ESCMID Online Lecture Library. by author. Ticks-related fever. Dr. José A. Oteo. 15 th ESCMID Summer School

Size: px

Start display at page:

Download "ESCMID Online Lecture Library. by author. Ticks-related fever. Dr. José A. Oteo. 15 th ESCMID Summer School"

Lesley Jacobs
5 years ago
Views:

1 Ticks-related fever Dr. José A. Oteo 15 th ESCMID Summer School Seville, Thursday, 7 July 2016

2 Case 1 August 9: a 16 year old male patient was admitted to the emergency room of San Pedro Hospital in La Rioja (Spain) because of a 3 days of fever (39 o C), malaise, myalgia and headache. In the anamnesis he reported the presence of a tick, handly removed, on his leg 12 days before. He had been camping in a mountain area in the North of Spain with his friends.

3 Case 1: Physical examination/complementary studies Tª 39 o C BP 110/75 mmhg Alert without neurological deficiencies. No rash. No cardiac or lung abnormalities. He referred to abdominal pain when the liver area was explored. Laboratory studies (emergency room): White cell count: 3,025/mm 3 (4.3% band forms, 72.3% neutrophils, 4.7% monocytes, 16.7% lymphocites); platelets 114,000/mm 3 ; hgb 13 g/l; AST 72 U/L; ALT 65 U/L; LDH 637 U/L. Chest Rx and abdominal ultrasonography did not reveal abnormalities.

4 Case 1: Complementary studies and treatment Giemsa stain of a blood smear did not show presence of morulae. Blood cultures, serologies to Borrelia burgdorferi sl. (ELISA), Anaplasma phagocytophilum (IFA), Rickettsia conorii (IFA), Coxiella burnetii (IFA) and a blood EDTA sample for performing PCRs to 16S rrna, msp for A. phagocytophilum and glta and ompb for Rickettsia spp. were processed. A tick-bite related fever was suspected and oral doxycycline was started: 100 mg bid. Blood cultures and all serologies were negative. ELISA: Enzyme-linked inmunoabsorbent; IFA : indirect immunofluorescence assay; PCR: Polymerase chain reaction

5 What is your diagnosis?

6 Case 1: Results, diagnosis and outcomes PCRs to 16S rrna and msp were positive. Another PCR amplifying the groel also resulted positive. The nucleotide sequence obtained showed 100% similarity with A. phagocytophilum. After 36 hours of starting doxycycline, fever and malaise disappeared. The patient was discharged. A second serum sample, 3 weeks later, showed an IFA (IgG) titre of 256 against A. phagocytophilum and 80 to C. burnetti phase II. Diagnosis: Human Anaplasmosis

7 Characteristics Ticks Haematophagous (blood-sucking) arthropods. Parasites of mammals, birds, reptiles and amphibians. Vectors, hosts and reservoirs of different infectious agents.

8 Phylum Class Subclass Order Suborder Superfamily Family Family Family Ticks ARTHROPODA ARACHNIDA ACARI PARASITIFORMES IXODIDA IXODOIDEA ARGASIDAE (soft ticks) IXODIDAE (hard ticks) NUTTALLIELLIDAE

9 General life cycle of hard ticks 3 growth stages 2-3 hosts 1-3 years Larvae Nymphs Adults Man can be an accidental host

10 Blood loss Tick-borne diseases Pathogenic Mechanisms Pathogen s transmission Injection of neurotoxins Hypersensitivity reactions Local trauma/secondary pyogenic infection

14 Ticks feeding on humans

15 Tick-bites do not produce pain and in a high % of patients are unnoticed

Characteristics Incubation period: 5-21 days Unspecific symptoms: - Fever, myalgias, arthralgias, headache - Others: cough, vomiting, diarrhoea, - Rash: 4% Human Anaplasmosis Presence of

