 12.9% (ND2), 1.2% (MXRA5), and 3.0% (RAG-1). Finally, the two species are geographically well separated by over 160 km. Description of holotype. MVZ ; Adult male; SVL: 38.9 mm; TrunkL: 18.5 mm; CrusL: 5.9 mm; TaiIL: 49.2 mm; TaiIW: 4.7 mm; HeadL: 11.2 mm; HeadW: 7.0 mm; HeadH: 4.5 mm; EarL: 0.9 mm; ForeaL: 5.3 mm; OrbD: 1.9 mm; NarEye: 3.5 mm; SnEye: 4.7 mm; EyeEar: 3.2 mm; Internar: 2.0 mm; Interorb: 4.1 mm. Build moderate; head very broad and distinct from neck. Snout long and broad, the distance from the tip to anterior border of the eye slightly greater than the interorbital distance anteriorly, greater than the distance between eye and ear opening. Snout covered with heterogeneous flattened granular scales, medium-sized on crown of head and middle of snout, becoming smaller laterally above eye, and larger anteriorly on snout, reaching largest size in loreal region. Scales on the snout larger than those on the occiput, which are, in turn, much larger than the small convex dorsal granules. Canthus rostralis not prominent. Rostral pentagonal, wider than high. Nostril oval and directed slightly posteriorly, bordered by rostral, first supralabial, supranasal, and two postnasals; supranasals separated by a single small internasal granule. Spiny superciliaries present. Mental heptaganol with shallow lateral fissures, followed by two large postmentals. Scales behind postmentals enlarged, decreasing in size towards base of throat, NEW SPECIES OF DWARF GECKO FROM MOZAMBIQUE Zootaxa 3710 (5) 2013 Magnolia Press 423

10 then increasing in size on chest and belly. Supralabials 8-8; infralabials 8-8. Gulars imbricate, 26 between posteriormost infralabials. Dorsal granular scales roughly homogeneous, slightly larger on ventrolateral portions of trunk. Limbs well developed but short, pentadactyl, 1 st digit greatly reduced and lacking claw. Distal portions of remaining digits expanded, bearing claw. Six pairs of lamellae under fourth finger; 8 enlarged subdigital scales occur proximally to manual lamellae; six pairs of lamellae beneath fourth toe. Granular scales on dorsal surface of limbs roughly homogeneous and similar size to those on trunk; scales on ventral surface of thighs subhexagonal, subimbricate, and same size as those on trunk; scales on ventral surface of arms subhexagonal, subimbricate, and smaller in size than those on trunk. Precloacal pores 12, arranged in a chevron roughly 6 scale rows anterior to cloaca posteriorly. Three rows of 4 6 enlarged, glandular scales (β-glands) present along the ventral surface of thighs. Tail shape cylindrical, caudal scales dorsally semi-flattened, imbricate, largely homogeneous; subcaudal scales large, flattened, subhexagonal, subimbricate, and arranged in a single broad row. Further measurements are recorded in Tables 4 and 5. FIGURE 6. Adult male Lygodactylus regulus sp. nov. (holotype MVZ ): A) lateral view shortly postmortem (specimen wet from rinse with water), B) dorsal view after preservation, C) ventral view after preservation. Coloration in ethanol. Above, a more-or-less uniform cinnamon brown background coloration, with a broad continuous kingfisher rufous lateral stripe extending from the shoulder to the base of the tail (Fig. 6B). Anterior to the shoulder the stripe breaks and continues irregularly to the posterior border of the eye, narrowing substantially in width. Just above the shoulder is a large black patch with a small white spot in the center. Dorsum of head anterior to crown is uniform burnt umber, throat is sulphur yellow with three pairs of irregular black stripes approximately two granules wide which converge from the labials towards the chest, with the two most distal pairs meeting and 424 Zootaxa 3710 (5) 2013 Magnolia Press PORTIK ET AL.

11 NEW SPECIES OF DWARF GECKO FROM MOZAMBIQUE Zootaxa 3710 (5) 2013 Magnolia Press 425

12 426 Zootaxa 3710 (5) 2013 Magnolia Press PORTIK ET AL.

