Emerging Tick-borne Diseases in California Moral of my story today is Good taxonomy is good public health practice Kerry Padgett, Ph.D. and Anne Kjemtrup, DVM, MPVM, Ph.D. Vector-Borne Disease Section, Infectious Disease Branch Division of Communicable Disease Control, California Department of Public Health Vector-Borne Disease Section California Department of Public Health The Vector-Borne Disease Section (VBDS) protects the health and well-being of Californians from diseases transmitted to people from insects and other animals. VBDS conducts prevention, surveillance, and control of vector-borne diseases, including hantavirus pulmonary syndrome, plague, Lyme disease, West Nile virus, and other tick-borne and mosquitoborne diseases. Vector-Borne Disease Section Tick-Borne Disease Surveillance Goals To estimate prevalence and distribution of pathogenic tick-borne disease agents To communicate risk to people Surveillance includes: Bacteria closely related to known human pathogens (in case they are later found to be human pathogens ) Common Human-Biting Ticks: California Known Tick-borne Disease Agents in California Ticks Ixodes pacificus (western blacklegged tick) Dermacentor occidentalis (Pacific Coast Tick) Lyme disease (~100 cases/year) Tick-borne relapsing fever (~8 cases/year) Anaplasmosis (~1 case per year) Rocky Mountain spotted fever (~ 1 case/year) Tularemia (~5 cases/year) Babesiosis (~2 cases/year) Colorado tick fever virus (<1 cases/year) 1
Disease Discovery Historically, pathogen discovery is driven by human diagnostics Emerging Paradigm Search for Emerging Pandemic Threats Goal: to detail potential pathogens that simmer in wait to head off a swelling pandemic and better manage outbreaks while they are still small/ local Enabled by new methodologies - Molecular testing/ sequencing - Computing platforms/ analytics - Metagenomics Virus Hunters Taxonomy tax on o my takˈsänəmē/ Noun Biology The branch of science concerned with classification, especially of organisms; systematics. 1.the classification of something, especially organisms. 2.a scheme of classification. Potential Pathogenic Agents in California Ticks Rickettsia 364D (Rickettsia philipii) Borrelia miyamotoi Borrelia bissettiae Tick-borne Spotted Fever Group Rickettsia in California Pacific Coast Tick Fever Eco-epidemiology Research Rickettsia are very small gram negative bacilli Obligate intracellular parasites of eukaryotic cells Rickettsia rickettsii Rocky Mountain Spotted Fever Fever, headache, petichial rash, confusion, and myalgia >20% case fatality rate if untreated Rare 2
Historical Background Lab strain type Rickettsia 364D was first described from a Pacific Coast Tick collected from Ventura County, 1966 Rickettsia 364D = Rickettsia philipii Robert Philip distinguished Rickettsia philipii from its nearest relative of R. rickettsii For over 30 years, R. philipii was suspected to cause human infection Pacific Coast Tick (Dermacentor occidentalis) Pacific Coast Tick Fever Pacific Coast Tick Fever 14 cases from 5 counties, 2008-2014 PCTF-Clinical Signs Onset of symptoms within one week after tick bite Common symptoms: ESCHAR, fever, headache, and lymphadenopathy Multiple eschars in 4 cases Variable severity 4 cases required hospitalization 1/14 recovered with no antibiotic treatment Serological Diagnostics Serological tests (IFA and WB) are cross-reactive for SFG Rickettsia Confirmatory tests CANNOT differentiate between R. rickettsii and other SFG Rickettsia Nevertheless, confirmatory serology of acute and convalescent samples recommended R.philipii PCTF Case Patient R.rickettsii RMSF Control 3