16 Characteristics Incubation period: 5-21 days Unspecific symptoms: - Fever, myalgias, arthralgias, headache - Others: cough, vomiting, diarrhoea, - Rash: 4% Human Anaplasmosis Presence of thrombocytopenia (83%) and leucopoenia (67%), CRP (96%), ESR (65%) Raise in liver parameters in 96% Lotric-Furlan et al. Wien Klin Wochenschr. 2006; 118: & Oteo JA, Brouqui P. Enferm Infecc Microbiol Clin. 2005; 23:375-80

17 Human Anaplasmosis in Europe Since first description < 100 confirmed cases Cases reported from all Europe (Slovenia, Sweden, Austria, France, Spain, Italy, ) Vector: Ixodes ricinus Mild disease (less serious and frequent than in USA)

18 Blood smear (Giemsa) Morulae (presence in < 10%) PROBABLE Anaplasmosis Ehrlichiosis Serum sample IFA Positive 64 Seroconvertion PROBABLE DEFINITIVE Anaplasmosis cross reaction? Human anaplasmosis Suspected Secuenced EDTA blood PCR Positive Not secuenced Heparine blood CULTURE (HL-60) Positive PCR and sequencing DEFINITIVE Anaplasmosis PROBABLE Anaplasmosis DEFINITIVE Anaplasmosis

19 Organism Target gene Method Oligonucleotide 5-3 Reference Anaplasma spp. and Ca. Neoehrlichia mikurensis rrs, 345bp Conventional EHR16SR: GGTACCYACAGAAGAAGTCC EHR16SD: TAGCACTCATCGTTTACAGC A. phagocytophilum rrs, 497bp Nested 1st amplification ge3a: CACATGCAAGTCGAACGGATTATTC ge10r: TTCCGTTAAGAAGGATCTAATCTCC 2nd amplification ge9f: AACGGATTATTCTTTATAGCTTGCT ge2: GGCAGTATTAAAAGCAGCTCCAGG A. phagocytophilum msp2, 334 bp Conventional msp2-3f: CCAGCGTTTAGCAAGATAAGAG msp2-3r: GCCCAGTAACAACATCATAAGC A. phagocytophilum msp2, 77bp Real time MSP2f:ATGGAAGGTAGTGTTGGTTATGGTATT MSP2r:TTGGTCTTGAAGCGCTCGTA MSP2p:FAMTGGTGCCAGGGTTGAGCTTGAGATTG TAMRA or BHQ Anaplasma spp. PCR protocols for detecting Anaplasma phagocytophilum groel, 1297 bp Nested 1st amplification HS1a: AITGGGCTGGTAITGAAAT HS6a: CCICCIGGIACIAIACCTTC 2nd amplification HS43:AT(A/T)GC(A/T)AA(G/A)GAAGCATAGTC HSVR: CTCAACAGCAGCTCTAGTAGC Parola et al., 2000 Massung et al., 1998 Zeidner et al., 2000 Courtney et al., 2004 Liz et al., 2002

20 Case 2 September 8: a 64 year old male patient was admitted to the Infectious Diseases Department in San Pedro Hospital in La Rioja (Spain) because of 15 days of malaise, headache, arthralgia and cervical and left arm radicular pain. Five days before admission fever of 38 o C was present. He worked in a furniture factory and was on treatment with candesartan and aspirin because of arterial hypertension.

21 Case 2 He did not remember tick-bite or rash in the last 3 months although he was a mushroom collector and went frequently to the mountains to take them. Several years ago he had removed ticks attached to different zones on his body but had never suffered a tick-borne disease.

22 Tª 38.3 o C Case 2: Physical examination BP 150/75 mmhg Bilateral facial paralysis Absence of tricipital reflex in left arm.

23 Case 2: Complementary studies Laboratory blood studies: complete blood count and biochemical parameters within the normal range with the exception of CRP (35 mg/l). Tumoral markers negative. VDRL and HIV negative. Several serologies to tick-borne related infections were taken. Craneal CT scan: no abnormalities. Lumbar puncture: 275 leucocytes/mm 3 (91% lymphocytes and isolated plasmatic cells); proteins g/dl; VDRL negative. ADA in normal range.