13 the most proximal pair remaining separated by three granules. Dorsal surfaces of limbs cinnamon brown, with irregular lighter markings. Body venter smoky white with no markings or speckling. Gular region suffused with pale sulphur yellow and bearing medium neutral gray markings (Fig. 6C, yellow lacking in paratype MVZ Fig. 7D). Dorsum of tail cinnamon brown with lighter chevron pattern (kingfisher rufous to pale pinkish buff), laterally exhibiting 19 cinnamon brown rectangular markings separated by kingfisher rufous background with minute pale pinkish buff spots, ventrally smoky white suffused with grey posteriorly. TABLE 5. Summary of morphological measurements for the type series of L. regulus sp. nov. Measurement Holotype MVZ Paratype MVZ Paratype PEM R14922 Trunk Length Crus Length Forearm Length Tail width Head length Head width Head height Ear Length Orbit Diameter Nostril-Eye Snout-Eye Eye-Ear Internares Interorbital Paratype PEM R20277 Measurements recorded to the nearest 0.1 millimeter. Note: Paratype PEM R20277 has a damaged head and several measurements were unable to be recorded. Museum abbreviations: MVZ, Museum of Vertebrate Zoology, University of California, Berkeley; PEM, Port Elizabeth Museum. Coloration in life. Recently euthanized specimens prior to fixation (Figs. 6A, 7A) are smoke gray to cinnamon-drab in background coloration with darker brown to black markings and a paler thick dorsolateral stripe. In the holotype this stripe contains a series of well-defined circular to oval markings ranging from cinnamon-drab anteriorly to cream white posteriorly. The ocellus anterior to the forelimb insertion is bright white with a black border. In paratype MVZ the pale dorsolateral stripe extends to the posterior border of the orbit. Paratype PEM R20277 (Fig. 8) exhibits a much more mottled pattern than seen in other members of the type series or in L. rex. This is dominated by brick red and dusky brown to smoky white dorsal markings, including a series of light lateral blotches. The ocellus near the limb insertion is bright white with a blackish surround. Venter of throat and chest bright white; abdomen, thighs and tail venter yellow (between pale greenish yellow and sulphur yellow) with area of β-glands trogon yellow (based on MVZ , Fig. 7B). The iris is crimson. Paratype variation. MVZ : Nostril bordered by rostral, first supralabial, supranasal, and one postnasal; mental hexaganol with shallow lateral fissures, followed by three postmentals (two large, one small); supralabials 7-7; infralabials 7-7; precloacal pores 13; gulars between posteriormost infralabials 28. Color in ethanol: Broad kingfisher rufous lateral stripe extends unbroken from base of tail to posterior border of eye, narrowing significantly in width approaching eye. Dorsum of anterior part of head is uniform burnt umber, with 3 to 4 minute cream spots along canthus rostralis. Throat is white with three pairs of irregular black stripes that converge from the infralabials towards the chest. Lateral dark rectangles on tail less conspicuous, but a line of minute pale pinkish buff spots still discernable. PEM R14922: Five pairs of lamellae under 4 th finger; mental with shallow lateral fissures, followed by three postmentals (two large, one small); supralabials 7-7; infralabials 8-8. PEM R20277: Five pairs of lamellae under 4 th toe; mental with shallow lateral fissures, followed by three postmentals (two large, one small). Additional differences in morphological measurements are recorded in Tables 4 and 5. NEW SPECIES OF DWARF GECKO FROM MOZAMBIQUE Zootaxa 3710 (5) 2013 Magnolia Press 427

14 FIGURE 7. Adult male Lygodactylus regulus sp. nov. (paratype MVZ ): A) lateral view shortly postmortem (grayish blotch extending from right forebody onto dorsum resulted from injection), B) ventral view shortly postmortem, C) dorsal view after preservation, D) ventral view after preservation. 428 Zootaxa 3710 (5) 2013 Magnolia Press PORTIK ET AL.