Molecular Diagnostics To differentiate R. rickettsii and R. philipii: a dry swab sample of tissue from under eschar (scab) or piece of scab using SYBR Green PCR and sequencing of OmpA gene All 14 cases were diagnosed on PCR of swab or scab Symptom Pacific Coast Tick Fever (% of current cases) Eschar 100% RMSF* (n=208) Not documented Fever 85% 100% Headache 79% 72% Lymphadenopathy 64% 20% Rash Uncommon (2/14) 92% * Summary from Paddock et al., CID, 2008 What are the Entomological Risk Factors for Pacific Coast Tick Fever? Field Methods 6,123 ticks were tested from 37 of 58 California counties, 2009-2014 Primarily adults with >800 larval and nymphal ticks CDPH historic field surveillance database queried for D. occidentalis Molecular Methods R. philipii ompa TCCCGTAGGTCTAAATATTACTCAAAATACCGTCGTTGGTTCGATTATAACGAAAGGTAA TCCCGTAGGTCTAAATATTACTCAAAATACTGTCGTTGGTTCGATTATAACGAAAGGTAA R. ricketsii (Sheila Smith) R. philipii ompa CTTGTTGCCTGTTACTATTACTGCCGGCAAAAGCTTAACTTTAAATGGTAATAATGCTGT CTTGTTGCCTGTTACTCTTAATGCCGGCAAAAGCTTAACTTTAAATGGTAATAATGCTGT R. ricketsii (Sheila Smith) Where Ticks were tested by RZB, CDC, and CDPH Ticks were tested individually Screening with 547-701 OmpA SYBR-GREEN PCR Confirmatory sequencing of 70-701 OmpA is Rickettsia philipii found in California? 4
Geographic Range of R. philipii Rickettsia philipii detected in 15/37 counties sampled (green=positive) What tick stage vectors R. philipii to people? Prevalence of R. philipii in adult D. occidentalis 2.1% statewide (5.4% in southern California) Dermacentor occidentalis (Pacific Coast Tick) Prevalence Life Stage Dermacentor occidentalis tested for SFG Rickettsiae by PCR, 2008-2014, Lake, Sonoma, and Mendocino Counties. nymph larva Adult female Adult male MIP, minimum infection prevalence Pacific Coast Tick Human Biting Records 171 human bite records were recovered from CDPH surveillance database Nymphs most commonly bite people Larvae were found to bite people too! Adult Nymph Larvae Pacific Coast Tick Dermacentor occidentalis Despite being a common human biting tick Male Phenology unknown. When Female is each life stage active? What type of habitat is preferred Nymph by each life stage? Eggs Larva 5
Number of ticks Number of ticks 2/5/2018 Seasonality D. occidentalis Seasonality D. occidentalis 3 # cases 5 5 1 Adults and nymphs: collected 1948-2014; larvae 1969-2014 Adults and nymphs: collected 1948-2014; larvae 1969-2014 Nymphs and Larvae: Vectors of PCTF Supporting evidence: nymph larva Both larvae and nymphs quest during summer Coincident with PCTF cases! Tick bite records support role of nymphs in transmission R. philipii is detected at similar frequency in nymph and adult ticks Borrelia miyamotoi Borrelia miyamotoi sensu lato Borrelia miyamotoi disease (BMD) or Hard tick-borne relapsing fever (HTBRF) or Borrelia miyamotoi associated disease (BMAD) No known cases in CA to date 6
Borrelia found in California Ticks Tick-Borne Relapsing Fever Borrelia hermsii B. bissettiae Tick-Borne Relapsing Fever In California ~ 8 cases/yr Tick-Borne Relapsing Fever Borrelia hermsii Symptomatology -Incubation period: average 7 days (4 to 18 days) -Fever, headache, chills, myalgia -Up to 13 febrile episodes Relapsing Fever Group Borrelia Antigenic variation helps RF spirochetes evade immune response High levels of RF Borrelia in peripheral blood TBRF is a serious disease If acquired during pregnancy, high risk of fetal loss (Dworkin et al.,2008) Diagnostics based on peripheral blood smear during febrile episode Borrelia miyamotoi Potential vertebrate reservoirs include: deer mice, voles, birds Transovarial transmission Detect in larval ticks Long suspected to cause RF-like disease in humans Cases Location Positive Sample 46 Russia Acute Whole Blood (PCR) 2 Eastern US Acute Whole Blood (PCR) 7 Wisconsin Acute Whole Blood (PCR) 97 Eastern US Acute Whole Blood (PCR) 1 Holland Acute Whole Blood and CSF (PCR) 1 New Jersey Cerebral Spinal Fluid (PCR) 1 New York Sera (GlpQ Serology) and PCR 18 Eastern US Sera (GlpQ Serology)* 2 Japan Sera (PCR) * Archived sera samples of 875 patients 7