24 What is your diagnosis?

25 Case 2: complementary studies CSF smear Western Blot in serum flab gene PCR in CSF

26 Case 2: diagnosis, treatment and outcomes A diagnosis of neuroborreliosis (Bannwarth s syndrome) was made. Ceftriaxone 2 g/24h IV was started. He slowly improved clinical signs in the next days. After 6 days of hospitalization the patient was discharged receiving the treatment at home for 21 days. 1 month later the patient was asymptomatic.

27 Lyme disease in Europe Every year hundred of cases of LD are diagnosed in Europe and overall in Central European countries (Austria, Czech Republic, Southern Germany, Switzerland, Slovakia and Slovenia) but also in northern Italy, France, Spain, Portugal, Great Britain, Ireland, The Balkans region, Vector: Ixodes ricinus and Ixodes persulcatus Ixodes spp. ticks active from Spring till Autumn

28 Clinical classification Clinical manifestations Stage Early localized LB Early disseminated LB Late LB Lyme disease Multisistemic disorder caused by different genospecies of Borrelia burgdorferi s.l. Borrelia burgdorferi s.s,; B. garinii; B. afzelii; B. spielmanii; B. babariensis Erythema migrans or lymphadenosis benign cutis with or without lymphadenopathy or Borrelial lymphocytoma Multiple erythema migrans or acute neurological, cardiac or articular manifestations Presence of joints (Lyme arthritis), skin (acrodermatitis chronic atrophicans) or chronic neurological syndromes Phase I Phase II Phase III

29 Erythema migrans: early and more typical lesion of Lyme disease

36 Clinical classification Clinical manifestations Stage Early localized LB Early disseminated LB Late LB Lyme disease: clinical features Erythema migrans or lymphadenosis benign cutis with or without lymphadenopathy or Borrelial lymphocytoma Multiple erythema migrans or acute neurological, cardiac or articular manifestations Presence of joints (Lyme arthritis), skin (acrodermatitis chronic atrophicans) or chronic neurological syndromes Phase I Phase II Phase III If erythema migrans is not present or undiagnosed some patients develop complications Neurological complications are frequent: Bannwarth s syndrome, peripherical radiculitis,

37 OTHER CLINICAL FEATURES Serum sample IFA/ELISA + Lyme disease Suspected Skin or sterile fluid CULTURE + PCR + ERITEMA MIGRANS WESTERN-BLOT+ DEFINITIVE LYME DISEASE

and clinical compatible features repit new assay Negative B.

38 Serological diagnosis of Borrelia burgdorferi infection Positive Positive or doubts WESTERN BLOT Negative ELISA (Sera/CSF) Positive Negative <30 days and clinical compatible features repit new assay Negative B. burgdorferi infection Consider other diagnose FALSE POSITIVE ELISA Consider other diagnose

39 PCR protocols for detection of Borrelia spp. DNA Organism Target gene Method Oligonucleotide 5-3 Reference Borrelia burgdorferi flab, 315 bp Nested 1st amplification FlaB-1: AARGAATTGGCAGTTCAATC FlaB-2: GCATTTTCWATTTTAGCAAGTGATG 2nd amplification FlaB-3: ACATATTCAGATGCAGACAGAGGTTCTA FlaB-4: GAAGGTGCTGTAGCAGGTGCTGGCTGT Borrelia burgdorferi Intergenic spacer region 5S-23S, 226 bp Nested 1st amplification 23SC1: 5 -TAAGCTGACTAATACTAATTACCC 23SN1: 5 -ACCATAGACTCTTATTACTTTGAC 2nd amplification 5SCB: 5 -GAGAGTAGGTTATTGCCAGGG 23SN2: 5 -ACCATAGACTCTTATTACTTTGACCA Borrelia burgdorferi p66, 236 bp Nested 1st amplification p66-1: CGAAGATACTAAATCTGT p66-2: GCTGCTTTTGAGATGTGTCC 2nd amplification p66-3: TGCAGAAACACCTTTTGAAT p66-4: AATCAGTTCCCATTTGCA Borrelia spp. rrs, 1350 bp Conventional Bf1: GCTGGCAGTGCGTCTTAAGC Br1: GCTTCGGGTATCCTCAACTC Clark et al., 2005 Johnson et al., 1992 Rijpkema et al., 1995 Rosa et al., 1991 Clark et al., 2005 Raoult et al., 1998 Borrelia miyamotoi glpq, 212 bp Conventional F: CAGAACATACCTTAGAAGCTCAAGC R: GTGATTTGATTTCTGCTAATGTG Hasin et al., 2006