15 FIGURE 8. Adult female Lygodactylus regulus sp. nov. in life (paratype PEM R20277, Muretha Plateau, Mt. Namuli; photo: J. Bayliss). Size. Largest male (MVZ ) = 88.0 mm; largest female (PEM R14922) = 78.7 mm (tail truncated). Distribution and habitat. The holotype (MVZ ) was collected from the rafters of a village hut, similar to the structure appearing in the foreground of Fig. 9A. The immediate surrounding vegetation had been cleared for agricultural plots, however a riparian forest strip was approximately 40 m west of the plot. This limited riparian forest followed the flowing Nanchili drainage below Nanchili Falls, and during a visual survey no specimens were located in this habitat. The paratype, MVZ , was found basking on wooden debris adjacent to a local residence, surrounded by cultivated plots. The paratype PEM R14922 was collected on rock in an open grassy area west of Ukalini Forest on the southern side of Mt. Namuli (15 22 S, E, 1800 m a.s.l.) (Fig. 9B, C). This area consists of a large granite whaleback with a thin layer of peaty soil that dries seasonally, thereby exfoliating and exposing the rock below (similar to Fig. 9C). Branch and Ryan (2001) report another individual (presumably L. regulus sp. nov.) was seen on a dead tree stump in similar habitat bordering the forest edge at the southern flank of Peseni, a peak 4 km southwest of Mt. Namuli (15 23 S, E). Another paratype (PEM R20277) was collected on the Muretha plateau on an exfoliating rock flake ( S, E, 1878 m a.s.l.). Based on the limited number of specimens and observations, Lygodactylus regulus sp. nov. has been found in open grassy habitat between m a.s.l. and utilizes a variety of basking sites, including exposed rock, tree stumps, woody debris, and artificial habitat. The exposed granite domes forming the main peaks throughout the Namuli massif may also serve as suitable habitat, provided some retreat is available. Lygodactylus regulus sp. nov. has not been recorded in Ukalini Forest, which consists of Afromontane forest vegetation, despite concerted attempts to locate it. All reports indicate this species does not require montane forest or mid-elevation forest habitat, and is often found adjacent to forest habitats. This contrasts with L. rex which is known only from midelevation forest habitats (Lukubula Forest Station, 825 m a.s.l.; Ruo Gorge riverine forest along Lujeri River, 995 m a.s.l.), except for a population on Lichenya Hut on Mt. Mulanje (1858 m a.s.l.). There are no other records of the NEW SPECIES OF DWARF GECKO FROM MOZAMBIQUE Zootaxa 3710 (5) 2013 Magnolia Press 429

16 FIGURE 9. Habitat surrounding localities where Lygodactylus regulus sp. nov. has been collected: A) Cultivated areas immediately south of Mt. Namuli, with typical native residence; B) View of grassy area above Nanchili Falls, adjacent to the southern face Mt. Namuli. Ukalini forest can be seen in the left background, along with areas being modified for agriculture. C) Same location as in (B) but facing west. Exposed granite rock underneath vegetation is visible in the foreground. The large granite whaleback where paratype PEM R14922 was collected can be seen in the center background. It extends to the right and connects to Mt. Namuli. 430 Zootaxa 3710 (5) 2013 Magnolia Press PORTIK ET AL.

17 species on the summit of Mt Mulanje, indicating that the Lichenya Hut population is possibly introduced as the hut is the largest on the mountain and was constructed in the 1920 s for use as a hill station allowing families from the tea estates to escape the summer heat (Eastwood 1988). The species has only been observed on trees or buildings, and has not been observed on rocks. However, a series of L. rex eggs were found in a crumbling rock crack sheltered by forest trees in Ruo Gorge. The broader Namuli massif covers an area of roughly 200 km 2 above 1200 m, with an estimated 300 ha of higher elevation grasslands (Timberlake et al. 2009), and it is likely that L. regulus sp. nov. is dispersed throughout this habitat. A survey at the nearby lower elevation town of Gurué produced only L. capensis, which seems to replace L. regulus sp. nov. at elevations below 800 m (Portik et al. 2013). Discussion The montane areas across East and southeastern Africa display a remarkable degree of localized endemism, a pattern that is exemplified in Lygodactylus geckos. Although the genus is widespread throughout sub-saharan