Borrelia miyamotoi Infection- Symptoms B. miyamotoi B. hermsii B. burgdorferi Fever (relapsing) Fever (relapsing) Fever (non-relapsing) Headache Headache EM Myalgia Myalgia Arthralgia Symptoms: High fever, headache sometimes arthralgia; no skin lesions Relapsing fever in some patients prior to antibiotic treatment Average 9 days between relapses No Borrelia miyamotoi human infections reported in CA to date Prior to any human infection, and knowing this agent is a human pathogen, it is prudent to understand What are the entomological risk factors? Duration of fever averages 3 days Tick bite to symptom onset: Average 15 days Two patients had meningoencephalitis (both were immunocompromised) Jarisch-Herxheimer reaction has been noted for some case-patients No Borrelia miyamotoi human infections reported in CA to date Prior to any human infection, and knowing this agent is a human pathogen, it is prudent to understand What are the entomological risk factors? Are there geographic areas associated with higher risk? Borrelia miyamotoi and Borrelia burgdorferi California Tick Surveillance Results 13 Year Project (2000-2012) CDPH Test Protocol Ticks tested: 24,635 adult I. pacificus 3,252 nymphal I. pacificus Ticks collected from 47 counties 16rRNA Primers 8
Infection Prevalence 2/5/2018 B. burgdorferi and B. miyamotoi Borrelia burgdorferi 970bp Borrelia miyamotoi 450bp Borrelia miyamotoi 30 Counties 16rRNA Primers Borrelia miyamotoi in California- Areas of Highest Prevalence/Risk Highest risk region is the same area of California with highest risk of B. burgdorferi North and central coast as well as the Sierra Nevada foothills Lowest prevalence/risk in Central Valley and Southern California What Tick Stage Involved in Transmission? Adult Nymphs Larvae Differential prevalence among life stages? Ixodes pacificus Life Stages- Off People Prevalence of B. miyamotoi and B. burgdorferi in Ixodes pacificus, CA 4.00% 3.50% 3.4% 3.00% 2.50% 2.00% 1.50% 1.00% 0.50% 0.7% 0.9% 1.4% B. burgdorferi B. miyamotoi N=584 (16 larvae) 0.00% Adults (n=6252) Nymphs (n=2326) 9
Prevalence of Borrelia miyamotoi Studies in California, Eastern NA, Canada, and Europe suggest that the prevalence of B. miyamotoi is similar among nymph and adult tick stages generally around1% Thus, it similar to other regions with human cases, it is highly likely that some Californians are exposed to B. miyamotoi Tick Surveillance Results Adults: B. miyamotoi = B. burgdorferi Roughly 1% infection prevalence Nymphs B. burgdorferi (3.4%) > B. miyamotoi (1.4%) 2.5 times higher infection prevalence Suggests higher risk of LD from nymphal ticks Larvae? Larval Ixodes pacificus Vector? Borrelia burgdorferi does NOT transmit transovarially Thus larvae do NOT harbor nor transmit Lyme disease Larval Ixodes pacificus Vector? Borrelia burgdorferi does NOT transmit transovarially Thus larvae do NOT harbor nor transmit Lyme disease B. miyamotoi DOES transmit transovarially Thus larval Ixodes pacificus CAN be infected with B. miyamotoi and potentially vector BMD to people Current focus on testing larvae 5 B. miyamotoi larval pools from Marin and El Dorado Counties last year B. miyamotoi DOES transmit transovarially Thus larval Ixodes pacificus CAN be infected with B. miyamotoi and potentially vector BMD to people Thank you! Tick collection CDPH-VBDS staff Local Vector Control Districts Technical support Natalia Fedorova and Bob Lane (UC Berkeley) Bridget Travinsky and Alan Barbour (UC Irvine) Mary Joyce Pakingan and Ian Rose (CDPH) Borrelia bissettiae 10
Borrelia bissettiae First isolated from Ixodes pacificus from Del Norte County California, this spirochete was described by Marjorie L. Bissett from our state Microbial Diseases Lab Borrelia bissettii => Borrelia bissettiae Borrelia burgdorferi sensu lato in Ixodes pacificus Borrelia burgdorferi sensu lato Borrelia miyamotoi (relapsing fever group) Borrelia burgdorferi (sensu stricto)*** Borrelia bissettiae Borrelia americana Borrelia californiensis Borrelia lanei ***Agent of Lyme borreliosis in North America Borrelia burgdorferi sensu lato: Lyme Borreliosis Borrelia bissettiae - human pathogen? Found