41 3.35 mm Ixodes ricinus 2.26 mm 1.71 mm 1.38 mm 0.85 mm Female Male Nymph Larvae

42 Ixodes ricinus distribution

43 Ixodes persulcatus distribution

44 Ixodes ricinus and related diseases Named Microorgasnism Distribution Lyme disease Borrelia burgdorferi s.l All Europe Human Anaplasmosis Anaplasma phagocytophilum All Europe Un-named Rickettsiosis Human babsiosis Rickettsia helvetica Rickettsia monacensis Babesia divergens Babesia microti Babesia venatorum All Europe? All Europe Neoehrlichiosis Ca. Neoerhlichia mikurensis Swizerland, Germany, Sweeden, Czech Republic, Poland. * Also found in ticks in Spain Un-named Borrelia miyamotoi Russia, The Netherlands Tick-borne encephaliltis TBEv Central and West Europe. Balkans

Case 3 June 21: a 53 year old male, working as viticultor (grape tree worker) in La Rioja began suddenly with fever (39 o C), chills, arthromialgia and malaise.

45 Case 3 June 21: a 53 year old male, working as viticultor (grape tree worker) in La Rioja began suddenly with fever (39 o C), chills, arthromialgia and malaise. After being recognized by his family physician a diagnosis of viriasis was made and ibuprofen was prescribed. June 23: fever persisted and the patient suffered a clinical worsening and was driven to the emergency room at San Pedro Hospital in Logroño. Anamnesis: nothing to declare. Asking specifically for tick-bites the patient did not remember to be bitten by ticks althouh he saw ticks on his dogs the previous week.

46 Case 3: physical examination Tª 39.5 o C BP 100/70 mmhg CR 100 bm

47 Case 3: complementary studies Laboratory studies (emergency room): Leucocyte count: 5,780/mm 3 (8.3% band forms, 75.3% neutrophils, 4.7% monocytes, 11.7% lymphocites); platelets 117,000/mm 3 ; hgb 13.2 g/l; creatine 1.6 mg/dl, urea 76 mg/dl, 69 AST 90 U/L; ALT 68 U/L; LDH 867 U/L; CRP 99 mg/l. Chest Rx and abdominal ultrasonography did not reveal abnormalities. Blood cultures and serologies to Rickettsia conorii were taken. Clinical diagnosis: Mediterranean Spotted Fever

clinical samples Swab from eschar PCR CULTURE Starting doxycycline Skin biopsy PCR CULTURE

48 Serum (IFA) 64: possible Seroconversion: DEFINITIVE Tick-borne Rickettsiosis Clinical clinical suspect suspect Blood EDTA Citrate PCR Blood Citrate Heparine CULTURE Take clinical samples Swab from eschar PCR CULTURE Starting doxycycline Skin biopsy PCR CULTURE Immunohistochemical Tick Gimenez PCR CULTURE Never wait for microbiological results to start doxycycline