Africa it reaches peak levels of diversity within these regions, a pattern driven by a high number of endemic taxa found in isolated Afromontane habitats distributed from southern Kenya into northeastern South Africa and Swaziland (Pasteur 1965; Branch 1998; Spawls et al. 2002). The recognition of L. regulus sp. nov. adds to the high regional diversity in the genus, which will likely continue to increase upon more thorough investigation of many understudied Afromontane species complexes (Travers 2012). Lygodactylus regulus sp. nov. is the only fully endemic member of the seven Lygodactylus species recorded from Mozambique, which include L. angolensis Bocage, L. angularis, L. capensis, L. chobiensis, L. insularis Boettger, and L. picturatus, and it is not thought to share close phylogenetic affinities with any of these congeners (Pasteur 1965). Although research on the systematics of Lygodactylus is limited, 13 species-groups have been established within the genus (Pasteur 1965; Röll et al. 2010), two of which are particularly relevant for the current study. The first group, the bonsi-group, consists of: L. bernardi FitzSimons, L. bonsi, L. graniticolus Jacobsen, L. ocellatus Roux, and L. waterbergensis Jacobsen. The second group, the rex-group, consists of: L. methueni FitzSimons, L. nigropunctatus Jacobsen, and L. rex. Most members of both groups occur in high elevation grassland or forest habitats in southern Africa (most above 1500 m), often with restricted ranges. Many forms are found in South Africa, including L. graniticolus, L. methueni, L. nigropunctatus, L. ocellatus, and L. waterbergensis, while L. bernardi occurs in Zimbabwe (FitzSimons 1943; Broadley 1963; Jacobsen 1992). Two species, L. bonsi and L. rex, are endemic to Mt. Mulanje, Malawi (Branch and Cunningham 2006). Most of the aforementioned species are rupicolous, preferring boulders, outcrops, and rock crevices, however two species, L. rex, and to a lesser extent L. methueni, are known to occupy forested habitats (Broadley 1963; Jacobsen 1992; Branch & Cunningham 2006). While some species in these groups may occur in sympatry, most appear to be isolated. The presence of two sympatric high elevation dwarf gecko species at Mt. Mulanje seems to be facilitated by divergences in habitat preference, with L. bonsi preferring rocky habitat at high elevations above 1500 m (Pasteur 1965; Broadley 2001) and reaching 2953 m, and L. rex preferring evergreen or riparian forest at mid-elevations ( m) (Broadley 2001), with a single location at 1858 m (Branch and Cunningham 2006). The validity of these currently recognized species-groups and the phylogenetic position of Lygodactylus regulus sp. nov. in relation to the additional Afromontane taxa remains unclear. Morphologically, L. regulus sp. nov. appears to be most closely related to L. rex, a species that was first placed in the capensis-group due to the shared tripartite condition of the mental (Broadley 1963), but subsequently changed upon Pasteur s (1965) systematic revision of the genus. In this monographic treatment, Pasteur formally recognized the bonsi- and rexgroups and hypothesized a close relationship between the two. Yet, these groups were poorly defined and diagnosed largely on the basis of body size and coloration. When Jacobsen (1992) revised L. ocellatus sensu lato and described the additional taxa from northeastern South Africa, he noted a further breakdown of the body size and coloration characters Pasteur used to define these two species-groups. Although the taxonomic status of these groupings has yet to be subjected to comprehensive revisionary work, preliminary data suggest they may not be monophyletic and a thorough revision of the systematics and species limits of these Afromontane groups is required (Travers 2012). NEW SPECIES OF DWARF GECKO FROM MOZAMBIQUE Zootaxa 3710 (5) 2013 Magnolia Press 431