in old and new world Borrelia garinii Borrelia bavariensis Borrelia afzelii Borrelia lusitaniae Borrelia burgdorferi sensu stricto Borrelia bissettiae Country Sample Test Number + Signs/Symptoms Czech Republic Sera PCR 7 Arthralgia, Myalgia, Fatigue Czech Republic CSF Culture 1 Endocarditis US (Mendocino Co) Sera PCR 3/27 N/A (serosurvey in Lyme endemic community) US (Florida) Plasma Culture* 1 Headache, Myalgia, Depression Borrelia valasiana Borrelia bissettiae - Ticks West and Southwest Ixodes pacificus (human, rodent, bird) Ixodes spinipalpis (small rodents) Ixodes auritulus (birds) Southeast Ixodes scapularis (human, rodent, bird) Ixodes affinis (small rodents) Northeast Rarely reported Borrelia bissettiae Wild Vertebrate Hosts Western US Europe Ixodes ricinus (human, rodent, bird) 11
Borrelia bissettiae Wild Vertebrate Hosts Southeastern US California Borrelia burgdoferi sensu lato (s.l.) Diversity Study Goal: To better understand risk of exposure to Borrelia burgdorferi s.l. in California. Specific Goals: 1.) To characterize Borrelia genomospecies within positive ticks 2.) To investigate spatial patterns of variation for Borrelia genomospecies 3.) To evaluate prevalence of Borrelia genomospecies among CA regions Tick Collection: 2008-2015 Protocol Purify DNA from tick Species Stage Number Counties Sampled Ixodes pacificus Adult 11,063 44 Ixodes spinipalipis Adult 44 2 Ixodes pacificus Nymph 3,815 36 Ixodes spinipalpis Nymph 144 5 Make tree and map Borrelia burgdorferi sensu stricto Borrelia bissettiae 12
Geographic Distribution Borrelia burgdorferi sensu stricto has only been detected in one Ixodes pacificus tick in Southern California, despite years of surveillance (over 8000 ticks tested). Borrelia bissettiae is found in the coastal region of California, including coastal Southern California Risk of exposure to Lyme disease is almost non-existent in Southern California while risk of exposure to Borrelia bissettiae is low Borrelia burgdoferi sensu lato Diversity In addition to Borrelia burgdorferi sensu stricto, and Borrelia bissettiae, we also found other Borrelia species in Ixodes pacificus, close relatives Borrelia americana and B. californiensis It is not known if these closely related Borrelia are associated with human disease. But if they are, we have a head start! Tick Bite Prevention To bare skin, Apply DEET repellent (>20%) Picaridin IR 3535 Oil of Lemon Eucalyptus 2-undecanone Tick Repellents Personal Protective Measures Check clothes regularly while in tick habitat Full body check at home up to 3 days after being in areas where ticks are found: hair line, armpit, back of knees, groin Bathe/Shower After Working Outside Preferably within 2 hours of coming indoors Wash off ticks that haven t yet attached Remove and launder clothing 10 minutes high heat in dryer Tick attached at the hairline of a child s head 13
Tick Removal Technique To prevent disease transmission, remove ticks as soon as they are detected! Grasp tick at skin surface Pull the tick firmly away from the skin Clean bite area with alcohol or soap and water Folklore remedies DO NOT work: Twist tick out Use lighted matches Liquid soaps Petroleum jelly Public Health Benefits of Conducting Surveillance for Potential Emerging Tick-Borne Diseases Prior understanding of entomological risk factors Tick vector, life stage, time of year Targeting geographic areas associated with higher risk e.g., Borrelia bissettiae is associated with coastal regions Closely related pathogens may present with similar disease etiology (or might have some distinct differences) e.g., Borrelia miyamotoi infections cause relapsing febrile illness Contact information Kerry A. Padgett, Ph.D. Supervising Public Health Biologist California Department of Public Health Division of Communicable Disease Control Vector Borne Disease Section 850 Marina Bay Parkway Richmond, CA 94804 Phone: 510-412-6252 Fax: 510-412-6263 Kerry.Padgett@cdph.ca.gov 14