49 PCR protocols for detection of Rickettsia spp. DNA Organism Target gene Method Oligonucleotide 5-3 Reference Spotted fever group rickettsiae ompa, 532 bp Semi nested 1st amplification Rr190.70p: ATGGCGAATATTTCTCCAAAA Rr n: GTTCCGTTAATGGCAGCATCT 2nd amplification Rr190.70p: ATGGCGAATATTTCTCCAAAA Rr n: AGTGCAGCATTCGCTCCCCCT Spotted fever group rickettsiae ompa, 154 bp Real time Rr F:CCTGCCGATAATTATACAGGTTTA Rr R: GTTCCGTTAATGGCAGCATCT Spotted fever and typhus group rickettsiae Spotted fever and typhus group rickettsiae Spotted fever and typhus group rickettsiae ompb, 420 bp (SFG) 230 bp (TG) Nested 1st amplification OF: GTAACCGGAAGTAATCGTTTCGTAA OR: GCTTTATAACCAGCTAAACCACC 2nd amplification SFG IF: GTTTAATACGTGCTGCTAACCAA SFG/TG IR: GGTTTGGCCCATATACCATAAG TG IF: AAGATCCTTCTGATGTTGCAACA glta, 337 bp Nested 1st amplification RpCS.877p: GGGGGCCTGCTCACGGCGG RpCS.1258n: ATTGCAAAAAGTACAGTGAACA 2nd amplification RpCS.896p: GGCTAATGAAGCAGTGATAA RpCS.1233n: GCGACGGTATACCCATAGC Gene D, 928 bp Conventional D1f: ATGAGTAAAGACGGTAACCT D928r: AAGCTATTGCGTCATCTCCG Regnery et al., 1991 Roux et al., 1996 Oteo et al., 2004 Eremeeva et al., 2003 Choi et al., 2005 Regnery et al., 1991 Wood et al., 1987 Choi et al., 2005 Sekeyova et al., 2001

50 Netherlands France Spain Portugal Human Cases of Mediterranean Spotted Fever Romania Switzerland Russia Slovenia, Kosovo, Serbia, Croatia, Bosnia, Albany Bulgary Grecee Turkey Syria Israel Lebanon Jordania Morocco Tunisia Algeria Italy Libya Malta Egypt Cyprus

51 Mediterranean Spotted Fever - Rickettsia conorii MSF was the unique TBR present in Europe before the 1990 s

52 Tick-borne Rickettsioses in Europe REFERENCIA AÑO RICKETTSIA SP. ENFERMEDAD Eremeeva et al R. conorii caspia FEM (Astrakhan SF) Raoult et al R. sibirica mongolitimonae LAR Raoult et al R. slovaca DEBONEL/TIBOLA Bacellar et al R. conorii israel FEM (Israel SF) Nilsson et al R. helvetica Innominated Raoult et al R. aeschlimmannii FEM-like Oteo et al. (*) 2004 R. raoultii DEBONEL/TIBOLA Vitale et al R. massiliae FEM-like Jado et al. (*) 2007 R. monacensis FEM-like Portillo et al. (*) 2009 R. rioja DEBONEL/TIBOLA Katargina et al Candidatus R. tarasevichiae FEM-like MSF: Mediterranean Spotted Fever; LAR: Lymphangitis Associated Rickettsiosis. DEBONEL: Dermacentor-borne Necrosis Erythema Lymphadenopathy; TIBOLA: Tick-borne Lymphadenopathy. Probably, some old MSF cases were caused by these new Rickettsia spp.

53 Rhipicephalus sanguineus and MSF Main vector and the only proved reservoir Activity from April to September

56 Rhipicephalus sanguineus s.l distribution

57 Case 3: diagnosis, treatment and outcomes We started with doxycycline 100 bid with improvement of fever and renal function. The patient was discharged in the following 72 hours. A PCR of the swab eschar and blood (ompb and ompa) were positive with a sequence similarity 100% with Rickettsia conorii conorii (strain Malish). Culture (Vero cells) at five day was positive. The IFA did not demonstrate antibodies and a second sample 16 days later showed a titre (IgG) of Patient was tired during at least 3 weeks.

58 Case 4 February 21: a 11 year old female goes to her pediatrician because of malaise, headache and painful cervical lymphadenopathies. A week before her mother handly removed a tick on the scalp with development of a necrotic wound in the site of the tick attachment.