18 Our phylogenetic analyses strongly support the inclusion of Lygodactylus regulus sp. nov. in a clade with species of both the bonsi-group and rex-group, to the exclusion of other major groups, including East and southern African forms (picturatus-group, angularis-group, and capensis-group). Although we lack additional members of the bonsi- and rex-groups in our analyses, the Mt. Mulanje endemics, L. bonsi and L. rex, are the species occurring geographically closest to L. regulus sp. nov., which is endemic to Mt. Namuli, Mozambique. Our analyses recover L. regulus sp. nov. as the sister species to L. rex, which suggests a tight biogeographic link between Mt. Namuli and Mt. Mulanje. However, with only three sampled taxa, it is difficult to assess how these species relate to other bonsi- and rex-group species distributed in Zimbabwe and South Africa. Additional sampling of these species will help clarify evolutionary and taxonomic relationships and uncover diversification patterns in the high elevation dwarf geckos of southern Africa. The description of Lygodactylus regulus sp. nov. adds to the growing list of unique species present at Mt. Namuli and other inselbergs of northern Mozambique. The forests of Mt. Namuli are home to several distinct avian species or subspecies, including the Namuli Apalis (Apalis lynesi) Vincent, the Olive-flanked Robin-chat (Cossypha anomala gurue) Vincent, the Thyolo Alethe (Alethe choloensis namuli) Vincent, and the Yellowthroated Woodland-warbler (Seisercus ruficapilla quelimanensis) Vincent (Ryan et al. 1999). In addition to the avifauna, the Namuli massif has an undescribed endemic species of Rhampholeon, as well as a near-endemic viper, Atheris mabuensis Branch and Bayliss, which also occurs at Mt. Mabu (Branch & Bayliss 2009). Other taxa found at Mt. Namuli and shared with Mt. Mulanje, e.g. the frogs Arthroleptis francei Loveridge, Notophryne broadleyi Poynton, and Strongylopus fullerborni (Nieden) (Timberlake et al. 2009), require further investigation to clarify evolutionary and taxonomic relationships. The number of endemic species is likely to increase with future work. As herpetofaunal survey work continues across inselbergs in northern Mozambique, the biogeographic ties to other Afromontane regions continue to emerge (Branch et al. 2005a; Timberlake et al. 2007; Timberlake et al. 2009; Bayliss et al. 2010; Bayliss et al. 2013; Portik et al. 2013). Biogeographic connections between Mt. Namuli and the greater Afromontane archipelago, including the Eastern Arc Mountains, are evidenced by the presence of East African hyperoliid and arthroleptid frog species at Mt. Namuli (Portik et al., in press). However, only limited herpetofaunal information is available from several nearby inselbergs, such as Mt. Chiperone, Mt. Mabu, and Mt. Inago (Fig. 1). It is possible that additional species closely related to those present at Mt. Mulanje and Mt. Namuli may be uncovered with future work, and that the historical connections between these mountains may be more extensive than currently recognized. The limited work in northern Mozambique has already led to important faunal and biogeographic discoveries, and there is a clear need for additional survey work and conservation efforts at Mt. Namuli and surrounding inselbergs. Acknowledgements DMP thanks the following Mozambican officials and agencies: Lucília Chuquela (Director of the Natural History Museum), Mandrate Oreste Nakala (Deputy National Director of the Ministry of Agriculture), Marcelino Foloma (National Directorate of Lands and Forests), Emilia Veronica Lazaro Polana (Department of Environmental Management), and the Ministry of Tourism National Directorate of Conservation Areas for granting permits and for logistical assistance. Survey work was conducted by DMP with the help of Jay McEntee (MVZ) and Elia Mulungu (Tanzania), and was funded by a Mohamed bin Zayed Species Conservation Fund awarded to J. McEntee (Project # ) and by the Museum of Vertebrate Zoology (University of California, Berkeley). Specimens were collected under the regulations of a research permit administered by the Universidade Eduardo Mondlane Natural History Museum of Maputo (No. 04/2011 and 05/2011) and a credential administered by the Ministry of Agriculture, and were exported under CITES Permit No. MZ-0354/2011 provided by the Ministry for the Coordination of Environmental Action. For specimens and for field assistance WRB thanks: Mt. Namuli, Julian Bayliss (Cambridge) and Peter Ryan (Cape Town); Mt. Mulanje, Carl Bruessow (Mount Mulanje Conservation Trust, Malawi), Mike Cunningham, and Johan Marais (South Africa). Julian Bayliss kindly provided Fig. 8. AMB and SLT were funded by Grants DEB and from the National Science Foundation of the United States. We thank Jimmy A. McGuire, Sarah Werning, Salvador Carranza, and one anonymous reviewer for commenting on the manuscript. 432 Zootaxa 3710 (5) 2013 Magnolia Press PORTIK ET AL.