59 Tª 37.9 o C Case 4: Physical examination BP 95/70 mmhg Clinical diagnosis: DEBONEL/TIBOLA/SENLAT Necrotic eschar sorrounded by an erythema and painfull regional adenopaties

60 Dermacentor Borne Tick Borne Scalp DEBONEL/TIBOLA/SENLAT Necrosis Erythema Lymphadenopathy Necrosis Erythema LymphAdenopathy LymphAdenopaThy

61 Site of the tick attachment in DEBONEL/TIBOLA/SENLAT 2 axila 3 espalda 146 cabeza 3 torax 3 brazo N: 157 Unpublish data

64 What is the etiolgy of DEBONEL/TIBOLA Clin Microbiol Infect 2004; 10:327-31

65 Which are the agents of DEBONEL/TIBOLA/SENLAT? RICKETTSIA SLOVACA Rickettsia raoultii Bartonella henseale RICKETTSIA RIOJA Rickettsia massiliae Francisella tularensis

from eschar PCR CULTURE Starting doxycycline Skin biopsy PCR CULTURE Immunohistochemical Tick

66 Serum (IFA) 64: possible Seroconversion: DEFINITIVE Tick-borne Rickettsiosis Clinical clinical suspect suspect Blood EDTA Citrate PCR Blood Citrate Heparine CULTURE Take clinical samples Swab from eschar PCR CULTURE Starting doxycycline Skin biopsy PCR CULTURE Immunohistochemical Tick Gimenez PCR CULTURE Most rentable sample for diagnosing DEBONEL: Swab from the necrotic eschar for PCR

67 PCR protocols for detection of Rickettsia spp. DNA Organism Target gene Method Oligonucleotide 5-3 Reference Spotted fever group rickettsiae ompa, 532 bp Semi nested 1st amplification Rr190.70p: ATGGCGAATATTTCTCCAAAA Rr n: GTTCCGTTAATGGCAGCATCT 2nd amplification Rr190.70p: ATGGCGAATATTTCTCCAAAA Rr n: AGTGCAGCATTCGCTCCCCCT Spotted fever group rickettsiae ompa, 154 bp Real time Rr F:CCTGCCGATAATTATACAGGTTTA Rr R: GTTCCGTTAATGGCAGCATCT Spotted fever and typhus group rickettsiae Spotted fever and typhus group rickettsiae Spotted fever and typhus group rickettsiae ompb, 420 bp (SFG) 230 bp (TG) Nested 1st amplification OF: GTAACCGGAAGTAATCGTTTCGTAA OR: GCTTTATAACCAGCTAAACCACC 2nd amplification SFG IF: GTTTAATACGTGCTGCTAACCAA SFG/TG IR: GGTTTGGCCCATATACCATAAG TG IF: AAGATCCTTCTGATGTTGCAACA glta, 337 bp Nested 1st amplification RpCS.877p: GGGGGCCTGCTCACGGCGG RpCS.1258n: ATTGCAAAAAGTACAGTGAACA 2nd amplification RpCS.896p: GGCTAATGAAGCAGTGATAA RpCS.1233n: GCGACGGTATACCCATAGC Gene D, 928 bp Conventional D1f: ATGAGTAAAGACGGTAACCT D928r: AAGCTATTGCGTCATCTCCG Regnery et al., 1991 Roux et al., 1996 Oteo et al., 2004 Eremeeva et al., 2003 Choi et al., 2005 Regnery et al., 1991 Wood et al., 1987 Choi et al., 2005 Sekeyova et al., 2001

Case 4: treatment, diagnosis and outcomes We started with azytromycin 10 mg/kg/day qd during 5 days with improvement of fever in 24 hours and a slow recovery of lymphadenopathy

68 Case 4: treatment, diagnosis and outcomes We started with azytromycin 10 mg/kg/day qd during 5 days with improvement of fever in 24 hours and a slow recovery of lymphadenopathy and eschar. A PCR of the swab eschar (glta and ompa) was positive with a sequence similarity 100% with Rickettsia rioja. Three months later an alopecia in the eschar area was present.

69 120% 100% 80% 60% 40% 20% 0% Clinical findings DEBONEL/TIBOLA/SENLAT N: 157 eschar escara eritema erithema adenopatía adenopathy cefalea headache low febrícula grade fever fiebre fever diffuse rash rash Unpublish data

71 Dermacentor marginatus distribution

72 Dermacentor reticulatus distribution

73 Tick-borne related diseases causing fever in 2016 Nombre Bacteria Virus Protozoa Mediterranean spotted fever Lymphangitis associated rickettsia Unnamed Unnamed Unnamed Unnamed DEBONEL/TIBOLA/SENLAT DEBONEL/TIBOLA/SENLAT DEBONEL/TIBOLA/SENLAT SENLAT Lyme disease Anaplasmosis Neoehrlichiosis Borreliosis Tick-borne Encephalitis Crimean-Congo Hemorragic Fever Babesiosis R. conorii R. sibirica-mongolitimonae R. monacensis R. helvetica R. massiliae R.aeschlimmanii R. slovaca R. rioja R. raoultii Francisella tularensis B. burgdorferi sl A. phagocytophilum C. Neoehrlichia mikurensis B. miyamotoi TBE virus CCHF virus Babesia spp.

74 Crimean-Congo Haemorragic fever in the world (2011) X X Autochthonous cases CCHF CCHFv detection in ticks and/or cow

75 Hyalomma marginatum distribution

Crimean-Congo hemorragic fever Palomar A, et al 2013. https://www.

76 Crimean-Congo hemorragic fever Palomar A, et al

France 11. Germany 12. Greece 13. Hungary 14. Italy 15. Latvia 16. Lithuania 17. Norway 18. Poland 19.

77 TICK-Borne Encephalitis (TBE) The most important arbovirus transmitted by ticks in Europe 3,000 admissions/year 1. Albania 2. Austria 3. Belarus 4. Bosnia 5. Croatia 6. Czech Republic 7. Denmark 8. Estonia 9. Finland 10. France 11. Germany 12. Greece 13. Hungary 14. Italy 15. Latvia 16. Lithuania 17. Norway 18. Poland 19. Republic of Moldova 20. Romania 21. Russia 22. Serbia 23. Slovak Republic 24. Slovenia 25. Sweden 26. Switzerland 27. Ukraine

Tick-borne encephalitis Palomar A, et al 2013. https://www.

78 Tick-borne encephalitis Palomar A, et al

79 Distribution of C. Neoehrlichia mikurensis in ticks Silaghi C, et al. Exp Appl Acarol 2015.

80 n = 11 Neoehrlichiosis (Clinical features) Clinical sign Number of patients (%) Fever 11/11 (100) Arthro-myalgias 8/11 (73) Vascular/thromboembolic events 6/11 (54) Erythema Nodosum and /or erysipelas 4/11 (36) Ankle edema 4/11 (36) Cough 4/11 (36) Weight loss 4/11 (36) Antecedent of tick bite 5/11 (45) Grankvist A et al. Infections with the tick-borne bacterium Candidatus Neoehrlichia mikurensis mimic non-infectious conditions in patients with B cell malignancias or autoimmune diseases. Clinical Infectious Diseases. 2014; [Epub ahead of print]

82 African tick-bite fever is the main cause of fever in patients returning from Sub-Saharian Africa after Malaria http//

84 Oteo et al. Med Clin (Barc) 2004

LABORATORY ASSAYS FOR THE DIAGNOSIS OF TICK-TRANSMITTED HUMAN INFECTIONS

LABORATORY ASSAYS FOR THE DIAGNOSIS OF TICK-TRANSMITTED HUMAN INFECTIONS Stephen R. Graves, Gemma Vincent, Chelsea Nguyen, Haz Hussain-Yusuf, Aminul Islam & John Stenos. Australian Rickettsial Reference