19 Comparative material examined Lygodactylus angularis: MVZ : Linchinga, Niassa Province, Mozambique (13 18'37"S, 35 14'59"E). Lygodactylus capensis: MVZ : Guru, Zambézia Province, Mozambique (15 28'07"S, 36 59'13"E); MVZ : Cuamba, Niassa Province, Mozambique (14 48'00"S, 36 32'27"E); MVZ , , : Guru, Zambézia Province, Mozambique (15 27'50"S, 36 58'40"E). Lygodactylus rex: MCZ (paratypes): Ruo Gorge, Mt. Mulanje, Phalombe District, Malawi (15 57'S, 35 39'E). PEM R9781, R9767: Hydro Station; Ruo Gorge; Luyeri River, Mt. Mulanje, Malawi ( S, E, 883 m a.s.l.); PEM R , R , R9780, R16303: CCPA offices, Lukabula Forest Station, Mt. Mulanje, Malawi (15 56'15"S, 35 30'10"E, 825 m a.s.l.); PEM R9770, R16835: Ruo Gorge, Luyeri River, Mt. Mulanje, Malawi (15 57'52"S, 35 39'13"E, 995m asl.); PEM R9776, R9787: Hydroelectric plant, Ruo Gorge, Lujeri River, Mulanje, Malawi ( "S, "E; 883 m a.s.l.); PEM R9783, R16289, R16300: Lichenya Hut, Mt. Mulanje, Malawi (15 58'28"S, 35 33'02"E, 1858 m a.s.l.). References Arevalo, E., Davis, S.K. & Sites, J.W. (1994) Mitochondrial DNA sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporus grammicus complex (Phrynosomatidae) in central Mexico. Systematic Biology, 43, Austin, J.J., Arnold, E.N. & Jones, C.G. (2004) Reconstructing an island radiation using ancient and recent DNA: the extinct and living day geckos (Phelsuma) of the Mascarene islands. Molecular Phylogenetics and Evolution, 31, Bauer, A.M. (1990) Phylogeny and biogeography of the geckos of southern Africa and the islands of the western Indian Ocean: a preliminary analysis. In: Peters, G. & Hutterer, R. (Eds), Vertebrates in the Tropics. Zoologisches Forschungsinstitut und Museum A. Koenig, Bonn, pp Bauer, A.M. (2002) Two new species of Cyrtodactylus (Squamata: Gekkonidae) from Myanmar. Proceedings of the California Academy of Sciences, 53, Bauer, A.M. (2003) Descriptions of seven new Cyrtodactylus (Squamata: Gekkonidae) with a key to the species of Myanmar (Burma). Proceedings of the California Academy of Sciences, 54, Bauer, A.M., De Silva, A., Greenbaum, E. & Jackman, T.R. (2007) A new species of day gecko from high elevation in Sri Lanka, with a preliminary phylogeny of Sri Lankan Cnemaspis (Reptilia: Squamata: Gekkonidae). Mitteilungen aus dem Museum für Naturkunde in Berlin, 83 (Supplement), Bauer, A.M., Jackman, T.R., Greenbaum, E., de Silva, A., Giri, V.B. & Das, I. (2010) Molecular evidence for the taxonomic status of Hemidactylus brookii group taxa (Squamata: Gekkonidae). The Herpetological Journal, 20, Bayliss, J., Monteiro, J., Fishpool, L., Congdon, C., Bampton, I., Bruessow, C., Matimele, H., Banze, A. & Timberlake, J.R. (2010) Biodiversity and Conservation of Mount Inago, Mozambique. Report produced under Darwin Initiative Award 15/ 036. Mulanje Mountain Conservation Trust, Malawi, 32 pp. Bayliss, J., Timberlake, J., Alves, T., Branch, W.R., Bruessow, C., Collins, S., Congdon, C., De Sousa, C., Dowsett-Lemaire, F., Fishpool, L., Harris, T., Giogiardis, S., Liggitt, B., Monadjem, A., Patel, H., Spottiswoode, C., Taylor, P., Wilcocks, S., Ribeiro, D. & Smith, P. (2013) The discovery, biodiversity, and conservation of Mabu forest the largest mid-altitude rainforest in southern Africa. Oryx, in press. Branch, W.R. (1998) Field Guide to Snakes and Other Reptiles of Southern Africa. rev. ed. Struiks Publ., Cape Town, 399 pp., 112 col. pls. Branch, W.R. & Bayliss, J. (2009) A new species of Atheris (Serpentes: Viperidae) from northern Mozambique. Zootaxa, 2113, Branch, W.R. & Cunningham, M. (2006) Herpetological Survey of Mount Mulanje, Malawi. Report for Mount Mulanje Conservation Trust, Blantyre, Malawi, 74 pp. Branch, W.R. & Ryan, P.G. (2001) Additions to the Mozambique Herpetofauna: Two new lizards from the Namuli Massif, Mozambique. Herpetological Review, 32, Branch, W.R. & Tolley, K.A. (2010) A new species of chameleon (Sauria: Chamaeleonidae: Nadzikambia) from Mount Mabu, central Mozambique. African Journal of Herpetology, 59, Branch, W.R., Rödel, M.O. & Marais, J. (2005a) Herpetological survey of the Niassa Game Reserve, northern Mozambique- Part I: Reptiles. Salamandra, 41, NEW SPECIES OF DWARF GECKO FROM MOZAMBIQUE Zootaxa 3710 (5) 2013 Magnolia Press 433